#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 19:45 GMT TreeBASE (cc) 1994-2008 Study reference: Beresford P., Barker F., Ryan P.G., & Crowe T.M. 2005. African endemics span the tree of songbirds (Passeri): molecular systematics of several evolutionary 'enigmas.'. Proceedings of the Royal Society B, 272(1565): 849-858. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11938] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=110; TAXLABELS Acanthisitta_chloris Achaetops_pycnopygius Acrocephalus_newtoni Aegithalos_iouschensis Aegithina_tiphia Alauda_arvensis Apalis_goslingi Arcanator_orostruthus Artamus_leucorhynchus Batis_mixta Bleda_syndactyla Bombycilla_garrulus Bradypterus_baboecala Bradypterus_barratti Bradypterus_victorini Camaroptera_brachyura Catharus_ustulatus Certhia_familiaris Cettia_brunnifrons Chaetops_frenatus Chloropsis_cochinchinensis Cincloramphus_mathewsi Cinclus_cinclus Cisticola_anonyma Climacteris_picumnus Cnemophilus_loriae Coracias_caudata Coracina_lineata Corvinella_corvina Corvus_corone Cracticus_quoyi Culicicapa_ceylonensis Dicaeum_aeneum Dicrurus_adsimilis Dryoscopus_cubla Elminia_nigromitrata Emberiza_schoeniclus Eminia_lepida Eremopterix_australis Eugerygone_rubra Euryptila_subcinnamomea Fringilla_montifringilla Furnarius_rufus Gallus_gallus Garrulax_milleti Hirundo_pyrrhonota Hylia_prasina Irena_cyanogaster Lanioturdus_torquatus Lanius_excubitor Macrosphenus_flavicans Malurus_melanocephalus Megalurus_palustris Melanocharis_nigra Meliphaga_analoga Menura_novaehollandiae Mimus_patagonicus Modulatrix_stictigula Monarcha_axillaris Motacilla_cinerea Muscicapa_ferruginea Namibornis_herero Nectarinia_olivacea Neodrepanis_coruscans Nicator_chloris Oriolus_larvatus Orthonyx_spaldingii Orthotomus_sutorius Pachycephala_soror Paradisaea_raggiana Pardalotus_striatus Parus_inornatus Passer_montanus Philepitta_castanea Philesturnus_carunculatus Phylloscopus_collybita Picathartes_gymnocephalus Pitta_sordida Ploceus_cucullatus Pomatostomus_isidorei Prinia_bairdii Prionops_plumatus Promerops_cafer Prunella_collaris Psarisomus_dalhousiae Ptilonorhynchus_violaceus Ptilorrhoa_caerulescens Pycnonotus_barbatus Regulus_calendula Remiz_pendulinus Schoenicola_brevirostris Sitta_carolinensis Smithornis_rufolateralis Sphenoeacus_afer Stenostira_scita Sturnus_vulgaris Sylvia_nana Sylvietta_denti Telophorus_dohertyi Thamnophilus_nigrocinereus Thamnornis_chloropetoides Tregellasia_leucops Troglodytes_aedon Turdus_falklandii Tyrannus_tyrannus Vanga_curvirostris Vireo_philadelphia Xanthomixis_zosterops Yuhina_nigrimenta Zosterops_senegalensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10327] TITLE Passerine_RAG; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4117; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acanthisitta_chloris TAAAGTGCGATCGTTTGATAAAACACCCTCCGATGGCAACCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATGAAGATGAAGTGGTGCCAAGAGGAGAAGGG---------------ATGGAGTTAATGGGCAACAGG---GAGGCAGTCAAGAAAGATGCCCATGACATGAAGACACAAGACAAC---AGAGATCACCAGAGCAATCTGGAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTACATGGGCCAGTGGATGATGAAACTCTGTGGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATAGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCGATTTTGTCACAA{CT}TGCTGGAGTATTATCCACAGGAAATTCAGTAATAC{AT}CTATGTGAAGTATATTTTCCTAGGAACAGCACAGTGGAGTGGCAGCCTCACTCTCCAAACTGTGATGTGTGCCATACTACCCGACAAGGAGTCAAGAGAAAAAACCAACAACCGAGAGTGCAACATGGCAAACGTGTGAAGACCATTGTGGAATGTGCTCGACTAAACAGAGGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAAAATATACATCTCAGCACCAAGATGCTTACAGTTGATTACCCAGAGGATTTCATTAAATCCTTATCTTGCCAGATTTGTGAACATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGTCCTTCCTGCTGGTATCCTTGTTTTCCTACTGATCTGGAAATACCAGTGAAATCCTTCCTGAACACCCTTGATAGCCTGAGTATAAGATGCCCTGTAAAAGACTGTGATGAAGAAATCAGGTATGGAAAATATAGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACATCCACATAAATAAAGGTGGCAGACCGAGGCAGCATCTCCTAACTTTGACCAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGCCTGGCAATTCGAATCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAAATCTTCCAGCCTTTGCATTCTCTTCGCACTGCTGAGAAAGCTCTCCTGCCAGGTTATCATCCATTTGAGTGGAAACCTCCTTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAACACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTCAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGCAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAGCATTGCTATAGCACAGGGGAATGAAAACAAGAGGATCTTTGAGGAAGGAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCGATCCTGAGCCCCCTCATTGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGTATCCTGAGAACATTCAGGTTCATCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATCACCAGGAGTCATGCTGAAAATCTGGAGCGATATGAAATTTGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGCAACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACTGTTCCCTCTATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCTGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCA{CT}GTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGTAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGG{CT}GTTTTCCTTCTTGATATAACACAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCCTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAAGTCTGACGAGTACCAGTATATCATCCATGGTGGTAAAACCCCTAACAATGACCTTTCTGATAAAATTTACATTATGAGTCTGGTCAGCAAAAATGGTAAGAAAACCACATTCCAATGTGTTGAGAAAGACCTGGGTGGAGATGTCCCTGCAGCTAGATATGGGCACACAATTAATGTTGTTCATAG{CT}CGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATATTCCTCTTGCACAAAGAACTACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGTTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAGTTGATCTTCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATTAGTGATACCGAATTTGTCCTTGTTGGAGGTTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTCCTGGAAGACAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAGCACTGCAGAATATGGTTTGGCTGTGATATGGGCAATGGATCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTACCCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAAGAGCAGAAGAGGAGAAGGAGGAAGAACTGACATCACAAATGTGTAGTCAAACATCAACTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATACTGACACTTACAACGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Achaetops_pycnopygius TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCCAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACCTGCGGAAGATGCCCATGCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTGTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACTGCACAATGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTTGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGATATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCAGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGTATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTGAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTGCGCACTGCTGAGAAAGCTCTCCTTCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCAGTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACCATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAGCTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATGCAAGGGCTGATGAGTACCACTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTTCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCCGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACATATACTCCTCTTGCACAAAGAACAACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATATACTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAGTAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGCATGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATG{CT}AAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAGTTGCAGTCAGACTTCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGC{AG}GAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCT{GT}CTGTACC Acrocephalus_newtoni CAAATTGCGGCCATTTGAAAAAACTCCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGCGCCAAAAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATG{AG}AAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCA{AC}CCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGCAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTAAACATCCTTGATAACTTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAAATGAAAGATGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATTCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCCATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCCTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAACATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTTTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATTCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCT{AG}TGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAAATGAGTGGCAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTCATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAAGAATGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAGATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCAAAAGATTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAC{GT}CTCAGAAGCGAGGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCGTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGGTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCATGTGTCAGTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAAC{CT}TGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCC{AG}GCTGTGACTTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAATCAGAAACGGCTGGCATGTAATACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCGAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAA{AG}GAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAGGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAATTTTGTTTTAGTGCTGAAGCCAATAGTTTTGATGCTGACGATGCTGATATTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Aegithalos_iouschensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAGAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAGCTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAG{AG}TTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCACACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCA{CG}AGATAAAC---AAAAATTTAATTAAAGAGATTGTGAACTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCGTTAAATCCATCTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTT{CT}TGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCAGAACATTCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGCTCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTACCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAGAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCGTCCTGAGAACATTTAGATTTGTCTTTAGGGGTACGGGATATGATGAGAAACTCATGCGGGAAGTAGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACAGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTTCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAAATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTG----------------------------TCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CT}GCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCCAACAACGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCC{AG}CTTGCACAAAGAACCACTGAAAAATGGAATAGCGTAGTCGATTGTTTACCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCAAACTTGTACAAGTTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATCGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGAGAACCCAGAGTGGACACCGGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---TTGATAACACAAATTTGCAGTCAGACATCGAGTGAAGATGCTGGAGACTCTGCTCCATTTGATGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Aegithina_tiphia TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGAAGAAGAGGCTGTTTCT------------------------------------------------------------TCGAACGAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAAGGACTTGAGGAAGATGCCCATGCCAGGCAAACACGAGAGAGT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCTGTACTACCAAACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCTACTGATTTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGAAAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTATATAAATAAAGGTGGTCGACCGAGGCAGCATCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTAGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGACGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGGTTTTCTTTCACAGTGATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTCACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGAT{CT}TTCCAGATGGAGATCGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCCGA---------AGGGCTGATGAGTATCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAAAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATATCCTTCCAGAACTTCAAGATGGACTCTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTATAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAA{CT}GTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGATCAGAAGAGGACAAGGAAGAAGAATCAATAACACA{AG}ATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Alauda_arvensis TAAATTGCCATCTTTTGA{AC}AAAACACCCTCTGATGACAGCCAGCACATAAACAAAGA{CT}CAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGCTAATGGGCAGTAGG---CAGG{AG}ACTTGAGGAAGATGCCCATGCCCTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTCAAGCAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAGACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATGCTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAATGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGG{AC}AGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTAC{CT}CCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGACGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCCAG{AG}CAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAATTGGAAGCTATAATGAAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACT{GT}CTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACAC{AT}GAAGTGGGAATTATAGATGGACTATC{AG}GGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGCGATTCCG{AG}TATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGG{AC}ATGAAAGCAAACAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGAT{CT}GGTGAACTTTACAAGAATCCTGATGTGTCTAA{AG}GAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTT{CT}GCAGAACTC{CT}TATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCAT{CT}GGGGCCTGGGCAAGTGAAGGAAATGAGTCTGG{AC}AACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCCATGGTGTTTTCCTCCTCGATATAAAACAGAATGAGCTCAAAATGAAACCTGCCTTCTTT---AAAGATTTGTGCTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATCCAAGGGCTGAGGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAACGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGAGCTGGGTGGAGATGTCCCTGAAGCTAGATATGGCCATACAATTAATGTAGTTCACAGCTGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTTTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACTTACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTA---ACACAAACTTGCAGTCAGACATCAAGTGAGGACCCTGGAGACTCTGGTCCATTTGAAGATTCGGAAGAGTTTTGTTTTAGTCCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Apalis_goslingi CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGC{AG}TAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGA---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAATACAAGACAAT---AGAGATCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGACGTGCGAGGGGATGTCGATACTATTCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCTCCAAACTGTGATGTGTGCCATACTACCAGACAAGGAGTTAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGTGAAGAACCAA------------{CG}CACAGCTAAACAACAAAAATTTAATGAAAGAGATTGCCAATTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTTACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTT{AG}CATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGGTCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTGGACACAATTGCAAAGAGATTCCGATATGATGCAGCCCTGGTCTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAGTGGCC{CT}CTTCACTGTGGTAGTCAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACTGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGCTACGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCC{GT}CAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATTTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACAGTTCCCTCCATAGATGCATTGCACTGCGACATCGGCAATGCGACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATC{CT}TCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAACGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAGGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATTATGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGACTGTTCTGTTTGGAGGGAGGAC{AG}TATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTATCAATTGCCAGAGATGACACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGACGATAGTAGGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAGAGGGTCGGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACGCC{AG}GATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACGAGGAAGAAGACTTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCGGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCCGAAGCAAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Arcanator_orostruthus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAATGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAATCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGACAATAGG---CAGGGACTTGAAGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGCGGAGTTCCATTTAAAATTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAG?CCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAAACAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGACCCAGTGGAAACAACATGTAGACACTTGTTTTGCAGACCTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCT{AG}TAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCACTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCC?GAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATA{CT}CACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCATCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAATTTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGCTTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGAT{CT}TACCCCTGGGCAGCCCGGAGGTGACCTGCAGCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCATTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATACTCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCGGAAACAGGCTACTGGATCACCTGCTGTGCC Artamus_leucorhynchus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGAGCACTAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACAAGACAGT---AGAACTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAGGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACGGTGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCATCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACAGGCGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGATGCTTGTAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAGGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCACGGAAAATATGGACAACACCTCTCCAGCCATAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGC{AG}TGAAAGCAAAAAACCTGGATGACTATATGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTAAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAGGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCCATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAAAGCGTAAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCTAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACTATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACTCCGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGGAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTCTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCGAACTACTTTTACATTCTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATGACACAAATTTGCAGTCAGACGTCAAGTGAAGACCTTGGAGACTCCACTCCATTTGAAGACTCTGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Batis_mixta TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAA{CT}GGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACGAGACAGT---AGAGTTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTACATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAAC{CT}TCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCACTTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAACCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGCTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGTTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCCGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCCTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACA{CT}GGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGTAAGCCCTTGTGTCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCC{CT}CTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCAATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGA{CT}GTTCCAATGCATTGAGAAAGGCCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCGCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTA{CT}CGGTGTCAAGTGCTATAGTGACCCAGATTAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGC{AG}GAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCGAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGG{CT}TACTGGATCACCTGCTGTGAG Bleda_syndactyla CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCGAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTACCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGAGACTTGAGGAAGATGCCCACGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTCCATGGACCAGTGGATGATGAAACTCTGTCACTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAATTGTACAACGTGGCAAACGTGTCAAAACCACTGGAGAATGTGCTCGGCTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGGACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTGTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGA{AG}AAAGCCCTGCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATC{CT}GCTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCGGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCA{AG}A{AG}AAGGCTGTTCGCTTCTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCTTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGCGATAGAGT{AG}AAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCATTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCCAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTA{CT}AGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAATTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTCAAAATGAAACCTGCCTTGTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACACATATTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTGGACTGTTTTCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAAC{CT}TGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGACGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Bombycilla_garrulus TAAACTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCA{AG}TGGGCAACAGGCAACAGGGAC{CT}TGAAGAAGATGCTCATGCCATGAAAACACAAGACACA---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCGTTTAAAAGTGACTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGGAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAAGGGATGTTGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGTGGCAAACGTGTCAAAACCACTGGGGCACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGCTTGTCAATTGCAAGGATAAACATCTCAGCACCAAGTTCCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAAACCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTAACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAGGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGC{AC}GATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTCCGCACTGCTGAGAAAGCTCTCCTACCCGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACT{CT}TCAATTGATGATTACCCAGTAGAAACAATTGCAAAAAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACCGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAACAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGGGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACCGCATTTTCCAGATGGAAATTGGTGAACTTTACAAAAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAGTTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAAATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAC{AG}CTC{AG}GAAGCGATGCTAGTGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGAGAAAGTTTACTTTATGAGTCTG{GT}TAAACAAAACTGGCAAGAAAATGACGTTCCAATGCATTGAAAAAGACCTGAGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTCGCACA{AG}AGAACCACTGAAAACTGGAACAGCGTAGTCGATTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTCTACATCTTACGTATTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGTCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCTTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATTGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGTTTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---CCGGTAACCCAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGTTACTGGATCACCTGCTGTGCC Bradypterus_baboecala TAAATTGCGATCATTTGAAAAGACACCCTCTGATGACAGCCAGCACATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCG{AC}ATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCGAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTGTCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACAGAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATAATACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAAATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTAAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGACCTTGCATGGAAGATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGA{CT}GGAGAGCTCTATAGCTACATAAATAAAGGCGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGAAATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGGGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACCAACACAGAGGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGGTATGATGCAGCCTTGGTTTGTGCTTTAAAAGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAGACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCAGTTCGCTTTTCCTTCACAGTCATGAACATTTC{CT}ATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACC{CT}GCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGAT{GT}TACTTTATGAGTCTGGTAAGCAAAACTAGTAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACTTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTC{AG}TTTGCCAGGGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTTCAAGCT{AG}AAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Bradypterus_barratti TAAATTGCGATCATTTGAAAAGACACCCTCTGATGACAGCCAGCACATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTA{CT}AAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCGAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTGTCCATCCCACTCG{AG}TTTTGTCACAACTGTTGGAGTATTATACAGAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATAATACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGACCTTGCATGGAAGATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGCGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTG{CT}AGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACCAACACAGAGGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGGTATGATGCAGCCTTGGTTTGTGCTTTAAAAGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAGACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCAGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCGTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATA{CT}GATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGTAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTGTT{CT}GGAGGGAGGACTTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCATTTGCCAGGGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTTCAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAATTCTGGAAGACAGTAAGATAGAGATTGTTGAACGTGTGAGCCCAGAGTGGACACCAGATATTAAACA{CT}GGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAA{CG}AAGTAGAAGAGGACAAGGAAGAAGAATTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Bradypterus_victorini TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACGAAGGTCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAT---------------ATGGAGTCAACGGGCAATAGG---CAGGGACCTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCGGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTAAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCGGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAAGGGATGTCGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGTCACACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCGCTGGGGAACGTGCTCGGCTAAACAGAGGTGAAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTTAGCACCAAGTTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTCTGGCAGATCCAGTGGAAACAACGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGACGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACCAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCCGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCAGTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAATTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTCGATGAGCTCCGCGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTTCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAGGGTTGATGAGTACCAGTATATAATCCATGGTGGCAAAACACCTAACAATGAACTTTCTGATAAGATTTATATTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTTCAATGCATTGAGAAGGACGTGGGTGGCGATGTCCCTGAAGCTAGATATGGGCATACAATTAACATAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGT{CT}GACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCCTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGATACTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Camaroptera_brachyura CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTG{CT}GTA{AC}AGATGAAGCAGTGCCAAGAGGAGAAAAG---------------{AG}TGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCGTGAAAATACAAGACAAT---CGAGATCATCAGAACAA{CT}CTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAC{AG}GCAACCTCTTGGCC{CT}GATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTC{AG}ATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATGCTCCATGTGAAGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAG{CT}GTACAACGTGGCAAACGTGTCAAAACCACTGGGGAATGCGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAA{AT}TTAATGAAAGAGATTGTAAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAATGTGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTTACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGATTGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAG{AC}TCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCAGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCC{AC}TTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGA{AG}AAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAACCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTC{AG}GAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAG{CT}CCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTTTTTAGGGGTACAGGCTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATCGGCAATGCGACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTATGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGA{CT}GTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTC{GT}AAAGATTCGTGTTACCTTCCCCCTCT{AC}CGCTACCCTGCTCTGTGCACGCTCAGAAGCGATGCAAGGGCCGATGAGTACCAGTACATCATCCATGGCGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTT{GT}ATGAG{CT}CT{AG}GTAAGCAAAACTAGCAAGAAAATTATATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACCTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAGTTGCCAGAGATGACACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGTCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTG{AG}CACTGAATTTATCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAATTCTGGAGGACAGTAGGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCGATTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAATTGATAGCACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCGGCTCCACTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCCGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Catharus_ustulatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGTCAGAAGAGGCTGTTTCT------------------------------------------------------------{CT}CAAACAAAGAATTCATTC{CT}GCATGAAGATGAAGCAGTACCAAGTGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACCCACTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAACACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGACGTGTGCCATACTACCAGAAGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACCGGGGAACATGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GTACAGATAAACAACAAAAATTTAATGAAAGAGATTCTCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAGTTGATTATCCACCGGATTTCATTAAATCCATGTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAATGTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCCACTGACCTGG{CT}AACCCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCACAGCTACATAAATAAAGGTGGC{AC}GACCGAGGCAACACCTCCTGTCCCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAACCTGGATGACTATTTGACTGGCCCCTTCACTGTGGTGATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCAC{AT}GTCATGAACATTTCTATAGCACATGGAAATGAAAACAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACT{AG}CTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTGCACTCCATAACCCGGAGCCATGCTGAAAACCTGGC{AG}CGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTCCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTGGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAGTAACGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCAACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTT{CT}CACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCAGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCT{CG}CCCCCTCTCCGCTACCCTGCTCTCTGCACACTCGGAAGCGATGCTAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAACAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCT{AG}CCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTGGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATCAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTAGGCATTCCAGGGACCAACAAACAAATAAGCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAAGGCAGAAGA{AG}TTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAG{CT}GCTGAAGCCAACAGCTTTGATGCTGA{CT}GATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Certhia_familiaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGGCCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAGGAATTCACC{CT}TGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAACAGGCAATAGG---CAGGGACT{AG}GAGGAAGTTGCCCATGCTCTGAAAACACAAGACAAG---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATCATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGTGCAAAGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGTCATACTATTAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACTACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTATATAAATAAAGGTGGCCGGCCGAGGCAGCACCTTCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCA{CT}CCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGT{GT}GGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCCGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGAAAACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAATATTGCTATAGCACATGA{CG}AATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAGATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATAGGTGAACTTTACAAGAATCCTGACATTTCTAAAGAGGAGAGGAAGAGGTGGCAGTCGACCCTTGACGAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAGTAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTCTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAATGCCCAGATCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTC{CT}AAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCAAAAGACTCGTGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCCGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCGGCTGTGTCCTGCACGATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGATAACCAGAAACGGCTGGCATGCAACACCATAGTTCTGGAAGATAGTAAGATAGAAATAGTTGAAAGTGCTAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATGTGGTTTGGCTGTGACATGGG{GT}AAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAATTCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACATCCAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGA{AG}GAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGATGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Cettia_brunnifrons TAAACTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAGG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAC---ACAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAA{AG}ACTGATTGTTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTCGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACA------AGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAATGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAAAAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAACCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCTATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGT{CT}GAAACAATGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCA{AC}GTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAGGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCTACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAGAACACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGA{CT}CATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTTCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCGTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTGTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGTTGAAAATGAGTGGTAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATCGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTACGAGATGGAGGATGTCTTGAGATC{CT}TGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGAGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGAGCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAATATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCA{CT}GTGTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAACTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTCTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTAACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATTGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGATGCTGACGACGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Chaetops_frenatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAACCAGCACCTAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAGTTCATCCTGCATAAAGATGGAGCAGTGCCCAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATCAG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAATGCAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAGCTCTGCCGGATCTGTGGAGCTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCCAGGAACAGCACGATGGAGTGGC{AG}ACCCCACTCCCCGAAGTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTATACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTTAATTGC{AG}AGGACATACATCTCAGCACCAAACTGATTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATGTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAGTCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCACGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAA{AG}ATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTC{AC}GAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTCTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCTTTGCATGCTCTTCGTATGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATTGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGACGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTTATGAACGTTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGGACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAAATGAGTGGAAATTTTGCTAGGAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGA{CT}GGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATCCAAGGACTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTT{CG}CAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTC{CT}TGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGT{CT}TCAATTGCCAGAGGTGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATAATGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGTCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCTGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTG{AG}TAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGGTGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Chloropsis_cochinchinensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGGCAGCCAGCACATAAACAAAGATCAGGCAGAAGAAACTGTTTCT------------------------------------------------------------TCAAACAAAGACTTCCTCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGA---CAGGGACTTGAGGAAGATGCCAATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCTTTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACAACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACCACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAGCCAA------------GCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGTAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAATACCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGACCAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGACTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCCATCCGAATCAACACGTTTCTCAGCTGTGGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACGGAAGTGGGAATTATTGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGA{CT}ACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTCGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATGGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTGTACAAGAATCCTGACGTGTCCAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGTATTGTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATTATGTTGCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCGTATGCTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGATGCTGTACATCCTACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACATCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTCGGCAGCCCGGCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAGCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACCCAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCTGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Cincloramphus_mathewsi TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACA{AT}AGATCAGGCAGAAGAGGCTATTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTG{CT}CAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGTCGATACTGTCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGAGGAGTCAAGAGAAAAAAACAGCCCCTAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGCTTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGACTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCCTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGACCTTGCATGGAAGATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGAC{AG}AGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCGTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACT{CT}TGTTCCTGCTA{CG}CCTTGAGAGCAAAAAATGAACACAAACAAGCAGACGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACAC{CG}TTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACCAACACAGAGGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGAAACAATTGCAAAGA{AG}ATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGA{CT}GGAATGGGA{AG}ATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGA{AG}AAGGCGGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTGGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAGCG{AG}TATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTC{CT}ATAGATGCATTGCACTG{CT}GACATTGGCAATGCAAC{AG}GAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GCGTCTAA{AG}GAGGAGAGGAAGAG{AG}TGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATG{CT}TGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTGGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAG{AG}CATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGA{CT}GGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATGTAAAGCAGAATGAGCTCAAAATGAAACCTGCC{GT}{CT}CTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCA{CT}GGTGGTAAAACACCTAACAATGAACTTTCTGATAAGA{CT}TTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACTTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCC{AG}TCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATGTACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTGTCAGTT{GT}CCAGGGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGGCCCCCAGCTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCCAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCGGACAACCAGAAACGGCTGGCATGTAACACCAT{AC}ATTCTGGAAGACAGTAAGATAGA{AG}ATTGTTGAACGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACAAGGAAGAAGAATTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTGGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Cinclus_cinclus TAAATTGCGATCGTTTGAAAAGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTC{CT}TTCTGCATAAAGATGAAGCAGTGCCAAATGGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGGAAGATGCCCATGCCATGAAATCACAAGACAAT---ATATCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGCTACAAGAAAACATACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTAT{CT}CATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGAAACAGCACTATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGGGGAGTCAAGAGAAAAAGCCAGACCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGAGGAACATGCTCAGCTAAAAAGAGGTGTAAAGAATCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCA{AG}TTGCAAGGATATACATCTGAGCACTAAGCTGCTTGCAGTTGACTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTTCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGA{CT}GGACTATCAGGACTGCCACTGTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCTCTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGTAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTCGGTTCGTCTTTAGAGGAACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCTACCCGCTGGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGC{CT}CTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTTCGCTACCCTGCTCTGTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGATAAACAAAACTAACAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATTCTTGGAGGCCACTCGCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTACCCCTGGGCAGCCCAGCTGTAACCTGCACCATCTTGCCAGGAGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAAGAAGAATTGATAACGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCAGACAATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Cisticola_anonyma CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAGTTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGAAGTTAACGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCATGCCATAAAAATACAAGACAAT---AGAGATCATCGGAAAAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATGCACAGAAAGTTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAATCAAGAGAAAAAAACAGTCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGACTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACTCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAAGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACCATCATGAACATTTCTATAGCACATGGGAATGAAACCAAGAGGATCTTTGAGGAAATAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGTTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGAGGTACAGGCTATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCTCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATCGGTGAACTCTACAAGAATCCTGATGTCTCTAAAGAGGAGAAGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGCGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTGTGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCGTAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTACCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGAGGACACAATCTACATCTTGGGAGGTCACTCTCTTCAAAATAACACCAGGTCCCCCAACTTGTATAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCGGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGA{CT}{AT}GTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGCTTGATTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGA{CT}{AG}AGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCC{AG}TTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATATCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Climacteris_picumnus TAAATTACGATCATTTGAAAAAACACCCTCTGATGACAACCAGCACATAAACAAAGATGAGGCAGAAGATGCTGCTTCT------------------------------------------------------------TCAAAGAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGACATAATG{AG}GCAATAGG---CAGGGACTTGAGAAAGATGCCCACGACATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTACCAGAGAACTTACCCAGTGCACGGGCCGGTGGATGATGAAACTCTGGGACTTCTGAGAAAGAAAGAAAAAAGAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTATTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACACTATGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCACCCCCATTCCTCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGCGTCAAGAGAAAAAGCCAGCCCTCAAGTGTGCAGCATGGCAAACGTGCCAAAACCACTAGGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCACAAGTATACATCTCAGCACTAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGTAGAAC{CT}TGCATCCTTAAGTGTATCAGGGTTTTGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAATTCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTATAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCA{AG}GTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTGAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCATTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGTTTTTCCTTCACAGTCATGAGCATTTCTATAGCACATGAGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGAGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCCGAGCTCTTATCTACAAAATTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGGAGAATGAGCTGAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCC{GT}GCTCTTTGCGCACTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAG{CT}CTGGTAAACAAAAATAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCT{AG}TTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGACAAATGGAACAGCGTGGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCCTTGACCTGCACCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATTGTGACTCAGGTCAGTGATACTGAATTTGTCCTAGTTGGTGGCTACCAATCTGACAGCCAGAAACGGTTGCTGTGTAACACCATAATTCTGGAAGACAGTAAAATAGAGATTGTTGAAAGTGTGAACCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTACTGCTGGGCATACCAGGGGCCAACAAACAATTAATGCCAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Cnemophilus_loriae TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGTGTTAATGGGCAATGGG---CAGGGACTTGAGGAAGATGCCCGTGCCATGAAAATACAAGACAA{CT}---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGACCAGTGGATGATGAAACACTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCAGACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATGTACAACATGGCAAACGTGTCAAAACCACTGCGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATCCATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACTCCAGTGAAATCCTTCCTAAGCATCCTTGATAACCTGAGTATAAGATG{CT}CCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCGTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGACGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAATATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACTCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACGAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GCGTCTAAAGAGGA{AG}AGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAA{AG}CCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGC{AT}GTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCA{CT}TAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTACAGCTACAACTCACAGCGTTTTGCAGAGCTCTTGTCTAC{AG}AAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCGAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTTCTCCTTGATGTAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACTCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCCGAGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGTACCATCCTGCCGGGAGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAT{CT}CCAGATGCAAACTACTTCTACATTTTGAGATGCAAAAGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACCTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Coracias_caudata TAAAGTGAGATC{AG}TTTGAGAAAACACCTTCTGATGACAGTCAGCACATAAACAAAGACCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCGTAAAGATGAAGCAGTTCCAAGAGGAGAAAAC---------------ATAGACTTAATGAGCAACAGG---CAGGCACTTGAGAAAGATGCCAGTGGCATGAAAACACAAGAC{AG}AT---CAAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGAGCTTATTGCTAAGGTTTTTAAGATTGATGTGCGGGGGGATATTGATACTATCCATCCCACTCGATTTTGTCAAAATTGCTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCC{CT}AGGAACAGCACAATGAAGTGGCAGCCGCACTCCCCAAACTGTGATGTGTGCCACACCACCAGTCGTGGAGTCAAGAGAAAAGGTCAGCCACCCA{CG}TGTACAACATGGCAAACGTGTGAAGACCATTGCAGAATGTGCTCGAATAAAGAGAGGTGTAAAGGACCAA------------GCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACAAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGGTCTGTGAGCATATTTTGGCAGATCCAGTGGAAACCACATGTAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATTAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAACCTGGGTATAAGATG{CT}CCTGTAAAGGAATGTGATGATGAGATCTTGCATAGAAAGTATGGCCAGCACCTCTCCAGCCACAAGGAGATAAAAGATAGAGAGCTTTACAGCCACATAAATAAAGGTGGCCGGCCAAGGCAGCATCTCCTGTCTTTGACCAGGAGGGCTCAAAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCACCCTGCCGTCTGCCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAATATCATAAAATGTATAGAACGGTAAAAGCCGTCACTGGGAAGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAATCTCTCCTACCCGGTTATCATCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGACGAGATTTTGGAAGGCATGAAAGCAAAAAACCTTGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGAAGTCAGCGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATAATGAACATTGCTATAGCACATGGGAATGAGAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTACTTGAAATGGGAGGCATCCTGAGAACATTCAAATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATTTGGTGTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAG{AG}TCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACTGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAAGTTTACAAAAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGATGAGGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACAGTAGAAGCGGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCC{GT}GCCAAGGAGTGTCCAGAATTGATGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCCTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATCACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGACGGGTCCATTGGGGCATGGGC{AG}AGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAATGCTATGAGATGGAGGATGTCCTG----------CCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCCTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAGGCAATGCAGAGTCTGATGAGTACCAGTATATCATCCATGGTGGGAAAACACCTAACAATGACCTTTCTGATAAGATTTATGCTATGAGGCTGGTAAGCAAAAGTAGCAAGAAACCCACGTTCCAATGTGTTGAAAAAGACCTATGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTCATTCATAGCCGGGGAAAAAGCATGAGCGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATTTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTGCTTTCCATGTTTCAGTTGCCAGAAATGATACAGTCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGAGCACCCAGCTTGTACAAGCTAAAGATTGATCTCCCACTGGGGAGCCCGTCTGTGACCTGCACCGTCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAACTGGTGATACCGAATTTGTCCTTGTCGGGGGCTACCAGTCTGATGATCAGAAACGGTTGGTGTGTAACACTATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGGGAGGGCCCAGACTGGACACCAGATATTAAACACTGCAGGATCTGGTTTGGCTGTGATATGGGTGAAGGATCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAGGAAGAACCAACAGCACAAATTTGCAGTCAGACATCGACCGAAGACGCTGGAGACTCCACTCCATTTGAAGATTCGGAAGAGTTTTCTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACGGGCTACTGGATCACCTGCTCTGCC Coracina_lineata TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAATGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGAGGGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGA{CT}GAATCAGATCACGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCCGGAGACTCCACTCCATTCGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACTTGCTGTGCC Corvinella_corvina TAAATTGCGATCATTTGAGAAAACATCGTCTGATGGCAGCCAGCACGTAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCTTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CACGGACTTGAGGAAGATGCCCATGTGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAACACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAATAGAGGTGTAAAGAACCAA------------GCACGGATAAACAACAAAAATATAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATAGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCGAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAGAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGAGTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTTAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAG{AG}AGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCTGTGTGGCGATCCTCATGTCCTGCCAAGGAATGCCCAGAACTGCTATGTCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATATATTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACATCAGGTCCCCCAACTTGTATAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTCACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTCTAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGATGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAGGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGACGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_corone TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCT{AG}TGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCGTACTACCAGAC{AG}AGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGAAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCA{CT}CCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGGCGAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTC{CT}TGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACGCAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Cracticus_quoyi TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACGTAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGATTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTC{AT}C{CT}AGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGC{GT}GAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGA{AG}GCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAGAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGT{AC}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTAC{AG}AAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAAT{CT}ATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGAC{AG}TTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAACATAAGTGTTCTGTTTGGAGGTAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTCTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGC{AG}AACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Culicicapa_ceylonensis