#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:05 GMT TreeBASE (cc) 1994-2008 Study reference: Barker F., Cibois A., Schikler P., Feinstein J., & Cracraft J. 2004. Phylogeny and diversification of the largest avian radiation. Proceedings of the National Academy of Sciences of the United States of America, 101(30): 11040-11045. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11939] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=146; TAXLABELS Acanthisitta_chloris Aegithalos_iouschensis Aegithina_tiphia Ailuroedus_melanotis Alauda_arvensis Arcanator_orostruthus Artamus_cyanopterus Artamus_leucorhynchus Batis_mixta Bombycilla_garrulus Campylorhamphus_trochilirostris Cardinalis_cardinalis Catharus_ustulatus Certhia_familiaris Chaetops_frenatus Chaetorhynchus_papuensis Chloropsis_cochinchinensis Cinclus_cinclus Cisticola_anonyma Climacteris_erythrops Climacteris_picumnus Cnemophilus_loriae Colluricincla_harmonica Conopophaga_ardesiaca Coracias_caudata Coracina_lineata Coracina_novaehollandiae Corcorax_melanorhamphos Cormobates_leucophaea Corvinella_corvina Corvus_corone Corvus_coronoides Corvus_orru Cracticus_quoyi Culicicapa_ceylonensis Cyanocitta_cristata Daphoenositta_chrysoptera Dicaeum_aeneum Dicrurus_adsimilis Dicrurus_hottentottus Dryoscopus_cubla Elminia_nigromitrata Emberiza_schoeniclus Ephthianura_tricolor Eugerygone_rubra Falcunculus_frontatus Formicarius_colma Fringilla_montifringilla Furnarius_rufus Gallus_gallus Garrulax_milleti Grallina_cyanoleuca Gymnorhina_tibicen Hirundo_pyrrhonota Hirundo_rustica Hylophilus_poicilotis Icterus_parisorum Irena_cyanogaster Lalage_leucomela Lanius_excubitor Loboparadisaea_sericea Malurus_melanocephalus Manucodia_atra Manucodia_chalybata Melampitta_gigantea Melampitta_lugubris Melanocharis_nigra Melanocharis_versteri Melanodryas_cucullata Meliphaga_analoga Menura_novaehollandiae Microeca_papuana Mimus_patagonicus Mionectes_macconnellii Modulatrix_stictigula Monarcha_axillaris Monarcha_chrysomela Motacilla_cinerea Muscicapa_ferruginea Nectarinia_olivacea Neodrepanis_coruscans Oedistoma_iliolophum Oreoica_gutturalis Oriolus_larvatus Oriolus_xanthonotus Orthonyx_spaldingii Orthonyx_teminckii Pachycephala_hyperthra Pachycephala_soror Pachycephalopsis_poliosoma Paradisaea_raggiana Paramythia_montium Pardalotus_punctatus Pardalotus_striatus Parula_americana Parus_inornatus Parus_major Passer_montanus Peneothello_bimaculatus Pericrocotus_ethologus Philepitta_castanea Philesturnus_carunculatus Picathartes_gymnocephalus Pipra_coronata Pitohui_cristatus Pitta_sordida Ploceus_cucullatus Polioptila_caerulea Pomatostomus_halli Pomatostomus_isidorei Prionops_plumatus Promerops_cafer Prunella_collaris Psarisomus_dalhousiae Ptilogonys_cinereus Ptilonorhynchus_violaceus Ptiloris_magnificus Ptilorrhoa_caerulescens Pycnonotus_barbatus Regulus_calendula Regulus_satrapa Remiz_pendulinus Rhipidura_hyperthra Rupicola_rupicola Schiffornis_turdinus Scytalopus_magellanicus Sitta_carolinensis Smithornis_rufolateralis Sphecotheres_viridis Strepera_graculina Struthidea_cinerea Sturnus_vulgaris Sylvia_nana Telophorus_dohertyi Thamnophilus_nigrocinereus Thraupis_cyanocephala Tityra_semifasciata Toxorhamphus_novaeguineae Tregellasia_leucops Troglodytes_aedon Turdus_falklandii Tyrannus_tyrannus Vanga_curvirostris Vireo_philadelphia Yuhina_zantholeuca Zosterops_senegalensis ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=146; TAXLABELS Acanthisitta_chloris Aegithalos_iouschensis Aegithina_tiphia Ailuroedus_melanotis Alauda_arvensis Arcanator_orostruthus Artamus_cyanopterus Artamus_leucorhynchus Batis_mixta Bombycilla_garrulus Campylorhamphus_trochilirostris Cardinalis_cardinalis Catharus_ustulatus Certhia_familiaris Chaetops_frenatus Chaetorhynchus_papuensis Chloropsis_cochinchinensis Cinclus_cinclus Cisticola_anonyma Climacteris_erythrops Climacteris_picumnus Cnemophilus_loriae Colluricincla_harmonica Conopophaga_ardesiaca Coracias_caudata Coracina_lineata Coracina_novaehollandiae Corcorax_melanorhamphos Cormobates_leucophaea Corvinella_corvina Corvus_corone Corvus_coronoides Corvus_orru Cracticus_quoyi Culicicapa_ceylonensis Cyanocitta_cristata Daphoenositta_chrysoptera Dicaeum_aeneum Dicrurus_adsimilis Dicrurus_hottentottus Dryoscopus_cubla Elminia_nigromitrata Emberiza_schoeniclus Ephthianura_tricolor Eugerygone_rubra Falcunculus_frontatus Formicarius_colma Fringilla_montifringilla Furnarius_rufus Gallus_gallus Garrulax_milleti Grallina_cyanoleuca Gymnorhina_tibicen Hirundo_pyrrhonota Hirundo_rustica Hylophilus_poicilotis Icterus_parisorum Irena_cyanogaster Lalage_leucomela Lanius_excubitor Loboparadisaea_sericea Malurus_melanocephalus Manucodia_atra Manucodia_chalybata Melampitta_gigantea Melampitta_lugubris Melanocharis_nigra Melanocharis_versteri Melanodryas_cucullata Meliphaga_analoga Menura_novaehollandiae Microeca_papuana Mimus_patagonicus Mionectes_macconnellii Modulatrix_stictigula Monarcha_axillaris Monarcha_chrysomela Motacilla_cinerea Muscicapa_ferruginea Nectarinia_olivacea Neodrepanis_coruscans Oedistoma_iliolophum Oreoica_gutturalis Oriolus_larvatus Oriolus_xanthonotus Orthonyx_spaldingii Orthonyx_teminckii Pachycephala_hyperthra Pachycephala_soror Pachycephalopsis_poliosoma Paradisaea_raggiana Paramythia_montium Pardalotus_punctatus Pardalotus_striatus Parula_americana Parus_inornatus Parus_major Passer_montanus Peneothello_bimaculatus Pericrocotus_ethologus Philepitta_castanea Philesturnus_carunculatus Picathartes_gymnocephalus Pipra_coronata Pitohui_cristatus Pitta_sordida Ploceus_cucullatus Polioptila_caerulea Pomatostomus_halli Pomatostomus_isidorei Prionops_plumatus Promerops_cafer Prunella_collaris Psarisomus_dalhousiae Ptilogonys_cinereus Ptilonorhynchus_violaceus Ptiloris_magnificus Ptilorrhoa_caerulescens Pycnonotus_barbatus Regulus_calendula Regulus_satrapa Remiz_pendulinus Rhipidura_hyperthra Rupicola_rupicola Schiffornis_turdinus Scytalopus_magellanicus Sitta_carolinensis Smithornis_rufolateralis Sphecotheres_viridis Strepera_graculina Struthidea_cinerea Sturnus_vulgaris Sylvia_nana Telophorus_dohertyi Thamnophilus_nigrocinereus Thraupis_cyanocephala Tityra_semifasciata Toxorhamphus_novaeguineae Tregellasia_leucops Troglodytes_aedon Turdus_falklandii Tyrannus_tyrannus Vanga_curvirostris Vireo_philadelphia Yuhina_zantholeuca Zosterops_senegalensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10328] TITLE Passerine_RAG; LINK TAXA = Taxa2; DIMENSIONS NCHAR=4126; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acanthisitta_chloris TAAAGTGCGATCGTTTGATAAAACACCCTCCGATGGCAACCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATGAAGATGAAGTGGTGCCAAGAGGAGAAGGG---------------ATGGAGTTAATGGGCAACAGG---GAGGCAGTCAAGAAAGATGCCCAT---------GACATGAAGACACAAGACAAC---AGAGATCACCAGAGCAATCTGGAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTACATGGGCCAGTGGATGATGAAACTCTGTGGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATAGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCGATTTTGTCACAA{CT}TGCTGGAGTATTATCCACAGGAAATTCAGTAATAC{AT}CTATGTGAAGTATATTTTCCTAGGAACAGCACAGTGGAGTGGCAGCCTCACTCTCCAAACTGTGATGTGTGCCATACTACCCGACAAGGAGTCAAGAGAAAAAACCAACAACCGAGAGTGCAACATGGCAAACGTGTGAAGACCATTGTGGAATGTGCTCGACTAAACAGAGGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAAAATATACATCTCAGCACCAAGATGCTTACAGTTGATTACCCAGAGGATTTCATTAAATCCTTATCTTGCCAGATTTGTGAACATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGTCCTTCCTGCTGGTATCCTTGTTTTCCTACTGATCTGGAAATACCAGTGAAATCCTTCCTGAACACCCTTGATAGCCTGAGTATAAGATGCCCTGTAAAAGACTGTGATGAAGAAATCAGGTATGGAAAATATAGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACATCCACATAAATAAAGGTGGCAGACCGAGGCAGCATCTCCTAACTTTGACCAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGCCTGGCAATTCGAATCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAAATCTTCCAGCCTTTGCATTCTCTTCGCACTGCTGAGAAAGCTCTCCTGCCAGGTTATCATCCATTTGAGTGGAAACCTCCTTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAACACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTCAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGCAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAGCATTGCTATAGCACAGGGGAATGAAAACAAGAGGATCTTTGAGGAAGGAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCGATCCTGAGCCCCCTCATTGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGTATCCTGAGAACATTCAGGTTCATCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATCACCAGGAGTCATGCTGAAAATCTGGAGCGATATGAAATTTGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGCAACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACTGTTCCCTCTATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCTGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCA{CT}GTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGTAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGG{CT}GTTTTCCTTCTTGATATAACACAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCCTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAAGTCTGACGAGTACCAGTATATCATCCATGGTGGTAAAACCCCTAACAATGACCTTTCTGATAAAATTTACATTATGAGTCTGGTCAGCAAAAATGGTAAGAAAACCACATTCCAATGTGTTGAGAAAGACCTGGGTGGAGATGTCCCTGCAGCTAGATATGGGCACACAATTAATGTTGTTCATAG{CT}CGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATATTCCTCTTGCACAAAGAACTACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGTTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAGTTGATCTTCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATTAGTGATACCGAATTTGTCCTTGTTGGAGGTTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTCCTGGAAGACAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAGCACTGCAGAATATGGTTTGGCTGTGATATGGGCAATGGATCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTACCCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAAGAGCAGAAGAGGAGAAGGAGGAAGAACTGACATCACAAATGTGTAGTCAAACATCAACTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATACTGACACTTACAACGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Aegithalos_iouschensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAGAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAGCTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAG{AG}TTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCACACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCA{CG}AGATAAAC---AAAAATTTAATTAAAGAGATTGTGAACTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCGTTAAATCCATCTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTT{CT}TGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCAGAACATTCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGCTCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTACCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAGAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCGTCCTGAGAACATTTAGATTTGTCTTTAGGGGTACGGGATATGATGAGAAACTCATGCGGGAAGTAGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACAGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTTCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAAATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTG----------------------------TCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CT}GCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCCAACAACGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCC{AG}CTTGCACAAAGAACCACTGAAAAATGGAATAGCGTAGTCGATTGTTTACCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCAAACTTGTACAAGTTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATCGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGAGAACCCAGAGTGGACACCGGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---TTGATAACACAAATTTGCAGTCAGACATCGAGTGAAGATGCTGGAGACTCTGCTCCATTTGATGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Aegithina_tiphia TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGAAGAAGAGGCTGTTTCT------------------------------------------------------------TCGAACGAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAAGGACTTGAGGAAGATGCCCAT---------GCCAGGCAAACACGAGAGAGT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCTGTACTACCAAACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCTACTGATTTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGAAAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTATATAAATAAAGGTGGTCGACCGAGGCAGCATCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTAGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGACGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGGTTTTCTTTCACAGTGATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTCACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGAT{CT}TTCCAGATGGAGATCGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCCGA---------AGGGCTGATGAGTATCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAAAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATATCCTTCCAGAACTTCAAGATGGACTCTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTATAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAA{CT}GTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGATCAGAAGAGGACAAGGAAGAAGAATCAATAACACA{AG}ATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Ailuroedus_melanotis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAGACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCAT---------GCCATGAAAACCCAAGACAAT---AGAGGTCATCAAAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATC{AG}CTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTTTGCCGTACTACCAGCCGAGGAGTCAAGAGAAGAAGCCAGCCCCCGAGTGTGCAACATGGCAAACGTGCCAAAACCACTGGGGAACGTCCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAAGCTATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATAAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATACAGCAAACACCTCTCCAGCCAT---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGACTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGAAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTACCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCTTGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACGGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGGGACGTCAGTGAAAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATTTTTGAGGAACTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAATGCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACGTACATTTGCACCCTGTGTGATGCAACGCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTCTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCCACAAAGTTCAAGTACAGATATGAAGGCAAAATTACAAATTACTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCCCACTCAGAAGCAAT---------GACGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTAGTAAGCAAAAATAGCAAGAAAATGATGTTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATTAGTGTCCTGTTTGGAGGGAGATCATATACTCCTCTCGCACAAAGAACCACTGAAAAATGGAACAGCGTGGTTGACTGTTTGCCGTCTGTGTTTCTCATCGATTTTGAGTTTGGATGCAGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCGCTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGTCCAGCTGTGACCTGCACCGTCATGCCAGGGGGGATATCGGTGTCAAGTGCTATTGTGACTCAGATCAGTGATACTGAATTTGTCCTGGTTGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGGTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATATGGTTTGGCTGTGATATGGGTAAAGGGTCTATATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGGCAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCAAGTGAAGA{CG}CCGGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Alauda_arvensis TAAATTGCCATCTTTTGA{AC}AAAACACCCTCTGATGACAGCCAGCACATAAACAAAGA{CT}CAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGCTAATGGGCAGTAGG---CAGG{AG}ACTTGAGGAAGATGCCCAT---------GCCCTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTCAAGCAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAGACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATGCTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAATGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGG{AC}AGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTAC{CT}CCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGACGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCCAG{AG}CAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAATTGGAAGCTATAATGAAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACT{GT}CTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACAC{AT}GAAGTGGGAATTATAGATGGACTATC{AG}GGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGCGATTCCG{AG}TATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGG{AC}ATGAAAGCAAACAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGAT{CT}GGTGAACTTTACAAGAATCCTGATGTGTCTAA{AG}GAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTT{CT}GCAGAACTC{CT}TATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCAT{CT}GGGGCCTGGGCAAGTGAAGGAAATGAGTCTGG{AC}AACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCCATGGTGTTTTCCTCCTCGATATAAAACAGAATGAGCTCAAAATGAAACCTGCCTTCTTT---AAAGATTTGTGCTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATCCAAGGGCTGAGGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAACGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGAGCTGGGTGGAGATGTCCCTGAAGCTAGATATGGCCATACAATTAATGTAGTTCACAGCTGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTTTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACTTACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---GAATTAACACAAACTTGCAGTCAGACATCAAGTGAGGACCCTGGAGACTCTGGTCCATTTGAAGATTCGGAAGAGTTTTGTTTTAGTCCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Arcanator_orostruthus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAATGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAATCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGACAATAGG---CAGGGACTTGAAGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGCGGAGTTCCATTTAAAATTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAG?CCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAAACAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGACCCAGTGGAAACAACATGTAGACACTTGTTTTGCAGACCTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCT{AG}TAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCACTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCC?GAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATA{CT}CACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCATCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAATTTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGCTTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGAT{CT}TACCCCTGGGCAGCCCGGAGGTGACCTGCAGCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCATTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATACTCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCGGAAACAGGCTACTGGATCACCTGCTGTGCC Artamus_cyanopterus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGAGCACTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAACTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACGGTGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCATCCCCCAAGTGTACAAC{AT}TGGCAAACGTGTCAAAACCACAGGCGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGATGCTTGTAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTG{CT}GATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTACTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAGGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCACGGAAAATATGGACAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCGCTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATATGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAAGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAGGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAGGCCATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAAAGCGTAAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCTAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACTCCGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGGAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTCTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGTGAACTACTTTTACATTCTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATGACACAAATTTGCAGTCAGAC{AG}TCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCTGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Artamus_leucorhynchus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGAGCACTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAACTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAGGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACGGTGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCATCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACAGGCGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGATGCTTGTAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAGGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCACGGAAAATATGGACAACACCTCTCCAGCCATAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGC{AG}TGAAAGCAAAAAACCTGGATGACTATATGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTAAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAGGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCCATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAAAGCGTAAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCTAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACTATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACTCCGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGGAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTCTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCGAACTACTTTTACATTCTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATGACACAAATTTGCAGTCAGACGTCAAGTGAAGACCTTGGAGACTCCACTCCATTTGAAGACTCTGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Batis_mixta TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAA{CT}GGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACGAGACAGT---AGAGTTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTACATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAAC{CT}TCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCACTTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAACCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGCTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGTTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCCGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCCTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACA{CT}GGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGTAAGCCCTTGTGTCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCC{CT}CTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCAATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGA{CT}GTTCCAATGCATTGAGAAAGGCCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCGCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTA{CT}CGGTGTCAAGTGCTATAGTGACCCAGATTAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGC{AG}GAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCGAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGG{CT}TACTGGATCACCTGCTGTGAG Bombycilla_garrulus TAAACTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCA{AG}TGGGCAACAGGCAACAGGGAC{CT}TGAAGAAGATGCTCAT---------GCCATGAAAACACAAGACACA---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCGTTTAAAAGTGACTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGGAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAAGGGATGTTGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGTGGCAAACGTGTCAAAACCACTGGGGCACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGCTTGTCAATTGCAAGGATAAACATCTCAGCACCAAGTTCCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAAACCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTAACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAGGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGC{AC}GATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTCCGCACTGCTGAGAAAGCTCTCCTACCCGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACT{CT}TCAATTGATGATTACCCAGTAGAAACAATTGCAAAAAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACCGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAACAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGGGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACCGCATTTTCCAGATGGAAATTGGTGAACTTTACAAAAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAGTTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAAATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAC{AG}CTC{AG}GAAGCGATGCTAGTGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGAGAAAGTTTACTTTATGAGTCTG{GT}TAAACAAAACTGGCAAGAAAATGACGTTCCAATGCATTGAAAAAGACCTGAGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTCGCACA{AG}AGAACCACTGAAAACTGGAACAGCGTAGTCGATTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTCTACATCTTACGTATTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGTCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCTTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATTGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGTTTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---CCGGTAACCCAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGTTACTGGATCACCTGCTGTGCC Campylorhamphus_trochilirostris TAAAGTGCGATCATTTGAAGAAACACCCTCTGATGACAGGCAGCATATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAATGAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ACAGACTTAATGGGCAGTAGG---CAGGAACTTGAGAAAGAGGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGTTACAACAGAACTCATCCAGTTCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTTAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAATAATACTCTATGTGAAGTATATTTTCCTAGGAATAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATGCTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGCAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCCGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGTCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCAGAGTCAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCAATCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTCACCGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTTCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCCATTGCACACGGGAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGCCTTATGCTGGCGGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGATGCTTGAAATGGGAGGCGTCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACACGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCATTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTGTGATGAGGATGACTGGAAATTTTGCTAGAAAACTTATGTCAAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGAACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCGTCATGCCCTGCCAAGGAGTGCCCAGAACTACTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTGTCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATC{AG}TTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTCAAAATGAAACCCACCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTTTCTGATAAGATTTACCTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGGTGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACAGAAAAATGGAACAGCGTAG{CT}TGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCATTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAACAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCGATGATACTGAATTTGTCCTTGTTGGTGGGTACCACTCTGACAACCAGAAACGGTTAGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCAAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGTCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTCCACC Cardinalis_cardinalis TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACACAGAAATCATCCTGCATGAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTCTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAA{CT}GTGCTCAG{CT}TAAACAGAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTATTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACACGGAAAATATGGCCAACACCTTTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGA{CT}GGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCAT{AT}CTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATCGGCAACGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTTGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAGATGAAACCTGTCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATAAGTTTGGTAAGCAAAACTAACAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGCCATACAATTAACGTAGTTCACAGTCGGGGGAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACGTGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTACCCCTGGGCAGCCCGGCTGTGACCTGCACTGTTCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATAAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATTCCAGATGCAAACTACTTCTACATTTTGAGATGCATAGGAACAGAAGAGGACAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACCCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAA{AG}CCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Catharus_ustulatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGTCAGAAGAGGCTGTTTCT------------------------------------------------------------{CT}CAAACAAAGAATTCATTC{CT}GCATGAAGATGAAGCAGTACCAAGTGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACCCACTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAACACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGACGTGTGCCATACTACCAGAAGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACCGGGGAACATGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GTACAGATAAACAACAAAAATTTAATGAAAGAGATTCTCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAGTTGATTATCCACCGGATTTCATTAAATCCATGTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAATGTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCCACTGACCTGG{CT}AACCCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCACAGCTACATAAATAAAGGTGGC{AC}GACCGAGGCAACACCTCCTGTCCCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAACCTGGATGACTATTTGACTGGCCCCTTCACTGTGGTGATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCAC{AT}GTCATGAACATTTCTATAGCACATGGAAATGAAAACAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACT{AG}CTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTGCACTCCATAACCCGGAGCCATGCTGAAAACCTGGC{AG}CGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTCCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTGGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAGTAACGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCAACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTT{CT}CACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCAGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCT{CG}CCCCCTCTCCGCTACCCTGCTCTCTGCACACTCGGAAGCGATGCTAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAACAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCT{AG}CCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTGGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATCAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTAGGCATTCCAGGGACCAACAAACAAATAAGCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAAGGCAGAAGA{AG}TTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAG{CT}GCTGAAGCCAACAGCTTTGATGCTGA{CT}GATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Certhia_familiaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGGCCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAGGAATTCACC{CT}TGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAACAGGCAATAGG---CAGGGACT{AG}GAGGAAGTTGCCCAT---------GCTCTGAAAACACAAGACAAG---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATCATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGTGCAAAGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGTCATACTATTAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACTACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTATATAAATAAAGGTGGCCGGCCGAGGCAGCACCTTCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCA{CT}CCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGT{GT}GGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCCGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGAAAACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAATATTGCTATAGCACATGA{CG}AATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAGATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATAGGTGAACTTTACAAGAATCCTGACATTTCTAAAGAGGAGAGGAAGAGGTGGCAGTCGACCCTTGACGAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAGTAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTCTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAATGCCCAGATCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTC{CT}AAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCAAAAGACTCGTGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCCGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCGGCTGTGTCCTGCACGATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGATAACCAGAAACGGCTGGCATGCAACACCATAGTTCTGGAAGATAGTAAGATAGAAATAGTTGAAAGTGCTAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATGTGGTTTGGCTGTGACATGGG{GT}AAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAATTCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACATCCAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGA{AG}GAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGATGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Chaetops_frenatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAACCAGCACCTAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAGTTCATCCTGCATAAAGATGGAGCAGTGCCCAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATCAG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATGCAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAGCTCTGCCGGATCTGTGGAGCTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCCAGGAACAGCACGATGGAGTGGC{AG}ACCCCACTCCCCGAAGTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTATACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTTAATTGC{AG}AGGACATACATCTCAGCACCAAACTGATTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATGTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAGTCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCACGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAA{AG}ATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTC{AC}GAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTCTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCTTTGCATGCTCTTCGTATGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATTGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGACGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTTATGAACGTTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGGACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAAATGAGTGGAAATTTTGCTAGGAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGA{CT}GGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATCCAAGGACTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTT{CG}CAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTC{CT}TGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGT{CT}TCAATTGCCAGAGGTGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATAATGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGTCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCTGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTG{AG}TAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGGTGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Chaetorhynchus_papuensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCACCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGAT{AG}CCCCT---------GCCATGCAAACACAGGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGACGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAATATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGC{AC}GTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAAC{GT}TGTCAAAACCACTGGGAAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAAGAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTACCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGT{CT}TGTCTGGCCATCCGAATCAACAC{AG}TTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCGCTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTGTAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCCGATCA{CT}GAAACTCTGACTGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTTCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTGTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTAAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGT{AG}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTC{AG}TGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGTAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTGTTGAGATCCTGCCCCACTGGTGTTTTCCTC{AC}TCGATATAAAGCAGAACGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGTGAT{GT}CAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACATTTCTGATAAGATTTACTT{CT}ATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGATGTTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAGGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGTATGAGTGTGCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTTCATGTTTCAATTGCCAGAGATGATACAATCTAC{AG}TCTTGGGCGGCCACTCACTTCAAAACAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATTCTGCCAGGGGG{GT}GTATCAGTGTCCAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGAGACTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTT{CT}TACATTTTGAGATGCAAAGGAGCAGAAGTGGACAAGGAAGAAGAATC{AG}ATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCTGGAGACTC{CT}ACTCC{GT}TTTGAAGACTCGGAGGAGTTTTGTTTCAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Chloropsis_cochinchinensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGGCAGCCAGCACATAAACAAAGATCAGGCAGAAGAAACTGTTTCT------------------------------------------------------------TCAAACAAAGACTTCCTCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGA---CAGGGACTTGAGGAAGATGCCAAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCTTTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACAACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACCACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAGCCAA------------GCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGTAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAATACCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGACCAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGACTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCCATCCGAATCAACACGTTTCTCAGCTGTGGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACGGAAGTGGGAATTATTGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGA{CT}ACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTCGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATGGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTGTACAAGAATCCTGACGTGTCCAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGTATTGTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATTATGTTGCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCGTATGCTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGATGCTGTACATCCTACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACATCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTCGGCAGCCCGGCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAGCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACCCAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCTGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Cinclus_cinclus TAAATTGCGATCGTTTGAAAAGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTC{CT}TTCTGCATAAAGATGAAGCAGTGCCAAATGGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAATCACAAGACAAT---ATATCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGCTACAAGAAAACATACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTAT{CT}CATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGAAACAGCACTATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGGGGAGTCAAGAGAAAAAGCCAGACCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGAGGAACATGCTCAGCTAAAAAGAGGTGTAAAGAATCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCA{AG}TTGCAAGGATATACATCTGAGCACTAAGCTGCTTGCAGTTGACTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTTCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGA{CT}GGACTATCAGGACTGCCACTGTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCTCTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGTAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTCGGTTCGTCTTTAGAGGAACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCTACCCGCTGGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGC{CT}CTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTTCGCTACCCTGCTCTGTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGATAAACAAAACTAACAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATTCTTGGAGGCCACTCGCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTACCCCTGGGCAGCCCAGCTGTAACCTGCACCATCTTGCCAGGAGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAAGAAGAATTGATAACGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCAGACAATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Cisticola_anonyma CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAGTTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGAAGTTAACGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATAAAAATACAAGACAAT---AGAGATCATCGGAAAAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATGCACAGAAAGTTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAATCAAGAGAAAAAAACAGTCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGACTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACTCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAAGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACCATCATGAACATTTCTATAGCACATGGGAATGAAACCAAGAGGATCTTTGAGGAAATAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGTTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGAGGTACAGGCTATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCTCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATCGGTGAACTCTACAAGAATCCTGATGTCTCTAAAGAGGAGAAGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGCGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTGTGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCGTAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTACCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGAGGACACAATCTACATCTTGGGAGGTCACTCTCTTCAAAATAACACCAGGTCCCCCAACTTGTATAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCGGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGA{CT}{AT}GTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGCTTGATTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGA{CT}{AG}AGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCC{AG}TTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATATCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Climacteris_erythrops TAAATTACGATCATTTGAAAAAACACCCTCTGATGATAACCAGCACATAAACAAAGATGAGGCAGAAGATGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGACATAATGGGCAATAGG---CAGGGACTTGAGAAAGATGCCCAC---------ACCACGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGACTTCTGAGAAAGAAAGAAAAAAGAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACGCCATGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCACCCCCATTCCTCAAACTGTGATGTGTGCTGTACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAGCATGGCAAACGTGCCAAAACCACTAGGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCACGAATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTAATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTTTGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTCCCTACTGACCTGGTAATTCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAAATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCATTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGACGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGTTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAACGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCATTTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTGGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGGAGAATGAGCTGAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGCACTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAGTCTGGTAAACAAAAATAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCCGAAGCTAGATACGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCTATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGACAAATGGAACAGCGTCGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCCGTGACCTGCACCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATTGTGACTCAGGTCAGTGATACTGAATTTGTCCTAGTTGGTGGCTACCAATCTGACAGCCAGAAACGATTGATGTGTAACACCATAATTCTGGAAGACAGTAAAATACAGATTGTTGAAAGTGTGAACCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTACTGCTCGGCATACCAGGGGCCAACAAACAATTAATGCCAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAGTTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Climacteris_picumnus TAAATTACGATCATTTGAAAAAACACCCTCTGATGACAACCAGCACATAAACAAAGATGAGGCAGAAGATGCTGCTTCT------------------------------------------------------------TCAAAGAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGACATAATG{AG}GCAATAGG---CAGGGACTTGAGAAAGATGCCCAC---------GACATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTACCAGAGAACTTACCCAGTGCACGGGCCGGTGGATGATGAAACTCTGGGACTTCTGAGAAAGAAAGAAAAAAGAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTATTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACACTATGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCACCCCCATTCCTCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGCGTCAAGAGAAAAAGCCAGCCCTCAAGTGTGCAGCATGGCAAACGTGCCAAAACCACTAGGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCACAAGTATACATCTCAGCACTAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGTAGAAC{CT}TGCATCCTTAAGTGTATCAGGGTTTTGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAATTCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTATAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCA{AG}GTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTGAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCATTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGTTTTTCCTTCACAGTCATGAGCATTTCTATAGCACATGAGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGAGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCCGAGCTCTTATCTACAAAATTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGGAGAATGAGCTGAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCC{GT}GCTCTTTGCGCACTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAG{CT}CTGGTAAACAAAAATAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCT{AG}TTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGACAAATGGAACAGCGTGGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCCTTGACCTGCACCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATTGTGACTCAGGTCAGTGATACTGAATTTGTCCTAGTTGGTGGCTACCAATCTGACAGCCAGAAACGGTTGCTGTGTAACACCATAATTCTGGAAGACAGTAAAATAGAGATTGTTGAAAGTGTGAACCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTACTGCTGGGCATACCAGGGGCCAACAAACAATTAATGCCAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Cnemophilus_loriae TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGTGTTAATGGGCAATGGG---CAGGGACTTGAGGAAGATGCCCGT---------GCCATGAAAATACAAGACAA{CT}---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGACCAGTGGATGATGAAACACTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCAGACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATGTACAACATGGCAAACGTGTCAAAACCACTGCGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATCCATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACTCCAGTGAAATCCTTCCTAAGCATCCTTGATAACCTGAGTATAAGATG{CT}CCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCGTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGACGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAATATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACTCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACGAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GCGTCTAAAGAGGA{AG}AGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAA{AG}CCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGC{AT}GTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCA{CT}TAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTACAGCTACAACTCACAGCGTTTTGCAGAGCTCTTGTCTAC{AG}AAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCGAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTTCTCCTTGATGTAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACTCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCCGAGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGTACCATCCTGCCGGGAGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAT{CT}CCAGATGCAAACTACTTCTACATTTTGAGATGCAAAAGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACCTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Colluricincla_harmonica TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCG{AC}GGGGATGTCGATACTATCCATCCCACTCAATTTTGCCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGAAA{AG}CGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAATGAGATGAAAGACGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGAGACAATTGCAAAGAGATTTCGATACGATG{CT}GGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTAGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGA{CT}GAATCAGACCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGA{AG}GCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGC{AG}TCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCA{CT}AAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGCGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAAAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTCCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCCATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGTATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGAC{AG}TCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGACTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGACGTTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Conopophaga_ardesiaca TAAAGTGCGATCATTTGAAAAAACACCCTCTGATGAC{AG}GGCAGAACATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGAGTAAAGATGAAGCAGTGCCAACAGGAGAAAAG---------------ATGGAGTTATTGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCCAT---------GACATGAAAATACAAGACAAT---AGAGCTCATCAGAACCATCTAAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAGACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCCGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCACTCGAGG{AG}GTCAAGAGAAAAAGCCAGCCACCAAATGTACAACATGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGTAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGTCTGGGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGG{AG}AAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGTCGGCCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACCGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTACATGCTCTTCGCACTGCTGAGAAAGCCCTGCTACCAGGCTATCA{CT}CCTTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACTGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTGAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTTACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATTGCACATGGGAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGCCTTATGCTGGCGGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGGTTTGTCTTTAGGGGTACAGGATATGACGAGAAACTTGTGCGGGAAGTAGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGGTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCCGGAGCCATGCTGAAAATCTGGAACGGTATGAAATATGGAGATCCAACCCCTATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTGATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGAGCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCTGAGCTCTTATCTACCAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACCGGTGTTTTCCTTCTTGATATAAAGCAGAGTGAGCTCAAAATGAAACCTGCCACCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAAGTCTGAGGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGGTGCTCCGATGCGTTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTTCACAAAGAACAAC{CT}GAAAAATGGAACAGTGTAGTGGACTGCTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGCCATTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACAATAGTTCTGGAAGATGGTAAGATAGAGATTATTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAGAAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGGCGTCAAACGAAGATCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Coracias_caudata TAAAGTGAGATC{AG}TTTGAGAAAACACCTTCTGATGACAGTCAGCACATAAACAAAGACCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCGTAAAGATGAAGCAGTTCCAAGAGGAGAAAAC---------------ATAGACTTAATGAGCAACAGG---CAGGCACTTGAGAAAGATGCCAGT---------GGCATGAAAACACAAGAC{AG}AT---CAAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGAGCTTATTGCTAAGGTTTTTAAGATTGATGTGCGGGGGGATATTGATACTATCCATCCCACTCGATTTTGTCAAAATTGCTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCC{CT}AGGAACAGCACAATGAAGTGGCAGCCGCACTCCCCAAACTGTGATGTGTGCCACACCACCAGTCGTGGAGTCAAGAGAAAAGGTCAGCCACCCA{CG}TGTACAACATGGCAAACGTGTGAAGACCATTGCAGAATGTGCTCGAATAAAGAGAGGTGTAAAGGACCAA------------GCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACAAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGGTCTGTGAGCATATTTTGGCAGATCCAGTGGAAACCACATGTAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATTAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAACCTGGGTATAAGATG{CT}CCTGTAAAGGAATGTGATGATGAGATCTTGCATAGAAAGTATGGCCAGCACCTCTCCAGCCACAAGGAGATAAAAGATAGAGAGCTTTACAGCCACATAAATAAAGGTGGCCGGCCAAGGCAGCATCTCCTGTCTTTGACCAGGAGGGCTCAAAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCACCCTGCCGTCTGCCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAATATCATAAAATGTATAGAACGGTAAAAGCCGTCACTGGGAAGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAATCTCTCCTACCCGGTTATCATCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGACGAGATTTTGGAAGGCATGAAAGCAAAAAACCTTGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGAAGTCAGCGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATAATGAACATTGCTATAGCACATGGGAATGAGAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTACTTGAAATGGGAGGCATCCTGAGAACATTCAAATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATTTGGTGTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAG{AG}TCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACTGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAAGTTTACAAAAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGATGAGGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACAGTAGAAGCGGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCC{GT}GCCAAGGAGTGTCCAGAATTGATGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCCTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATCACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGACGGGTCCATTGGGGCATGGGC{AG}AGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAATGCTATGAGATGGAGGATGTCCTG----------CCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCCTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAGGCAATGCAGAGTCTGATGAGTACCAGTATATCATCCATGGTGGGAAAACACCTAACAATGACCTTTCTGATAAGATTTATGCTATGAGGCTGGTAAGCAAAAGTAGCAAGAAACCCACGTTCCAATGTGTTGAAAAAGACCTATGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTCATTCATAGCCGGGGAAAAAGCATGAGCGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATTTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTGCTTTCCATGTTTCAGTTGCCAGAAATGATACAGTCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGAGCACCCAGCTTGTACAAGCTAAAGATTGATCTCCCACTGGGGAGCCCGTCTGTGACCTGCACCGTCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAACTGGTGATACCGAATTTGTCCTTGTCGGGGGCTACCAGTCTGATGATCAGAAACGGTTGGTGTGTAACACTATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGGGAGGGCCCAGACTGGACACCAGATATTAAACACTGCAGGATCTGGTTTGGCTGTGATATGGGTGAAGGATCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAGGAAGAACCAACAGCACAAATTTGCAGTCAGACATCGACCGAAGACGCTGGAGACTCCACTCCATTTGAAGATTCGGAAGAGTTTTCTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACGGGCTACTGGATCACCTGCTCTGCC Coracina_lineata TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAATGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGAGGGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGA{CT}GAATCAGATCACGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCCGGAGACTCCACTCCATTCGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACTTGCTGTGCC Coracina_novaehollandiae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---A{CG}AGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAATGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGAGAGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTCCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCTTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAAGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTT{AG}TTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGGAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCT{AG}ATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAAGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACTTGCTGTGCC Corcorax_melanorhamphos TAAATTGCGATCATTTGAAAAACCACCCTCTGATGACAGCC{AG}GCACATAAATAAAGATCAGGCAGAAGAGTCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAT---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACGAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAGAATTTAATGAAGGAGATTATCA{AG}TTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTGTAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTTATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTGGTTGACTGTGTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTCCAAAATAACACCAGGTCCCCCAACCTGTACAAGGTAAAAATTGATCTTCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTAC{AC}ACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTGAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAGTAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Cormobates_leucophaea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGTGAGCACATAAACAAAGATGAGGCAGAAAATGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGTAGTGCCAAGAGGAGAAAAG---------------ATGGACTTAAGGGGCAATAGG---CAGGGACTTGAGAAAGATGCCCAC---------GCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGCAGCTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACCAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTTACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACGCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCACCCCCACTCCTCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGAGTCAAGAGAAAGAGCCAGCCCCCAAGTGTGCAGCATTGCAAAC{AG}TGCCAAAACCGCTGGGGAACGTGCTCGGCTAAACAGAGTTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCATGAATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCTGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAAGCTGTATGCATGACATTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGATGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGGAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGA{CT}GGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAG{AG}TTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAGGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGTACACTCAGAAGCAAT---------GATGAGTATCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAGTTTGGTAAGCAAAAATAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGCTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATCAGTGTTCTATTTGGAGGCAGGTCATATAC{AG}CCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTG{AG}TTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCT{CT}CAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTATACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCTGTGACCTGCTCCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATCGTGACTCAGGTCAGTGATACTGAATTTGTCCTGGTTGGTGGCTACCAATCTGACAATCAGAAACGGTTGCTGTGCAACACC{AG}TAGTTCTGGAAGACAGTAAAATAGAGATTGTTGAAAGTGTGAGCCCAGACTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATACCAGGGGCCAACAAACAATTAATGACAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Corvinella_corvina TAAATTGCGATCATTTGAGAAAACATCGTCTGATGGCAGCCAGCACGTAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCTTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CACGGACTTGAGGAAGATGCCCAT---------GTGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAACACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAATAGAGGTGTAAAGAACCAA------------GCACGGATAAACAACAAAAATATAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATAGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCGAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAGAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGAGTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTTAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAG{AG}AGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCTGTGTGGCGATCCTCATGTCCTGCCAAGGAATGCCCAGAACTGCTATGTCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATATATTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACATCAGGTCCCCCAACTTGTATAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTCACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTCTAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGATGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAGGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGACGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_corone TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCT{AG}TGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCGTACTACCAGAC{AG}AGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGAAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCA{CT}CCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGGCGAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTC{CT}TGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACGCAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_coronoides TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGGGGTAAAACGCCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACACAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGATGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_orru TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCATACTACCAGACGAGG{AC}GTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAA{CT}ATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCC{AT}CTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGGGGTAAAACGCCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCGCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACACAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGATGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Cracticus_quoyi TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACGTAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGATTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTC{AT}C{CT}AGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGC{GT}GAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGA{AG}GCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAGAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGT{AC}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTAC{AG}AAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAAT{CT}ATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGAC{AG}TTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAACATAAGTGTTCTGTTTGGAGGTAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTCTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGC{AG}AACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Culicicapa_ceylonensis