#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 18:45 GMT TreeBASE (cc) 1994-2008 Study reference: Nonaka K., Miyazaki H., Iwatsuki M., Shiomi K., Tomoda H., Omura S., & Masuma R. 2012. Staphylotrichum boninense, a new hyphomycete (Chaetomiaceae) from soils in the Bonin Islands, Japan. Mycoscience, 53(4): 312-318. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11921] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=20; TAXLABELS Botryotrichum_piluliferum Chaetomium_globosum Chaetomium_sphaerale Humicola_fuscoatra Humicola_grisea_var._grisea_DAOM232586 'Humicola grisea var. grisea FO-2942' Humicola_grisea_var._thermoidea Humicola_insolens_IMI126330 Humicola_insolens_MTCC4617 Humicola_nigrescens Retroconis_fusiformis 'Staphylotrichum boninense FKI-4751' 'Staphylotrichum boninense FKI-4859' 'Staphylotrichum boninense FKI-5336' Staphylotrichum_coccosporum_CBS364.58 'Staphylotrichum coccosporum FKI-5577' Staphylotrichum_coccosporum_NBRC31817 Staphylotrichum_coccosporum_NBRC33272 Zopfiella_erostrata Zopfiella_karachiensis ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=18; TAXLABELS Botryotrichum_piluliferum Chaetomium_floriforme Chaetomium_globosum Chaetomium_sphaerale Humicola_fuscoatra Humicola_grisea_var._grisea Humicola_grisea_var._thermoidea Humicola_insolens Humicola_nigrescens Retroconis_fusiformis 'Staphylotrichum boninense FKI-4751' 'Staphylotrichum boninense FKI-4859' 'Staphylotrichum boninense FKI-5336' Staphylotrichum_coccosporum_CBS364.58 'Staphylotrichum coccosporum FKI-5577' Staphylotrichum_coccosporum_NBRC31817 Staphylotrichum_coccosporum_NBRC33272 Zopfiella_erostrata ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10278] TITLE D1D2; LINK TAXA = Taxa2; DIMENSIONS NCHAR=600; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Botryotrichum_piluliferum GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCATCTGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATAGATGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGGGGATAAAGGCACCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGCGGGGACCGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCA----------------- Chaetomium_floriforme -----T--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTACTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCAACTGAGTCCCCTGGAACGGGGCGCCACAGAGGGTGAGAGCCCCGTATAGTTGGACGCTAAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGTGTAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGA Chaetomium_globosum ---------------------GAAAAGAA--CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTTGGATGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGTCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA Chaetomium_sphaerale -----T--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGACGCTAAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCAGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA Humicola_fuscoatra GCATATCCCA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGACGCTAAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCAGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA Humicola_grisea_var._grisea GCATAT-CCT-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCGCGGCTCTAACTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTTAGATGCCTAGCC--TATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCAGATCATCCGGTGTTCTCACCGGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGGGGATAAAGGTCCCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGTGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTG- Humicola_grisea_var._thermoidea GCATAT-CCA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGGGTCCGCGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCGCTGTCTGAGTCCCCTGGAACGGGGCGCCAAAGAGGGTGAGAGCCCCGTATAGACGGATGCCTAGCCTGTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCTTAGGGAATGTAGCTCCTCCGGGAGTGTTATAGCCCTCTGCGTAATACCCTCGCGGGGACCGAGGTCTGCGC-TCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA Humicola_insolens --------CACGT-AGCGGAGGAA--GAA-CCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGGGTCCGCGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCGCTGTCTGAGTCCCCTGGAACGGGGCGCCAAAGAGGGTGAGAGCCCCGTATAGACGGATGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCTTAGGGAATGTAGCTCCTCCGGGAGTGTTATAGCCCTCTGCGTAATACCCTCGCGGGGACCGAGGTCTGCGC-TCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCTTCTTGA Humicola_nigrescens GCATAT--CA-AAAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCGCGGCTCTAACTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTTAGATGCCTAGCC--TATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCAGATCATCCGGTGTTCTCACCGGTGCACTCTGCCCGGCTCAGGCCAGCATCGGTTCTCGTGGGGGGATAAAGGTCCCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGTGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA Retroconis_fusiformis GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCAACTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTTGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGTCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGCGTAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA 'Staphylotrichum boninense FKI-4751' GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCAGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCTGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA 'Staphylotrichum boninense FKI-4859' GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCAGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCTGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA 'Staphylotrichum boninense FKI-5336' GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGCCCAGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCTGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA Staphylotrichum_coccosporum_CBS364.58 GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CCTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGA 'Staphylotrichum coccosporum FKI-5577' GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CCTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGA Staphylotrichum_coccosporum_NBRC31817 GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CCTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGCTCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCAGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGA Staphylotrichum_coccosporum_NBRC33272 GCATAT--CA-ATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CCTC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTTGGGCGCGGCACCGACCGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATGGTCGGACGCCTAGCC--TGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCCGGCTGATCATCCGGTGTTCTCACCGGTGCACTCTGCCGGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGACAAAGGCCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCTGGGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGACCCGTCTTGA Zopfiella_erostrata -------------------------------CAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGG-CTCC-GGCCCGAGTTGTAATTTGCAGAGGAAGCTTCTGGTGATGCACTGTCTAAGTCCCCTGGAACGGGGCGCCACAGTGGGTGAGAGCCCCATTT-GACAGAGGCAGATCC--TGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTCCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCTGGGCTGATCATCCGGTGTTCTCACCGGTGCACTCGGCCCAGCTCAGGCCAGCATCGGTTTTGGTGGGGGGATAAAGGCGCTGGGAACGTAGCTCCTTCGGGAGTGTTATAGCCCAGCGTGCAATGCCCCCGCTGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10279] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=604; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Botryotrichum_piluliferum ACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCC-TAAACCATTG-TGAACGTTACCTTCAAACCGTTGCTTCGGCGGGCGGCCC----------GGGTCCGCCCGGTGCCCCCTGGCCCCC---TAGCG-----GGGCGCCCGCCGGAGG--AAA-ACCCAACTC-TTGATTAT--TATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCGCGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCT-GTCACACCGGGCGTAGTAGATT-TTATC-TCGCTCAGGGCGTGCT-GCGGG-TTC-CGGCCGTTAAAAAGCCT-------TTTTTACCCA--AGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Chaetomium_globosum --CTGCGGAGGGATCATTACAGAGTTGCAAAACTCCC-TAAACCATTG-TGAACGTTACCTA--TACCGTTGCTTCGGCGGGCGGCCCCGGGGTTT-ACCCCCCG---GGCGCCCCTGGGCCCC-----ACCGC----GGGCGCCCGCCGGAGG--TC--ACCAAACTCTTGATAATT--TATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCT-GTCGCACCGAGCGTAGTAGCAT-ACATC-TCGCTCTGGTCGCGCC-GCGGG-TTC-CGGCCGTTAAACCACCT--------TTTAACCCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAA------------ Chaetomium_sphaerale ACCTGCGGAGGGATCATTACAGAGTTGCAAAACTCCC-TAAACCATTG-TGAACGTTACCTA--AACCGTTGCTTCGGCGGGCGGC-CCGGGTCCTTCCC--------GGCGCCCCCCGGCCC-----TCGC------GGGCGCCCGCCGGAGG--TAA-ACCAAACTA-TTGCATTA---ATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAATGCAGTGGCGGGCTCGCT-GTCACTCCGAGCGTAGTAGTT--ACATC-TCGCTCTGGGCGTGCT-GCGGCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AGGCGGAGGA-------------------------------------------------- Humicola_fuscoatra ACCTGCGGAGGGATCATTACAGAGTTGCAAAACTCCC-TAAACCATTG-TGAACGTTACCTA--AACCGTTGCTTCGGCGGGCGGC-CCGGGTCCTTCCC--------GGCGCCCCTCGGCCC-----TCGC------GGGCGCCCGCCGGAGG--TAA-ACCAAACTA-TTGCATTG--TATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAATGCAGTGGCGGGCTCGCT-GTCACTCCGAGCGTAGTAGTT--ACATC-TCGCTCTGGGCGTGCT-GCGGG-TTC-CGGCCGTTAAAAAGCCT-------TATTTACCCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Humicola_grisea_var._grisea_DAOM232586 ACCAGCGGAGGGATCATTAAAGAGTTGCAAAACTCCC--AAACCATTG-TGAACAT-ACCTTC-AAC-GTTGCTTCGGCGGGTTGGCCCCGGTCTCCGGGGTCCCC--GGCCCTACTC--------------------GGGCGCCCGCCGGAGG--TAT---CTAACTC-TTGAACTT-TTATGGCCTCTCTGAGTCTT-TGTACTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTAGTCACTCCGAGCGTAGTAAT---ACATC-TCGCTCAGGGCGTGCT-GCGGG-TTC-CGGCCGTTAAAAAGCCT-------TATTTACCCA--AGGTTGACCTCGGATCAGGTAG---------------------------------------- 'Humicola grisea var. grisea FO-2942' ACCTGCGGAGGGATCATTAAAGAGTTGCAAAACTCCC--AAACCATTG-TGAACAT-ACCTTC-AAC-GTTGCTTCGGCGGGTTGGCCCCGGTCTCCGGGGTCCCC--GGCCCTACTC--------------------GGGCGCCCGCCGGAGG--TAT---CTAACTC-TTGAACTT-TTATGGCCTCTCTGAGTCTT-TGTACTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTAGTCACTCCGAGCGTAGTAAT---ACATC-TCGCTCAGGGCGTGCT-GCGGG-TTC-CGGCCGTTAAAAAGCCT-------TATTTACCCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Humicola_grisea_var._thermoidea ACCTGCGGAGGGATCATTACAGAGTTACACAACTCAC-CAAACCATCG-TGAACCGACCCTT----CTGTTGCTTCGGCGGGAGGCGCC------TCGGCGCCCCTCGGCCGATCCCCCGCCCCCGCGGCGTGGGGGGAGGCTCCCGCCGGAGGAATACCCCCAAACCCTTTGCAGCA--CGTGGCCTCTCTGAGT-TTATGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCTGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAATGCAGTGGCGGGCTCGCAAGACACACCGAGCGTAGTAGCTT-ACAACCTCGCTTTGGGAGTGCT-GCGGG-TGC-TGGCCGTAAAGCGACCT-TTGCGTCTTTAGCACT--AGGTTGACCTCGGATCAGGTAGGAGGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Humicola_insolens_IMI126330 -------------------CAGAGTTACACAACTCAC-CAAACCATTG-TGAACCGACCCTT----CTGTTGCTTCGGCGGGAGGCGCC------TCGGCGCCCCTCGGCCGATCCCCCGCCCCCGCGGCGTGGGGGGAGGCTCCCGCCGGAGGAATAC-CCCAAACCCTTTGCAGCA--CATGGCCTCTCTGAGT-TTATGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTAGTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCTGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAATGCAGTGGCGGGCTCGCAAGACACACCGAGCGTAGTAGCTT-ACAACCTCGCTTTGGGAGTGCT-GCGGG-TGC-TGGCCGTAAAGCGACCT-TTGCGTCTTTAGCACT--AGGTTGACCTCGGATCAGGTAGGAGGACCCGCT----------------------------- Humicola_insolens_MTCC4617 -------GACGGATCATTACAGAGTTACAC-ACTCAC-CAAACCATTGCTGAACCGACCCTT----CTGTTGCTTCGGCGGGAGGCGCC------TCGGCGCCCCTCGGCCGATCCCCCGCCCCCGCGGCGTGGGGGGAGGCTCCCGCCGGAGGAATAC-CCCAAACCCTTTGCAGCA--CATGGCCTCTCTGAGT-TTATGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCTGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAATGCAGTGGCGGGCTCGCAAGACACACCGAGCGTAGTAGCTT-ACAACCTCGCTTTGGGAGTGCT-GCGGG-TGC-TGGCCGTAAAGCGACCCTTTGCGTCTTTAGCACT--AGGTTGACCTCGGATCAGGTAGGAGGACCCGCTGAACTTAAGCATATCAATAAAGCGGAGGA Humicola_nigrescens ACCTGCGGAGGGATCATTAAAGAGTTGCAAAACTCCC--AAACCATTG-TGAACAT-ACCTTC-AAC-GTTGCTTCGGCGGGTTGGCCCCGGTCTCCGGGGTCCCC--GGCCCTACCC--------------------GGGCGCCCGCCGGAGG--TAT---CTAACTC-TTGAACTT-TTATGGCCTCTCTGAGTCTT-TGTACTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCAGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTAGTCACTCCGAGCGTAGTAAT---ACATC-TCGCTCAGGGCGTGCT-GCGGG-TTC-CGGCCGTTAAAAAGCCT-------TATTTACCCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGAGGAGGA Retroconis_fusiformis ACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCC--AAACCATTG-TGAACGTTACCTTC-TACCGTTGCTTCGGCGGGCGGCTCCGGGTCTCCC----------GGGGCCCCTCGGCCCCC---TCGCG-----GGGCGCCCGCCGGAGG--CT--ACCAAACTC-TTG-ATTAATTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTTATCATC-TCGTTCTGGGCGTGCT-GCGGG-TTC-CGGCCGTTAAACCACCT-------TCATAACCCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA 'Staphylotrichum boninense FKI-4751' ACCAGCGGAGGGATCATTACAGAGTCGAAATACTCCG-TAAACCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGCCCTCGTGGCCCGC--GGCGCCCCCCGGCCCCC----TGC------GGGCGCCCGCCGGAGG--TAT-ACCTAACTC-TTGAATTA--CACGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGACCCCGAAAACCAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTT-ACACC-TCGCCCAGGGCGCGAC-GCGGG-TTCCCGGCCGTTAAAC--CCC-------CACCATCTCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-A--------- 'Staphylotrichum boninense FKI-4859' ACCTGCGGAGGGATCATTACAGAGTCGAAATACTCCG-TAACCCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGCCCTCGTGGCCCGC--GGCGCCCCCCGGCCCCC----TGC------GGGCGCCCGCCGGAGG--TAT-ACCTAACTC-TTGAATTA--CATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGACCCCGAAAACCAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTT-ACACC-TCGCCCAGGGCGCGAC-GCGGG-TTCCCGGCCGTTAAAC--CCC-------CACCATCTAA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCCG---- 'Staphylotrichum boninense FKI-5336' ACCAGCGGAGGGATCATTACAGAGTCGAAATACTCCG-TAAACCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGCCCTCGTGGCCCGC--GGCGCCCCCCGGCCCCC----TGC------GGGCGCCCGCCGGAGG--TAT-ACCTAACTC-TTGAATTA--CATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGACCCCGAAAACCAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTT-ACACC-TCGCCCAGGGCGCGAC-GCGGG-TTCCCGGCCGTTAAAC--CCC-------CACCATCTCA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AA-------- Staphylotrichum_coccosporum_CBS364.58 ACCAGCGGAGGGATCATTACAGAGTCGCAATACTCCG-TAAACCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGGCCTCACCGCCCGC--GGCGCCCCCCGGCCCCC----CGT------GGGCGCCCGCCGGAGG--TAC-ACCAAACTC-TTGCATTA--TATGGCCTCTCTGAGTATTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCAGGGCTTGCGTTGGGGACCTGCGGCTGCCGCAGGCCCCGAAAAACAGTGGCGGGCTCGCT-GTCACCCCGAGCGTATTAGTTT-ACACC-TCGCCCAGGGCGTGCC-GCGGG-TTCCCGGCCGTTAAAC--CCC-------CCATACCACA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA 'Staphylotrichum coccosporum FKI-5577' ACCAGCGGAGGGATCATTACAGAGTCGCAATACTCCG-TAAACCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGGCCTCACCGCCCGC--GGCGCCCCCCGGCCCCC----CGT------GGGCGCCCGCCGGAGG--TAC-ACCAAACTC-TTGCATTA--TATGGCCTCTCTGAGTATTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCAGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCCGAAAAACAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTT-ACACC-TCGGCCAGGCCGAGCC-GCGGG-TTCCCGGACGTTAAAC--CCC-------CCATACCACAC-AGGTTGACCTCGGATC-TCTAGGAAGACCCGCTGAACTTAAGCATATC-------------- Staphylotrichum_coccosporum_NBRC31817 