TAAATTGCGATCATTTGAAAAAGCACCCTCTGATGACAGCCAGCACCTAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAGAGAATCCATCTTGCAAAAAGATGAAGCAGTGCCAAGGGGAGAAAAG---------------ACAGAGTTAACAAGCAAAAGG---CAGGGACTTGAGGAAGATGCCCACGCAATGAAAACACAAGACAGTGTTTTCACTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATAAGACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAATAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCATTCCCCAAACTGTGATGTATGCCATACTACAAGACAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTTCAAGGCAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTAACCCCAGTGAAATCCTTCCTCCACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCAGGCCACAAGGAGGTGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGGCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCCTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATAATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCGGTGGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTGATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGA{AG}GAAGT?AAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCCTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATTCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAACGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAGGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAGCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAGGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAA?GAGTCTGGAAACAAACTGTTTAGG?GGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACAGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAACTGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCAGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCAGCTGTGTTTCTCATTGATTTTGAGTTTGGTTGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTATCAATTGCCAGAGATGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACTAGGTCCCCCAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCGGACAACCAGAAACGGCTGGTGTGTAACACCGTAGTTCTGGAAGATAGTAAGATAGAGATTCATGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTCTACTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGTTAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGCACTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGACGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Dicaeum_aeneum TAAATTGCGATCATTTGAAAAAA{CT}ATCCTCTGACGACAGCCAGCACATAAACAAAGATCAGGCAAAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CA{AG}GGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATG{AC}AACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGACGTGTGCCATACTACCAGAC{AG}AGGAATCAAGAGAAAAAGCCAGCCCCCACGTGTACAACCTGGTAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACGGACAAACAACAAAAATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTCGATAATCTGAGTATACGATGCCCTGTAAAGGAGTGTGATGAAGAGATCTC{AC}CATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACC{AG}AGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTC{AC}GGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATCGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCCGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTATATCTGAGGATGAAGCCAGTGTGGAGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTCTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCTTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATCAGGACCAGTATATCATCCATGGTGGTAAAACACCTAACAACGACCTTTCTGATAAGATTTACTTCATGAGTTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTACGCTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGATAACCAGAAACGCCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCGATTTTGCTGGGCATTCCAGGAGCCAGCAAACAAATAATCCCGGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Dicrurus_adsimilis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCATGCTATGCAAACAGAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGA{CT}CTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGCGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAA{CT}AGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGT{CT}AATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTGCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTCTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATCATAGATGGACTATCAGGTCTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAACTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCGGCCTTCTTCTC{CT}AAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAG{AG}TCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCA{AT}CCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACAATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCA{AG}TAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Dryoscopus_cubla TAAATTGCAATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTATTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCTTTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAGACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAAGCGATGTTGATACCATCCATCCCACGAAATTTTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAGCGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTACCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCAC---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCTTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATAAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGA{CT}GACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATTCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCTTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACCGGATTTTCCAGATGGAGATTGGTGAACTTTATAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCTACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCCATGCACGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGGTACCGAATTCGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Elminia_nigromitrata TAAATTGCGATCATTTGAAAAAGCACCCTCTGATGACAGCCAGCACCTAAAGAAAGACCACGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACAGAGTTAACGGGTAATAGG---CAGGGTCTTGAGGAAGATGCCCTTGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATTTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCACTTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGCAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGCAGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCA?TAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATGTTTTGGCTGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGACCTGGTAACCCCAGTGAAATCTTTCCTGCACATCCTTGACAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGGCAACATCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGTTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATGGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTGGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAGTCATGAACATTTCTATAGCACATGGGAATGACAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACTTTTAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGTCATTCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAGGAGTGCCCAGACCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATAAATGCTAGGCAGTCCAAAG-----------------------AGATCCTGCCCCACAGGTGTTTTCCTGCTCGCTATAAAGCAGAATGAGCTCAAACTGAAACCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTGAGAAGTGATGCAGGGGCTGATGAGTACC{AT}GTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAATCTAGCAAGAAAATGACATTCCAGTGCCTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGAGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGAGCAGAGAACCACTGAAAAATGGAACAGCGTAATTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACACACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGACACTCACTTCAAGATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGTCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCGTCGTTCTGGAAGACAGTAAGATAGAGATTCATGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTGGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Emberiza_schoeniclus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGAAAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTCAAAACTGATT{GT}TTCCAAGAGAACT{CT}ACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGGTTGATGTGCGAGGGGATGTTGACACTACCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAGCCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGT{AT}ACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCAAACACCTTTCTGGCCACAAGGAGATGAAAGAAG{CG}AGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGTAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTTTAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAATCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACAAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAA{AG}TGTGAGGAAAGGCATGAAGCCCTCAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTCCTTCTCCAGAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAATTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTAGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACGGAAACATGGAACAGTGTAGTTGACTGTTTGCCATTTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAGTTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGATAATAAGATAGAGATTGTTGAAAGCGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACAATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Eminia_lepida CAAATTGCGACCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGAGCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGCTAACGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAATACAAGACAAC---AGAGATCATCGGAAAAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGAGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATGCACAGAAAGTTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGCGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGCGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGACATTTGTTTTGCAGAACCTGCATCTTTAAATATATCAGGGTTATGGGCAGCTATTGCCCTTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTTACCCCAGTGAAATCATTCCTGAGCATCCTTGATAACTTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATACGGCCAACACCTGTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCAGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTGGACACAATTGCAAAGAGATTCCGATATGATGCAGCCCTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACCATCATGAACATTTCTATAGCACATGGGAATGAAACCAAGAGGATCTTTGAGGAAATAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAG{AT}GGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGAGGTACAGG{AC}TATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAACCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAGTTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGAGATCCTCATGCCCTGCT{AG}AGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGA{CT}GTCTTGAGATCCTCCCCCACTGGTGTTTTCCTCCTTGATATAAAGCCGAATGAGCTCAAAATGAAACCTGTTGCTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTGTGCATGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTATGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGACACAATCTACATCTTGGGAGGTCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCGGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGACAGTAGGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCGGCTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGT{AG}CC Eremopterix_australis TAAATTGCGATCTTTTGAAAAAACGCCCTCTGATGACAG{CG}CAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TTAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCAAAGAGGAGAAAAG---------------ATGGAGCTAATGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCATGCCCTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTCAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACCTACCCAGTGCATGGACCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAATCAGCAACCTCTTGGCCAGATCTTATTGCCAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTG{CT}{CG}ATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAAC{AG}TGGTAAACGTGTCAAAACCACTGGGGAATGTGCTCGGCT{AT}AACAGAGGT{AG}TAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTCCCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTT{AG}TGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATTAGATGCCCTGTAAAGGAGTGTGATGAAGAGATCTTGCATGGAAAATATG{AG}CCAACACCTCTCTGGCCACAGGGAGACAAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCTAGGCAGCACCTCCTGTCTCTGACACGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGCGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGG{CT}ATGAAAGCAAACAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAA{CT}ATTTCCATAGCACATGGGAA{CT}GAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGACGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGCACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATCACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATA{CT}CACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATCGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAG{CT}TGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATG{CT}TGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCT{AG}AAAGAACTAATGGACCTTTATTTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCAGCTCTTTGC{AG}CACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAAATTTACTTTATGAGTCTGGTAAACAAAACCAGCAAGAAAGT{GT}ACATTCCAATGCATTGAGAAAGACCTGGGTGGAGAAGTCCCTGAAGCTAGATATGGGCATACTATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCTTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAAC{CT}TGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCTGCTGTGACCTGCACCATCCTGC{CT}AGGGGG{AG}ATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTA---ACACAAATTTGCAGCCAGACATCAAGTGAAGATGCTGGAGACTCTGCTGCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATAACGTGCTGTGCC Eugerygone_rubra TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAAGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAACAATTCATCCTGCATAATGATGAAGCAATACCAAGGGGAGAAAAG---------------ATGGAGTTG---------AGG---CAGGGACTTGAGGAAAATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGACAAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGA---GGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGCACAACAGGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAGAATTTAATGAAAGAGATTGTCAATTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTCTGCAGAACCTGCATCCTGAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCGTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTGAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGCTACATCAATAAAGGTGGCCG{AG}CCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACAGTCATAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGA{AG}CATTTCTATAGCACATGGGAATGAAAGCAAAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCCGATCATGAGACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAGACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAAAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCCGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGGTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAACTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCATCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGAGGTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAGGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTTTCTGATAAGATCTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCATTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCAGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCTGTGTCAAGTGCCATAGTGACCCAGATCAGTGATAGTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCCGTGATATGGGTAAAGGGTCTGTCTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATACAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGA{CG}GACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAG{AT}GGAGTTTTGTTTTAGTGCTGAAGCCAATAACTTTGATGGTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Euryptila_subcinnamomea CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTTATCCTGCGTAGAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCACATGCCATGAAAATACAAGACAAC---AGAGATCATCAGAAAAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACGGATTGTTACAAGAGAACTTAC{CT}CAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAAGTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACCACCAGACGAGGAGTCAAGAGAAAAAAACAGTCCCCAAGCGTACAA{CT}GTGGCAAACGTGTCAAAACCACTGGGGAACGCACTCAGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGACTTCATTAAATCCATCTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTTACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCACGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCAGTGTGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTGGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACCATCATGAACATTTCTATAGCACATGGGAATGAAACCAAGAGGATCTTTGAGGAAATAAAGCCCAACTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTAGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAACCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTCGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGCGAAGGAAACGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTTCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTGCTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTGTGCATGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATTATCCATGGTGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTATGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACATATGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACAAACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGACACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATTCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACGCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCGGCGCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Fringilla_montifringilla TAAATTGCGATCATTTGAAAAAACAGCCTC{CT}GATGACAGCCAGCACATA{CG}ACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACCAAGAAATCATCCTGCATGAAGAAGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGCTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCC{AC}TGCCATAAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCAAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTGTATTT{CT}CCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCACACTTCCAGACGAGGAGTCAAGAGAAAAA{AG}CCA{AG}CCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACGACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCGTTAAATCCATTTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAAC{AG}ACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGA{CT}GACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTGATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAACTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTTTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTG{CT}GACATTGGCAATGCCACAGAATTCTACAGGAT{CT}TTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCC{AG}GAACTGCTGTGCCAATATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTGTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGCTTGGTAAGCAAAACAAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATACGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATACACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGGGAGGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAAATCAGTGACAATGAATTTGTCCTCGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCGTGTAACACCATACTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTAGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAGCACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTATTTTAG{CT}GCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Furnarius_rufus TAAAGTGCGATCATTTGAAGAAACACCCTCTGATGACAGGCAGCATATAAACAAACATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATTATACTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGAACTTGAGAAAGAGGCCCATGACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAACA{AC}CTTTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGTTACAACAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCT{AG}TGGCTTCTTAGAAAGAAAGAAAAACAAGCAACCTCTTGGCCAGACATTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATATTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTCTATTTTCCTAGGAACAGCACAGTGGAGTGGCAACCTCACTCCCCAAATTGTGATGTATGCCATACTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCATCAAGTGTACAATATGGCAAACGTGTGAAGACCATTGTGGAACGTGGTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCA{AG}TTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCC{CT}GTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGGTAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAATCAACACGTTTCTCAGTTGTAGCCAGTACCATAAAATGTACAGGACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTAGATA{CT}GATGCAGCCTTGGTTTGTGCCTTAAAGGACATAGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTAGATGACTATTTGAATGGTCCCTTCACCGTGACAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTAATGAACATTGTCATTGCACATGGTAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTATGCCTTATGCTAGCAGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTAAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTAGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTACACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCGAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGAACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCGTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAGCTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACAGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTGAAAATGAAACCAACCTTCTTCTCCAAAGACTCATGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAACAATAGCAAGAAAATGGTGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCAGGGGAAAAGCGTGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCATTCCA{CT}GTTTCAATTGCCAGAGATGATACAATCTACATATTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAATTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATATTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGGTACCACTCCGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCAAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGATGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Gallus_gallus TAAAGTGAGGCCATTTCAAAAAGAACCTTCTGATAAAAGCCAATGCATAAACAAGGATCAAGAACAAGAGGTAGCTTCT------------------------------------------------------------ACAGACAAAAACATCACGCTGCATAAAGATGAAGAAGTTCCAAGAGGAGAAAAGTTAATTCTGACACAGAAGGACTTCATGGGCAATACG---CAAGCACTTGAGAAAGATGTCAATGACATGAAAATACAAGACAAC---ACAGCTCACCAGAACAACCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCGTTTAAAACTGATTGCTACAAGAGAACTCATCCAGTACATGGACCAGTAGATGATGAAACTCTGTGGCTACTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGATCTTATTGCAAAAGTTTTCAAGATTGATGTGAGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATCCACAGGAAATTCAGTAATACTCCATGTGAAGTTTATTTTCCTAGGAACAGCACGATGGAGTGGCAGCCCCACTCTGCAAACTGTGAAGTGTGCCACACGCCCAGCCGGGGAGTCAAGAGAAAGAGCCAACCACCCAACGTACAACATGGCAAACGTGTGAAGATCATTGCAGAACGTGCTCGAGTTAACAGAGGCATAAAGAACCAA------------GTG---ATAAAGAACAAAAATGTAATGAAAGAGATTACAAACTGCAAGAACAGACATCTCAGCACCAAACTGCTTGCAGTTGATTATCCAGCAGATTTCATTAAATCCATCTCTTGCCAGATCTGTGAGCATATTTTGGCAGACCCAGTGGAAACAACGTGTAGACACTTGTTTTGCAGAACTTGCATTCTCAGTTGCATCAAAGTTATGGGATGCTATTGCCCTTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGAGCATAAGATGCCCTGTTCCAGAATGTGATGAAGAGATCTTGCACGGAAAATATGGCCAACACTTCTCTAACCACAAGGAGATGAAAGATAAAGAGCTCTATAACCCCATAAATAAAGGTGGCCGACCAAGGCAGCATCTTCTGTCTTTGACCAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAACGAACACAAGCAAGCAGATGAATTGGAGGCTATAATGCAAGGCAGAGGATCTGGACTTCATCCCGCTGTTTGCCTGGCAATACGAATCAACACTTTTCTCAGCTGTAGCCAGTATCACAAAATGTACCGAACTGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCACTGCATGCTCTTCGCACCGCCGAGAAAGCCCTCTTACCAGGTTATCATCCTTTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTACCCCTCTCGATTGATGACTACCCAATAGACACAATTGCAAAGAGATTTCGATATGATACAGCCTTGGTTTCTGCTTTAAAGGACATGGAGGAAGAAATCTTGGAGGGCATGAAGGCAAAAAACCTGGATGACTATCTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTGCTGTGACGGAATGGGAGATGTCAGCGAGAAGCATGGAAGTGGTCCTGCTGTCCCAGAGAAGGCTGTACGCTTTTCATTTACAGTCATGAACATTGCTATAGACCACGAGAACGAAAGGATAAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGTCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTCAGCCCTCTCATAGCAGAGAGAGAGGCTATGAAGAACAGTGAACTGCTTCTTGAAATAGGAGGCATCCTGAGAACATTCAAATTCATCTTTCGAGGTACAGGCTATGATGAGAAACTTGTAAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATCTGTACCCTCTGTGATGCAACCCGCCTAGAGGCCTCCCAGAATTTGGTCTTCCACTCCATCACCAGGAGCCACACTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATAGAGACTGTTCCCTCCATAGACGCGTTGCACTGTGACATTGGCAACGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAAGTCTATAAGAATCCTGATGCGACTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAAATTAAAACCTATGATGAGGATGAGTGGGAACTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAAATGAAACCAGTATGGCGATCTTCGTGCCCTGCCAAAGAGTGTCCAGAATTGCTGTGCCAGTACAGCTATAATTCACAGCGTTTTGCGGAGCTCCTGTCTACCAAGTTTAAATACAGATATGAGGGCAAGATTACCAATTATTTCCACAAAACCCTTGCTCATGTACCTGAAATCATTGAAAGAGATGGGTCCATTGGTGCTTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTATTTAGGAGGTTCCGAAAAATGAATGCGAGGCAGTCCAAATTCTATGAAATGGAGGATGTCTTA----------CCACGGGTGTTTTCTTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAGGGATTCATGTTACCTTCCCCCACTCCGCTACCCAGCTATTTGCACACTTAGAGGCAACGGGGAGTCTGATAAGCACCAGTACATCATTCATGGTGGGAAAACACCTAACAATGATCTTTCTGATAAGATTTACATTATGAGTATGGTAAACAAAACTACCAAGAAAACCACATTTCAGTGCATTGAGAAAGATCTAGGTGGAGATGTCCCTGAAGCTAGATACGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGATTGTTATATTTGGAGGTAGATCATATATTCCTCTTGCACAGAGAACTACTGAAAAATGGAATAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCATGTTTCAGTTGCCAGGGATGATACAATCTACATTCTGGGAGGCCATTCACTTCAAAACAACACCCGGCCTCCCAGCCTATACAAGCTAAAAGTTGATCTCCCGCTGGGCAGCCCATGCGTGACCTGCTCTATCTTGCCAGGGGGAATATCTGTGTCGAGTGGTATTGTGACTCAGACTGGTGATACTGAATTTGTCCTTGTTGGGGGCTACCAGTCTGACAACCAGAAACGGATGATCTGTAACACTATAGTTTTGGAAGATAATAAAATAGAGATTGTTGAAAGGGTGAGCCCAGACTGGACACCTGATATTAAGCACTGTAGGATGTGGTTTGGCTGTGATATGGGCAAAGGGTCCGTATTGTTGGGCATTCCTGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAACAAAGCAGAAGAGGATGAAGAGGAAGAACTGACAGCACAAACATGCAGTCAGGCATCTACCGAAGACCAAGGAGACTCCACTCCATTTGAAGATTCCGAAGAGTTTTCTTTCAGTGCTGAAGCCAGTAGCTTTGATGTTGATGACATTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGGTACTGGATCATCTGCTGTGCC Garrulax_milleti CAAATTGCGATCATTTGAAAAAACACCTTCTGAAGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCGTAAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAGACACAAGACAAC---AGAGCTCATCAGAGCAATCTGAACCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTTGCAAGAGAATTTACCCAGTGCATGGACCAGTGGATGAGGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACCGCAACCTCTTGGCCAGATCTGATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCGCAATGCAGTGGCAACCACATTCCCCAAACTGTGATGTGTGCCATACTACCAGACAAGGAGTCAAGAGAAAGAAACAGCTCCCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTTGATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTCAAATGTATCAGGGTTATGGGCAGCTATTGCCCCACCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTCTCTGGTCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAAAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCCAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAGTGGCCCCTTCACTGTG{CG}TAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTATAAGAATCCTGATGTGTCTAAAGTGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCGCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACGCCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGGTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCGCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCA{CT}GTATCAATTGCTAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGTACCATCCTGTCTGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAAACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGATACCTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Hirundo_pyrrhonota TAAATTACGATCATTTGAAAAAACACCCTCAGATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTGACCCTGCATAAAGATGAAGCAGTGTCAA{CG}ACGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CATGGACTTGAGGAAGATGTCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTCACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGACGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGACAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAAGATATACACCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCCGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTTTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGCGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGTTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTCCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCC{CT}CTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGA{CT}GATTACCCAGTAGACACAATTGCAAAAAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGGATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAACGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTCAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATA{CT}GAAATATGGAGGTCCAACCCATATCATGAGTCTG{CT}TGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCATTGCGACATTGGAAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAAAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAATGTGAGGAGAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCAATGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCACAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACTTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTGTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAAAGATGATACAGTCTACATCTTGGGAGGCTACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTTCTTGT{CT}GGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATGGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCAGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATTCCAGATGCAAACTACTTCTACATTTTGAGGTGCAAAGGAGAAGAGGACAAAGAAGAAGAA---TTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGATGCTGGAGACACTGCTCCACTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAGACAGGCTACTGGATCACCTGTTGTGCC