TAAATTGCGATCATTTGAAAAAGCACCCTCTGATGACAGCCAGCACCTAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAGAGAATCCATCTTGCAAAAAGATGAAGCAGTGCCAAGGGGAGAAAAG---------------ACAGAGTTAACAAGCAAAAGG---CAGGGACTTGAGGAAGATGCCCAC---------GCAATGAAAACACAAGACAGTGTTTTCACTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATAAGACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAATAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCATTCCCCAAACTGTGATGTATGCCATACTACAAGACAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTTCAAGGCAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTAACCCCAGTGAAATCCTTCCTCCACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCAGGCCACAAGGAGGTGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGGCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCCTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATAATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCGGTGGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTGATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGA{AG}GAAGT?AAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCCTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATTCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAACGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAGGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAGCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAGGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAA?GAGTCTGGAAACAAACTGTTTAGG?GGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACAGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAACTGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCAGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCAGCTGTGTTTCTCATTGATTTTGAGTTTGGTTGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTATCAATTGCCAGAGATGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACTAGGTCCCCCAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCGGACAACCAGAAACGGCTGGTGTGTAACACCGTAGTTCTGGAAGATAGTAAGATAGAGATTCATGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTCTACTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGTTAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGCACTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGACGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Cyanocitta_cristata TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATCGTTACAAGAAGACTTACCCAGTGCATGGGCCAGTGGAT{AG}ATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGC{CT}CCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTTCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTCGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTG{CT}ACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACGGTAGAGGCCGT{AT}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGC{AG}TGCTCAGAAGCGATGCAAAGGCTGATGAGTACCA{AG}TATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCGTAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACCCAGATAAGTGATAATGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAGTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGACGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Daphoenositta_chrysoptera TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATGAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGGTGAAGCA{AG}TGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGA---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAA{CT}ACAAGAC{AG}AT---AGAGCCCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAGGAGAACGTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGCCACAACTGTTGGACTATTATACATAGAAAATTCAGCAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGC{CT}CCCAAGTGTACAACGTGGCAAACGTATCAAAACCAC{GT}GGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGACATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTA{CT}AGCTACATAAATAAAGGTGG{AC}CGACC{AG}AGGCAGCACCTCCTGTCTTTGACACGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGT{AG}TGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGG{AT}TTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACGTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGA{AG}TCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACGTTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTCATGCTGGCTGACGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGA{AG}GGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTTTGTGAACTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTT{CT}AAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCAT{CT}GGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGCACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCTTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAG{CT}CGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTCGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCGGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCA{CG}CATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCAGTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGA{AG}TGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGGCATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTGGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATC{GT}GAAAC{AG}GGCTACTGGATCACCTGCTGTGCC Dicaeum_aeneum TAAATTGCGATCATTTGAAAAAA{CT}ATCCTCTGACGACAGCCAGCACATAAACAAAGATCAGGCAAAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CA{AG}GGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATG{AC}AACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGACGTGTGCCATACTACCAGAC{AG}AGGAATCAAGAGAAAAAGCCAGCCCCCACGTGTACAACCTGGTAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACGGACAAACAACAAAAATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTCGATAATCTGAGTATACGATGCCCTGTAAAGGAGTGTGATGAAGAGATCTC{AC}CATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACC{AG}AGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTC{AC}GGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATCGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCCGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTATATCTGAGGATGAAGCCAGTGTGGAGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTCTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCTTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATCAGGACCAGTATATCATCCATGGTGGTAAAACACCTAACAACGACCTTTCTGATAAGATTTACTTCATGAGTTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTACGCTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGATAACCAGAAACGCCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCGATTTTGCTGGGCATTCCAGGAGCCAGCAAACAAATAATCCCGGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Dicrurus_adsimilis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCTATGCAAACAGAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGA{CT}CTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGCGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAA{CT}AGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGT{CT}AATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTGCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTCTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATCATAGATGGACTATCAGGTCTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAACTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCGGCCTTCTTCTC{CT}AAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAG{AG}TCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCA{AT}CCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACAATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCA{AG}TAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Dicrurus_hottentottus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCTAT{AG}CAAACAGAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTATAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGCGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGTCTGCCACTCTCAGTTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCTTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAACTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCGGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAGTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACAATCCTGCCAGGGGGGGTATCGGTGTCAAGCGCTATAGTGACCCAGATCAGCGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGACGAGGACAAGGAAGAAGAATTGATAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Dryoscopus_cubla TAAATTGCAATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTATTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCTTTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAGACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAAGCGATGTTGATACCATCCATCCCACGAAATTTTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAGCGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTACCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCAC---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCTTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATAAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGA{CT}GACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATTCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCTTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACCGGATTTTCCAGATGGAGATTGGTGAACTTTATAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCTACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCCATGCACGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGGTACCGAATTCGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Elminia_nigromitrata TAAATTGCGATCATTTGAAAAAGCACCCTCTGATGACAGCCAGCACCTAAAGAAAGACCACGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACAGAGTTAACGGGTAATAGG---CAGGGTCTTGAGGAAGATGCCCTT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATTTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCACTTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGCAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGCAGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCA?TAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATGTTTTGGCTGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGACCTGGTAACCCCAGTGAAATCTTTCCTGCACATCCTTGACAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGGCAACATCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGTTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATGGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTGGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAGTCATGAACATTTCTATAGCACATGGGAATGACAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACTTTTAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGTCATTCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAGGAGTGCCCAGACCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATAAATGCTAGGCAGTCCAAAG-----------------------AGATCCTGCCCCACAGGTGTTTTCCTGCTCGCTATAAAGCAGAATGAGCTCAAACTGAAACCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTGAGAAGTGATGCAGGGGCTGATGAGTACC{AT}GTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAATCTAGCAAGAAAATGACATTCCAGTGCCTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGAGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGAGCAGAGAACCACTGAAAAATGGAACAGCGTAATTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACACACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGACACTCACTTCAAGATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGTCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCGTCGTTCTGGAAGACAGTAAGATAGAGATTCATGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTGGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Emberiza_schoeniclus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGAAAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTCAAAACTGATT{GT}TTCCAAGAGAACT{CT}ACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGGTTGATGTGCGAGGGGATGTTGACACTACCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAGCCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGT{AT}ACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCAAACACCTTTCTGGCCACAAGGAGATGAAAGAAG{CG}AGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGTAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTTTAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAATCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACAAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAA{AG}TGTGAGGAAAGGCATGAAGCCCTCAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTCCTTCTCCAGAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAATTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTAGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACGGAAACATGGAACAGTGTAGTTGACTGTTTGCCATTTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAGTTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGATAATAAGATAGAGATTGTTGAAAGCGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACAATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Ephthianura_tricolor TAAATTGCGATCATTTGAAAAAATAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGGGGCTGCTTCT------------------------------------------------------------TCAAACAAGGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCTTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTTAGAAAGAAAGAAAAAACAGCAACGTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAAGTGTGATGTGTGCCATATTACTAGGCGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACTACGTGGTAAATGTGTCAAAACCACTGGGGAACGTGCTTGGCCAAACAGAGGTGTAAAGAACCAA------------GCACAGATGAATAACAAAATTTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCCACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCATCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGAGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTAAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGTATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTGAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGATACAATTGCAAAGAGATTTCGGTATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGAATGGTCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCGGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCCTCCGGGAAGTAGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCTTATCACGAATCTGTTGATGAGCTCCGC{AG}ACAGAGTGAAGGGTGTTTCAGCCAAACCGTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATC{CT}TCATGCCCCACCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATCACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAACGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTTGTGTTTTCGTCCTCGATATAAGGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGTACGCTCAGTAGCGAAGCAAGCAATGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAATTGACGCTCCAATGCACTGAGAAAGACCTGTGTGGAGATTTCCCTGAAGCCAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGTGTGTTCTGTTTGGAGGGCGATCATATACTCCTCTTGCCCAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCGTACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACTAGGTCCCCCAACCTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAATACCATAGTTCTAGAAGACAGTAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTCTTGCTGGGTATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGGCATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACATGCTGTGCC Eugerygone_rubra TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAAGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAACAATTCATCCTGCATAATGATGAAGCAATACCAAGGGGAGAAAAG---------------ATGGAGTTG---------AGG---CAGGGACTTGAGGAAAATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGACAAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGA---GGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGCACAACAGGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAGAATTTAATGAAAGAGATTGTCAATTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTCTGCAGAACCTGCATCCTGAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCGTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTGAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGCTACATCAATAAAGGTGGCCG{AG}CCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACAGTCATAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGA{AG}CATTTCTATAGCACATGGGAATGAAAGCAAAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCCGATCATGAGACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAGACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAAAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCCGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGGTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAACTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCATCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGAGGTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAGGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTTTCTGATAAGATCTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCATTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCAGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCTGTGTCAAGTGCCATAGTGACCCAGATCAGTGATAGTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCCGTGATATGGGTAAAGGGTCTGTCTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATACAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGA{CG}GACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAG{AT}GGAGTTTTGTTTTAGTGCTGAAGCCAATAACTTTGATGGTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Falcunculus_frontatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTTATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTCTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAGGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTCGAGTGGAAACCTCCTTTGAAAAACGTATCCACTAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGAATGGCCCTTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGCAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACCCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCGTTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTATGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAACAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGAGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGA{CT}GTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTC{AG}TATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTCACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAATAAGATCGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGAACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTT{CT}AGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Formicarius_colma TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGGCAGCATATAAACAAAGATCAGGCAGAAGGGGTTACTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGACCCA{CT}---------GACATGAAGACACAAGACAAT---ATTGCTCATCAGAACAATTTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCCGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAGGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGAGAGGGGATGTTGATACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATAATCCACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCGTATTGCCGCTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGCAAACGTGTGAACACCATTGTGGAATGTGCTCGACTGAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAACTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTTAAGTGTATCAAGGTTGTGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCTTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTATAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTCTCTTTGACAAGGAGAGCTCAGAAACATCGTCTCAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTGTAATGCAAGGGAGGGGATCGGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCAGTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCAGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATT{AG}CCATTGCACATGGGAATGAAAGCAAGAGAATCTTTGAGGAACTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCAGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCACTCATAGCAGAAAGAGAGGCCATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGAATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCATTGTGACATTGGCAATGCAGCAGAGTTCTATAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCAAAAGAGACAGTAGAGGCAGTATGTGAATTAGTAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGAGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTTTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGGGCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTGTGCATGCTCAGAAGCAATGCAAACTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAGTAGCAAGAAAATGATGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACCATTAATGTAGTTCATAGCCGGGGCAAAAGCATGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATTTCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTCCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGCCCAACAAACAGTTAATCTCTGATGCAAACTACTTCTACATTTTGAGGTGCAAAGGAGCAGAAGAGGAAAAGGAAGAAGAATTGACAACACAAACTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAACGAGGACGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCATCTGCTCTGCC Fringilla_montifringilla TAAATTGCGATCATTTGAAAAAACAGCCTC{CT}GATGACAGCCAGCACATA{CG}ACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACCAAGAAATCATCCTGCATGAAGAAGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGCTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCC{AC}T---------GCCATAAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCAAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTGTATTT{CT}CCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCACACTTCCAGACGAGGAGTCAAGAGAAAAA{AG}CCA{AG}CCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACGACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCGTTAAATCCATTTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAAC{AG}ACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGA{CT}GACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTGATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAACTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTTTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTG{CT}GACATTGGCAATGCCACAGAATTCTACAGGAT{CT}TTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCC{AG}GAACTGCTGTGCCAATATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTGTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGCTTGGTAAGCAAAACAAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATACGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATACACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGGGAGGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAAATCAGTGACAATGAATTTGTCCTCGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCGTGTAACACCATACTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTAGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAGCACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTATTTTAG{CT}GCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Furnarius_rufus TAAAGTGCGATCATTTGAAGAAACACCCTCTGATGACAGGCAGCATATAAACAAACATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATTATACTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGAACTTGAGAAAGAGGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAACA{AC}CTTTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGTTACAACAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCT{AG}TGGCTTCTTAGAAAGAAAGAAAAACAAGCAACCTCTTGGCCAGACATTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATATTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTCTATTTTCCTAGGAACAGCACAGTGGAGTGGCAACCTCACTCCCCAAATTGTGATGTATGCCATACTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCATCAAGTGTACAATATGGCAAACGTGTGAAGACCATTGTGGAACGTGGTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCA{AG}TTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCC{CT}GTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGGTAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAATCAACACGTTTCTCAGTTGTAGCCAGTACCATAAAATGTACAGGACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTAGATA{CT}GATGCAGCCTTGGTTTGTGCCTTAAAGGACATAGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTAGATGACTATTTGAATGGTCCCTTCACCGTGACAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTAATGAACATTGTCATTGCACATGGTAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTATGCCTTATGCTAGCAGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTAAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTAGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTACACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCGAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGAACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCGTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAGCTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACAGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTGAAAATGAAACCAACCTTCTTCTCCAAAGACTCATGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAACAATAGCAAGAAAATGGTGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCAGGGGAAAAGCGTGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCATTCCA{CT}GTTTCAATTGCCAGAGATGATACAATCTACATATTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAATTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATATTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGGTACCACTCCGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCAAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGATGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Gallus_gallus TAAAGTGAGGCCATTTCAAAAAGAACCTTCTGATAAAAGCCAATGCATAAACAAGGATCAAGAACAAGAGGTAGCTTCT------------------------------------------------------------ACAGACAAAAACATCACGCTGCATAAAGATGAAGAAGTTCCAAGAGGAGAAAAGTTAATTCTGACACAGAAGGACTTCATGGGCAATACG---CAAGCACTTGAGAAAGATGTCAAT---------GACATGAAAATACAAGACAAC---ACAGCTCACCAGAACAACCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCGTTTAAAACTGATTGCTACAAGAGAACTCATCCAGTACATGGACCAGTAGATGATGAAACTCTGTGGCTACTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGATCTTATTGCAAAAGTTTTCAAGATTGATGTGAGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATCCACAGGAAATTCAGTAATACTCCATGTGAAGTTTATTTTCCTAGGAACAGCACGATGGAGTGGCAGCCCCACTCTGCAAACTGTGAAGTGTGCCACACGCCCAGCCGGGGAGTCAAGAGAAAGAGCCAACCACCCAACGTACAACATGGCAAACGTGTGAAGATCATTGCAGAACGTGCTCGAGTTAACAGAGGCATAAAGAACCAA------------GTG---ATAAAGAACAAAAATGTAATGAAAGAGATTACAAACTGCAAGAACAGACATCTCAGCACCAAACTGCTTGCAGTTGATTATCCAGCAGATTTCATTAAATCCATCTCTTGCCAGATCTGTGAGCATATTTTGGCAGACCCAGTGGAAACAACGTGTAGACACTTGTTTTGCAGAACTTGCATTCTCAGTTGCATCAAAGTTATGGGATGCTATTGCCCTTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGAGCATAAGATGCCCTGTTCCAGAATGTGATGAAGAGATCTTGCACGGAAAATATGGCCAACACTTCTCTAACCACAAGGAGATGAAAGATAAAGAGCTCTATAACCCCATAAATAAAGGTGGCCGACCAAGGCAGCATCTTCTGTCTTTGACCAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAACGAACACAAGCAAGCAGATGAATTGGAGGCTATAATGCAAGGCAGAGGATCTGGACTTCATCCCGCTGTTTGCCTGGCAATACGAATCAACACTTTTCTCAGCTGTAGCCAGTATCACAAAATGTACCGAACTGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCACTGCATGCTCTTCGCACCGCCGAGAAAGCCCTCTTACCAGGTTATCATCCTTTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTACCCCTCTCGATTGATGACTACCCAATAGACACAATTGCAAAGAGATTTCGATATGATACAGCCTTGGTTTCTGCTTTAAAGGACATGGAGGAAGAAATCTTGGAGGGCATGAAGGCAAAAAACCTGGATGACTATCTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTGCTGTGACGGAATGGGAGATGTCAGCGAGAAGCATGGAAGTGGTCCTGCTGTCCCAGAGAAGGCTGTACGCTTTTCATTTACAGTCATGAACATTGCTATAGACCACGAGAACGAAAGGATAAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGTCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTCAGCCCTCTCATAGCAGAGAGAGAGGCTATGAAGAACAGTGAACTGCTTCTTGAAATAGGAGGCATCCTGAGAACATTCAAATTCATCTTTCGAGGTACAGGCTATGATGAGAAACTTGTAAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATCTGTACCCTCTGTGATGCAACCCGCCTAGAGGCCTCCCAGAATTTGGTCTTCCACTCCATCACCAGGAGCCACACTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATAGAGACTGTTCCCTCCATAGACGCGTTGCACTGTGACATTGGCAACGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAAGTCTATAAGAATCCTGATGCGACTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAAATTAAAACCTATGATGAGGATGAGTGGGAACTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAAATGAAACCAGTATGGCGATCTTCGTGCCCTGCCAAAGAGTGTCCAGAATTGCTGTGCCAGTACAGCTATAATTCACAGCGTTTTGCGGAGCTCCTGTCTACCAAGTTTAAATACAGATATGAGGGCAAGATTACCAATTATTTCCACAAAACCCTTGCTCATGTACCTGAAATCATTGAAAGAGATGGGTCCATTGGTGCTTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTATTTAGGAGGTTCCGAAAAATGAATGCGAGGCAGTCCAAATTCTATGAAATGGAGGATGTCTTA----------CCACGGGTGTTTTCTTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAGGGATTCATGTTACCTTCCCCCACTCCGCTACCCAGCTATTTGCACACTTAGAGGCAACGGGGAGTCTGATAAGCACCAGTACATCATTCATGGTGGGAAAACACCTAACAATGATCTTTCTGATAAGATTTACATTATGAGTATGGTAAACAAAACTACCAAGAAAACCACATTTCAGTGCATTGAGAAAGATCTAGGTGGAGATGTCCCTGAAGCTAGATACGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGATTGTTATATTTGGAGGTAGATCATATATTCCTCTTGCACAGAGAACTACTGAAAAATGGAATAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCATGTTTCAGTTGCCAGGGATGATACAATCTACATTCTGGGAGGCCATTCACTTCAAAACAACACCCGGCCTCCCAGCCTATACAAGCTAAAAGTTGATCTCCCGCTGGGCAGCCCATGCGTGACCTGCTCTATCTTGCCAGGGGGAATATCTGTGTCGAGTGGTATTGTGACTCAGACTGGTGATACTGAATTTGTCCTTGTTGGGGGCTACCAGTCTGACAACCAGAAACGGATGATCTGTAACACTATAGTTTTGGAAGATAATAAAATAGAGATTGTTGAAAGGGTGAGCCCAGACTGGACACCTGATATTAAGCACTGTAGGATGTGGTTTGGCTGTGATATGGGCAAAGGGTCCGTATTGTTGGGCATTCCTGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAACAAAGCAGAAGAGGATGAAGAGGAAGAACTGACAGCACAAACATGCAGTCAGGCATCTACCGAAGACCAAGGAGACTCCACTCCATTTGAAGATTCCGAAGAGTTTTCTTTCAGTGCTGAAGCCAGTAGCTTTGATGTTGATGACATTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGGTACTGGATCATCTGCTGTGCC Garrulax_milleti CAAATTGCGATCATTTGAAAAAACACCTTCTGAAGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCGTAAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAGACACAAGACAAC---AGAGCTCATCAGAGCAATCTGAACCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTTGCAAGAGAATTTACCCAGTGCATGGACCAGTGGATGAGGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACCGCAACCTCTTGGCCAGATCTGATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCGCAATGCAGTGGCAACCACATTCCCCAAACTGTGATGTGTGCCATACTACCAGACAAGGAGTCAAGAGAAAGAAACAGCTCCCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTTGATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTCAAATGTATCAGGGTTATGGGCAGCTATTGCCCCACCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTCTCTGGTCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAAAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCCAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAGTGGCCCCTTCACTGTG{CG}TAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTATAAGAATCCTGATGTGTCTAAAGTGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCGCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACGCCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGGTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCGCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCA{CT}GTATCAATTGCTAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGTACCATCCTGTCTGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAAACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGATACCTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Grallina_cyanoleuca TAAATTGCGACCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGACTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAG{CG}AGAAAAG---------------ATGGAGTTAGCAGGCAATAGG---CAGGGACTCGAGGAAGATGCCCAT---------GCCATACAAACAGAAGACAAC---ATAGCTCATCAAAACATTTTGAAAGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACAGATTGCTACAAGAGGACTTACCCGGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCGCACTCCCCAAAGTG{CT}GATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATGTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAG{AG}AATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAG{AG}GATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGACCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTCGATTCGTCTTTAGGGGTACAGGGTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGAC{CG}GTTCCCTCCATAGATGCCTTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAACTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTC{CT}TATCTACAAAGTTCAAGTATAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAATCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTCCATAGCCGGGGAAAAAGCAT{AG}AGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCA{CT}GTTTCAATGGCCAGAGATGACACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTGAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACC{AG}TAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCGGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAA{GT}TAA{GT}CCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCCAGTGAAGACCC{AT}GGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCT{AG}TGCC Gymnorhina_tibicen TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACGTAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGATTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTAGCCACAACGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCGGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACGAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTC{CG}TCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGAC{AG}TTCCAATGCATTGAGAAAGA{CG}CTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAACATAAGTGTTCTGTTTGGAGGTAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACAT{CT}TTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTCTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTACTCCCAGATGCGAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Hirundo_pyrrhonota TAAATTACGATCATTTGAAAAAACACCCTCAGATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTGACCCTGCATAAAGATGAAGCAGTGTCAA{CG}ACGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CATGGACTTGAGGAAGATGTCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTCACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGACGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGACAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAAGATATACACCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCCGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTTTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGCGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGTTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTCCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCC{CT}CTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGA{CT}GATTACCCAGTAGACACAATTGCAAAAAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGGATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAACGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTCAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATA{CT}GAAATATGGAGGTCCAACCCATATCATGAGTCTG{CT}TGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCATTGCGACATTGGAAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAAAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAATGTGAGGAGAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCAATGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCACAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACTTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTGTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAAAGATGATACAGTCTACATCTTGGGAGGCTACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTTCTTGT{CT}GGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATGGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCAGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATTCCAGATGCAAACTACTTCTACATTTTGAGGTGCAAAGGAGAAGAGGACAAAGAAGAAGAA---TTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGATGCTGGAGACACTGCTCCACTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAGACAGGCTACTGGATCACCTGTTGTGCC Hirundo_rustica TAAATTGCGATCATTTGAAAAAACACCCTCAGATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTGACCCTGCATAAAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ATGGA{AG}TTAACGGGCAATAGG---CATGGACTTGAGGAAGATGTCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTCACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGACGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGGTAAGGTTTTCAAGATTGATGTG{AC}GAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAGTCAAGAGAAAAAGACAGCCCCCA{AT}GTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAAGATATACACCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCCGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTG{AG}GTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTTTCCAGCCACAGGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGACGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCAC{AT}GCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGA{CT}GATTACCCAGTAGACACAATTGCAAAGAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAACGAGAGGCTATGAAGAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTCAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGAAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAAAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGTGAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGC{AG}TGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTGTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACGCTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTAATGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGGTGCAAAAGAGAAGAGGATAAGGAAGAAGAA---TTGA{CT}AACACAAA{AT}TTGCAGCCAGACGTCAAGTGAAGATGCTGGAGACACTGCTCCACTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAGACAGGCTACTGGATCACCTGTTGTACC Hylophilus_poicilotis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAGAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAAAGGGCAACAGG---CAGGGACTGGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTCTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTGCAACGTGGCAAATGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCCGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGCGGTCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGGCTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAAATCTTTCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCCCATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGTTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACAGCAATCTTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATGTAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTA{CT}CCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGTGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGATGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGACTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTCCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCACTAATACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Icterus_parisorum TAAATTGCGATCATTCCAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCC------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATACAAGACAAC---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACAC{CT}ATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTTTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTGCAACATGGCAAACGTGTAAAAAAGACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACATATCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATCGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCAACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAAT{CT}TGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTTTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCGGTGTGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGCAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGATTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATAAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGAGGGAAGTGGAAGGGCTTGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCATGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATTCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGCAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCCTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGGGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTCTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGC{CT}ATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGCGGCTACCTCTCAGACAACCAGAAACGGCTGGTATGTAACACCATAGTTTTGGAGGATAATAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACAGCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAAATGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGAAGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Irena_cyanogaster TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAA---------GCCATGAAAACACAAGGCAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTAAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGAGATGTTGATACTATCCATCCCACTCTATTTTGTCACAACTGTCGGAGTATTATGCATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCATTCCCCAGACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCTCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGGACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGGAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCTCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGGTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATTCTCTTCGCACGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCTCTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCGGTCTCAATTGATGATTACCCAGTAGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAACAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCGCATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTAATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGTGTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCCTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTATCTAAAGAGGAGAGGAAGAGGTGGCAG{CT}TGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCGGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCT{AG}AAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTATTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTCGTTCATAGCAGGGGGAAAAGCATGAGTGTTCTATTTGGAGGGCGGTCATACACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTCGCCGTCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAGTTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCCCTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGAGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCAAGCAAACA{AG}ATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGA{AG}GAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTCGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATATGTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Lalage_leucomela TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATGTAAACAAAGATCAGGTAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAGAGATGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACGTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGACGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCACAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGTTCGGCTAAACAGGAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGGTTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGAATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAAATCTTGGAAGGTATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACCGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTTGGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTGATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCAGCTCTTTGCACACTCAGAAGCGATGC{AC}AGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAG{CT}CTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTGCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGAC{CT}TGCACCATCCTGCCAGGGGGTTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACG{AG}TTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Lanius_excubitor TAAATTGCGATCATTTGAGAAAACATCCTCTGATGGCAGCCAGCACGTAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCTTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAAG---CACAGACTTGAGGAAGATGCCCAT---------GTGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCGTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACAACGTGGAAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAATAGAGGTGTAAAGAACCAA------------GCACGGATAAACAACAAAAATATAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATAGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGAGTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTTAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCTGTGTGGCGATCCTCATGCCCTGCCAAGGAATGCCCAGAACTGCTATGTCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTTGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATATACTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAGAATAACATCAGGTCCCCCAACTTGTATAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTCTAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGCGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGATGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAGGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Loboparadisaea_sericea TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAGCAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGTGTTAACGGGCAATGGG---CAGGGACTTGAGGAAGATGCCCGT---------GCCATGAAAATACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACACTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCATAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCAGACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATATACAACGTGGCAAACGTGTCAAAACCACTGCGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATCCATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACTCCAGTGAAATCCTTCCTAAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCGTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGACGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAATATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGAGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACTCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACGAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCACTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTACAGCTACAACTCACAGCGTTTTGCAGAGCTCTTGTCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCGAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCGTTGATGTAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCGTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGAGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACTACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCGGGAGGGATATCCGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATACAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGATAGCACAAATTTGCAGTCAGACCTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Malurus_melanocephalus TAAATTGCGATCATTTGAAAAAGCAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCAAAATGATGAG{GT}CTGTGCCAAGAGGAGAAAAG---------------ATTAAGATAGCAGGTGATAGG---CAGG{CG}ACTTGAGGAAAATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTCTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGCGATGTGTGCCATATTACCAGGCAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACG{CT}{AG}TCAAAACCACTGGGGAACGCGCTCGGTTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTGATGAAAGAGATTGTCAATTGCAATGATATACATCTCAGCACCAAGCTGCTTGC{AC}ATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTTCTGAGTATCCTTGATAACCTGAGTATTAGATGCCCTGTAAAGGAATGTGGTGAAGAGGTCTTGCATGGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATCAAAGATAGAGAGCTCTACAGCTACGTAAACAAAGGTGGCCGACCAAGGCTTCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCT{CT}TGCATGCTCTTCGCAA{CT}GCTGAGAAAGCCCTCTTACCAGGTTACCACCCATTCGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCCT{AG}GTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGATTATTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCA{AG}AGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAGCACATGGCAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAA{CT}GTTTAGATT{CT}GTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGTTATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCAAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACAT{CT}GGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACCCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCAATGCTGAAGATGAG{CT}GGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCTTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGCTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACGAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGTAATGAATCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAACGAGCTCAAAATGAAACCAGCCCTCTTCTCTAAAGATTCATGTTACCTTCCCCCTCTCCGTTA{CT}CCTGC{CT}CTTTGCA{CT}ACTCAGAAGTGATGCTAGTTCTGATGAGTACCAGTATATCATCCATGGAGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCA{AG}TGCATTGAGAAAGACCTGTGTGGAGATGTCCCCGAAGCTAGATATGGGCATACAATTAATGTCGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACTAC{CT}GAAAAATGGAACAGTGTGGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTCCC{AG}GAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACACGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCAC{GT}CTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGCGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCTAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTAAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGA{AG}TTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTATTGGATCACGTGCTGTGCC Manucodia_atra TAAATTGCGATCGTTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGTGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCCTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATAGTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAAGCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATGTTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGGTTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCCTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGCACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGG{CT}TGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGAC{CT}GTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGC{CT}TTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CT}GCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACGTGCACCGTCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCG{AT}TAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGA{CT}GTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Manucodia_chalybata TAAATTGCGATCGTTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATGAAGACGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCCTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATAGTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAAGCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATGTTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCT{AG}AGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCT{CG}TCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGGTTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGCACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGC{CT}TTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAAC{CT}TGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACGTGCACCGTCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGCTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Melampitta_gigantea TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACTGAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGAGTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCGATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGGAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTCCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCC{AT}GTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACAGCCAACACCTCTCCAGCCACAAAGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCATCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTACATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACTATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCCAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAACGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACTCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCGAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCGGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCTATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Melampitta_lugubris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATACAGATGAAGC{AG}GTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACAGAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGAGTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCGATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGGAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTCCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCATCTC{CT}TGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTACATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCC{AG}TTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCCAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCA{AG}AAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGCGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGATAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTC{AG}TATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCAT{CT}GGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCA{AG}CTTGTACAAGGTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCA{AG}CAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Melanocharis_nigra TAAATTGCGATCATTTGAAAAAACACCCTCCGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------CCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---GGAGATCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCTCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAGACAACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGCCTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGAAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTATGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGA{AG}CTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAG{AG}TGGCAGTTGACTCTCGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCCATGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTC{AG}TGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACATTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGT{AG}TTGAGAAGGACCTGGGTGGAGATGT{CG}CCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGTGTGAGTGTTCTATTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAA{CT}CACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCC{AG}TCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGA{CG}TTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACTCAGGTCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGCAAGATAGAGATTATTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCCAA{CT}AGCTTTGACGTTGGTGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Melanocharis_versteri TAAATTGCGATCATTTGAAAAAACACCCTCCAATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------CCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGATCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCTCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGG{AT}GTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGCCTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGAAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTATGCTGTAAGCCCTTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAAAAACTTGTGCGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCACGCTGAAAATCTAGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATCGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTCGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAACGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAGGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACA{AG}TCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGCAAGATAGAGATTATTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Melanodryas_cucullata TAAATTGCGATCATTTGAAAAAACACCCTCTGGTGACAGCCAG{AC}ACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAGGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGATGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATAGTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCACCGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGACTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAATCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAGAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAATGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTCTGCCTTAAAGGATATGGAAGAGGAGATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAATTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGTGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCAGAGCCGGGGAAAAAGCATGAGTGTTTTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAATTTGGATGCTGTACGTCATAC{AG}TACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAATTTGTACAAGCTAAAAATTGATTTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAAAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGA{CT}GCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGA{CT}GATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Meliphaga_analoga CAAATTGCGATCATTTGAAAAAATAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAGGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAAGAAAAAAG---------------ATGGAGTTAATGGGTGACAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCTTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACCGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAAGCGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACTACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCCAAACAGAGGTGTAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCA{CT}ATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCCACTGATCTG{AG}TAAC{CT}CCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCATCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCATGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTGAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGGATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGG{AC}ATGGGAGATGTCAGTGAGAAGCA{CT}GGAAGTGGGCCTGCTGTCCC{AG}GAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATG{CT}TGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAG{AG}TTCATCTTTAGGGGTACAGGATATGATGAGAAACTCCTCCGGGAAGTAGAAGGGCT{AG}GAGGC{CT}TCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCA{CT}GAATCTGTTGATGA{AG}CTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTAT{CT}GAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTGATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATCACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCC{CT}ACTGGTGTTTTCGTCCTCGATATAAAGCAGAATGAGCT{CG}AAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTGCGCTACCCTGCTCTTTGTACGCTCAGA{AG}GCGA{CT}GCAAGCAATGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCCAG{AG}TATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCAT{AG}TGTGTTCTGTTCGGAGGGCGATCGTATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATC{CT}TGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACA{AG}GCTAAAAAT{CT}GATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACTATAGTTCTAGAAGA{CT}AGTAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTCTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGCGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGGTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGGCATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Menura_novaehollandiae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAACACATAAACAAAGATCAGGCACAAGAGGCTGCTTCT------------------------------------------------------------TCAAATGAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGACAATAGG---CAGGGACTTGAGAAAGATGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAGGCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCGGTGGATGATGAAACTATGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCTCTAAGGTGTTCAAGATTGATGTGCGAGGCGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACACAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATGTTTTGGCAGATCCTGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGTGTATAAGATGCCCTATACAGGAATGTGATCAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAGGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGGGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTAAAAAATGTATCCACAAACACAGAAGTGGGCATTATAGATGGACTATCAGGATTGCCACTCTCTATTGATGACTATCCAGTGGACACAATTGCAAAGAGATTTCGCTATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTCTCTTTCACAGTCATGAACATTTCTGTAGCACATGAGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGTAAGCCCTTGTGCCTTATGCTCGCTGATGAATCTGATCATGAAATTCTGACTGCAATCCTGAGCCCCCTCATCGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGATCCTTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATGTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCTTACCACGAATCTGTTGACGACCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCCAAAGAGGAGAGGAAGCGGTGGCAGTTGACTCTTGATAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGCTGAGAATGACTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAATTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACCAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTGCTTCTCTAAAGACTCATGTTACCTTCCGCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAGGTCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGACATTCCAATGCAGTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAGAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACTTCATACATACTCCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAACAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTTCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCGAGTGCTATAGTGACTCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCTTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATCGATGATACTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Microeca_papuana TAAATTGCGATCATTTGAAAAAACACCCTCCGATGACAGCCAGCACATAAACAAAGATCAGGCAGAGGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTGCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCATATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTAGCAAACGTGTCAAAACCACCGGGGAATGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATC{AG}TCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGACTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCC{CG}TCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGATATGAAAGACGGAGAGGTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCTGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCCGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCAAGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACAAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAACGAAAGCAAAAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTGGAACTGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTC{CT}TGCGGGAAGTGGAAGGGCTGGAGGC{CT}TCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTGGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATTAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTCATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTAGGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATATGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGTAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTATGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCC{CT}GGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAACAGGACAAGGAAGAAGAATTAATAACGCAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTTCC Mimus_patagonicus TAAATTGCGCTCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATTCTGCATAAAGATGAAGCAGGACCAAGACGAGAAAAG---------------ATGGAGTTAATGGGAAATAGG---CAGGCACTTGAGGAAGATGCCCAC---------GCCGTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACCATCCATCCCACTCAATTTTGTCGCAACTGTTGGAGTATTATACATAGCAAATACAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGGGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACCACGTGGTAAACGTGTCAAAACCACTGGTGAACGTGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTAAATCGATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGCAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTACAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCCCTTACAAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAGATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACTGAAGTGGGAATTATAGATGGACTATCAGGACTGCCAGTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAACACAAGGGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCCGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGG{AC}AATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAACTTACTTTATGAGTCTGGTAAACAAAGCCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAGTCAATGTAGTTCATAGCCGGGGGAAAAGCGTGACTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCTCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACCTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACTGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAGGGGTCTGTTCTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACGTTTTGAGATGCAAAGAGGCAGAAGAAGACAAGGAAGAAGAATTGATA------ATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAGGAAGACGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Mionectes_macconnellii TAAAGTGCAACCATTTGAAAAAATGCCCTCTGATGACAAGCAGCACATACACAAAGATCAGGCAGAAGGGATTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATAAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCTGT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCGTTTAAAACTGATTGCTACAAGAGGACTCATCCCGTGCATGGGCCGGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCTACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTGTCCATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATCCATAGAAAATACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGACACCAAGTATACAACAAGGCAAACGTGTGAAGACCACCGTGGAACGTGCCCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAACAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCATGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAGCTTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAATCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTATAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGCGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCGAAAAACGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGTCTTCATCCCGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCACAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCACGCTCTTCGCACGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAGGTGGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGATACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCGAAAAACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTTCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGCTGCAAGCCCCTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACCCTAACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGGGGCATCCTGAGAACGTTCAGGTTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTTTGGATAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTACTGTGCCAGTATAGCTACAATTCACA{AG}CGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGAGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAATCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTCTTCCTGCTTGATATAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTAGTAAGCAAAAGTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGAGCTGGGGGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGCTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATAGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGTTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTATGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGATCTGTATTGCTGGGCATCCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGACGACCCTGGAGATTCCACTCCATTTGAAGACTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACTGGTTACTGGATCACCTGCTGTGCC Modulatrix_stictigula TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAATCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACTGGCAATAGG---CAGGGACTTGAAGAAGATGCCCAT---------GCCATGAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTG?CGCATCTGTGGAGTTCCATTTAAAATTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCTACCCCATTCCCCAAACTGTGATGTGTGCCATGTTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAAACAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGACCCAGTGGAAACAACATGTAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCGCTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTACTGCTTGAAATGGGAGGCATCCTGCGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCATCCATAGATGCATTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAATCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCCAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTAGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGCTTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGATAAAAATTGAT{CT}TACCCCTGGGCAGCCCAGCGGTGACCTGCAGCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTGTGGAAGATAGTAAGATAGAGATTATTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATACTCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAGGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTA?TGGATCACCTGCTGT?CC Monarcha_axillaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------AT{AG}GAGTTAGCGGGCAATAGG---CAGGGACTCGAGGAAGATGCCCAT---------GCC{AG}TGCAAACAGAAGACAAT---A{CT}AGCTCATCAAAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCTAAA{AG}TGCAATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGTAGTAGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACATGCATCCTTAAATGTATCAGGGTTATGGGAAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGCGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATACAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCGGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAA{AT}TGGGAGG{CG}ATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTAC{AC}CTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCA{CT}GAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTC{CT}GGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCAATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGGGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCGTACATTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGACACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCGCTGTCAAGTGCTATAGTGACCCAGATCAGTGATACGGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCGTAGTTCTGGAAGATAGCAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCTGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCAGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGGTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Monarcha_chrysomela TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAGCTGGCAATAGG---CAGGGACTCGAGGAAGATGCCCAT---------GCCATGCAAACAGAAGACAAT---ATAGCTCATCAAAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAGTGCGATGTGTGCCATCCTACCAGACAAGGAGTCAAGAGAAAAAGCCGGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAAATAAACAACAAAAA{CT}TTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGTAGTAGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACATGCATCCTTAAATGTATCAGGGTTATGGGAAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTTTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCT{AG}AGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGTTGGCTGACGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAG{AG}TTCGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATTTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACAGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTAGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTTTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATC{AG}TACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGACACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACAGAATTTGTCCTTGT{CT}GGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACC{AG}TAGTGCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTACTGGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCTGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCAGGAGACTCCACTCC{AG}TTTGAAGACTC{AG}GA{AG}GAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Motacilla_cinerea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATATG---CAGGGACTTGAGGAAGAT---------------GCTGTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCACTTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTTAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGGGGCAAACGTGTAAAAGCCACTGGGGAAC{AG}TGCTCAGCTAAACAGAGGTATAAAGAACCAGCAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTG{CT}AGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAATATTCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGA?GAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTATCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATG{CT}TGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTT{AG}CGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGGAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTC{GT}AAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAGGTGTGAGGAAAGGCATGAAGCCCT{AT}AAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTC{AG}TGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTTTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACGAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGA{CT}GTGCCTGAGGCTAGATATGGGCATTCAATTAACGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATATGCTTCCAGAGCTTCAAGACGGACTTTCTTTCCACGTCTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCC{CT}AACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCCATAGTGACCCAGGTCAGTGACAATGAATTTGTCCTTGTCGGTGGCTATCACTCAGACAACCAAAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTGTTGCTGGGCATTCCAGGAGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAGGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Muscicapa_ferruginea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCT---TCT------------------------------------------------------------TCAAACAAGGAACT{CT}ATTCTGCATAAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAATGGGCAAT{AC}GG---CAGGCACTTGAGGAAGATGCCCAC---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGTATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGA{CT}GTGCGAGGGGATGTTGATACCATCCATCCCACTCACTTTTGTCACAACTGTTGGAGTATTATACACAGCAAATACAGTAATACTCTATGTGAAGT{AG}TATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGCGATGTGTGCCATACTATCAGGAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATGTACAGCGTGGCAAACGGGTCAAAACCACCGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGTACCAAGCTGCTTGCAGTTGATTATCCACCAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAGAGGAGTGTGATGAAGAGATCATGCATGGAAGGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACCGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTGCTGTCTCTGACCAG{AG}AGAGCTCAGAAACATCGTCTGAGGGAACTGAAACG{CT}CAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGG{AT}TCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTA{CT}CATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGGTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTCCCACTCTCAATTGATGATTACCCAGTAGACACTATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGTACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAACTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTC{AG}TCTT{CT}AGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACGTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCACGAAGCCTTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAGCTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAA{CT}TGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAA{AG}CAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTCTGCACGCTCAGAAGTGATGCAGAGGCTGATGAGTATCAGTACATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGACAAGATTTACTGTATGAGTCTGGTAAACAAAACTAGCAAGAGAATGACATTCCGATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGACTGTTCTCTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTCTCAATTGCCAGATATGATACAATTTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGACCTACCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTG{CT}AGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTT{CT}TGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCGAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAAGAAGAATT{AG}ATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTC{AG}GAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Nectarinia_olivacea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGTATAAATATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTGCAAGACAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAGA{AT}CAGCAACCTCTTGGCCAGAACTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTTCCAGACGAGGAATCAAGAGAAAAAGCCAGCCTCCAAGTGTAAAACGCGGCAAACGTGTCAAAACCACTCAG------------CTAAATAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAACTGCTTGCAGTTGATTTCCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCT{CT}AAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCTTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTCAAGGAATGTAATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAGAGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGCATCAATACATTTCTCAGCTGCAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCT{CT}CGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGTCCCTTCACAGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTCTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTACTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGGTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAAAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGGAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCTTGTCCAACTGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTCAAAATGAAACCTGT{CG}TTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCT{AC}CGGTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGGCTGATGAGCACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTTTGGTAAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAG{CT}GTGAGTGTTCTGTTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTT{CT}TCATTGACTTTGAGTTTGGATGCTGTACATCATACATACTTCCTGAGCTTCAAGATGGACTTTCTTTCCACGTTTCGATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATTCCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAG{CT}GTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTGAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAGAGGAAC{AG}GAAGAGGACAAGGAAGAAGAATTGGTAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Neodrepanis_coruscans TAAAGTGCGAACATTTGAAAAAACTCCCTCTGATGGGAAGCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAACAGC---CAGGCAGTTGAGAAAGATGCCCAT---------GACATTAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTACATGGGCCAGTGGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGAT{AG}TTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATTCATAGAAAATTCAGTAATGTTCCATGTGAAGTATATTTTCCCAGGAACAGCATGATGGAGTGGCAACCTCACTCCCCAAAGTGTGATGTATGTCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACTGAGTATACAACATGGAAAACGTGTGAAGACCATTGTGGAATGTACTCGATTAAACAGAGGTGTAAAGAACCAA------------GCACAAAGAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCATTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGCGGCCGACCAAGGCAGCATCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATTACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCGCTAACGCAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAATCTGGATGACTGTTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGGTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAGGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAACAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGAGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAACCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTGATGGACCTTTATCTCAGGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGGAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCAAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGTGTACTCGGGAGCAATGCAAAGTCTGATGAGTACCACTATATCATCCATGGTGGTAAAACACCTAACAATGACCTGTCTGATAAGATTTACTTTATGAGTCTGATAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAGTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCGGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGAAGATACTATATACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACTATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAAATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCCGTGACCTGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACGACACAAATTTGCAGTCAGACATCAAATGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTCAGTGCTGAAGCCAATAGCTTTGACATTGGTGATAATGATACTTACAATGAGAATGATGAAGAAGATGAATCAGAAACAGGCTACTGGACCACCTGCTCTGCC Oedistoma_iliolophum TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACGAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGC{CT}CAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTG{CT}GGAGTTTCATTTAAAACTGATTG{CT}TACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAGGACAGCCCCCAAGTGTACAGCGTGGCAAACGGGTCAAAA{CT}CACTGGGGAACGGGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGA{CT}TGTCAATTGCAAGGATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGA{AG}CATCCT{CT}GATAACGTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAAGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCCGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGA{AG}GGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCC{AC}TTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGACTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGGTATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGC{AC}AGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGG{CG}AAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTGCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCTGTGTTTCTCATTGATTTTGAGTTTGGTTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCGAGTGCTATAGTGACCCAGGTCAGTGATACT{AG}AATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGCGTGTAACACCGTAGTTCTGGAAGATAACAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTGGC Oreoica_gutturalis TAAATTGCGATCATTTCAGAAAACACCCTCTGATGACAGGCAGCACATAAACAAAGGTCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTTATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGCGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATAATACACAGAAAATTCAGCAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGGTGTAAAGAACCAA------------{AG}CACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTCAACACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTT{AG}GCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGC{AG}TATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGA{CT}AGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAACTGGAGGCTATACTGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAGACCCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCGTCTTTAGGGGTACAGGATATGATGAGAAGCTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTG{CG}CAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGTTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCATGCTCAGAAGCGATGCAAGGGCTGGTGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAG{AG}TTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATCGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCA{CG}{AG}GGGAATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGGTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCCTTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTCTACATGTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAAGCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Oriolus_larvatus TAAATTGCGATCATTTGAAAAAACGCCCTCTGATGACAGCCAGCACATAAACAAAGGTCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACGGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACCGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAG{AG}TTAACAACAAAAATTTAATGAAAGAAATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCGTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCA{CT}CTCCTGTCTTTGACGAGGAGAGCACAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATACTGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTGTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGATATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACGATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCTTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAA{AG}CTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTATCTAAAGAGGAGAGGAAGAGGTGGCAGCTGAC{AG}CTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAACTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCGGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCATGCTCAGAAGTGATGCAAAGGCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGA{CT}CTTTCTGATAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGATCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAAAGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGA{CG}ATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTATATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTGCATT{GT}GAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATTGCTTTGATGTTGATGATGCCGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Oriolus_xanthonotus TAAATTGCGATCATTTGAAAAAACAC{CT}CTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCGGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACCGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATTAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCGTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCGCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACGATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCTTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACGCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGC{CT}AAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCGGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCGCTTTGCACACTCAGAAGTGATGCAAAGGCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTTTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGATCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCC{AG}GGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAAAGGTTGGTGTGCAACAGCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTACTGGG{AC}ATTCCAGGGGCCA{AG}CAAACAATTAATCCCAGATGCAAACTACTTCTATATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTGCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCCGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Orthonyx_spaldingii TAAATTGCGATCATTTGAAAAAACACCTTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGGAAGACGCCCAT---------GCCATCAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTTTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTCATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTAGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGGAGAGATCTTGCATGGAAAATATGGCCAACACCTTTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGTCTGGCCATCCGGATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATCTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCTCACGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGCGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAAACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAACGAGTCTGGAAACAAACTCTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAACCAGAGTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAAGCTGATGAGTTCCAGTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACTTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAG{CG}CCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGATTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACACCCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCCGGGGCCAACAAACAACTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGTAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Orthonyx_teminckii TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTAT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCA{AG}TGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATCAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTCATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGT{AG}TATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGCCGAGGAGTCAAGAGAAAATGCCAGCCCCCAACTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATGTCTTGCCAGATTTGTGATCATATTTTAGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCGTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTTTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGTCTGGCCATCCGGATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATCTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCTCATGGGGATGAAAGCACGAGGGTCTTCGAAGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCAGAAAATCTGCAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATA{CT}GAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTCTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAACCAGAGTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCAAAAGCTGATAAGTTCCAGTATATCATCCACGGTGGCAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCTAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGATTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACACCCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCCGGGGCCAACAAACAACTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGTAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pachycephala_hyperthra TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAAACACTGTTTCT------------------------------------------------------------TCAAACAAAGAATGCATCCTGCATAACAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGATTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---ACAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGCGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCAATACTACCAGGCAAGGAGTCAAGAGAAAAAGCCAGCCCCTAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCGCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCAGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACTGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCAAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGATGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTAATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAGAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGACCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACGGAAGAGGACAAGGAAGATGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTTTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACTGGCTACTGGATCACCTGCTGTGCC Pachycephala_soror TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATG{CT}ATCCTGC{AG}TAACAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGATTTAACGGGCAA{CT}AGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---ACAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCC{AG}GAGCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACGCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCAATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAGCCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATCATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCAAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTT{CT}CGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCT{CT}AAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGATGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTCCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAGGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCAC{CT}CCGTTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACAATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pachycephalopsis_poliosoma TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------A{CT}GGAGTTAATGAACAAGAGA---CAGGGACTTGAGGAAGATGCCCAT---------TCTATGAAAACACAACACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTG{CG}CTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGAAACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTAT{AG}CGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACAACCCAACGAGGAGTCAAGAGAAAAAGCCAGTCCCCAA{AG}TGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGGGTGTAAAGAACCAA------------GCACA{AG}ATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAAATTTGTGATCATATTTTGGCAGATGCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTGAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTTCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGCTACATAAATAAAGGTGGCCGGCCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCCATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACGAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCGG{CT}AGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCA{AG}AAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAGACTCTGACAGCAATCCTGAGCCCCCTCAAAGCAGAAAGAGAGGCTATGAAAACCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAAC{CT}CGCTTGGAGGCATCCCAGAATCTGGTATTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCCTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGAT{AC}TTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGATGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTCGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGGAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCTTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGTTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAAAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTTTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTGAAAGTTGATTTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATCGTTCTGGAAGGTAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACTCCAGATATTAAACACTGCAGAATGTGGTTCGGCTGTGATATGGGTAAAGGATCTGTCTTGATGGGCATTCCAGGGGCCAGCAAACAGCTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTACC Paradisaea_raggiana TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGCAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTTAAGAGAAAAAGCCAGCCCCGAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTGTCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGG{CT}GATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAA{CT}CCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAGAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAACTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTTAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATC{AG}ATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGA{CT}GTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Paramythia_montium TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAACGAATTCATCCTGCATAAAGATGAAGCCGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATCATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCCAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCC{AG}AGAGTGCAACGTGGCAAACGTGTCAAAAACACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTGTCAA{CT}TGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATCAAATCCATTTCTTGCCAGATTTGCGATCATATCTTGGCAGATCCAGTGGAAACAACTTGCAGACACTTGTTTTGCAGAAGTTGCATCCTTAAGTGCATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGA{AG}ATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTCTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTTGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTCAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCTGGTTCCACTTATATTTGTACCCTATGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGCGAGCTTTACAAGAATCCTGATGTGTCTAAAGAAGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTTGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCTCTAAAAGAACTGATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAA{CG}TTCAAGTACAGATACGAGGGCAAGATTACGAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGAGCCTGGGCAAGCGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATGTAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGC{CG}ATGCAAAGGCGGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGGCATACGATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATGTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAGTTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGCGTGTAACACCTTAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGATGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pardalotus_punctatus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCCTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAGGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGATAGG---CAGGGACTTGAGAAAGATGCC---------------CTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTTCATTTAAAACGGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTAGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACTTGTCAAAACCACTGGGGAACGCACTCGGCTAAACAGAGGTGTAAAGAACCAA------------ACACAGATAGACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAATGATATACATCTCAACACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCCGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAGCCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGGAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCCCTGCAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTTTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAC{AG}AGGATCTTTGAGGAAGTAAAGCCCAATTCTGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCATGAATCAGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAGCTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGATTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAACGCGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGTTACCCCGCTCTTTGCACACTCAGAAGCGAT---GAGTCTGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAGGACCTGGGTGGGGATGTCCCTGAAGCCAGATACGGGCATACAATTAATGTAGTTCACAGCAGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGATCATATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGGTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTCCAAAATAATGCCAGGTCCCCCAACTTGTACAAGCTCAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATGGTAAGATAGGGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACATCAAGTGA{AG}GACCCTGGCGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTTCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Pardalotus_striatus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGATAGG---CAGGGACTTGAGAAAGATGCC---------------CTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTAGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACTTGTCAAAACCACTGGGGAACGCACTCGGCTAAACAGAGGTGTAAAGAACCAA------------ACACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAATGATATACATCTCAGCACCAAGCTGCTTCCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCCGGGTTATGGGCAGTTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGGAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTGCAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCTGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCATGAATCAGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTAAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGATTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAACGCGATGGGTCCATTGGG{AG}CCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGTTACCCCGCTCTTTGCACACTCAGAAGCGAT---GAGTCTGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGGGATGTCCCTGAAGCCAGATACGGGCATACAATTAATGTAGTTCACAGCAGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAG{AG}TCATATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCGTACGTACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTCCAAAATAATGCCAGGTCCCCCAACTTGTACAAGCTCAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATGGTAAGATAGGGATTGTTGAAAGTGTGAGCCC{AG}GAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGCGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTTCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Parula_americana TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGTAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGTGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGTACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAAAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTTTCTGGCCACAAGGAGATGAAAGAAGGAGAGGTCTATAGTTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCGGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCTTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCTACTAACACAGAAGTGCGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTATCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATTTGAATGGCCCATTCACCGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACA{AT}GAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATATGTGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAGAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTTTCCTTGTAGGTGGCTACCTCTCAGACAACCAGAAACGGCTAGCATGTAACACCATAGTTTTGG{AG}GGATAATAAGATAGAGATTGTTGAATGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGTGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAAGTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Parus_inornatus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCTCATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGAAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACATGCAATAGG---CAGGGTCTTGAGGAAGATGCCCAT---------GCCATGAAAACACA{AG}GACAAT---AGAGTGCATCAGACTAATCTGAAGCAATTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCGACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATGGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCGCAATGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGTAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGACATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTTCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCATTGGAAACAACGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCACGGAAAATACGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACACCAATAAAGGCGGTCGACCAAGGCAGCACCTCCTGTCCTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTTTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCTTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTGTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTTGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCTGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGTTATGATGAGAAACTCGTGCGGGAAGTGGAAGGACTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGGTATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGAGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCAATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCGCTTTGCACGCTCAGAAGCGATGCAAGGGCCGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGAAGGTCGTATACTCCTCTTGAACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCGTCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGACACTATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACAATGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGATCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCTGGTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Parus_major TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCTCATAGGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTGCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATGGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCGCAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGTAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGACATTGTCAATTGCA{AC}GGATATACATCTCAGCACCAAGCTGCTTTCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCACGGAAAATATGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGACAGAGAGCTCTGTAGCTACATCAATAAAGGTGGTCGACCAAGGCAGCACCTCCTGTCCTTGACGAGAAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTTTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGC{CT}CTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTGTCAATCGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATCTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCCGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTCGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGACTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTTAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTCTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCCTATCTACAAAGTTCAAGTACAGGTATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCAATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCACTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGAGCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGAACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCGTCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGACACTATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGATCTGCCGCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACAATGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGACTGGCATGTAA{CT}ACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGCGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGACGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Passer_montanus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATAAAGAAATCATCCT{CG}CATGAAGATGAAGCAGTGCCAAGAGAAGAAGAG---------------ATGGAGTTAACAGACAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAGGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACAGATTGTTCCAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAGGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGAGGAGGAGTCAAGAGAAAAAGCCAGCCCCCACATGTGCAACGTGGCAAACGTGTCAAAACCACTGGGAAACATGCTCAGCTAAACAGAGGTGTAAAGAACCAACAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAAGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGACTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCA{CT}AAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGCAGTCAGTATCATAAAATGTACAGAACGGTAAAAGCTGTCACTGGCAGGCAGGTCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTCTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGACGACTACTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTCAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCA{CT}GCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCGGCCAA{AG}GAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGA{AG}GGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGCGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTGTATAAGTTTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGGTATGGGCATACAATTAA{CT}GTAGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCC{AT}CTGTGTTTCTGATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCC{AT}GAACTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAA{CT}ACCAGGTCCCCTAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACAATGAATTTGTCCTCGTCGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGC{AT}TGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGAGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTCGAAGATTCGGAGGAGTTTTGTTTTGGTGCTGAAGCCAATAGCTTTGATGCTGGCGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Peneothello_bimaculatus TAAATTGCGATCATTTGAAAAAACACCCTCTGGTGACAGCCAGCACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAGGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAGT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCACTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATAGTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCAC{CT}GGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGAGTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGA{CG}ATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAGAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTGGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTCTGCCTTAAAGGATATGGAAGAGGAGATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATGAAGGAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAACAAAACAAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGTGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAATATGAGTGTTTTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAATCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Pericrocotus_ethologus TAAATTGCGATCATTTGAGAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGCGCCAAGAGGAGAAAGG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACCTGAGGAAGATGCCCATGATGCGCATGCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTGCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTCTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGCGCCAAGAGGAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTTGGGAACATGCTCGGCTAAACAGGAGTGCGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAAACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGC{AC}GACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTGAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTTCAGCCTTTGCATGCTCTCCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCCATTGATGACTACCC{AC}GTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAACACCTGGACGACTATTTGAACGGGCCCTTCAGTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGTCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCCATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAGGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAAAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAG{AG}AAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCCGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGCGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCGGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTGGCAAACAAAACTAGCAAAAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAGGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGCACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACA{AG}GCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTGTCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGTTACCACTCTGACAACCAGAAGCGGTTGGTGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGACTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Philepitta_castanea TAAAGTGCGAACATTTGAAAAAACACCCTCTGATGGCAAGCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAACAGC---CAGGCACTGGAGAAAGATGCCCAT---------GACATGAAAATACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTACATTTAAAACTGATTGGTACAAGAGAACTCATCCAGTACATGGACCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTACGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCA{CG}AACTGTTGGAGCATTATCCATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCATGGTGGAGTGGCAACCTCACTCCCCAGACTGTGATGTATGTCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAATGTACTCGATTGAACAGAGGTGTAAAGAACCAA------------GCACAAAGAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATACATCTCAGCATGAAGCTGCTTGCAGTTGATTATCCAGCAGATTTCATTAAATCAATTTCTTGCCAAATTTGTGAGCATGTTTTGGCAGATCCAGTCGAAGCAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCGTTCCTGAACATCCT{GT}GATAACTTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTATATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGCCGGCCAAGGCAGCATCTTCTATCTTTGACAAGAAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTGGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCACAAAATGTATAGAACCGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACCCAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAATCTGGATGACTGTTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAATTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAAAGATATGAAATATGGAGGTCCAATCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATATTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGACATGAAGCCCTAAAAGAACTGATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGCATACTCAGAAGCAAGGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGCTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAGAGATGACACCATTTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTACCCCAACTTGTACAAGGTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACTATCTTGCCAGGGGGAATATCGGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGATTGGTGTGTAACACCATAGTTGTGGAAAATAGTAAAATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATCTGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAAAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAACGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGATACTTACAATGAGGATGATGAA---GATGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Philesturnus_carunculatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATTCATCCTCCATAAAGATGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAACATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTTATTTAAAACTGATGGTTACAATAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATAAATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGCGCTCGGCTAAACAGAGGTATAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCGGCACCAAGCTGCTTGCCGTTGATTACCCGGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAAGGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTCGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAA{GT}GAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCTGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGCGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGTATCTTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCCTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTATAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCCCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATGTCATCCATGGTGGTAAAACACCAAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAACGTAATTCATAGCCGGGGAAAAAGC{AG}TAAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTCGGATGCTGTACATCATACATACTACCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTTACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGGTAGAGATTGTTGAAAGTCTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAAGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACATTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTGCC Picathartes_gymnocephalus TAAATTGCGATCATTTGAAAAAACACCCTCTGATAACAACCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATACATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAAG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATGCAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGCGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGTCAGCCCCCAAATGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGATTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACGTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAGTCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCACGGAAAATATGGCCAACACCTCTCCAACCACAAGGATATGAAAGATAGAGAGCTTTATAGCTACATAAATAGAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGGCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCCGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATCTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCGGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGATGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTTTGTGATGCAACGCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGATCCAACCCATATCACGAATCTGTTGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCTTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTTCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCACGCTCAGAGGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACACCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACCATCTACATCTTGGGTGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGAATATCAGTATCAAGTGCTATAGTGACCCAGATCAGTGATAATGAGTTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACGTTTTGAGATGCGAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pipra_coronata TAAAGTGCGATCATCTGAAAAAACGCCCTCTGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGGGATTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAATGACCAATAGG---CAGGCACTTGAGAAAGAGGCCCAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTATAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGCGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACCCTATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACAAGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAAGAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACGTCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTAAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAGGTAGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAATATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTAACGGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGTTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTCTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCCATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCGCCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTGTAAGTCTGGTAAGCAAAAATAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGGTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGCTATATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCTAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCATCTGTGACCTGCACCATCTTGCCAGGGCGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACGAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAAAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAACGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pitohui_cristatus TAAATTGCGATCATTTCAAAAAACACCATCTGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTTATCCCGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGCGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGGCTTCTGAAAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATAATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCTTTCCTGAACATCCTTGATAACCTGCGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATA{CT}TGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAAC{AC}GTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATTTTTGTGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAGACCCTGACG{AG}CAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCGTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCAAGAATCTGTTGATGAGCTTCGCGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTACACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGTTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCAT{GT}CTCAGAAGCGATGCAAGGGCTGGTGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCC{AG}GGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAA{AG}TGGAACAGCGTAGTTGACTGTTTGCCATCT{CG}TGTTTCTCATCGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAAC{CT}TGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCCA{CT}AGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATACTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pitta_sordida TAAAGTGCGACCATTTGAAAAAACGCCCTCTGATGGCAAGCAGCACATTAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAATAAGAAAATCCTATTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAACAGG---CAGGCACTTGAGAAAGATGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATAATCCACAGAAAATTCAGTAATAATTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGAGGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAACGTGCTCGATTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGAACATACATCTGAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAAGCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAGTATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTCTCAAGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCATTCCTGAACATCCTTGATAGCCTGACTATAAGATGCCCTATAAAGGAATGTGATGAAGAGGTCTTACATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAGTTGGAGGCTATAATGCAAGGGAGAGGATCTGGTCTTCATCCTGCTGTCTGTCTGGCAATTCGAGTCAACACATTTCTCAGCTGTAGCCAATACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTTGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTATCCAGTAGACACAATTGCAAAAAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAATCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCGGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTATGTGATGCAACTCGCTTGGAGGCATCACAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAGAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAGCAGAATTCTATAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAACCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCCAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTTGACATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATG{CT}TACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAATGCAAAGCCTGATGAGTACCAGTACATCATACATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTCATAAGCAAAAATAGCAAGAAAATGACGTTCCGATGCATTGAGAAAGATCTGGGTGGAGATGTCCCT{AG}AAGCTAGATATGGGCATACCATTAATGTAGTTCATAGC{CT}GGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATATTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTCCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCGTTCCATGTTTCAATTGCCAGAGATGATACCATCTACATTTTAGGAGGCCATTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAGGTTGATCTCCCGCTGGGCAGCCCAGCTGTGACGTGCACCATCTTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATAGTAAGATAGAGATTGTCGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCCATATTGCTTGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATACAAACTACTTCTACATTTTGAGATGCAAAG{CG}AGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATCTGTAGTCAGACATCATCCGAAGACCCTGGAGACTCCATTCC{AG}TTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGTTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Ploceus_cucullatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGTC{AC}GCACATACACAAAGATCAGGAAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCGTCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAATTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAA{AC}TGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTGCAACGTGGCAAACGTGTCAAAA{AC}CACTGGGGAACGTGTTCAGCTCAACAGAGGCGTAAAGAACCAACAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGTATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGCATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATTAACACCTTTCTCAGCTGTAGTCAGTATCA{CT}AAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACGTGGACGACTA{CT}TTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGG{CT}GATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGCGAACATTTAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTC{CT}ATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCA{CT}GAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATTAAATGTGAGGAAAGGCACGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAGGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTTTCTTCTCTAAAGACTC{CT}TGTTACCTTCCCCCTCTGCGCTACCCTGCTCTGTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTATCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGA{AG}AAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACGGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACA{AG}TCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGG{GT}ATATCAGTGTCAAGTGCTATAGTGACTCAGATCAGTGACAATGAATTTGTCCTTGTCGGTGGCTACCACTCGGACAACCAGAAACGGCTAGAGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGAT{CT}ACCTGCTGTGCC Polioptila_caerulea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCGGAAGAAACTGTT{CT}CT------------------------------------------------------------TCAAACAAGGAATTCACCCTGCATAAAGATGAAGCAGCACCAAGAGGAGAAAAG---------------ATGGAGTTAGCAGGCGACAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAATGGATAGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGCCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCATTCCCCAAACTGTGACGTGTGCCATACTACT{AG}GACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGAGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGACTGTGATGATGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGAC{AG}AAAGATAGAGAGCTCTGTAGCTACATAAACAAAGGTGGCCGACCGAGGCTGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCGGCTGTCTGTCTGGCCAT{CT}CGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGGTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACACTCAATTGATGATTACCCAGTAGAAACAATTGCAAAGAGATT{CT}CGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTGAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTGTAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCAAGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATACGATGAGAAACTTCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGATGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTAAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTTCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAGCCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACCGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCAGTACATCATATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGAGCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGCAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCTACCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGCTGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTT---TTTAGTGCTGAAGCCAACAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pomatostomus_halli TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTTT------------------------------------------------------------TCAAACAAAGACTTCATCGTGCATAAAGATAAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCCATCAAAACAGAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCCAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTATCAGTTGCAAGGATACACATCTCAACACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCAATTTCTTGCCAGGTTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGATCTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTTGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCATGGAAAATATGGCCGACACCTCTCCAGCCACAAGGATATGAAAGATAGAGATTTCCATAGCTACACAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAAGGAACTGAAACGTCAAGTGAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCCTTTGAGTGGAAACCGCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCGATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGACATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAAGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTAGATGAACTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCACGAAGCCATAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAGGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCATGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTTAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATAGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGACATACAATAAACGTAGTTCATAGCCGGGGAAAAAGTATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCCTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGGTGACACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTACCCCTGGGCAGCCCAGCTGTGAGCTGCACTATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTTGGTGGCTACCACGCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCATGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGCAGCAGAAGCAGACAAGGAAGAAGAATTGATGACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCTACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCCATAGCTTTGACACTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGG{CG}TACTGGATCACCTGCTGTGCC Pomatostomus_isidorei TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAAGAAAGATCAGGCAGAAGAGGCTGCTTTT------------------------------------------------------------TCAAACAAAGACTTCATCGTGCATAAAGATAAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCCATCAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTATCAATTGCAAGGATACACATCTCAACACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCATGGAAAATATGGCCGACACCTCTCCAGCCACAAGGATATGAAAGACAGAGATTTCCATAGCTACACAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAAGGAACTGAAACGTCAAGTGAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGCCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCCTTTGAGTGGAAACCGCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCGATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGACATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGACTGAAAGCAAGAAGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTAGATGAACTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCACGAAGCCATAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTAAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTTAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATGGAGAAAGACCTGGGTGGAGACGTGCCTGAAGCTAGATATGGACATACAATAAACGTAGTTCATAGCCAGGGAAAAAGTATGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACTGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGGTGACACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATATACCCCTGGGCAGCCCAGCTGTGAGCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACGCTGACAACCAAAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGCGGACAAGGAAGAAAAATTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCCATAGCTTTGACGCTGATGATACTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Prionops_plumatus TAAATTACGACCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACAGGCAGTAGG---CAGGGACTTGAGGAAGATACCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGTGTCAAAACCATTGGGGAACGTGGTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACCAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTGTGCCAATATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAATAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGATTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCGGTTTGCGCGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCGGATAAGATTTACTTTATGAGTCTTGTAAGCAAGACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTCGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATATCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATATACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGTAGAAGAAGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGCGAGGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Promerops_cafer TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTCCGTTTAAAACTGACTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGAT{CT}GATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATCGAAAATTCAGTAATACTCT{AG}TGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATATAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATACGGCCAACACCTCTCC{AG}GCCACAAGGACATGAAAGAGAGAGAGCTCTA{CT}AGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTCTGTT{CT}CTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAACCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTAAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCGCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCA{CT}TGCACTGTGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGATGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGCGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTGTTGTCTACAAAGTTCAAGTACAGATATGAGGGCAAGATCACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAAAGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGCTTTACTTTATGGGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCGTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAATTCATAGCCGGGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCACTTCAAAATAACATCAGGTCCCCTAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCGGCGGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGAGCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAATAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCC{CT}GGAGACTC{CT}ACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGTTGTGCT Prunella_collaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATGAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAGGATGAA{GT}CAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAACAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGATAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAGCTAATTGTTCGAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGAGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATG{CT}GAAGTGTATTTTCCTAGGAACAGCACCATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTATGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCACCTAAACAGAGGCATAAAGAACCAACAACACAAACAAGCACAGATAAACAACAAAAATTTAATGAAGGAGATCGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTAAACATCCTTGATAATCTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCATAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATTAACACGTTTCTCAGCTG{CT}AGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGGTACGATGCAGCCTTGGTCTGCGCC{CT}TAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAATCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCC{CT}AATTCTGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAG{AC}G{AG}TATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGCGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAA{AG}TACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTAAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCAGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAAAAGCGATGCAAGGGCTGATGAGCACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCCGGGGGGATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGACACTGAATTTGTTCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGACATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGGGACTCCACTCTATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Psarisomus_dalhousiae TAAAGTGCGAACATTTAAAAAAACACCCTCTGATGGCAAACAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAAGAGC---CAGGCACTTGAGAAAGATGCCCAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATTTAAAGCAGCTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACTTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACCCCATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACTGAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAACGTGCTCGATTAAACAGAGGTGTAAAGGACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATGCATCTCAGCACCAAGCTGCTTGCAGTCGATTACCCAGTAGACTTCATTAAATCAATTTCTTGCCAAATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGCTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCGTTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGCCGACCAAGGCA{AG}CATCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTGAGAGCACAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCTTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCGGTCACCGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTGTCAGGATTGCCACTCTCAGTTGATGACTACCCAATAGACACAATTGCAAAGAGGTTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAGTGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGCGAGAAGCATGGATGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCAATAGTACATGGGAATGAAAGTAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCATGAATCGGTTGATGAGCTCCG{CT}GACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTTTATAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTATTTCGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAATTTACTTTATGAGTCTTGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTCCATAGCCGGGGAAAAAGTGTGAGCGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAAAGATGATACTATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCCCTGGGCAGCCCAGCTGTGACTTGCACAATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAGTTTGTCCTTGTTGGTGGCTATCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGATGATAGGAAGATAGAGATTATTGAAAGGGTGAGCCCAGAGTGGACAGCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATCTGGGCAAAGGATCTGTATTGCTGGGCATCCCAGGGTCCAACAAGCAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAATGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTACTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAGACAGGCTACTGGATCACCTGCTCCTCC Ptilogonys_cinereus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAA{CG}AAAGATCAGGCAGAAGTGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAA---------------AT{AG}GAGTTAATGGGCAA{CG}AGGCAACAGAGTCTTGAGGAAGATGC{CT}CAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACCTGAAGCAGCTCTGCCGCATCTGTGGAGTTTCGTTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCGGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCGTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGCCACTTGCTCAGCTAAACAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGCTCATCAGTTGCAAGGATAAACATCTCAGCACCAAGCTCCTTGCAGTTGATTTCCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGAGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAATACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGG{CG}AGGCAGATCTTCCAGCCTTTGCATGCTCTCCGCACCGCTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGACGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGAAACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGCGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACCGGATTTTCCAGATGGAAATTGGTGAACTTTACAAAAATCCTGACGTATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAGTTAATAAAGTGTGAGGAAAGGCACGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAGGGAGTGCCCAGAACTGCTGTGTCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAAATGGAGGATGTCCTGCGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCTAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACGATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACACCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCCTATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACGGTAAAATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Ptilonorhynchus_violaceus TAAATTGCGATCATTTGAAAAAACAC{CT}CTCTGATGACAGCCAGCACA{CT}AGACAAAGATCAAGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAAAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCTTTTAGAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAA{CT}AGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTTTGCCGTACTACCAGCCGAGGAGTCAAGAGAAGAAGCCAGCCCCCGAGTGTGCAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGACTAAACAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCTATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCTTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATACGGCAAACACCTCTCCAGCCAC---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGACTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGAAAGGGAGGGGATCCGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCACGCCCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTACCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTTTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACAGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCATATGGGAATGAAAGCAA{CG}AGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCCGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTC{AG}ACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCC{AG}GTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTCTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCCACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTACTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTGATGTAGTTCATAGCCGGGGGAAAAGTATGAGTGTCCTGTTTGGAGGAAGATCATATACTCCTCTCGCACAAAGAACCACTGAAAAATGGAACAGCGTGGTTGACTGTTTGCCATCTGTGTTTCTCATCGATTTTGAGTTTGGATGCAGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCAGCTGTGAGCTGCACCATCCTGCCTGGG{AG}GGATATCAGTGTCAAGTGCTATCGTGACTCAGATCAGTGATACTGAATTTGTCCTGGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTTTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGA{AG}CAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCCAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACAGGCTACTGGATCACCTGCTCTGCC Ptiloris_magnificus TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCGAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCGAAGTGTACAAC{AG}TGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTGTCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCC{AC}TTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTC{CG}TGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGTACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGA{AG}TTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGAC{AG}GCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCCCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAACTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGCGTGTAACACCATAGTTCTAGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGGACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCGGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Ptilorrhoa_caerulescens TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAAAAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTTGCAGGCAATAAG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAACCCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATCGAAAAATCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAA{CT}GTGGCAAACGTGTCAAAACCACTGGGGAACGTGCCCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCACGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAGATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGTCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAATCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTGAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCTCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTAGAGGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTCAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTATTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTC{CT}AAAGACTCGTGTTACCTTCCCCCTCTCCGGTACCCTGCTGTTTGCACACTCAGAAGCGCTGCAAAGGCTAATGAGTACCAGTATATCATCCACGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCAATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCCTAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCC{AG}GAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGATTCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGA{AG}GAGTTTTGTTTTAGTGCTGAAGCCAATGGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACTGGCTACTGGATCACCTGCTCTGCT Pycnonotus_barbatus CAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGACTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCGGTAC{CT}AAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGAACTTGAGGAAGACGCCCAT---------GCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGGAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTCCATGGACCAGTAGATGATGAAACTCTGTCACTTTTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGAT{CG}TTATTGCTAAGGTTTTCAAGATTGATCTGCGAGGGGATGTCGATACTATCCATCCCACT{AC}GATTTTGTCACAACTGCTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCACTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGGACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTACTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCGCTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCGGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAGAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTCTCCTTCACAGTCATGAACATTTCTATAGCATGTGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGAGAGGCATCCTGAGAACATTTA{AG}ATTTGTCTTCAGGGGTACAGGATATGATGAAAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCCACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCGTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTGCTTGATATAAAGCCGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTAGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCA{CT}AGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACACTTGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTTCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTAGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTGTGGAAGATGATAAGATAGAGATTGTTGAAAGT{AG}TGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGCAAAGGATCTGTTTTGCTGGGCCTTCCAGGGGCCAACAAACAAGTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGACCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGAAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCAGAAGCCAGTAGCTTTGATGCTGACAATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Regulus_calendula TAAATTACGATCATTTGAAAAAACACACTCTGATGACAGCCAGAACATAAACAAA{GT}ATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGGAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAGGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCC{CT}GATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCCAGCTGTGACGTGTGCCATACTACCAGAC{AG}AGGAGTCAAGAGAAAAAGTCAGCCCCC{AG}AGAGTACTACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGGGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTAAACACCAAGCTGCTTGCAGTAGATTACCCAGTAGATTTCATTAAATCTGTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGATTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTCCTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTC{AG}ATAACCTGATTAT{AT}AGATGCCCTGTAAAAGAGTGTGATGAGGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACC{AG}AGGCAGCATCTCCTGTCTTTGAC{AC}AGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGACAAATCTTCCAGCCTTTGCATGCTCTTCGCACTGCCGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCAATAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACTGTCATGAACATTTCTATAGCACATGGGAGTGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAAGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTCAAAATCTGGAGCGATATGAAATGTGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTCTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAAATTGGTGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAAAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAATATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGATGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGAAGAATGAGCTCAAGATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTGTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGGTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGTGGCCACTCACTTCAGAATAACACCAGACCCTCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGC{AG}AGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTATCACTCAGACAACCAGAAACGGCTGGCCTGTAACACCATCGTTCTGGAAGATGGTAAGATAGAGATTG{CT}TGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATAGCAGAATGTGGTTTGGCTGTGATATAGG{CT}AAAGGGTC{GT}GTTTTGCTGGGCATTCCAGGGGCCAACAAGCAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGAAAGAAGAATTAATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGG{AG}GACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Regulus_satrapa TAAATTGCGATCATTTGAAAAAACAC{CT}{CG}TCTGATGACAACCAGAACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGGAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAAAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCCAGCTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGAGTACTATGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAGAGAGATTGTCAATTGCAAGGATAGACATCTAAACACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCTGTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTCGATAACCTGATTATAAGATGTCCTGTAAAAGAGTGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTA{CT}GTAAATAAAGGTGGCCGACCGAGGCAGCACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGACAAATCTTCCAGCCTTTGCACACTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTAGGAATTATAGATGGACTATCAGGACT{AG}CCACTCTCAATTGATGATTACCCAGTAGACACAATTGCCAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGAGTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTTATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAAGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAACCATGCTCAAAATCTGGAGCGATACGAAATGTGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTC{AG}GCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCATTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAGGAACTAATGGACCTTTATCTGAATATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGATGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAGATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTGTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATAAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTCGTCGACTGTTTGCCATCCGTGGTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGGGGCCACTCACTTCAAAATAACACCAGACCCTCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGC{AT}GCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAAC{AG}GCTGACCTGTAACACCGTCGTTCTGAAAGATGGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATAGCAGAATGTGGTTTGGCTGTGATATAGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAGCAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACATAAAAGAAGAATTAGTAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGA{CT}GATGCTGATACTTACAATGAAGATGATGAAGAAG??GAGTCGGAAACAGGCTACTGGAT?ACCTGCTGT--- Remiz_pendulinus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGACAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTACT------------------------------------------------------------TCAAAGAAAGAATTTATCCTGCATCAAGATGAAGCAGTGCCTAGAGGAGAAAAG---------------AGGGAGTTAATGGGCAACAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAACTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTTCAAAAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGCCTTCTGAGAAAGAAAGAAAAGACAGCAACTTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATGTTCTATGTGAAGTATATTTTCCTAGGAGCAGCACAATGGAGTGGCAACCCCATTTCCCAAACTGTGATGTGTGCCACATTACCAGACAAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAGCATGGCAAACATATCAAAACCACCAGGGAACGTGCTCGGCTAATCAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAGTGAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAATAGACTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGAGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGGGAGCTCTATAACTACATCAATAAAGGTGGCCGACCAAGGCAACACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACATCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGAACTGGACTTCACCCGGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGTTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGGTCTTCCAGCCTCTGCATGCCCTTCGCACTGCAGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATCGATGGACTATCAGGACTGGCTCTCTCAATTGATGATTACCCAGTCAACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCCAAAAACCTGGACGACTATCTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGGATGGGTGATGTCAGTGA{AG}AAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGCTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGCTTTGCCTTTAGGGGTACAGGATACGACGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTCTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCGACAGAATTCTACAAGATTTTCCTGATGGAGGTTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGACGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAATGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCCCATGTTCCTGAAATAATTGAACGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCC{CT}CCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTATTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCACTTTGCGTGCTCAGAAGGGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTGCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGATGATACTGTTTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTTTACAAGCTAAAAATTGATCTGCCCCTAGGCAGCCCATCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTATCACTCAGACAGCCAGAAACGGCTGGCATGTAACACCATTGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGTCAGCAAACAAATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGGGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATATGTACAATGAAGATGATGAAGGAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Rhipidura_hyperthra TAAATTGCGATCATTTGAAAAAACACCTCTGGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAGTAGG---CAGGGACCTGAGGAAGATGCCCAT---------GCCA{CT}GCAAACACAAGCCAAT---AGAGCTCATCAGAACAACTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAGTTTTGTCACAAGTGTCGGAGTATTATACATAGAAAATTCAGTAATACT{CT}TGTGTGAAATATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAAC{AG}TGTGAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGATGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCATGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATTCTTAAATGTATCAGGGTTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGA{CT}CTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGCGTATGAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTCCATCCTGCTGTCTGTCTGGCCATCAGAATCAACAC{AG}TTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCGGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCCGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATATGAAATATGGAGGTCCAACCCCTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCGGTATGTGAATTAATAAAGTGTGA{AG}GAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCTAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGG{CT}TGGTGTGTAACACCATAGTTCTGGAAGAGAATAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAGGGATCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAACTGAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCAC{AG}CCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Rupicola_rupicola TAAAGTGCGATCATTTGAAAAAATGCCCTCTGATGACACGCAGCACATAAACAAAGATCAGGCAGAAGGGATTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATGCTGCATAAAGATAAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAAAGGGCAATAGG---CAAGCACTTGAGAAAGAGGCCCGT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAA{CT}CTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTCATCCAGTGCATGGACCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACTTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCATCAAGTGTACAACAAGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAGCAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAACATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGGCACTTGTTTTGCAGAACTTGCATTCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGCTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTCAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAATCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTAAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTAGGAATTATAGACGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGATACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTTTAACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCAGCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTAAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGGGCCTGGGCAAGTGAAGGAAATGAATCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCTAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAAATCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAATAGCAAGAAAATTATATTCCAATGCATTGAGAAAGACGTGGGTGGGGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGC{AG}TAGTCGACTGTTTGCCATTTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGATTGGTGTGTAATACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATATCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAGGGAAGAAGAATTGACAACACAAACTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTACATTCGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGACACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTATTGGATCACCTGCTGTGCC Schiffornis_turdinus TAAAGTGCGATCATTTGAAAAAACATCCTCTGATGACAGGCAGCACATAAACAAAGATCAGGCAAAAGGGATTACTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATAAAGCAGTGTCAAGAGAAGACAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCTGT---------GACATGAAAACACGAGACAAT---AGAACTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTCATCCTGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGACCTTATCGCTAAGGTTTTCAAGATTGATGTGCGGGGAGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACCATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGCGGAAAAGCCAGCCACAAAGTGTACAACAAGGCAAACGCGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATTCTTAAGTGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACCGATCTTGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAGCCTTGGTATAAGATGCCCTGTCAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTTAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAGGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTAAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTAC{AC}CAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGTTGCAA{AG}CCCTTGTGTCTTATGCTGGCTGATGAATCGGATCATGAAACTCTAACGGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTAGAGGCATCCCAGAATTTGGTTTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTTCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGATAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAATAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTATCCTGCTCTTTGCATACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCCGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAATAGCAAGAAAATGACGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACCGAATTTGTCCTTGTTGGTGGCTACCACGCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAAGTTGTTGAAAGGGAGAGCCCACAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGTTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGACGAATCAGAAACAGGTTACTGGATCACCTGCTGTGCC Scytalopus_magellanicus TAAACTGCGACCATTTGAAAAAACACCCTCTGATGACAGGCAGCAAAAAACCAAAGATCAGGCAGAAGCAGATGCTTTT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGGAGAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCCAT---------GACATGAAAACGCAAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATGCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGCTGTATGCCACACTATCACTCGAAGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGCAAACGTGTGAAGACCATTGTGGAATGTGCTCGACTAAACAGAAGTGTAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGGTTGTCAATTGCAAGAATACACATCTCAGCACCAACCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTAGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTTCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCATGAGGAGATGAAAGATAGAGAGTTCTATAGCTACACAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTGGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGAAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACTGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAAATCTTGGAAGGCATGAATGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAGCATTGCTATTGCACATGGGAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGCCTGATGCTGGCAGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAGGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACTCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAATTGTTTAGGAGGTTCCGAAAAATGAA{CT}GCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTCTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAAGTCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACATTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATTATGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTCGTTCATAGCCAGGGCAAAAGCATGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCACCAGAGGTGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGTTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGCGGGATATCAGTGTCAAGTGCTATAGTGACTCAAACCGGTGATACTGAATTTGTCCTTGTCGGAGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGGGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCGGTGATATGGGCAATGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATACCGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Sitta_carolinensis