ACCAGCGGAGGGATCATTACAGAGTCGCAATACTCCG-TAAACCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGGCCTCACCGCCCGC--GGCGCCCCCCGGCCCCC----CGT------GGGCGCCCGCCGGAGG--TAC-ACCAAACTC-TTGCATTA--TATGGCCTCTCTGAGTATTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCAGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCCGAAAAACAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTT-ACACC-TCGCCCAGGGCGTGCC-GCGGG-TTCCCGGCCGTTAAAC--CCC-------CCATACCACA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Staphylotrichum_coccosporum_NBRC33272 ACCAGCGGAGGGATCATTACAGAGTCGCAACACTCCG-TAAACCATTG-TGAACGTTACCTT--AACCGTTGCTTCGGCGGGCGGCGCCCGGGCCTCACCGCCCGC--GGCGCCCCCCGGCCCCC----CGT------GGGCGCCCGCCGGAGG--TAC-ACCAAACTC-TTGCATTG--TATGGCCTCTCTGAGTATTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCCGAAAACCAGTGGCGGGCTCGCT-GTCACCCCGAGCGTAGTAGTTT-ACACC-TCGCCCAGGGCGTGCC-GCGGGTTTCCCGGCCGTTAAACC-CCC-------CCATACCACA--AGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Zopfiella_erostrata ACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCC--AACCCTTTG-TGAA--TCAACTA--GACAGTTGCCTCGGCGGGAGGCCCT--------------------------------------------TCAGGGGCTGCCCGCCGGAGGACC---ACTAAACTC-TTGTATTT---TTGGCCTCTCTGAGTAAT---TCTAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCAGGCTTGTGTTGGAGCCCTGCGGCTGCCGCAGCCTCCTAAAAGCAGTGGCGGGCTCGCT-ATCACACCGAGTGCAGTAGATT-TC-TCTTCGCTCAGGACGTGTG-GCGGG-TTC-CGGCCGTGAAAC--CCC-------CTACTCTTTA--AGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA Zopfiella_karachiensis ACCGGCGGAGGGATCATTAGCGAGT---AATACTCTCTAACACCATTG-TGAACG--AACCGAATTTAGTTGCTTCGGCGGGGT-------------------------------------------------------AAAACCCGCCGGAAGAAC----GCAAACACTCTGTAATG---ATTGTATCTCTGAGCTAACTTT--TTAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAG-CCCCAGGCTTGCGTTGGGGGCCTGCGGCTGCCGCAGCCCCCTAAAAGCAGTGGCGGGCTCGCT-GTCATTCCGAGCGCAGTAGTT--ACATC-TCGCTCTGGGCGTGGCGGCGGG-CAC-CGGCCGTAAAA-------------C-ACTCTTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAT-AAGCGGAGGA ; END; BEGIN TREES; TITLE Staphylotrichum_Fig1; LINK TAXA = Taxa2; TRANSLATE 1 Zopfiella_erostrata, 2 Humicola_grisea_var._thermoidea, 3 Humicola_insolens, 4 Humicola_grisea_var._grisea, 5 Humicola_nigrescens, 6 Botryotrichum_piluliferum, 7 Retroconis_fusiformis, 8 Chaetomium_globosum, 9 'Staphylotrichum boninense FKI-4751', 10 'Staphylotrichum boninense FKI-4859', 11 'Staphylotrichum boninense FKI-5336', 12 Staphylotrichum_coccosporum_NBRC31817, 13 Staphylotrichum_coccosporum_NBRC33272, 14 'Staphylotrichum coccosporum FKI-5577', 15 Staphylotrichum_coccosporum_CBS364.58, 16 Chaetomium_floriforme, 17 Humicola_fuscoatra, 18 Chaetomium_sphaerale; TREE Fig._1 = [&U] (((((1,((2,3),((4,5),(6,(7,8))))),(16,(17,18))),((9,10),11)),13),12,(14,15)); END; BEGIN TREES; TITLE Staphylotrichum_Fig2; LINK TAXA = Taxa1; TRANSLATE 1 Zopfiella_karachiensis, 2 Zopfiella_erostrata, 3 Humicola_grisea_var._thermoidea, 4 Humicola_insolens_MTCC4617, 5 Humicola_insolens_IMI126330, 6 'Staphylotrichum boninense FKI-4859', 7 'Staphylotrichum boninense FKI-4751', 8 'Staphylotrichum boninense FKI-5336', 9 'Staphylotrichum coccosporum FKI-5577', 10 Staphylotrichum_coccosporum_NBRC33272, 11 Staphylotrichum_coccosporum_CBS364.58, 12 Staphylotrichum_coccosporum_NBRC31817, 13 Chaetomium_globosum, 14 Humicola_nigrescens, 15 'Humicola grisea var. grisea FO-2942', 16 Humicola_grisea_var._grisea_DAOM232586, 17 Botryotrichum_piluliferum, 18 Retroconis_fusiformis, 19 Humicola_fuscoatra, 20 Chaetomium_sphaerale; TREE Fig._2 = [&U] (((((1,2),((3,5),4)),((6,(7,8)),(((9,12),11),10))),(13,(19,20))),((14,(15,16)),17),18); END;