Hylia_prasina TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTCCT------------------------------------------------------------TTAAACAAAGAATTCATCCCGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAGGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGAAGTGTGCCATACTACCACACGAGGAGTCAAGAGGAAAAAACAGACCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAACAAAAATTTTATCAAAGAGATTATCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTATCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAA{CG}GTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCCGTGAAATCCTTCCAGAACATCCTTGGTAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTCTCTGTCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGC{GT}CAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGC{CT}CTCCTACCAGGTTATCA{CT}CCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTCTCAGGACTGCCACCCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGCTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAGAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAATCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGA{AG}TGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCC{CT}GTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGC{AG}TCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAAAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTA{CT}ATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAGAATCTGGAGCGGTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGGAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGC{CT}CTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGG{AC}AAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAATCTGGAAACAAATTGTTTAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAACGAACTTTCTGATAAGATATACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGA{AC}GCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGT{CG}TTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCGCAAAGAACCACTGAAAAATGGAACAGTGTAGTGGACTGTTTGCCGTCTGTGTTTCTCATTGATTCTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAATATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAG{CT}GCTATAGTGACCCAGATCAGTGACAC{AT}GAATTTGTCCTCGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGC{AG}TGTAACACCATAGTTCTGGGAGATAGTGAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAA{CT}AGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Irena_cyanogaster TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAAGCCATGAAAACACAAGGCAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTAAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGAGATGTTGATACTATCCATCCCACTCTATTTTGTCACAACTGTCGGAGTATTATGCATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCATTCCCCAGACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCTCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGGACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGGAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCTCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGGTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATTCTCTTCGCACGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCTCTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCGGTCTCAATTGATGATTACCCAGTAGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAACAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCGCATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTAATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGTGTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCCTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTATCTAAAGAGGAGAGGAAGAGGTGGCAG{CT}TGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCGGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCT{AG}AAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTATTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTCGTTCATAGCAGGGGGAAAAGCATGAGTGTTCTATTTGGAGGGCGGTCATACACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTCGCCGTCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAGTTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCCCTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGAGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCAAGCAAACA{AG}ATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGA{AG}GAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTCGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATATGTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Lanioturdus_torquatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGAATGATGCCCATGCCATGCAAACACGAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATATGGAAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATATTGGCAGATCCAGTGGAAACAACATGCAGACACGTGTTTTGCAGAACTTGCATCCTTAAATGTATTAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAG{AT}TAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCATCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTCCATCCTGCCGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCT{AC}CCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATCGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGACCCTTCACTGTGGTAGTAAAAGAGTCTTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCGTTGTGTCTTATGCTGGCTGACGAATCAGATCATGAAACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTCCTGCTTGAAATGGGAGGTATCCTGAGAACATTTCGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCCGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCATGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTTTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGG{AG}TCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAACGAGCTCAAACTGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCCATGCAAGGGCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGAC{AG}TTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTTGCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAG{CT}GTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAGTTAATCCCAGACGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCGAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACACTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Lanius_excubitor TAAATTGCGATCATTTGAGAAAACATCCTCTGATGGCAGCCAGCACGTAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCTTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAAG---CACAGACTTGAGGAAGATGCCCATGTGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCGTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACAACGTGGAAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAATAGAGGTGTAAAGAACCAA------------GCACGGATAAACAACAAAAATATAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATAGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGAGTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTTAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCTGTGTGGCGATCCTCATGCCCTGCCAAGGAATGCCCAGAACTGCTATGTCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTTGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATATACTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAGAATAACATCAGGTCCCCCAACTTGTATAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTCTAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGCGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGATGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAGGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Macrosphenus_flavicans CAAATTGCGGTCATTTGAAAAAACACCCTCTGATGAGAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCCATGTAAAGATGAAACAGTCCCAAGAGGAGAAAAG---------------ATGGAGTCAGTGGGCAATAGG---CAGGGACCTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAGCTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAAC{AG}TGGCAAACGTGTCAAAACCGCTGGGGAAC{AG}{GT}GCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTC{CT}TGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCTTGAACATCCTTGACAACTTGAGCATAAGATGCCCTGTAAAGGAATGTGATCAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCCGAAAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCGCTAACACAG{AG}AGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATAGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATG{CG}GAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCTTGAGCCCTCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCGCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACTAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCCAAGAGACTGTAGAGGCAGTATGTGAGTTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGA{AG}TGCCCAGAACTGCTGTGTCAGTATAGCTACAATTCACAGCGTTTCGCAGAACTCTTAACTACAAAGTTCAAGTACAGGTATGA{AG}GGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATCGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTACGAGATGGAGGATGTCCTG-------------------TTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTACATTTCAATGCATTGAGAAGGACCTGGGTGGAGATATCCCTGAAGCTAGATATGGGCATACAATAAATGTAGTTCATAGCCGGGGAAAAAACA{CT}GATTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCAGGGGGGATACCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAAC{AG}GCTGG{CT}GTGTAACACCATAGTTCTGGAAGACAGTAAGATAGA{AG}{AG}TTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGACGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCCGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Malurus_melanocephalus TAAATTGCGATCATTTGAAAAAGCAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCAAAATGATGAG{GT}CTGTGCCAAGAGGAGAAAAG---------------ATTAAGATAGCAGGTGATAGG---CAGG{CG}ACTTGAGGAAAATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTCTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGCGATGTGTGCCATATTACCAGGCAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACG{CT}{AG}TCAAAACCACTGGGGAACGCGCTCGGTTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTGATGAAAGAGATTGTCAATTGCAATGATATACATCTCAGCACCAAGCTGCTTGC{AC}ATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTTCTGAGTATCCTTGATAACCTGAGTATTAGATGCCCTGTAAAGGAATGTGGTGAAGAGGTCTTGCATGGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATCAAAGATAGAGAGCTCTACAGCTACGTAAACAAAGGTGGCCGACCAAGGCTTCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCT{CT}TGCATGCTCTTCGCAA{CT}GCTGAGAAAGCCCTCTTACCAGGTTACCACCCATTCGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCCT{AG}GTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGATTATTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCA{AG}AGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAGCACATGGCAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAA{CT}GTTTAGATT{CT}GTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGTTATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCAAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACAT{CT}GGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACCCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCAATGCTGAAGATGAG{CT}GGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCTTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGCTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACGAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGTAATGAATCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAACGAGCTCAAAATGAAACCAGCCCTCTTCTCTAAAGATTCATGTTACCTTCCCCCTCTCCGTTA{CT}CCTGC{CT}CTTTGCA{CT}ACTCAGAAGTGATGCTAGTTCTGATGAGTACCAGTATATCATCCATGGAGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCA{AG}TGCATTGAGAAAGACCTGTGTGGAGATGTCCCCGAAGCTAGATATGGGCATACAATTAATGTCGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACTAC{CT}GAAAAATGGAACAGTGTGGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTCCC{AG}GAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACACGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCAC{GT}CTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGCGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCTAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTAAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGA{AG}TTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTATTGGATCACGTGCTGTGCC Megalurus_palustris TAAATTGCGATCAGTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTATTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGTACTTGAGGAAGATTCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTGTCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATAATACCAGACGAGGAGTCAAGCGAAAGAAACAGCCCCTAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGACCTTGCATGGAAGATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCCTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGAAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACCAACACAGAGGTGGGAATTATAGATGGGCTATCAGGGCTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCTTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCA{AG}AGAAGGCGGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCTTGAGCCCTCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCCCAGCGTTTTGCAGAACTCTTGTCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGAGCTTTCTGATAAGATTTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATAAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACTTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAGTTGCCAGGGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGGCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGTCCGGCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAATTCTGGATGACGGTAAGATAGAGATTGTTGAATGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAAACAGAAGAGGACAAGGAAGAAGAACTGATAACGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTATTGGATCACCTGCTGTGCC Melanocharis_nigra TAAATTGCGATCATTTGAAAAAACACCCTCCGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------CCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---GGAGATCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCTCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAGACAACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGCCTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGAAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTATGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGA{AG}CTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAG{AG}TGGCAGTTGACTCTCGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCCATGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTC{AG}TGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACATTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGT{AG}TTGAGAAGGACCTGGGTGGAGATGT{CG}CCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGTGTGAGTGTTCTATTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAA{CT}CACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCC{AG}TCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGA{CG}TTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACTCAGGTCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGCAAGATAGAGATTATTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCCAA{CT}AGCTTTGACGTTGGTGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Meliphaga_analoga CAAATTGCGATCATTTGAAAAAATAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAGGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAAGAAAAAAG---------------ATGGAGTTAATGGGTGACAGG---CAGGGACTTGAGGAAGATGCCCATGCCTTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACCGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAAGCGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACTACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCCAAACAGAGGTGTAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCA{CT}ATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCCACTGATCTG{AG}TAAC{CT}CCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCATCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCATGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTGAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGGATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGG{AC}ATGGGAGATGTCAGTGAGAAGCA{CT}GGAAGTGGGCCTGCTGTCCC{AG}GAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATG{CT}TGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAG{AG}TTCATCTTTAGGGGTACAGGATATGATGAGAAACTCCTCCGGGAAGTAGAAGGGCT{AG}GAGGC{CT}TCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCA{CT}GAATCTGTTGATGA{AG}CTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTAT{CT}GAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTGATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATCACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCC{CT}ACTGGTGTTTTCGTCCTCGATATAAAGCAGAATGAGCT{CG}AAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTGCGCTACCCTGCTCTTTGTACGCTCAGA{AG}GCGA{CT}GCAAGCAATGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCCAG{AG}TATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCAT{AG}TGTGTTCTGTTCGGAGGGCGATCGTATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATC{CT}TGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACA{AG}GCTAAAAAT{CT}GATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACTATAGTTCTAGAAGA{CT}AGTAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTCTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGCGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGGTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGGCATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Menura_novaehollandiae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAACACATAAACAAAGATCAGGCACAAGAGGCTGCTTCT------------------------------------------------------------TCAAATGAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGACAATAGG---CAGGGACTTGAGAAAGATGCCCATGACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAGGCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCGGTGGATGATGAAACTATGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCTCTAAGGTGTTCAAGATTGATGTGCGAGGCGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACACAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATGTTTTGGCAGATCCTGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGTGTATAAGATGCCCTATACAGGAATGTGATCAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAGGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGGGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTAAAAAATGTATCCACAAACACAGAAGTGGGCATTATAGATGGACTATCAGGATTGCCACTCTCTATTGATGACTATCCAGTGGACACAATTGCAAAGAGATTTCGCTATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTCTCTTTCACAGTCATGAACATTTCTGTAGCACATGAGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGTAAGCCCTTGTGCCTTATGCTCGCTGATGAATCTGATCATGAAATTCTGACTGCAATCCTGAGCCCCCTCATCGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGATCCTTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATGTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCTTACCACGAATCTGTTGACGACCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCCAAAGAGGAGAGGAAGCGGTGGCAGTTGACTCTTGATAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGCTGAGAATGACTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAATTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACCAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTGCTTCTCTAAAGACTCATGTTACCTTCCGCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAGGTCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGACATTCCAATGCAGTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAGAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACTTCATACATACTCCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAACAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTTCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCGAGTGCTATAGTGACTCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCTTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATCGATGATACTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Mimus_patagonicus TAAATTGCGCTCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATTCTGCATAAAGATGAAGCAGGACCAAGACGAGAAAAG---------------ATGGAGTTAATGGGAAATAGG---CAGGCACTTGAGGAAGATGCCCACGCCGTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACCATCCATCCCACTCAATTTTGTCGCAACTGTTGGAGTATTATACATAGCAAATACAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGGGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACCACGTGGTAAACGTGTCAAAACCACTGGTGAACGTGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTAAATCGATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGCAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTACAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCCCTTACAAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAGATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACTGAAGTGGGAATTATAGATGGACTATCAGGACTGCCAGTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAACACAAGGGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCCGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGG{AC}AATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAACTTACTTTATGAGTCTGGTAAACAAAGCCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAGTCAATGTAGTTCATAGCCGGGGGAAAAGCGTGACTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCTCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACCTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACTGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAGGGGTCTGTTCTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACGTTTTGAGATGCAAAGAGGCAGAAGAAGACAAGGAAGAAGAATTGATA------ATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAGGAAGACGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Modulatrix_stictigula TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAATCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACTGGCAATAGG---CAGGGACTTGAAGAAGATGCCCATGCCATGAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTG?CGCATCTGTGGAGTTCCATTTAAAATTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCTACCCCATTCCCCAAACTGTGATGTGTGCCATGTTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAAACAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGACCCAGTGGAAACAACATGTAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCGCTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTACTGCTTGAAATGGGAGGCATCCTGCGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCATCCATAGATGCATTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAATCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCCAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTAGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGCTTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGATAAAAATTGAT{CT}TACCCCTGGGCAGCCCAGCGGTGACCTGCAGCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTGTGGAAGATAGTAAGATAGAGATTATTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATACTCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAGGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTA?TGGATCACCTGCTGT?CC Monarcha_axillaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------AT{AG}GAGTTAGCGGGCAATAGG---CAGGGACTCGAGGAAGATGCCCATGCC{AG}TGCAAACAGAAGACAAT---A{CT}AGCTCATCAAAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCTAAA{AG}TGCAATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGTAGTAGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACATGCATCCTTAAATGTATCAGGGTTATGGGAAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGCGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATACAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCGGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAA{AT}TGGGAGG{CG}ATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTAC{AC}CTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCA{CT}GAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTC{CT}GGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCAATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGGGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCGTACATTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGACACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCGCTGTCAAGTGCTATAGTGACCCAGATCAGTGATACGGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCGTAGTTCTGGAAGATAGCAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCTGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCAGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGGTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Motacilla_cinerea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATATG---CAGGGACTTGAGGAAGAT------GCTGTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCACTTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTTAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGGGGCAAACGTGTAAAAGCCACTGGGGAAC{AG}TGCTCAGCTAAACAGAGGTATAAAGAACCAGCAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTG{CT}AGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAATATTCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGA?GAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTATCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATG{CT}TGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTT{AG}CGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGGAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTC{GT}AAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAGGTGTGAGGAAAGGCATGAAGCCCT{AT}AAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTC{AG}TGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTTTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACGAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGA{CT}GTGCCTGAGGCTAGATATGGGCATTCAATTAACGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATATGCTTCCAGAGCTTCAAGACGGACTTTCTTTCCACGTCTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCC{CT}AACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCCATAGTGACCCAGGTCAGTGACAATGAATTTGTCCTTGTCGGTGGCTATCACTCAGACAACCAAAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTGTTGCTGGGCATTCCAGGAGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAGGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Muscicapa_ferruginea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCT---TCT------------------------------------------------------------TCAAACAAGGAACT{CT}ATTCTGCATAAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAATGGGCAAT{AC}GG---CAGGCACTTGAGGAAGATGCCCACGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGTATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGA{CT}GTGCGAGGGGATGTTGATACCATCCATCCCACTCACTTTTGTCACAACTGTTGGAGTATTATACACAGCAAATACAGTAATACTCTATGTGAAGT{AG}TATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGCGATGTGTGCCATACTATCAGGAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATGTACAGCGTGGCAAACGGGTCAAAACCACCGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGTACCAAGCTGCTTGCAGTTGATTATCCACCAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAGAGGAGTGTGATGAAGAGATCATGCATGGAAGGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACCGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTGCTGTCTCTGACCAG{AG}AGAGCTCAGAAACATCGTCTGAGGGAACTGAAACG{CT}CAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGG{AT}TCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTA{CT}CATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGGTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTCCCACTCTCAATTGATGATTACCCAGTAGACACTATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGTACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAACTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTC{AG}TCTT{CT}AGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACGTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCACGAAGCCTTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAGCTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAA{CT}TGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAA{AG}CAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTCTGCACGCTCAGAAGTGATGCAGAGGCTGATGAGTATCAGTACATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGACAAGATTTACTGTATGAGTCTGGTAAACAAAACTAGCAAGAGAATGACATTCCGATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGACTGTTCTCTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTCTCAATTGCCAGATATGATACAATTTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGACCTACCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTG{CT}AGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTT{CT}TGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCGAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAAGAAGAATT{AG}ATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTC{AG}GAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Namibornis_herero TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGCCAGCATATAAACAAAGATCAGGCAGAAGAGGCT---TCT------------------------------------------------------------TCAAACAAGGAACCCATTCTGCATAAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAATGGGCGATAGG---CAGGCACTTGAGGAAGATGCCCACGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAATAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTATGAGGAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAGCGTGGCAAACGTGTCAAAACCACCGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGTACCAAGCTGCTTGCAGTTGATTATCCACCAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTCAATAACCTGAGTATAAGATGCCCTGTAGAGGAGTGTGATGAAGAGATCATGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACCGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCCAGGCAGCACCTGCTGTCTCTGACCAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATACGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGGTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTCCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACGTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACGGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAGTTAATAACGTGTGAGGAAAGGCACGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTTAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTA{AG}GAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Nectarinia_olivacea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGTATAAATATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTGCAAGACAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAGA{AT}CAGCAACCTCTTGGCCAGAACTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTTCCAGACGAGGAATCAAGAGAAAAAGCCAGCCTCCAAGTGTAAAACGCGGCAAACGTGTCAAAACCACTCAG------------CTAAATAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAACTGCTTGCAGTTGATTTCCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCT{CT}AAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCTTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTCAAGGAATGTAATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAGAGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGCATCAATACATTTCTCAGCTGCAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCT{CT}CGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGTCCCTTCACAGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTCTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTACTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGGTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAAAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGGAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCTTGTCCAACTGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTCAAAATGAAACCTGT{CG}TTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCT{AC}CGGTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGGCTGATGAGCACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTTTGGTAAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAG{CT}GTGAGTGTTCTGTTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTT{CT}TCATTGACTTTGAGTTTGGATGCTGTACATCATACATACTTCCTGAGCTTCAAGATGGACTTTCTTTCCACGTTTCGATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATTCCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAG{CT}GTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTGAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAGAGGAAC{AG}GAAGAGGACAAGGAAGAAGAATTGGTAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Neodrepanis_coruscans TAAAGTGCGAACATTTGAAAAAACTCCCTCTGATGGGAAGCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAACAGC---CAGGCAGTTGAGAAAGATGCCCATGACATTAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTACATGGGCCAGTGGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGAT{AG}TTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATTCATAGAAAATTCAGTAATGTTCCATGTGAAGTATATTTTCCCAGGAACAGCATGATGGAGTGGCAACCTCACTCCCCAAAGTGTGATGTATGTCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACTGAGTATACAACATGGAAAACGTGTGAAGACCATTGTGGAATGTACTCGATTAAACAGAGGTGTAAAGAACCAA------------GCACAAAGAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCATTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGCGGCCGACCAAGGCAGCATCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATTACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCGCTAACGCAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAATCTGGATGACTGTTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGGTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAGGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAACAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGAGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAACCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTGATGGACCTTTATCTCAGGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGGAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCAAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGTGTACTCGGGAGCAATGCAAAGTCTGATGAGTACCACTATATCATCCATGGTGGTAAAACACCTAACAATGACCTGTCTGATAAGATTTACTTTATGAGTCTGATAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAGTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCGGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGAAGATACTATATACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACTATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAAATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCCGTGACCTGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACGACACAAATTTGCAGTCAGACATCAAATGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTCAGTGCTGAAGCCAATAGCTTTGACATTGGTGATAATGATACTTACAATGAGAATGATGAAGAAGATGAATCAGAAACAGGCTACTGGACCACCTGCTCTGCC Nicator_chloris TAAATTGAGATCATTTGAAAAAACACCCTCAGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGC{AG}TAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTCAGGAAGATG{CT}CCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGGACAATCTGAAGCAACTCTG{CT}CGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTCTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTCTGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCATCCCCATTCCCCAAACTGTGATGT{AG}TGCCATACTCCCAGACGAGGAGTCAAGAGGAAAAACCAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGAAAGGTGCTCGGCTAAACAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGTTTATCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGGAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTCAAATGTATCAAAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTGGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGACGAAAGATAGAGAGCTCTATAGCTACGTCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGAC{AG}AGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGACGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCCAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAGAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACTGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACGGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGGCTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTGGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAAGTCTACGAGATGGAAGATGTCTTGCGATCTTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAGGCGATCCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACCCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCCTATGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCGGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCAGTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGTCACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCGGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCTGAGGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGTAGTCAGACATCAAGTGAAGACCCTGGAGATTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Oriolus_larvatus TAAATTGCGATCATTTGAAAAAACGCCCTCTGATGACAGCCAGCACATAAACAAAGGTCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACGGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACCGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAG{AG}TTAACAACAAAAATTTAATGAAAGAAATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCGTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCA{CT}CTCCTGTCTTTGACGAGGAGAGCACAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATACTGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTGTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGATATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACGATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCTTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAA{AG}CTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTATCTAAAGAGGAGAGGAAGAGGTGGCAGCTGAC{AG}CTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAACTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCGGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCATGCTCAGAAGTGATGCAAAGGCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGA{CT}CTTTCTGATAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGATCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAAAGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGA{CG}ATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTATATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTGCATT{GT}GAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATTGCTTTGATGTTGATGATGCCGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Orthonyx_spaldingii TAAATTGCGATCATTTGAAAAAACACCTTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGGAAGACGCCCATGCCATCAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTTTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTCATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTAGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGGAGAGATCTTGCATGGAAAATATGGCCAACACCTTTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGTCTGGCCATCCGGATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATCTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCTCACGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGCGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAAACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAACGAGTCTGGAAACAAACTCTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAACCAGAGTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAAGCTGATGAGTTCCAGTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACTTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAG{CG}CCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGATTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACACCCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCCGGGGCCAACAAACAACTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGTAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Orthotomus_sutorius CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGATGAGACTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGC{AC}GTGCCAAGAGGAGAAAAG---------------GTGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGGTGCCCATGCCATGAAAATACAAGACAAT---AGAGATCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGT{CT}TCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCCTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATTCACAGAAAGTTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAC{AG}AGGAGTCAAGAGAAAAAA{AC}CAGCCCCCAAGCATACAACTTGGCAAACGTGTCAAAACCACTGGGGAACGCGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGACTTCGTTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTCGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGCCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGG{AG}ACTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCGCTGCTGA{AG}AAAGCCCTCCTGCCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTGGACACAATTGCAAAGAGATTCCGATATGATGCAGCCCTGGTTTGTGCCTTAAAAGACATGGAGGATGAGAT{CT}TTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGA{AG}AAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATTCTGAGCCCTCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGCTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCATTGCGACATCGGCAACGCGACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGTCTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATC{CT}TCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGCGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAGAACTAGCAAGAAAATTGTGTTCCAATGCATTGAGAAAGACCTTGGTGGAGATGTTCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGACACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGATCTGCCGCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCGGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAGCGGCTGGCATGTAACACCATAGTTCTGGAGGATAGTGAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAATTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAA{CT}TGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACC{CT}TGGAGACTCGGCTCCGTTTGAAGATTCGGAAGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGGTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pachycephala_soror TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATG{CT}ATCCTGC{AG}TAACAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGATTTAACGGGCAA{CT}AGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---ACAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCC{AG}GAGCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACGCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCAATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAGCCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATCATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCAAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTT{CT}CGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCT{CT}AAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGATGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTCCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAGGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCAC{CT}CCGTTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACAATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Paradisaea_raggiana TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGCAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTTAAGAGAAAAAGCCAGCCCCGAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTGTCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGG{CT}GATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAA{CT}CCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAGAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAACTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTTAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATC{AG}ATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGA{CT}GTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Pardalotus_striatus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGATAGG---CAGGGACTTGAGAAAGATGCC------CTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTAGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACTTGTCAAAACCACTGGGGAACGCACTCGGCTAAACAGAGGTGTAAAGAACCAA------------ACACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAATGATATACATCTCAGCACCAAGCTGCTTCCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCCGGGTTATGGGCAGTTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGGAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTGCAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCTGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCATGAATCAGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTAAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGATTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAACGCGATGGGTCCATTGGG{AG}CCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGTTACCCCGCTCTTTGCACACTCAGAAGCGAT---GAGTCTGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGGGATGTCCCTGAAGCCAGATACGGGCATACAATTAATGTAGTTCACAGCAGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAG{AG}TCATATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCGTACGTACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTCCAAAATAATGCCAGGTCCCCCAACTTGTACAAGCTCAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATGGTAAGATAGGGATTGTTGAAAGTGTGAGCCC{AG}GAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGCGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTTCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Parus_inornatus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCTCATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGAAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACATGCAATAGG---CAGGGTCTTGAGGAAGATGCCCATGCCATGAAAACACA{AG}GACAAT---AGAGTGCATCAGACTAATCTGAAGCAATTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCGACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATGGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCGCAATGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGTAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGACATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTTCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCATTGGAAACAACGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCACGGAAAATACGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACACCAATAAAGGCGGTCGACCAAGGCAGCACCTCCTGTCCTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTTTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCTTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTGTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTTGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCTGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGTTATGATGAGAAACTCGTGCGGGAAGTGGAAGGACTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGGTATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGAGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCAATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCGCTTTGCACGCTCAGAAGCGATGCAAGGGCCGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGAAGGTCGTATACTCCTCTTGAACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCGTCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGACACTATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACAATGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGATCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCTGGTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Passer_montanus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATAAAGAAATCATCCT{CG}CATGAAGATGAAGCAGTGCCAAGAGAAGAAGAG---------------ATGGAGTTAACAGACAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAGGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACAGATTGTTCCAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAGGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGAGGAGGAGTCAAGAGAAAAAGCCAGCCCCCACATGTGCAACGTGGCAAACGTGTCAAAACCACTGGGAAACATGCTCAGCTAAACAGAGGTGTAAAGAACCAACAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAAGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGACTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCA{CT}AAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGCAGTCAGTATCATAAAATGTACAGAACGGTAAAAGCTGTCACTGGCAGGCAGGTCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTCTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGACGACTACTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTCAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCA{CT}GCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCGGCCAA{AG}GAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGA{AG}GGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGCGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTGTATAAGTTTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGGTATGGGCATACAATTAA{CT}GTAGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCC{AT}CTGTGTTTCTGATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCC{AT}GAACTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAA{CT}ACCAGGTCCCCTAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACAATGAATTTGTCCTCGTCGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGC{AT}TGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGAGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTCGAAGATTCGGAGGAGTTTTGTTTTGGTGCTGAAGCCAATAGCTTTGATGCTGGCGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Philepitta_castanea TAAAGTGCGAACATTTGAAAAAACACCCTCTGATGGCAAGCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAACAGC---CAGGCACTGGAGAAAGATGCCCATGACATGAAAATACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTACATTTAAAACTGATTGGTACAAGAGAACTCATCCAGTACATGGACCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTACGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCA{CG}AACTGTTGGAGCATTATCCATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCATGGTGGAGTGGCAACCTCACTCCCCAGACTGTGATGTATGTCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAATGTACTCGATTGAACAGAGGTGTAAAGAACCAA------------GCACAAAGAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATACATCTCAGCATGAAGCTGCTTGCAGTTGATTATCCAGCAGATTTCATTAAATCAATTTCTTGCCAAATTTGTGAGCATGTTTTGGCAGATCCAGTCGAAGCAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCGTTCCTGAACATCCT{GT}GATAACTTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTATATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGCCGGCCAAGGCAGCATCTTCTATCTTTGACAAGAAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTGGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCACAAAATGTATAGAACCGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACCCAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAATCTGGATGACTGTTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAATTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAAAGATATGAAATATGGAGGTCCAATCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATATTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGACATGAAGCCCTAAAAGAACTGATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGCATACTCAGAAGCAAGGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGCTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAGAGATGACACCATTTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTACCCCAACTTGTACAAGGTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACTATCTTGCCAGGGGGAATATCGGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGATTGGTGTGTAACACCATAGTTGTGGAAAATAGTAAAATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATCTGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAAAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAACGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGATACTTACAATGAGGATGATGAA---GATGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Philesturnus_carunculatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATTCATCCTCCATAAAGATGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAACATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTTATTTAAAACTGATGGTTACAATAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATAAATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGCGCTCGGCTAAACAGAGGTATAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCGGCACCAAGCTGCTTGCCGTTGATTACCCGGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAAGGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTCGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAA{GT}GAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCTGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGCGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGTATCTTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCCTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTATAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCCCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATGTCATCCATGGTGGTAAAACACCAAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAACGTAATTCATAGCCGGGGAAAAAGC{AG}TAAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTCGGATGCTGTACATCATACATACTACCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTTACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGGTAGAGATTGTTGAAAGTCTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAAGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACATTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTGCC Phylloscopus_collybita TAAATTGCGATCATTTGAAACAACACCCTCTGATGACAGCCGGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGTTGAC{AG}GGCAATAGG---CAGAGACTGGAGGAAGATGCCCATGCCATGAAAAC{AG}CAAGACAAC---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCA{CT}GGGCCAGTGGATGACGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACAGAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGTAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGACTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTGAGGATAAGATGCCCTGTAAAGGAATGTGGTGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCAGGTCACAAGGAGATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCCTTAACTAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTACTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAGGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCA{AG}ATCTTTCAGCCTTTGCATTCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCGTTCGAGTGGAGACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCCTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAGGAAAAAAACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTGGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCCACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGC{CT}AAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCAT{CT}GGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCCGCCACCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCGGCTCTTTGCACGCTCAGAAGCGATGGAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGATGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTGGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATTAGTGACACTGAATTTGTCCTTGTTGGTGG{CG}TACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATAGCTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAGTCCCAGATGC{AG}AACTACTTCTACATTTT{AG}A{AG}ATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCCGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCAGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Picathartes_gymnocephalus TAAATTGCGATCATTTGAAAAAACACCCTCTGATAACAACCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATACATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAAG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAATGCAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGCGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGTCAGCCCCCAAATGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGATTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACGTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAGTCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCACGGAAAATATGGCCAACACCTCTCCAACCACAAGGATATGAAAGATAGAGAGCTTTATAGCTACATAAATAGAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGGCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCCGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATCTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCGGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGATGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTTTGTGATGCAACGCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGATCCAACCCATATCACGAATCTGTTGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCTTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTTCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCACGCTCAGAGGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACACCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACCATCTACATCTTGGGTGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGAATATCAGTATCAAGTGCTATAGTGACCCAGATCAGTGATAATGAGTTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACGTTTTGAGATGCGAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pitta_sordida TAAAGTGCGACCATTTGAAAAAACGCCCTCTGATGGCAAGCAGCACATTAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAATAAGAAAATCCTATTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAACAGG---CAGGCACTTGAGAAAGATGCCCATGACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATAATCCACAGAAAATTCAGTAATAATTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGAGGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAACGTGCTCGATTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGAACATACATCTGAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAAGCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAGTATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTCTCAAGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCATTCCTGAACATCCTTGATAGCCTGACTATAAGATGCCCTATAAAGGAATGTGATGAAGAGGTCTTACATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAGTTGGAGGCTATAATGCAAGGGAGAGGATCTGGTCTTCATCCTGCTGTCTGTCTGGCAATTCGAGTCAACACATTTCTCAGCTGTAGCCAATACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTTGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTATCCAGTAGACACAATTGCAAAAAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAATCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCGGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTATGTGATGCAACTCGCTTGGAGGCATCACAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAGAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAGCAGAATTCTATAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAACCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCCAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTTGACATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATG{CT}TACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAATGCAAAGCCTGATGAGTACCAGTACATCATACATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTCATAAGCAAAAATAGCAAGAAAATGACGTTCCGATGCATTGAGAAAGATCTGGGTGGAGATGTCCCT{AG}AAGCTAGATATGGGCATACCATTAATGTAGTTCATAGC{CT}GGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATATTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTCCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCGTTCCATGTTTCAATTGCCAGAGATGATACCATCTACATTTTAGGAGGCCATTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAGGTTGATCTCCCGCTGGGCAGCCCAGCTGTGACGTGCACCATCTTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATAGTAAGATAGAGATTGTCGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCCATATTGCTTGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATACAAACTACTTCTACATTTTGAGATGCAAAG{CG}AGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATCTGTAGTCAGACATCATCCGAAGACCCTGGAGACTCCATTCC{AG}TTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGTTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Ploceus_cucullatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGTC{AC}GCACATACACAAAGATCAGGAAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCGTCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAATTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAA{AC}TGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTGCAACGTGGCAAACGTGTCAAAA{AC}CACTGGGGAACGTGTTCAGCTCAACAGAGGCGTAAAGAACCAACAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGTATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGCATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATTAACACCTTTCTCAGCTGTAGTCAGTATCA{CT}AAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACGTGGACGACTA{CT}TTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGG{CT}GATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGCGAACATTTAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTC{CT}ATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCA{CT}GAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATTAAATGTGAGGAAAGGCACGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAGGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTTTCTTCTCTAAAGACTC{CT}TGTTACCTTCCCCCTCTGCGCTACCCTGCTCTGTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTATCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGA{AG}AAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACGGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACA{AG}TCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGG{GT}ATATCAGTGTCAAGTGCTATAGTGACTCAGATCAGTGACAATGAATTTGTCCTTGTCGGTGGCTACCACTCGGACAACCAGAAACGGCTAGAGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGAT{CT}ACCTGCTGTGCC Pomatostomus_isidorei TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAAGAAAGATCAGGCAGAAGAGGCTGCTTTT------------------------------------------------------------TCAAACAAAGACTTCATCGTGCATAAAGATAAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCATGCCATCAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTATCAATTGCAAGGATACACATCTCAACACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCATGGAAAATATGGCCGACACCTCTCCAGCCACAAGGATATGAAAGACAGAGATTTCCATAGCTACACAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAAGGAACTGAAACGTCAAGTGAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGCCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCCTTTGAGTGGAAACCGCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCGATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGACATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGACTGAAAGCAAGAAGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTAGATGAACTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCACGAAGCCATAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTAAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTTAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATGGAGAAAGACCTGGGTGGAGACGTGCCTGAAGCTAGATATGGACATACAATAAACGTAGTTCATAGCCAGGGAAAAAGTATGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACTGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGGTGACACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATATACCCCTGGGCAGCCCAGCTGTGAGCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACGCTGACAACCAAAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGCGGACAAGGAAGAAAAATTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCCATAGCTTTGACGCTGATGATACTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Prinia_bairdii CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGAGCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------CCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAATACAAGACAAT---AGAGATCATCGGAAAAATCTAGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGACGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATCATGCACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGCGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTCTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCTACAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTGGACACAATTGCAAAGAGATTCCGATATGATGCAGCTTTAGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAATCATGAACATTTCTGTAGCGCATGGGAATGAAACCAAAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTAGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAATTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTCGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAAATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATCGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAATTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGAGCCGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTGTGTTCCAATGCATCGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGATGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGACACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCGTCCTGCCGGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAGCGGCTGGCATGTAACACCATAGTTCTGGAGGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATCTGGTTTGGCTGTGATATGGGTAAAGGGTCGATTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCGGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Prionops_plumatus TAAATTACGACCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACAGGCAGTAGG---CAGGGACTTGAGGAAGATACCCATGCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGTGTCAAAACCATTGGGGAACGTGGTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACCAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTGTGCCAATATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAATAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGATTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCGGTTTGCGCGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCGGATAAGATTTACTTTATGAGTCTTGTAAGCAAGACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTCGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATATCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATATACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGTAGAAGAAGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGCGAGGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Promerops_cafer TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTCCGTTTAAAACTGACTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGAT{CT}GATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATCGAAAATTCAGTAATACTCT{AG}TGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATATAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATACGGCCAACACCTCTCC{AG}GCCACAAGGACATGAAAGAGAGAGAGCTCTA{CT}AGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTCTGTT{CT}CTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAACCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTAAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCGCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCA{CT}TGCACTGTGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGATGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGCGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTGTTGTCTACAAAGTTCAAGTACAGATATGAGGGCAAGATCACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAAAGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGCTTTACTTTATGGGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCGTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAATTCATAGCCGGGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCACTTCAAAATAACATCAGGTCCCCTAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCGGCGGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGAGCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAATAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCC{CT}GGAGACTC{CT}ACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGTTGTGCT Prunella_collaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATGAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAGGATGAA{GT}CAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAACAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGATAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAGCTAATTGTTCGAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGAGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATG{CT}GAAGTGTATTTTCCTAGGAACAGCACCATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTATGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCACCTAAACAGAGGCATAAAGAACCAACAACACAAACAAGCACAGATAAACAACAAAAATTTAATGAAGGAGATCGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTAAACATCCTTGATAATCTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCATAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATTAACACGTTTCTCAGCTG{CT}AGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGGTACGATGCAGCCTTGGTCTGCGCC{CT}TAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAATCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCC{CT}AATTCTGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAG{AC}G{AG}TATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGCGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAA{AG}TACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTAAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCAGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAAAAGCGATGCAAGGGCTGATGAGCACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCCGGGGGGATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGACACTGAATTTGTTCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGACATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGGGACTCCACTCTATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Psarisomus_dalhousiae TAAAGTGCGAACATTTAAAAAAACACCCTCTGATGGCAAACAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAAGAGC---CAGGCACTTGAGAAAGATGCCCATGACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATTTAAAGCAGCTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACTTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACCCCATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACTGAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAACGTGCTCGATTAAACAGAGGTGTAAAGGACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATGCATCTCAGCACCAAGCTGCTTGCAGTCGATTACCCAGTAGACTTCATTAAATCAATTTCTTGCCAAATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGCTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCGTTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGCCGACCAAGGCA{AG}CATCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTGAGAGCACAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCTTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCGGTCACCGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTGTCAGGATTGCCACTCTCAGTTGATGACTACCCAATAGACACAATTGCAAAGAGGTTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAGTGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGCGAGAAGCATGGATGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCAATAGTACATGGGAATGAAAGTAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCATGAATCGGTTGATGAGCTCCG{CT}GACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTTTATAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTATTTCGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAATTTACTTTATGAGTCTTGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTCCATAGCCGGGGAAAAAGTGTGAGCGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAAAGATGATACTATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCCCTGGGCAGCCCAGCTGTGACTTGCACAATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAGTTTGTCCTTGTTGGTGGCTATCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGATGATAGGAAGATAGAGATTATTGAAAGGGTGAGCCCAGAGTGGACAGCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATCTGGGCAAAGGATCTGTATTGCTGGGCATCCCAGGGTCCAACAAGCAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAATGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTACTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAGACAGGCTACTGGATCACCTGCTCCTCC Ptilonorhynchus_violaceus TAAATTGCGATCATTTGAAAAAACAC{CT}CTCTGATGACAGCCAGCACA{CT}AGACAAAGATCAAGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAAAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCTTTTAGAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAA{CT}AGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTTTGCCGTACTACCAGCCGAGGAGTCAAGAGAAGAAGCCAGCCCCCGAGTGTGCAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGACTAAACAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCTATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCTTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATACGGCAAACACCTCTCCAGCCAC---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGACTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGAAAGGGAGGGGATCCGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCACGCCCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTACCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTTTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACAGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCATATGGGAATGAAAGCAA{CG}AGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCCGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTC{AG}ACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCC{AG}GTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTCTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCCACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTACTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTGATGTAGTTCATAGCCGGGGGAAAAGTATGAGTGTCCTGTTTGGAGGAAGATCATATACTCCTCTCGCACAAAGAACCACTGAAAAATGGAACAGCGTGGTTGACTGTTTGCCATCTGTGTTTCTCATCGATTTTGAGTTTGGATGCAGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCAGCTGTGAGCTGCACCATCCTGCCTGGG{AG}GGATATCAGTGTCAAGTGCTATCGTGACTCAGATCAGTGATACTGAATTTGTCCTGGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTTTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGA{AG}CAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCCAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACAGGCTACTGGATCACCTGCTCTGCC Ptilorrhoa_caerulescens TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAAAAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTTGCAGGCAATAAG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAACCCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATCGAAAAATCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAA{CT}GTGGCAAACGTGTCAAAACCACTGGGGAACGTGCCCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCACGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAGATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGTCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAATCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTGAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCTCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTAGAGGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTCAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTATTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTC{CT}AAAGACTCGTGTTACCTTCCCCCTCTCCGGTACCCTGCTGTTTGCACACTCAGAAGCGCTGCAAAGGCTAATGAGTACCAGTATATCATCCACGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCAATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCCTAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCC{AG}GAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGATTCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGA{AG}GAGTTTTGTTTTAGTGCTGAAGCCAATGGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACTGGCTACTGGATCACCTGCTCTGCT Pycnonotus_barbatus CAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGACTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCGGTAC{CT}AAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGAACTTGAGGAAGACGCCCATGCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGGAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTCCATGGACCAGTAGATGATGAAACTCTGTCACTTTTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGAT{CG}TTATTGCTAAGGTTTTCAAGATTGATCTGCGAGGGGATGTCGATACTATCCATCCCACT{AC}GATTTTGTCACAACTGCTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCACTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGGACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTACTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCGCTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCGGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAGAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTCTCCTTCACAGTCATGAACATTTCTATAGCATGTGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGAGAGGCATCCTGAGAACATTTA{AG}ATTTGTCTTCAGGGGTACAGGATATGATGAAAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCCACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCGTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTGCTTGATATAAAGCCGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTAGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCA{CT}AGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACACTTGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTTCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTAGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTGTGGAAGATGATAAGATAGAGATTGTTGAAAGT{AG}TGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGCAAAGGATCTGTTTTGCTGGGCCTTCCAGGGGCCAACAAACAAGTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGACCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGAAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCAGAAGCCAGTAGCTTTGATGCTGACAATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Regulus_calendula TAAATTACGATCATTTGAAAAAACACACTCTGATGACAGCCAGAACATAAACAAA{GT}ATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGGAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAGGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCC{CT}GATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCCAGCTGTGACGTGTGCCATACTACCAGAC{AG}AGGAGTCAAGAGAAAAAGTCAGCCCCC{AG}AGAGTACTACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGGGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTAAACACCAAGCTGCTTGCAGTAGATTACCCAGTAGATTTCATTAAATCTGTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGATTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTCCTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTC{AG}ATAACCTGATTAT{AT}AGATGCCCTGTAAAAGAGTGTGATGAGGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACC{AG}AGGCAGCATCTCCTGTCTTTGAC{AC}AGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGACAAATCTTCCAGCCTTTGCATGCTCTTCGCACTGCCGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCAATAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACTGTCATGAACATTTCTATAGCACATGGGAGTGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAAGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTCAAAATCTGGAGCGATATGAAATGTGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTCTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAAATTGGTGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAAAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAATATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGATGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGAAGAATGAGCTCAAGATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTGTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGGTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGTGGCCACTCACTTCAGAATAACACCAGACCCTCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGC{AG}AGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTATCACTCAGACAACCAGAAACGGCTGGCCTGTAACACCATCGTTCTGGAAGATGGTAAGATAGAGATTG{CT}TGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATAGCAGAATGTGGTTTGGCTGTGATATAGG{CT}AAAGGGTC{GT}GTTTTGCTGGGCATTCCAGGGGCCAACAAGCAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGAAAGAAGAATTAATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGG{AG}GACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Remiz_pendulinus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGACAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTACT------------------------------------------------------------TCAAAGAAAGAATTTATCCTGCATCAAGATGAAGCAGTGCCTAGAGGAGAAAAG---------------AGGGAGTTAATGGGCAACAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAACTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTTCAAAAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGCCTTCTGAGAAAGAAAGAAAAGACAGCAACTTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATGTTCTATGTGAAGTATATTTTCCTAGGAGCAGCACAATGGAGTGGCAACCCCATTTCCCAAACTGTGATGTGTGCCACATTACCAGACAAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAGCATGGCAAACATATCAAAACCACCAGGGAACGTGCTCGGCTAATCAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAGTGAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAATAGACTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGAGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGGGAGCTCTATAACTACATCAATAAAGGTGGCCGACCAAGGCAACACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACATCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGAACTGGACTTCACCCGGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGTTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGGTCTTCCAGCCTCTGCATGCCCTTCGCACTGCAGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATCGATGGACTATCAGGACTGGCTCTCTCAATTGATGATTACCCAGTCAACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCCAAAAACCTGGACGACTATCTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGGATGGGTGATGTCAGTGA{AG}AAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGCTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGCTTTGCCTTTAGGGGTACAGGATACGACGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTCTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCGACAGAATTCTACAAGATTTTCCTGATGGAGGTTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGACGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAATGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCCCATGTTCCTGAAATAATTGAACGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCC{CT}CCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTATTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCACTTTGCGTGCTCAGAAGGGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTGCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGATGATACTGTTTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTTTACAAGCTAAAAATTGATCTGCCCCTAGGCAGCCCATCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTATCACTCAGACAGCCAGAAACGGCTGGCATGTAACACCATTGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGTCAGCAAACAAATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGGGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATATGTACAATGAAGATGATGAAGGAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Schoenicola_brevirostris TAAATTGCGATCAGTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGTCTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCGAAGGTTTTCAAGATTGATGTGCGAGGGGA{CT}{CG}TCGATACTGTCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAA{CT}AGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGG{AG}GAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAA{AT}TTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTAGCAGATCCAGTGGAAACAACATG{CT}AGACACTTGTTCTGCAGAACTTGCATCCTTA{AG}ATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCGGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGACCTTGCATGGAAGATATGGCCAACACCTCTC{CT}GGCCACAAGGAGATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGCGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGC{GT}GAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACCAACACAGAGGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGGTATGATGCAGCCTTGGTTTGTGCTTTAAAAGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCGGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCT{AG}CTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAAC{AC}AGGAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCA{AG}TTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCG{CT}CAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAA{CT}TCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTC{AG}TGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGTAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAA{AG}CATGACTGTTCTGTTTGGAGGGAGGACTTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCATTTGCCAGGGATGATACAATCTACAT{CT}TTGGGAGGCCACTCACTTCAAAATAAC{AG}CCAGGTCCCCCAACTTGTTCAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCT{AG}CAC{AC}ATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACG{CG}CTGGCATGTAACACCATAATTCTGGAAGACAGTAAGATAGAGATTGTTGAACGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAAGTAGAAGAGGACAAGGAAGAAGAATTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Sitta_carolinensis TAAATTGCGATCATTTGAAAAAACACCCTCGGATGACAGCCAGCACATAAACAAAGATCAGACAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAGGAATTCATCCTGCACACAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAGCAGGGAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGGCAAC---AGAGCTCATCTGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTGCATTTAAAACTGATTGCCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCGACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACCATCCATCCCACCCGGTTCTGTCACAACTGTTGGAGTATTATACAGAGAAAATTCAGTAATACTCTCTGTGAGGTATACTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGGTGTGTGCCATACTACCAGCCAAGGAGTCAAGAGAAAAAGCCAGCTCCCAGGTGCACATCGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGCTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTACATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCATAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACGCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGGAAATATGGCCAACACGTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGGCCGAGGCAGCACCTGCTGTCTTTGACAAGGAGAGCTCAGAAACACCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCCAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGCCTGGCCATCCGAATCAACACGTTCCTCAGCTGTAGTCAGTACCATAAAATGTACAGAACAGTGAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTCCGCACTGCTGAGAAAGCCCTCCTACCTGGTTATCACCCATTCGAGTGGAAACCCCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGCTACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGAGGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGGATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACGGTCATGAACATTTCTGTAGCACATGGCAGTGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAGACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCGATGAAAAGCAGCGAGCTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCGTCTTCAGGGGGACAGGATATGATGAGAAACTGGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTCGGAGGCATCCCAGAACCTGGTCTTCCACTCCATCACCAGGAGCCATGCTGAGAATCTGGAACGATACGAGATATGGAGGTCGAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTCATTGAGACTGTCCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCGACAGAGTTCTACAGGATCTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCCGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGCTCCTCGTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCCCAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATCACAAATTACTTCCATAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTCAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCCTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCCGAGGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAATTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCGCTTGAAAATAACACCAGGTCCCCCAACTTGTTCAAGCTAAAAATCGACCTGCCCCTGGGCAGCCCGGCTGTGAGCTGCACCATCCTGCCAGGGGGGATATCAGTGTCGAGTGCCATAGTGACCCAGATCAGCGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGTCCTGCAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTAGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGCAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAACCCCAGACGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAGCTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACCCCTTTTGAAGATTCAGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Smithornis_rufolateralis TAAAGTGCGAACATTTGAAAAAACACCCTCTGATGGCAAGCAGCACATAAACAAAGATCAGGCAGATGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCAATAGGCAACAAG---CAGGCACTTGAGAAAGTTACTGATGACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGAACTTATTGTTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCCTTGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCAACCTCACTCCTCAAACTGTGATGTATGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCACCAAGCGTACAACATGGAAAACGTGTGAAGACCATTGTTGAACGTGCTCGATTAAACAGAGGTGTAAATAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAACATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAAAACTTGCATCCTTAAATGTATCAAAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACTCCAGTTAAGTCATTCCTGAACATCCTTGATAATCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTACATGAAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGATATATAGCCACATAAATAAAGGTGGCCGACCAAGGCAACATCTTCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTAGCAATCCGAGTCAATACATTTCTCAGCTGTAGTCAGTACCATAAGATGTATAGGACCGTAAAAGCTGTCACTGGGAGACAGATCTTTCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAGTTGATGACTACCCAATAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAACAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAG{CT}TGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTATAGGATTTTCCAGATGGAGATTGGTGAGCTTTACAAGAATCCTGA{CT}GTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTGGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATA{CT}GAAGGCAAGATTACAAACTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACGGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCC{CT}CTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCAATGCAAAATCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTCTCTGATAAGATTTATTTAATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCGAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGCGGGATATCAGTGTCAAGTGCTATAGTGTCTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTATATTGTTGGGCATTCCAGGGGCAAACAAACAGTTAATCTCAGATGCAAACTACTTCTACGTTTTGAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTG{AG}CAACACAAATGTGCAGTCAGACATCAACTGAAGACCCT{CG}{GT}AGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Sphenoeacus_afer TAAGTTGCGATCATTTGAAAAAACATCCTCCGATGACAGCCAGCACATAAAGAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACAGGCAATAGG---CAGGGACCTGAGGAAGATGCCCATGCCATGGAAACACAAGAC{AC}AT---AGAGCTCATCAGAAC{AC}ATCTGAAGCAACTGTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGACAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTCGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCTCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCTAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTGCATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTCGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGCAGGGGATCTGGACTTCACCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTGCGCACTGCTGAGAAAGCTCTCCTTCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCAGTAACACTGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCCTGGAAGGCATGAAAGCAAAAAGCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAATAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAGCTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAACCTGCCGTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGAAAGGGCTGATGAGTACCAGTATGTCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTTCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCAGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTTCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATATACTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTAACCTGCACCATCCTGCCAGGAGGGATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAGTTGCAGTCAGACTTCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCGGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Stenostira_scita TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAAATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATCCATCCTGCATATAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ACGCAGTTAATGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCCTTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAA{CT}TCTATGCCTTTTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTGGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATATTAGCAGAGGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGCAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCTGCTAAACAGAAGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCAGTAGATTTCATTCAATCCATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTAC{AG}GATCTGGTGACCCCAGTGAAATCTTTCCTGCACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCAGGCCACAAAGAGATGAAAGATGGAGATCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTAGACGACTATTTGAATGGCCCCTTCACTGTGGTGGTAAAAGAGTCCTGTGATGGAATGGGAGATGTC{AG}GTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGTAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCGTCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGG{CG}AATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAGCTTTACAAGAACCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTGGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGAGCTCTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGACCTGCTGTGCCAGTATAGCTACAATTCACAACGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACT{CG}TTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCTACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAACTGAAACCTACCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGCAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTACGTTTCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACGGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGGTGATACAATCTATATCTTGGGAGGTCACTCACTTCAAAATAACACTAGGTCCCCCAACTTGTACCAGCTAAAAATTGATCTGCCCCTGGGCAGCCCATCTGTGACTTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTT{AG}TTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACTGTAGTTCTGGAAGACAGTAAGATAGAGATTCTTGAGAGTGTGAGCCCAGAGTGGACACCAGA{GT}ATTAAACACGGCAGAGTGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATTACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Sturnus_vulgaris TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATTCATTCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCAACAAGCAATAGG---CAGGCACTTGAGGAAGATGCCCATGCTGTGAAAATACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACAATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGG{AC}AACCCCATTCCCCAAACTGTGA{CT}GTGTGCCATACTACCAGAA{AG}AGGAGTCAAGAGAAAAAGCCAGCCTCCAA{AG}TGTACAACGTGGCAAACGTGCCAAAACCACCAGGGAACATGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTGGCGGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCT{CT}GATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAGGGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAGGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAACACATGGGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGGTATGAAATATGGAGGTCCAACCCCTACCACGAGTCTGTGGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTCCCCGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAACGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGCTGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAGGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAATTTACTTTATGAGTCTGGTAAACAAAGCTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCACACAATTAATGTAGTTCATAGCC{AG}GGGAAAAAGCGTGACTGTTCT{CG}TTTGGAGGGAGGTCATATACTCCTCTTGCTCAGAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACCTGCTTCCAGAGCTTCAAGATGGACTTTC{CT}TTCCACGTTTCAATTGCCA{AG}AGGTGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACATTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCGGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAGGGGTCTGTTCTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAATGGCCAGAAGAGGACAAGGAAGAAGAATTGATAACACAGACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Sylvia_nana TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACCTAAACAAGGATCAGGCAGAAGAGGCAGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGA{AG}AAG---------------ATAGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCAATGAAAACACAAGAAAAT---AGAGCTCATCAGAACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTAT{CT}GCCAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAATAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAGGATATCCACCTCAGCACCAAACTTCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAGGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCT{AG}GCTTTGAGAGCCAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGTTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGT{AC}TCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCTGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTT{AG}TGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCTACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATTTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCCCAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCTTGCCCCACTGGGGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCACCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGCCCTCAGAAGCGATGCAAACGCTGACGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCA{AG}TGCATTGAGAAAGACCTGGGTGGAGATATCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGATGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTCGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAGTTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGAGAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGACCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGGTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGACGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Sylvietta_denti TAAATTGCGATCATTTGAAAAAACACCCTCC{AG}ATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCAAAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAACGGGCAACAGG---CAGGGAGTTGTGGAAGAT{GT}CCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGAGGAAACTCTGTGGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGA{CT}CTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTA{AG}TACTCCATGTGAAGTATATTTTCCCAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAA{AG}AGAAAAAACCAGTCCCC{AG}AGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAAC{AC}AA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACCTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATCGAGAGCTCTA{CT}AGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACCTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCAGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACCATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATCTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTCAATGAGCTCCGTGACAGAGTGAAGGGTGTTTC{AC}GCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGCGGTGGCAGCTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCT{GT}TATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTCGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCAATGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGACTACCAGTATATCATCCATGGTGGCAAAACACCTAACAATGAACTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTTCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGG{AG}CATACAATTAATGTAGTTCATAGCCGGGGAAAAAGTATGAGTGTTCTGTTTGGAGGGAGGACGTAT{AG}CTCCTCTTGCACAAAGAACCACTGAAAAATGGAATAGCGTGGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATTATTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAGCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAA{AG}TTTGCAGTCAGACATCAAGTGAAGATCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGAC{AG}ATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Telophorus_dohertyi TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACAAGACAGT---AGAGCTCATCAGAATAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCTCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAGAAGAGGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTACTGCCCGTCCTGCTGGTATCCTTGCTTTCCTACTGATTTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGGTGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATAAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTATCACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCGCTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCC{GT}TAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATACTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGC{AG}TCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTTTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCCCTTAGCACGCTCAGAAGCCATGAAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATAAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCCAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTTTTTGGAGGGAGGTCGTATACGCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGCTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACCTGTACAAGCTAAAAATCGATCTGCCCCTGGGCATCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGAGCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCCGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACACTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Thamnophilus_nigrocinereus TAAAGTGCGATCATTTGAAAAAACACCCTCGGGTGACAGGCAGCGCATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCACACAGATGAAGAAGTGCCAAGAAGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCCCTTGAGAAAGAGGCCCATGAC---------------AAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATTTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTAGGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCTCACTCCCCAAACTGTGATGTATGCCATACTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAGCATGGCAAACATGCGAAGACCGTTGTGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATTGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGGACTTGCATCCTTAAATGTATCAAGCTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACACCAGTAAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCTTGGAAAATATGGCCAACACATCTCCAGCCACAAAGAGAAGAAAGACAGAGAGCTCTACAGCCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAGGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTGAGAGCGAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTACAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTAGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAGGAGTCTTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCATTCACAGTTATGAACATCGCTATTGCAAATGGGAATGAAAGCCAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTATGCCTTATGCTGGCTGATGAGTCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTATTGCTTGAAATAGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGGTATGATGAAAAACTTGTACGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACAAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACAGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTTGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCATGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAACATAAAGTCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATTGTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTGCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTACACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACGTAGTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATGTTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAAATCGGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAGGGATCTGTATTGCTGGGGATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCATACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACAAGGAAGAAGAGTTGACAACACAAATCTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAATTTTGGTTTGGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTATAATGAGGATGATGAAGACGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Thamnornis_chloropetoides TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGTCAATAGG---C{AC}GGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATGAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATAATGAAACTCTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTTCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTTTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCTCGAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGGAAAAAACAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATTAACAACAAAAATTTAATGAAAGAGATAGTCAATTGCAAGGACATACATCTCAGCACTAAGCTGCTTGCAATTGATTACCCAATAGATTTCATTAAATCCATCTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTCAAGGAATGTGATGAAGAGACCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGA{CT}GGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAGGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGACTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGA{CT}CATGAAACTCTGACAGCAATTCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAGAACAGTGAACTTCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAAACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCAATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCTTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTTTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAAATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACCGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGTGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACGCCTAACAACGAACTTTCTGATAAGGTTTACTTCATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTCGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAGTTGCCAGGGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCTACCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACACCCAGAAACGGCTGGTATGTAACACCATAGTTCTGGAAGATAGTAATATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGA{AG}{CG}AGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGATGCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGGTGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Tregellasia_leucops TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGTACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAGGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTGTGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCACCGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGACTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAAGAGGAAATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAG{AG}TGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAAC{AG}CTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTTTATTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTTTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCGTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAGCTTGTACAAGCTGAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGAGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Troglodytes_aedon TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCACACAAGGAATTCATCCTGCAA---GATGAAGCAGTGCCAAGAGGAGAAAAG---------------{AG}TG{AG}AGTTAACAGGCAACAGG---CAGGGGCTAGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGGACAATCTGAAGCAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAAC{CT}TCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCTATGTGAAGTATATTTTCCCAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTAATGTGTGCCATACTACTAGACGAGGAGTCAAGAGAAAAAGCCAGCCTGCAA{AG}TGTTCAACGTGGCAAACGTGTCAAAACCACTGTG------------TTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAA{CT}AAA{AC}ATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATTTTGCATGGAAAATATGGTCAACACCTCTCTGGTCACAAGGAGA{CG}AAAAGATGGAGAGCTCTATAGCTACATAAACAAAGGTGGCCGACCGAGGCTGCACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAA{AG}GCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCGGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGGACAGTAAAAGCTGTCACGGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACC{AG}GGTTATCACCCGTTTGAATGGAAACCTCCCCTGAAAAATGTATCCACTAACAC{CT}GAAGTGGGAATTATAGATGGACTATCAGGACTGCCGCACTCAATCGATGATTACCCAGTAGAAACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAA{CT}CTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCCGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCC{CT}CTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGCACAGGATATGATGAGAAACTTCTGCGGGAAGTGGAAGGGCTGGAGGCCGCAGGTTCCACCTACATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTGAGCAAAAGCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTTGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACGATTAATGTAGTTCATAGCCGAGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATGTTGAGTTTGGGTGCTGTACATCGTATATACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAACTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTG{AG}CATGCAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTCGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGAAAAGG{GT}TCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATTACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGAT{GT}ATGCTGATACTTACAATGAAGATGACGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Turdus_falklandii TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATTCTGCATGAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACAGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGACACTATCCA{CT}CCCACCCACTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCTGTGTGAAGTGTATTTTCCTAGGAACAGCACAATGCAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACCGGGGAACATGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACCGGATTTCATTAAATCCATGTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTAACCCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGCAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTTCTGTCCCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAGGGGAAGGGATCTGGACTTCACCCCGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCACAAAATGTACAGAACGGTAAAAGCTGTCACAGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAATCCTCCCCTGAAA{AT}ATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACTTGGATGACTATTTGACTGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAACAAGAGAATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGA{AG}ATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCCTGCACTCCATAACCCGGAGCCATGCTGAAAACCTGGCGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCCGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTCCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTA{CT}AGGATCTTCCAGATGGAGATCGGTGAGCTTTACAAGAATCCTGACGTGTCTAAGGAAGAGAGGAAGAGGTGGCAGCTGACTCTGGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACCAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTCTGCACGCTCAGAAGCGATGCCAGGGCTGATGAGTACCAGTACATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAACAACATTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTTTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCCCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTGGTGGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATCAAACACTGCAGAACATGGTTCGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTAGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAAGACAAGGCAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Tyrannus_tyrannus TAAAGTGCGATCATTTGAAAAAACA---TCTGATGACAGGCAGCACATAAGCAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ATGGACTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCATGACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCCACAAGAGAACTCATCCAGTGCATGGGCCTGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGATCTTAT{AC}GCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTTGATACTGTCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAGCCTCACTCCCCAAACTGTGA{CT}GTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGACACCAAGTGTACAGCATGGCAAACGTGTGAAGACCACTGTGGAACGTGCTCGACTAAACAGAGGAGTAAAGAACCAG------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCGACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTATGTGAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCCGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAACGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTTAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAACGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTTTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCAC{AG}ATTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAATAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGTTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCAT{AG}CTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAACCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCTATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCGCCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACACAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAGTAGCAAGAAAATGACATTCCA{AG}TGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGAACAAAGAACCACTGAAAAGTGGAACAGCGTAGTGGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACGATCTACATTTTAGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAAAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGAGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGCTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTATAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Vanga_curvirostris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCAGAAGGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGGGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGACAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGGGGTGTAAAGAACAAA------------------------------AATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTACCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGAAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCCAAA{AG}GCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCAATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTCCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTCATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTGTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAAACTCTTGTTACCTTCCCCCTCTCCGCTACCCTGCGGTTTGCACGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCAAGGGAAAAAGCATCAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGTACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATATCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTCTCAGTTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACGCAGATCACTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAACGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGCCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Vireo_philadelphia TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGACCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAAAGGGCAATAGG---C{AG}GGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGTATCTGTGGAATTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCA{CT}GGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATAC{GT}ATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCTGTACTACCAGAAGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTG{CT}GATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGTTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATACGATGAGAAACTTGTGCGGCAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTT{AG}GAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCA{GT}TGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCAT{AT}GGGGCCTGGGCAAGTGAAGGGAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATGTGAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCCCTTTGCACACTCAGAAGCGAT---------GATGTGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCTACTCACTTCAAAATAACACCAGGTC{CG}CCCAACTTATACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGG{CT}TGGTGTGTAACACCATAGTTCTGGATGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCGCTAATGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGC{AC}AATCACTTTGATGTTGACGATGCTGACATTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Xanthomixis_zosterops TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGATGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAATTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAAATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTG{CG}AGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAATGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGCTGTAAAGAACCAA------------GCACAGATAAACAACAAAAACTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAACCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACATCATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTAATGGGTAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCATTCCTGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTCAAGGAATGTGATGAAGAGACCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGAGGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACACCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAGGTGGGAATTATAGATGGGCTGTCAGGACTGCCACTCTCAATTGATGATTATCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAGGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAACCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTTTTATCGACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAACGGCTGATGA{AG}TACCAGTATATCATACATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACGTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTCGGATGCTGTACATCGTACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGGGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAG{AG}TCCCCCAACTTGTACAAGCTAAAAATTGAT{CT}TGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCTTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAG{AG}TCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACACCCAGAAACGGCTGGCATGTAACACCATAATTCTGGAAGA{CT}AGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACAAGGAAGAAGAATCA{AG}TAACACAAATTTGCAGTCAGACATCAAGTGAAGATGCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGA{GT}GATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Yuhina_nigrimenta TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAGAGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCACACCAAGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGGAGCAGCTGTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATAGATGTCCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAACACTCCATGTGAAGTATATTTTCCTAGGAACAACCCCATTGTGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCCCCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GTGCAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATATTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAA{CT}CTGAGTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACAGCCAACACCTCTCTGGTCACAAGGAGACGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCCGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTAATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTTCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATTTCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAAATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTATAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGCAAAACACCTAACAATGAACTTTCTGATAAGATGTACTTTATGAG{CT}CTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGCAGGACATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGATTGTTTGCCATCTGT{GT}TTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAGTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTCGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGACGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTATATTTTGAGATGCAAAGGAGTAGATGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTC{AC}GAGGAATTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Zosterops_senegalensis TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCATGCCATGAAAACACAAGACAAT---AGAGCTCATCA{AG}AACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATAGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCTCCAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCTGCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGTTCAGCTAAACAAAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTATCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAA{CT}TTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTAAGTATAAGATGCCCCGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACAGCCAACACCTCTCTAGTCACAAGGAGACGAAAGAGGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCA{CT}CTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGACGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATATCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTAATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATTTCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTCCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAAC{AG}GAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGT{AG}TCTAAAGAGGAGAAGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAGGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAAATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTATAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTATTTGCACGCTCAGGAGCGATGCAGGGGCTGATGAGTACCAGTATGTCATCCACGGGGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCCTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGCAGGACATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGATTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTGTCACTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTCGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACG{CG}CTGGCATGTCACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGATGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCC{AG}TTTGAAGATTCAGAGGAATTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC ; END; BEGIN SETS; CHARSET RAG1 (CHARACTERS = Passerine_RAG) = 1-2965; CHARSET RAG2_3rdpos (CHARACTERS = Passerine_RAG) = 2989 2992 2995 2998 3001 3004 3007 3010 3013 3016 3019 3022 3025 3028 3031 3034 3037 3040 3043 3046 3049 3052 3055 3058 3061 3064 3067 3070 3073 3076 3079 3082 3085 3088 3091 3094 3097 3100 3103 3106 3109 3112 3115 3118 3121 3124 3127 3130 3133 3136 3139 3142 3145 3148 3151 3154 3157 3160 3163 3166 3169 3172 3175 3178 3181 3184 3187 3190 3193 3196 3199 3202 3205 3208 3211 3214 3217 3220 3223 3226 3229 3232 3235 3238 3241 3244 3247 3250 3253 3256 3259 3262 3265 3268 3271 3274 3277 3280 3283 3286 3289 3292 3295 3298 3301 3304 3307 3310 3313 3316 3319 3322 3325 3328 3331 3334 3337 3340 3343 3346 3349 3352 3355 3358 3361 3364 3367 3370 3373 3376 3379 3382 3385 3388 3391 3394 3397 3400 3403 3406 3409 3412 3415 3418 3421 3424 3427 3430 3433 3436 3439 3442 2968 2971 2974 2977 3445 3448 3451 3454 3457 3460 3463 3466 3469 2980 2983 2986 3472 3475 3478 3481 3484 3487 3490 3493 3496 3499 3502 3505 3544 3508 3511 3514 3547 3550 3553 3517 3520 3523 3556 3559 3562 3526 3529 3532 3565 3568 3571 3574 3535 3538 3541 3577 3580 3583 3586 3589 3592 3595 3598 3601 3604 3607 3610 3613 3616 3619 3622 3625 3628 3631 3634 3637 3640 3643 3646 3649 3652 3655 3658 3661 3664 3667 3670 3673 4099 4102 4105 4108 4111 4114 4117 3676 3679 3682 3685 3688 3691 3694 3697 3700 3703 3706 3709 3712 3715 3718 3721 3724 3727 3730 3733 3736 3739 3742 3745 3748 3751 3754 3757 3760 3763 3766 3769 3772 3775 3778 3781 3784 3787 3790 3793 3796 3799 3802 3805 3808 3811 3814 3817 3820 3823 3826 3829 3832 3835 3838 3841 3844 3847 3850 3853 3856 3859 3862 3865 3868 3871 3874 3877 3880 3883 3886 3889 3892 3895 3898 3901 3904 3907 3910 3913 3916 3919 3922 3925 3928 3931 3934 3937 3940 3943 3946 3949 3952 3955 3958 3961 3964 3967 3970 3973 3976 3979 3982 3985 3988 3991 3994 3997 4000 4003 4006 4009 4012 4015 4018 4021 4024 4027 4030 4033 4036 4039 4042 4045 4048 4051 4054 4057 4060 4063 4066 4069 4072 4075 4078 4081 4084 4087 4090 4093 4096; CHARSET RAG1_2ndpos (CHARACTERS = Passerine_RAG) = 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69 72 75 78 81 84 87 90 93 96 99 102 105 108 111 114 117 120 123 126 129 132 135 138 141 144 147 150 153 156 159 162 165 168 171 174 177 180 183 186 189 192 195 198 201 204 207 210 213 216 219 222 225 228 231 234 237 240 243 246 249 252 255 258 261 264 267 270 273 276 279 282 285 288 291 294 297 300 303 306 309 312 315 318 321 324 327 330 333 336 339 342 345 348 351 354 357 360 363 366 369 372 375 378 381 384 387 390 393 396 399 402 405 408 411 414 417 420 423 426 429 432 435 438 441 531 444 447 450 534 537 540 453 543 456 459 546 549 462 552 465 468 471 555 558 561 474 564 477 480 567 570 483 573 486 576 489 492 579 495 498 582 501 585 504 507 588 510 591 513 516 594 519 522 597 525 528 600 603 606 609 612 615 618 621 624 627 630 633 636 639 642 645 648 651 654 657 660 663 666 669 672 675 1086 1089 1092 1095 1098 1101 1104 1107 1110 1113 678 681 684 687 690 1116 1119 1122 1125 1128 693 696 699 1131 1134 702 1137 705 708 711 714 717 1140 1143 1146 1149 1152 720 723 726 1155 1158 1161 1164 729 732 735 738 1167 1170 741 1173 744 747 750 1176 1179 1182 1185 753 756 759 1188 1191 1194 1197 1200 1203 1206 1209 1212 1215 1218 1221 1224 1227 1230 762 765 1233 1236 1239 768 771 774 1242 777 1245 780 1248 1251 1254 783 786 789 1257 1260 792 795 798 801 804 807 810 813 816 819 822 825 828 1263 1266 1269 1272 1275 1278 1281 1284 1287 1290 1293 1296 1299 1302 1305 1308 1311 1314 831 834 837 840 843 846 849 1317 1320 1323 852 855 858 1326 1329 1332 861 864 1335 867 1338 870 873 876 879 1341 1344 1347 1350 1353 1356 882 885 888 1359 891 1362 894 1365 1368 1371 897 900 903 1374 1377 906 909 1380 1383 1386 912 915 918 1389 1392 921 924 1395 1398 1401 927 930 933 1404 936 939 942 1407 945 1410 948 951 1413 1416 1419 954 957 960 1422 1425 1428 963 966 1431 969 972 975 1434 1437 1440 978 1443 981 1446 1449 984 987 990 993 996 999 1002 1005 1008 1011 1014 1017 1020 1023 1026 1029 1032 1035 1038 1041 1452 1455 1458 1461 1464 1467 1470 1473 1476 1479 1482 1485 1488 1491 1494 1497 1500 1503 1506 1509 1512 1515 1518 1521 1524 1527 1530 1044 1047 1050 1053 1056 1059 1062 1065 1068 1071 1074 1077 1080 1083 1533 1536 1539 1542 1545 1641 1548 1644 1551 1554 1557 1647 1650 1653 1560 1656 1563 1566 1659 1662 1569 1665 1572 1575 1578 1668 1671 1674 1581 1677 1584 1587 1680 1683 1590 1593 1596 1686 1689 1692 1599 1602 1605 1695 1698 1701 1608 1611 1614 1617 1620 1623 1626 1704 1707 1629 1710 1632 1635 1638 1713 1716 1719 1722 1725 1728 1731 1734 1737 1740 1743 1746 1749 1752 1755 1758 1761 1764 1767 1770 1773 1776 1779 1782 1785 1788 1791 1794 1797 1800 1803 1806 1809 1812 1815 1818 1821 1824 1827 1830 1833 1836 1839 1842 1845 1848 1851 1854 1857 1860 1863 1866 2196 1869 1872 1875 2199 2202 1878 1881 1884 2205 2208 2211 1887 1890 2214 2217 1893 1896 1899 2220 2223 2226 1902 2229 1905 1908 1911 2232 2235 2238 1914 1917 1920 2241 2244 2247 1923 1926 2250 2253 2256 1929 1932 1935 2259 2262 2265 1938 1941 1944 2268 2271 2274 1947 1950 1953 2277 2280 2283 1956 1959 2286 1962 1965 1968 1971 1974 1977 1980 1983 1986 1989 1992 1995 1998 2001 2289 2292 2295 2298 2301 2304 2307 2310 2313 2316 2319 2322 2325 2328 2331 2334 2337 2340 2343 2004 2007 2010 2013 2016 2019 2022 2025 2028 2031 2034 2037 2040 2043 2346 2349 2352 2355 2046 2358 2361 2364 2367 2370 2373 2376 2379 2751 2382 2385 2388 2391 2394 2397 2400 2403 2406 2409 2412 2415 2418 2421 2424 2427 2430 2433 2436 2439 2442 2049 2052 2055 2058 2061 2064 2067 2070 2073 2076 2079 2082 2085 2088 2091 2094 2097 2100 2103 2106 2109 2112 2115 2445 2448 2451 2454 2457 2460 2463 2466 2469 2472 2118 2121 2124 2127 2475 2478 2130 2481 2754 2484 2487 2133 2136 2139 2142 2145 2148 2151 2154 2157 2160 2163 2166 2169 2172 2175 2490 2493 2496 2499 2502 2505 2508 2511 2514 2517 2520 2523 2526 2529 2532 2535 2538 2541 2544 2178 2181 2184 2187 2190 2193 2547 2550 2553 2757 2556 2559 2562 2760 2565 2568 2763 2571 2574 2766 2577 2580 2769 2583 2586 2772 2589 2592 2775 2595 2598 2778 2601 2604 2607 2781 2610 2613 2616 2619 2622 2784 2625 2628 2631 2634 2787 2637 2640 2643 2790 2793 2796 2799 2802 2805 2808 2646 2811 2649 2652 2655 2658 2661 2664 2667 2670 2673 2676 2679 2682 2685 2688 2691 2694 2697 2700 2703 2706 2709 2712 2715 2718 2721 2724 2727 2730 2733 2736 2739 2742 2745 2748 2814 2817 2820 2823 2826 2829 2832 2835 2838 2841 2844 2847 2850 2853 2856 2859 2862 2865 2868 2871 2874 2877 2880 2883 2886 2889 2892 2895 2898 2901 2904 2907 2910 2913 2916 2919 2922 2925 2928 2931 2934 2937 2940 2943 2946 2949 2952 2955 2958 2961 2964; CHARSET RAG2_2ndpos (CHARACTERS = Passerine_RAG) = 3774 3219 3777 3222 3225 3228 3231 3780 3234 3237 3240 2967 3783 3243 3246 2970 3249 3786 3252 3255 2973 2976 3789 2979 2982 3258 3261 3264 2985 2988 3267 3792 3270 3273 2991 2994 2997 3276 3795 3279 3282 3000 3003 3006 3285 3288 3009 3798 3012 3291 3294 3015 3801 3018 3021 3297 3300 3804 3303 3306 3024 3027 3030 3309 3807 3312 3315 3033 3036 3039 3318 3321 3042 3810 3045 3048 3324 3327 3330 3051 3333 3054 3813 3057 3060 3336 3339 3342 3063 3816 3066 3069 3345 3819 3348 3351 3354 3357 3360 3363 3366 3369 3372 3375 3378 3381 3384 3387 3390 3393 3396 3399 3402 3405 3408 3411 3414 3417 3420 3423 3426 3429 3432 3435 3438 3441 3444 3447 3450 3453 3456 3459 3462 3465 3468 3471 3474 3477 3480 3483 3486 3489 3492 3495 3498 3501 3504 3507 3510 3513 3516 3519 3522 3525 3528 3531 3534 3537 3540 3543 3546 3549 3552 3555 3558 3561 3564 3567 3570 3573 3576 3579 3582 3585 3588 3591 3594 3597 3600 3603 3606 3609 3612 3615 3618 3621 3624 3627 3630 3633 3636 3639 3642 3645 3648 3651 3654 3657 3660 3663 3666 3669 3672 3675 3678 3681 3684 3687 3690 3693 3696 3699 3702 3705 3708 3711 3714 3717 3720 3723 3726 3729 3732 3735 3738 3741 3744 3747 3750 3753 3756 3759 3762 3765 3768 3771 3072 3075 3078 3081 3084 3087 3090 3093 3096 3099 3102 3105 3108 3111 3114 3117 3120 3123 3126 3129 3132 3135 3138 3141 3144 3147 3150 3153 3156 3159 3162 3165 3168 3171 3174 3177 3180 3183 3186 3189 3192 3195 3198 3201 3204 3207 3210 3213 3216 3822 3825 3828 3831 3834 3837 3840 3843 3846 3849 3852 3855 3858 3861 3864 3867 3870 3873 3876 3879 3882 3885 3888 3891 3894 3897 3900 3903 3906 3909 3912 3915 3918 3921 3924 3927 3930 3933 3936 3939 3942 3945 3948 3951 3954 3957 3960 3963 3966 3969 3972 3975 3978 3981 3984 3987 3990 3993 3996 3999 4002 4005 4008 4011 4014 4017 4020 4023 4026 4029 4032 4035 4038 4041 4044 4047 4050 4053 4056 4059 4062 4065 4068 4071 4074 4077 4080 4083 4086 4089 4092 4095 4098 4101 4104 4107 4110 4113 4116; CHARSET RAG1_3rdpos (CHARACTERS = Passerine_RAG) = 1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88 91 94 97 100 103 106 109 112 115 118 121 298 301 124 304 307 310 313 316 319 322 325 328 331 334 337 127 340 343 130 133 346 136 349 352 139 142 355 145 358 361 148 151 364 154 367 157 370 373 160 163 376 166 379 382 385 169 172 175 388 178 391 394 181 184 187 397 400 190 193 403 406 409 196 199 202 205 208 211 214 217 220 223 226 229 232 235 238 241 412 415 418 421 424 427 430 433 436 244 247 250 253 256 439 442 259 445 262 448 451 454 265 268 271 274 457 460 277 463 280 466 283 286 469 472 475 289 292 478 295 481 484 487 490 493 496 499 502 505 508 511 514 517 853 856 520 523 859 862 526 865 529 532 868 871 874 535 538 877 880 541 544 547 550 553 556 559 562 565 883 886 568 571 574 889 892 577 580 895 898 901 583 586 904 589 592 907 910 913 595 598 916 601 919 922 925 928 931 934 937 940 943 946 949 952 604 607 610 613 616 619 622 625 628 631 634 637 640 643 646 649 652 955 958 961 964 967 970 973 976 655 658 661 664 979 982 667 985 670 673 676 988 991 994 997 679 682 1000 685 688 691 1003 1006 1009 694 1012 697 1015 700 703 706 1018 1021 1024 709 1027 712 715 1030 1033 1036 718 721 1039 724 727 1042 1045 1048 730 733 1051 736 1054 1057 739 742 745 1060 1063 748 1066 1069 751 754 757 1072 1075 760 1078 763 766 769 1081 1084 1087 772 1090 775 778 781 1093 1096 1099 784 1102 787 790 793 1105 1108 1111 1114 1117 1120 1123 1126 1129 1132 1135 1138 796 799 802 805 808 811 814 817 820 823 826 829 832 835 1141 1144 1147 1150 1153 1156 1159 838 841 844 847 1162 1165 850 1168 1171 1174 1177 1180 1183 1186 1189 1192 1195 1198 1201 1204 1207 1210 1213 1216 1219 1222 1408 1411 1414 1417 1420 1225 1423 1426 1429 1228 1231 1234 1432 1435 1438 1237 1240 1243 1441 1246 1249 1444 1447 1252 1255 1258 1450 1261 1264 1267 1453 1456 1270 1273 1459 1276 1279 1462 1282 1465 1285 1288 1291 1294 1297 1468 1471 1474 1477 1480 1483 1486 1489 1492 1495 1300 1303 1306 1309 1312 1315 1318 1321 1324 1327 1330 1333 1336 1339 1342 1345 1348 1351 1354 1357 1360 1498 1501 1504 1507 1510 1513 1516 1519 1522 1525 1528 1531 1534 1537 1540 1543 1546 1549 1552 1555 1558 1363 1366 1369 1372 1375 1378 1381 1384 1561 1564 1567 1387 1570 1390 1393 1396 1399 1573 1576 1579 1582 1585 1402 1405 1588 1591 1594 1597 1600 1603 1606 1609 1612 1615 1618 1963 1966 1621 1624 1627 1969 1972 1975 1630 1633 1636 1639 1642 1645 1648 1651 1654 1657 1978 1981 1984 1987 1990 1993 1996 1999 2002 2005 2008 2011 1660 1663 1666 1669 1672 2014 2017 2020 1675 1678 2023 2026 1681 1684 1687 2029 2032 2035 1690 1693 1696 1699 1702 1705 1708 1711 1714 1717 1720 1723 2038 2041 2044 2047 2050 2053 2056 2059 2062 2065 2068 2071 2074 2077 2080 2083 1726 1729 1732 1735 1738 1741 1744 1747 2086 2089 2092 2095 1750 1753 2098 2101 2104 2107 1756 1759 1762 1765 1768 2110 2113 1771 2116 2119 1774 1777 2122 2125 1780 1783 2128 2131 1786 1789 2134 1792 2137 1795 2140 2143 1798 1801 2146 1804 2149 1807 2152 2155 1810 1813 2158 1816 2161 1819 2164 2167 1822 2170 2173 2176 1825 1828 2179 2182 1831 1834 1837 2185 2188 1840 2191 2194 2197 1843 1846 1849 1852 2200 2203 1855 2206 2209 1858 1861 1864 2212 2215 1867 1870 2218 2221 1873 2224 2227 2230 2233 2236 2239 2242 2245 2248 2251 2254 2257 2260 2263 2266 2269 1876 1879 1882 1885 1888 1891 1894 1897 1900 1903 1906 1909 1912 1915 1918 1921 1924 1927 1930 1933 1936 1939 1942 1945 2272 2275 2278 2281 2284 2287 2290 1948 1951 2293 1954 1957 1960 2296 2299 2302 2305 2308 2311 2314 2317 2320 2518 2323 2326 2521 2524 2329 2332 2527 2335 2530 2533 2338 2341 2536 2344 2539 2542 2545 2347 2350 2353 2548 2551 2554 2356 2359 2362 2557 2560 2563 2365 2368 2371 2374 2377 2380 2383 2386 2389 2392 2395 2398 2566 2569 2572 2575 2578 2581 2584 2587 2590 2593 2596 2599 2602 2401 2404 2407 2410 2413 2605 2608 2416 2611 2614 2617 2419 2422 2425 2428 2620 2623 2431 2626 2434 2629 2437 2440 2632 2635 2443 2638 2446 2449 2452 2641 2644 2647 2455 2650 2458 2461 2464 2653 2656 2659 2467 2662 2470 2473 2476 2665 2668 2671 2479 2482 2485 2674 2677 2680 2488 2491 2494 2683 2686 2689 2497 2500 2692 2695 2503 2698 2506 2509 2701 2704 2512 2707 2515 2710 2713 2716 2719 2722 2725 2728 2731 2734 2737 2740 2743 2746 2749 2752 2755 2758 2761 2764 2767 2770 2773 2776 2779 2782 2785 2788 2791 2794 2797 2800 2803 2806 2809 2812 2815 2818 2821 2824 2827 2830 2833 2836 2839 2842 2845 2848 2851 2854 2857 2860 2863 2866 2869 2872 2875 2878 2881 2884 2887 2890 2893 2896 2899 2902 2905 2908 2911 2914 2917 2920 2923 2926 2929 2932 2935 2938 2941 2944 2947 2950 2953 2956 2959 2962 2965; CHARSET RAG2 (CHARACTERS = Passerine_RAG) = 2966-4117; CHARSET RAG1_1stpos (CHARACTERS = Passerine_RAG) = 212 215 218 221 224 227 230 233 236 239 242 245 248 251 254 257 260 263 266 269 272 275 278 281 284 287 290 293 296 299 302 305 308 311 314 317 320 323 326 329 332 335 338 341 344 347 350 353 356 359 362 365 368 371 374 377 380 383 386 389 392 395 398 401 404 407 410 413 416 419 422 425 428 431 434 437 440 443 446 449 452 455 458 461 464 467 470 473 476 479 482 485 488 491 494 497 500 503 506 509 512 515 518 521 524 527 530 533 536 539 542 545 548 551 554 557 560 563 566 569 572 575 578 581 584 587 590 593 596 599 602 605 608 611 614 617 620 623 626 629 632 635 638 641 644 647 650 653 656 659 662 665 668 671 674 677 2 5 8 11 14 17 20 23 26 29 32 35 38 41 44 47 50 53 56 59 62 65 68 71 74 77 80 83 86 89 92 95 98 101 104 107 110 113 116 119 122 125 128 131 134 137 140 143 767 146 149 152 770 680 773 155 776 158 779 782 683 161 686 689 785 788 791 692 695 698 794 797 800 803 701 704 707 710 713 716 719 806 809 812 815 818 821 824 827 722 725 728 731 734 737 830 833 836 740 839 164 842 845 743 746 848 851 167 854 749 857 170 860 863 752 755 866 173 869 872 758 176 761 764 875 878 881 884 179 887 890 182 893 896 185 899 902 188 905 908 911 914 917 920 923 926 929 932 935 938 941 944 947 950 953 956 959 962 965 968 971 974 977 980 983 986 1322 1325 1328 1331 1334 1337 1340 1343 1346 1349 1352 1355 1358 1361 1364 1367 1370 1373 1376 1379 1382 1385 1388 1391 1394 1397 1400 1403 1406 1409 1412 1415 1418 989 992 995 998 1001 1004 1007 1010 1013 1016 1019 1022 1025 1028 1031 1034 1037 1040 1421 1424 1427 1430 1433 1436 1439 1442 1445 1448 1043 1046 1049 1052 1451 1454 1457 1055 1058 1460 191 1463 1466 1469 1472 1061 1064 1067 1070 1073 1076 1079 1475 1478 1481 1484 1082 1085 1487 194 1490 1493 1088 1091 1094 1496 1097 1499 197 1502 1505 1100 1103 1106 1508 1109 1511 1514 1517 1520 1523 1526 1529 1532 1535 1538 1541 1544 1547 1550 1112 1115 1118 1121 1124 1127 1130 1553 1556 1559 1562 1133 1136 1565 200 1568 1571 1574 1139 1142 1145 1148 1151 1577 1580 1154 203 1157 1160 1583 1163 206 1166 1169 209 1172 1175 1877 1178 1181 1184 1187 1190 1193 1196 1199 1202 1205 1208 1211 1214 1217 1220 1223 1226 1229 1232 1235 1586 1589 1592 1595 1598 1601 1604 1607 1610 1613 1616 1619 1622 1625 1628 1631 1634 1637 1640 1643 1646 1649 1652 1655 1658 1661 1664 1667 1670 1673 1238 1241 1244 1247 1250 1253 1256 1259 1262 1265 1268 1271 1274 1277 1676 1679 1682 1685 1688 1280 1283 1286 1691 1694 1697 1289 1292 1700 1295 1880 1298 1301 1304 1703 1706 1709 1712 1715 1718 1721 1724 1727 1730 1733 1736 1739 1742 1745 1748 1751 1754 1757 1760 1763 1307 1310 1313 1316 1319 1766 1769 1772 1883 1775 1886 1778 1889 1892 1781 2432 1784 2435 1895 2438 1787 1790 2441 1793 2444 1898 2447 1796 1799 2450 1802 2453 1901 2456 2459 1805 1808 1811 2462 1814 2465 1904 2468 2471 1817 1820 1823 2474 1826 2477 1907 2480 2483 1829 1832 1835 2486 1838 2489 1910 2492 1841 1844 2495 1847 1913 1850 1853 2498 2501 2504 2507 1856 1859 2510 2513 1862 1865 2516 2519 1868 1871 2522 1916 2525 1874 1919 1922 1925 1928 1931 1934 1937 1940 1943 1946 1949 1952 1955 1958 1961 1964 1967 1970 1973 1976 1979 2528 1982 1985 2531 2534 2537 2540 2543 2546 2549 2552 2555 2558 2561 2564 2567 2570 2573 2576 2579 2582 2585 2588 2591 2594 2597 2600 1988 2603 2606 2609 2612 2615 2618 2621 2624 2627 2630 2633 2636 1991 2639 2642 2645 1994 2648 2651 2654 2657 1997 2660 2663 2666 2000 2669 2672 2675 2678 2681 2684 2687 2003 2690 2693 2696 2006 2009 2012 2699 2702 2705 2708 2711 2714 2717 2720 2723 2726 2729 2732 2735 2738 2741 2744 2747 2750 2753 2756 2759 2762 2765 2768 2771 2774 2777 2780 2783 2786 2789 2792 2795 2798 2015 2801 2804 2807 2810 2813 2816 2819 2822 2018 2825 2828 2831 2834 2837 2021 2840 2843 2846 2849 2852 2855 2858 2861 2864 2024 2867 2870 2873 2876 2027 2879 2882 2885 2030 2888 2891 2894 2033 2897 2900 2903 2906 2909 2912 2915 2918 2921 2924 2927 2930 2933 2936 2939 2942 2945 2948 2951 2954 2957 2960 2963 2036 2039 2042 2045 2048 2051 2054 2057 2060 2063 2066 2069 2072 2075 2078 2081 2084 2087 2090 2093 2096 2099 2102 2105 2108 2111 2114 2117 2120 2123 2126 2129 2132 2135 2138 2141 2144 2147 2150 2153 2156 2159 2162 2165 2168 2171 2174 2177 2180 2183 2186 2189 2192 2195 2198 2201 2204 2207 2210 2213 2216 2219 2222 2225 2228 2231 2234 2237 2240 2243 2246 2249 2252 2255 2258 2261 2264 2267 2270 2273 2276 2279 2282 2285 2288 2291 2294 2297 2300 2303 2306 2309 2312 2315 2318 2321 2324 2327 2330 2333 2336 2339 2342 2345 2348 2351 2354 2357 2360 2363 2366 2369 2372 2375 2378 2381 2384 2387 2390 2393 2396 2399 2402 2405 2408 2411 2414 2417 2420 2423 2426 2429; CHARSET RAG2_1stpos (CHARACTERS = Passerine_RAG) = 3305 3308 3311 3314 3317 3320 3323 3326 3329 3332 3335 3338 3341 3344 3347 3350 3353 3356 3359 3362 3365 3368 3371 3374 3377 3380 3383 3386 3389 3392 3395 3398 3401 3404 3407 3410 3413 3416 3419 3422 3425 3428 3431 3434 3437 3440 3443 3446 3449 3452 3455 3458 3461 3464 3467 3470 3473 3476 3479 3482 3485 3488 3491 3494 3497 3500 3503 3506 3860 3863 3509 3866 3869 3512 3515 3872 3518 3875 3878 3881 3521 3524 3527 3884 3530 3887 3890 3893 3533 3536 3539 3896 3899 3902 3542 3545 3548 3905 3908 3911 3551 3554 3557 3914 3917 3920 3560 3563 3566 3923 3926 3929 3569 3572 3575 3932 3578 3935 3938 3581 3584 3941 3944 3947 3950 3953 3956 3959 3962 3965 3587 3590 3593 3596 3599 3602 3605 3608 3611 3614 3617 3620 3968 3971 3974 3977 3980 3983 3986 3989 3992 3995 3998 4001 4004 4007 4010 3623 3626 3629 3632 3635 3638 3641 4013 4016 4019 3644 3647 4022 4025 3650 3653 3656 4028 4031 4034 4037 3659 3662 4040 3665 3668 4043 4046 3671 4049 3674 3677 4052 4055 3680 3683 3686 3689 3692 3695 4058 4061 3698 3701 3704 4064 4067 3707 3710 4070 4073 3713 3716 4076 4079 3719 3722 4082 4085 4088 3725 3728 4091 3731 3734 4094 4097 4100 3737 3740 4103 3743 3746 4106 4109 4112 3749 3752 4115 3755 3758 3761 3764 3767 3770 3773 3776 3779 3782 3785 3788 3791 3794 3797 3800 3803 3806 3809 3812 3815 3818 3821 3824 3827 3830 3833 3836 3839 3842 3845 3848 3851 3854 3857 2966 2969 2972 2975 2978 2981 2984 2987 2990 2993 2996 2999 3002 3005 3008 3011 3014 3017 3020 3023 3026 3029 3032 3035 3038 3041 3044 3047 3050 3053 3056 3059 3062 3065 3068 3071 3074 3077 3080 3083 3086 3089 3092 3095 3098 3101 3104 3107 3110 3113 3116 3119 3122 3125 3128 3131 3134 3137 3140 3143 3146 3149 3152 3155 3158 3161 3164 3167 3170 3173 3176 3179 3182 3185 3188 3191 3194 3197 3200 3203 3206 3209 3212 3215 3218 3221 3224 3227 3230 3233 3236 3239 3242 3245 3248 3251 3254 3257 3260 3263 3266 3269 3272 3275 3278 3281 3284 3287 3290 3293 3296 3299 3302; END; BEGIN TREES; TITLE Relationships_among_Passerines; LINK TAXA = Taxa1; TRANSLATE 1 Acanthisitta_chloris, 2 Achaetops_pycnopygius, 3 Acrocephalus_newtoni, 4 Aegithalos_iouschensis, 5 Aegithina_tiphia, 6 Alauda_arvensis, 7 Apalis_goslingi, 8 Arcanator_orostruthus, 9 Artamus_leucorhynchus, 10 Batis_mixta, 11 Bleda_syndactyla, 12 Bombycilla_garrulus, 13 Bradypterus_baboecala, 14 Bradypterus_barratti, 15 Bradypterus_victorini, 16 Camaroptera_brachyura, 17 Catharus_ustulatus, 18 Certhia_familiaris, 19 Cettia_brunnifrons, 20 Chaetops_frenatus, 21 Chloropsis_cochinchinensis, 22 Cincloramphus_mathewsi, 23 Cinclus_cinclus, 24 Cisticola_anonyma, 25 Climacteris_picumnus, 26 Cnemophilus_loriae, 27 Coracias_caudata, 28 Coracina_lineata, 29 Corvinella_corvina, 30 Corvus_corone, 31 Cracticus_quoyi, 32 Culicicapa_ceylonensis, 33 Dicaeum_aeneum, 34 Dicrurus_adsimilis, 35 Dryoscopus_cubla, 36 Elminia_nigromitrata, 37 Emberiza_schoeniclus, 38 Eminia_lepida, 39 Eremopterix_australis, 40 Eugerygone_rubra, 41 Euryptila_subcinnamomea, 42 Fringilla_montifringilla, 43 Furnarius_rufus, 44 Gallus_gallus, 45 Garrulax_milleti, 46 Hirundo_pyrrhonota, 47 Hylia_prasina, 48 Irena_cyanogaster, 49 Lanioturdus_torquatus, 50 Lanius_excubitor, 51 Macrosphenus_flavicans, 52 Malurus_melanocephalus, 53 Megalurus_palustris, 54 Melanocharis_nigra, 55 Meliphaga_analoga, 56 Menura_novaehollandiae, 57 Mimus_patagonicus, 58 Modulatrix_stictigula, 59 Monarcha_axillaris, 60 Motacilla_cinerea, 61 Muscicapa_ferruginea, 62 Namibornis_herero, 63 Nectarinia_olivacea, 64 Neodrepanis_coruscans, 65 Nicator_chloris, 66 Oriolus_larvatus, 67 Orthonyx_spaldingii, 68 Orthotomus_sutorius, 69 Pachycephala_soror, 70 Paradisaea_raggiana, 71 Pardalotus_striatus, 72 Parus_inornatus, 73 Passer_montanus, 74 Philepitta_castanea, 75 Philesturnus_carunculatus, 76 Phylloscopus_collybita, 77 Picathartes_gymnocephalus, 78 Pitta_sordida, 79 Ploceus_cucullatus, 80 Pomatostomus_isidorei, 81 Prinia_bairdii, 82 Prionops_plumatus, 83 Promerops_cafer, 84 Prunella_collaris, 85 Psarisomus_dalhousiae, 86 Ptilonorhynchus_violaceus, 87 Ptilorrhoa_caerulescens, 88 Pycnonotus_barbatus, 89 Regulus_calendula, 90 Remiz_pendulinus, 91 Schoenicola_brevirostris, 92 Sitta_carolinensis, 93 Smithornis_rufolateralis, 94 Sphenoeacus_afer, 95 Stenostira_scita, 96 Sturnus_vulgaris, 97 Sylvia_nana, 98 Sylvietta_denti, 99 Telophorus_dohertyi, 100 Thamnophilus_nigrocinereus, 101 Thamnornis_chloropetoides, 102 Tregellasia_leucops, 103 Troglodytes_aedon, 104 Turdus_falklandii, 105 Tyrannus_tyrannus, 106 Vanga_curvirostris, 107 Vireo_philadelphia, 108 Xanthomixis_zosterops, 109 Yuhina_nigrimenta, 110 Zosterops_senegalensis; TREE Fig._1 = [&R] (44:0.0545025,(27:0.046377,(1:0.048464,(((105:0.028519,(43:0.027388,100:0.02847):0.007879):0.002317,(78:0.031896,(93:0.023464,(85:0.020642,(64:0.018113,74:0.017362):0.005729):0.006276):0.00131):0.007043):0.005262,(56:0.029949,((25:0.033296,86:0.024826):0.005116,((55:0.019677,(52:0.034739,71:0.024055):0.002185):0.007035,((67:0.024101,80:0.030642):0.001259,(((26:0.020457,75:0.018507):0.001516,(54:0.02059,(28:0.013482,69:0.016908,(87:0.019834,(66:0.019043,107:0.020743):0.002186):0.00123,((34:0.012093,(70:0.009565,(59:0.022095,(30:0.01461,(29:0.004596,50:0.005057):0.016637):0.002268):0.001646):0.001952):0.003426,((9:0.021206,31:0.006105):0.002948,((82:0.010108,106:0.014451):0.00151,(5:0.018175,(10:0.007459,49:0.012128):0.005111,(35:0.010514,99:0.019344):0.003147):3.93E-4):8.66E-4):0.004665):0.001231):0.005276):0.001631):0.001393,((20:0.017581,77:0.01628):0.008213,((40:0.029711,102:0.024505):0.003255,(((89:0.030899,(103:0.025899,(18:0.024992,92:0.047729):0.001118):0.00445):2.4E-4,(12:0.029315,((57:0.017968,96:0.018537):0.007368,(23:0.024988,((17:0.013073,104:0.011584):0.013312,(61:0.006743,62:0.006863):0.01587):0.003049):0.001843):0.007359):9.95E-4):0.001289,(((83:0.019232,(8:0.006002,58:0.007281):0.00971):0.00289,((21:0.021047,48:0.023576):0.002528,((33:0.018518,63:0.021187):0.003931,(84:0.019622,(79:0.01782,(60:0.016429,73:0.021068,(37:0.016402,42:0.016104):0.003424):0.001851):0.001372):0.006473):3.53E-4):0.001314):0.001136,(((72:0.025365,90:0.041903):0.003017,(95:0.022654,(32:0.022984,36:0.020025):0.005154):0.006656):5.82E-4,((6:0.014292,39:0.014145):0.008358,(65:0.023165,((98:0.016181,((2:0.008919,94:0.009918):0.009158,(15:0.015419,51:0.015794):0.001656):0.001232):0.001333,(46:0.030205,76:0.020807,(4:0.015449,19:0.017006,47:0.015651):0.002678,(3:0.020898,((101:0.015456,108:0.009157):0.003993,((22:0.007349,53:0.009545):0.001697,(91:0.002348,(13:0.001996,14:0.001606):0.003942):0.004345):0.007192):0.004043):0.001369,((11:0.009725,88:0.016163):0.012036,(97:0.020456,(45:0.01853,(109:0.012592,110:0.013219):0.009216):0.002928):0.003598,(7:0.013491,(16:0.012641,(68:0.013012,(24:0.012773,(81:0.012294,(38:0.010411,41:0.010644):0.005201):0.001698):0.003785):0.001753):0.00289):0.010869):0.001887):0.001397):5.99E-4):4.66E-4):0.003604):0.001729):0.0):0.003532):0.00124):0.001175):0.001791):0.002917):0.006657):0.003658):0.014341):0.005399):0.013941):0.0545025); END;