TAAATTGCGATCATTTGAAAAAACACCCTCGGATGACAGCCAGCACATAAACAAAGATCAGACAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAGGAATTCATCCTGCACACAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAGCAGGGAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGGCAAC---AGAGCTCATCTGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTGCATTTAAAACTGATTGCCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCGACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACCATCCATCCCACCCGGTTCTGTCACAACTGTTGGAGTATTATACAGAGAAAATTCAGTAATACTCTCTGTGAGGTATACTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGGTGTGTGCCATACTACCAGCCAAGGAGTCAAGAGAAAAAGCCAGCTCCCAGGTGCACATCGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGCTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTACATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCATAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACGCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGGAAATATGGCCAACACGTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGGCCGAGGCAGCACCTGCTGTCTTTGACAAGGAGAGCTCAGAAACACCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCCAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGCCTGGCCATCCGAATCAACACGTTCCTCAGCTGTAGTCAGTACCATAAAATGTACAGAACAGTGAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTCCGCACTGCTGAGAAAGCCCTCCTACCTGGTTATCACCCATTCGAGTGGAAACCCCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGCTACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGAGGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGGATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACGGTCATGAACATTTCTGTAGCACATGGCAGTGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAGACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCGATGAAAAGCAGCGAGCTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCGTCTTCAGGGGGACAGGATATGATGAGAAACTGGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTCGGAGGCATCCCAGAACCTGGTCTTCCACTCCATCACCAGGAGCCATGCTGAGAATCTGGAACGATACGAGATATGGAGGTCGAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTCATTGAGACTGTCCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCGACAGAGTTCTACAGGATCTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCCGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGCTCCTCGTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCCCAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATCACAAATTACTTCCATAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTCAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCCTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCCGAGGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAATTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCGCTTGAAAATAACACCAGGTCCCCCAACTTGTTCAAGCTAAAAATCGACCTGCCCCTGGGCAGCCCGGCTGTGAGCTGCACCATCCTGCCAGGGGGGATATCAGTGTCGAGTGCCATAGTGACCCAGATCAGCGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGTCCTGCAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTAGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGCAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAACCCCAGACGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAGCTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACCCCTTTTGAAGATTCAGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Smithornis_rufolateralis TAAAGTGCGAACATTTGAAAAAACACCCTCTGATGGCAAGCAGCACATAAACAAAGATCAGGCAGATGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCAATAGGCAACAAG---CAGGCACTTGAGAAAGTTACTGAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGAACTTATTGTTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCCTTGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCAACCTCACTCCTCAAACTGTGATGTATGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCACCAAGCGTACAACATGGAAAACGTGTGAAGACCATTGTTGAACGTGCTCGATTAAACAGAGGTGTAAATAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAACATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAAAACTTGCATCCTTAAATGTATCAAAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACTCCAGTTAAGTCATTCCTGAACATCCTTGATAATCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTACATGAAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGATATATAGCCACATAAATAAAGGTGGCCGACCAAGGCAACATCTTCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTAGCAATCCGAGTCAATACATTTCTCAGCTGTAGTCAGTACCATAAGATGTATAGGACCGTAAAAGCTGTCACTGGGAGACAGATCTTTCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAGTTGATGACTACCCAATAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAACAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAG{CT}TGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTATAGGATTTTCCAGATGGAGATTGGTGAGCTTTACAAGAATCCTGA{CT}GTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTGGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATA{CT}GAAGGCAAGATTACAAACTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACGGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCC{CT}CTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCAATGCAAAATCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTCTCTGATAAGATTTATTTAATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCGAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGCGGGATATCAGTGTCAAGTGCTATAGTGTCTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTATATTGTTGGGCATTCCAGGGGCAAACAAACAGTTAATCTCAGATGCAAACTACTTCTACGTTTTGAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTG{AG}CAACACAAATGTGCAGTCAGACATCAACTGAAGACCCT{CG}{GT}AGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Sphecotheres_viridis TAAAGTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCACCACATAAACAAAGATCAGGCAGAAGAGGCTGTTGCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACGCAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCGTACTAGCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCC{CT}AAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGA{AG}ATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGGACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTA{AG}CCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGA{GT}ATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGA{AG}GGTGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCT{AG}GCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACCGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCCTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTAGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCC{AG}TATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CG}GCTCAGAAATGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAG{AG}TTTACTTTATGAGTCTGGTAAACAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACTTATACAAGCTAAAAATTGATCTTCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACTCAGATCAGTGATACTGAATTTATCCTTGTCGGTGGTTACCACTCTGACAGCCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAATCT{AG}GAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTA{CT}ATTTTGAGCTGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAATC{AG}CTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTGCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAAC{AG}GGCTACTGGATCACCTGCTGTGCC Strepera_graculina TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATG{CT}CCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCTA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCCGTTGATTACCCAGTGGATTTCATGAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGACTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGAC{AC}TTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGAAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATAAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCGGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGTAGAATGTGGTTTGGCTCTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCGAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACCCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Struthidea_cinerea TAAATTGCGATCATTTGAAAAACCACCCTCTGATGACAGCCGGCACATAAATAAAGATCAGGCAGAAGAGTCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAATGATGAAGCAGTGCCAAGAGGAGAAAAT---------------ATGGAGTTAA{CT}GGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAA---------GCCATGCAAACAAAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGCTGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAA?TTAATGAAGGAGATTATCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCGGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCC{CT}GCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACC{CT}GCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCCTGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAA{AG}GAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGA{AC}AGGCATGAAGCCCTAAAAGA{AG}CTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCACGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGG{CT}AAGATTACGAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAGAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTGGTTGACTGTGTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTAC{CT}TCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTCCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTCGTCCTTGTCGGTGGCTACCACTCGGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAAC{AG}TGGTTTGGCTGTGATATGGGTAAAGGATCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGGTGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Sturnus_vulgaris TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATTCATTCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCAACAAGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCTGTGAAAATACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACAATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGG{AC}AACCCCATTCCCCAAACTGTGA{CT}GTGTGCCATACTACCAGAA{AG}AGGAGTCAAGAGAAAAAGCCAGCCTCCAA{AG}TGTACAACGTGGCAAACGTGCCAAAACCACCAGGGAACATGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTGGCGGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCT{CT}GATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAGGGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAGGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAACACATGGGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGGTATGAAATATGGAGGTCCAACCCCTACCACGAGTCTGTGGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTCCCCGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAACGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGCTGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAGGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAATTTACTTTATGAGTCTGGTAAACAAAGCTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCACACAATTAATGTAGTTCATAGCC{AG}GGGAAAAAGCGTGACTGTTCT{CG}TTTGGAGGGAGGTCATATACTCCTCTTGCTCAGAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACCTGCTTCCAGAGCTTCAAGATGGACTTTC{CT}TTCCACGTTTCAATTGCCA{AG}AGGTGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACATTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCGGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAGGGGTCTGTTCTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAATGGCCAGAAGAGGACAAGGAAGAAGAATTGATAACACAGACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Sylvia_nana TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACCTAAACAAGGATCAGGCAGAAGAGGCAGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGA{AG}AAG---------------ATAGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCAATGAAAACACAAGAAAAT---AGAGCTCATCAGAACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTAT{CT}GCCAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAATAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAGGATATCCACCTCAGCACCAAACTTCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAGGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCT{AG}GCTTTGAGAGCCAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGTTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGT{AC}TCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCTGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTT{AG}TGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCTACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATTTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCCCAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCTTGCCCCACTGGGGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCACCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGCCCTCAGAAGCGATGCAAACGCTGACGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCA{AG}TGCATTGAGAAAGACCTGGGTGGAGATATCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGATGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTCGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAGTTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGAGAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGACCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGGTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGACGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Telophorus_dohertyi TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAATAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCTCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAGAAGAGGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTACTGCCCGTCCTGCTGGTATCCTTGCTTTCCTACTGATTTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGGTGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATAAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTATCACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCGCTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCC{GT}TAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATACTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGC{AG}TCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTTTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCCCTTAGCACGCTCAGAAGCCATGAAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATAAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCCAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTTTTTGGAGGGAGGTCGTATACGCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGCTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACCTGTACAAGCTAAAAATCGATCTGCCCCTGGGCATCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGAGCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCCGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACACTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Thamnophilus_nigrocinereus TAAAGTGCGATCATTTGAAAAAACACCCTCGGGTGACAGGCAGCGCATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCACACAGATGAAGAAGTGCCAAGAAGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCCCTTGAGAAAGAGGCCCAT---------GAC---------------AAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATTTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTAGGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCTCACTCCCCAAACTGTGATGTATGCCATACTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAGCATGGCAAACATGCGAAGACCGTTGTGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATTGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGGACTTGCATCCTTAAATGTATCAAGCTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACACCAGTAAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCTTGGAAAATATGGCCAACACATCTCCAGCCACAAAGAGAAGAAAGACAGAGAGCTCTACAGCCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAGGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTGAGAGCGAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTACAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTAGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAGGAGTCTTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCATTCACAGTTATGAACATCGCTATTGCAAATGGGAATGAAAGCCAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTATGCCTTATGCTGGCTGATGAGTCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTATTGCTTGAAATAGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGGTATGATGAAAAACTTGTACGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACAAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACAGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTTGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCATGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAACATAAAGTCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATTGTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTGCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTACACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACGTAGTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATGTTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAAATCGGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAGGGATCTGTATTGCTGGGGATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCATACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACAAGGAAGAAGAGTTGACAACACAAATCTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAATTTTGGTTTGGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTATAATGAGGATGATGAAGACGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Thraupis_cyanocephala TAAATTGCGATCACTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCCGCATGAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGCAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGACGATGAAACCCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCCAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACTAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTCTGCAACGTGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCAGCTAAACAGAGGTGTAAAGAA{CT}CAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAAACCTTCCTGAACATCCTTGATAATCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACACGGAAAATATGGCCAACACCTTTCTGGCCACAGGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGC{CT}CAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTCCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCGGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAACCTTTGCATGCTCTTCGCACTGC{CT}GAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGTTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCCGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGCTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTGCCTGAAGCTAGGTATGGACATACAATTAACGTAGTTCACAGCCGGGGAAGAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTACACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGTCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTCACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAATGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAACTTGCAGTCAGACATCAAGTGAAGAGCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGTTACTGGATCACCTGCTGTGCC Tityra_semifasciata TAAAGTGCGATCATTTGAAAAAACACCCTCTGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATAGTGCATAAAGATAAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCCCT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAGTACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATAC{CT}ACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCA{AG}CTGTACAACAAGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAATAAAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAACTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAACCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAGCCTGGGTATAAGATGCCCC{AG}TCAAAGAATGTGATGAAGAGATTTTGCATGGAAAATACGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAAAGAG{CG}TCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTTAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAAC{CT}GTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTTGACGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAACACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTC{AG}GAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTAACGGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTAGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAACCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAATTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTTTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCGAAGTCTGATGAGTACCAGTATGTCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAATAGCAAGAAAATGACGGTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCATAGTCGACTGTTTGCCATCTGTGTTTCTTGTGGATTTTGAATTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGC{AT}ATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTG{GT}T{AG}TGTAACACCATAGTTCTGAAGGAGAGTAAGATAGAGGTTGTTGAAAGGGAGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTC{AC}ACTTGAAGATTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Toxorhamphus_novaeguineae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATCAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAA---GATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACAGTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATCATACATAGAAAATTCAGCAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCTGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACTGATCTGGTCACCCCAGTGAAATCCTTCCTGAATATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGCGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGGCTATCCGGACTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCACAAAACCTGGACGATTATTTGAACGGCCCCTTCACTGTGGTACTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGA{AG}GCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCACTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCAATGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGCCTGGTAAGCAAAACTAGCAAGAAAATTAC{AG}TTCCAATGCATTGAGAAGGACTTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGTGTGAGTGTTCTATTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTTGTTGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCCTGCCAGGGGGGAAATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTCGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGCTTGGTGTGTAACACCATCATTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGGTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAGCAAACAATTAATCCCAGATGCAAACTACTTCTACATCTTGAGATGCAAAGGAGCAGAGGACGACAAGGAAGAAGAATTGATAACACAAATTTGCA{GT}TCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAGCAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Tregellasia_leucops TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGTACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAGGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTGTGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCACCGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGACTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAAGAGGAAATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAG{AG}TGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAAC{AG}CTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTTTATTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTTTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCGTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAGCTTGTACAAGCTGAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGAGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Troglodytes_aedon TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCACACAAGGAATTCATCCTGCAA---GATGAAGCAGTGCCAAGAGGAGAAAAG---------------{AG}TG{AG}AGTTAACAGGCAACAGG---CAGGGGCTAGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGGACAATCTGAAGCAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAAC{CT}TCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCTATGTGAAGTATATTTTCCCAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTAATGTGTGCCATACTACTAGACGAGGAGTCAAGAGAAAAAGCCAGCCTGCAA{AG}TGTTCAACGTGGCAAACGTGTCAAAACCACTGTG------------TTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAA{CT}AAA{AC}ATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATTTTGCATGGAAAATATGGTCAACACCTCTCTGGTCACAAGGAGA{CG}AAAAGATGGAGAGCTCTATAGCTACATAAACAAAGGTGGCCGACCGAGGCTGCACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAA{AG}GCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCGGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGGACAGTAAAAGCTGTCACGGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACC{AG}GGTTATCACCCGTTTGAATGGAAACCTCCCCTGAAAAATGTATCCACTAACAC{CT}GAAGTGGGAATTATAGATGGACTATCAGGACTGCCGCACTCAATCGATGATTACCCAGTAGAAACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAA{CT}CTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCCGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCC{CT}CTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGCACAGGATATGATGAGAAACTTCTGCGGGAAGTGGAAGGGCTGGAGGCCGCAGGTTCCACCTACATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTGAGCAAAAGCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTTGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACGATTAATGTAGTTCATAGCCGAGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATGTTGAGTTTGGGTGCTGTACATCGTATATACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAACTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTG{AG}CATGCAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTCGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGAAAAGG{GT}TCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATTACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGAT{GT}ATGCTGATACTTACAATGAAGATGACGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Turdus_falklandii TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATTCTGCATGAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACAGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGACACTATCCA{CT}CCCACCCACTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCTGTGTGAAGTGTATTTTCCTAGGAACAGCACAATGCAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACCGGGGAACATGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACCGGATTTCATTAAATCCATGTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTAACCCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGCAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTTCTGTCCCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAGGGGAAGGGATCTGGACTTCACCCCGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCACAAAATGTACAGAACGGTAAAAGCTGTCACAGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAATCCTCCCCTGAAA{AT}ATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACTTGGATGACTATTTGACTGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAACAAGAGAATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGA{AG}ATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCCTGCACTCCATAACCCGGAGCCATGCTGAAAACCTGGCGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCCGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTCCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTA{CT}AGGATCTTCCAGATGGAGATCGGTGAGCTTTACAAGAATCCTGACGTGTCTAAGGAAGAGAGGAAGAGGTGGCAGCTGACTCTGGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACCAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTCTGCACGCTCAGAAGCGATGCCAGGGCTGATGAGTACCAGTACATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAACAACATTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTTTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCCCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTGGTGGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATCAAACACTGCAGAACATGGTTCGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTAGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAAGACAAGGCAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Tyrannus_tyrannus TAAAGTGCGATCATTTGAAAAAACA---TCTGATGACAGGCAGCACATAAGCAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ATGGACTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCCACAAGAGAACTCATCCAGTGCATGGGCCTGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGATCTTAT{AC}GCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTTGATACTGTCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAGCCTCACTCCCCAAACTGTGA{CT}GTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGACACCAAGTGTACAGCATGGCAAACGTGTGAAGACCACTGTGGAACGTGCTCGACTAAACAGAGGAGTAAAGAACCAG------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCGACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTATGTGAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCCGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAACGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTTAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAACGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTTTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCAC{AG}ATTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAATAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGTTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCAT{AG}CTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAACCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCTATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCGCCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACACAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAGTAGCAAGAAAATGACATTCCA{AG}TGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGAACAAAGAACCACTGAAAAGTGGAACAGCGTAGTGGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACGATCTACATTTTAGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAAAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGAGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGCTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTATAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Vanga_curvirostris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCAGAAGGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGGGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGACAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGGGGTGTAAAGAACAAA------------------------------AATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTACCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGAAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCCAAA{AG}GCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCAATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTCCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTCATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTGTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAAACTCTTGTTACCTTCCCCCTCTCCGCTACCCTGCGGTTTGCACGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCAAGGGAAAAAGCATCAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGTACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATATCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTCTCAGTTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACGCAGATCACTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAACGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGCCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Vireo_philadelphia TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGACCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAAAGGGCAATAGG---C{AG}GGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGTATCTGTGGAATTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCA{CT}GGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATAC{GT}ATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCTGTACTACCAGAAGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTG{CT}GATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGTTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATACGATGAGAAACTTGTGCGGCAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTT{AG}GAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCA{GT}TGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCAT{AT}GGGGCCTGGGCAAGTGAAGGGAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATGTGAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCCCTTTGCACACTCAGAAGCGAT---------GATGTGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCTACTCACTTCAAAATAACACCAGGTC{CG}CCCAACTTATACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGG{CT}TGGTGTGTAACACCATAGTTCTGGATGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCGCTAATGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGC{AC}AATCACTTTGATGTTGACGATGCTGACATTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Yuhina_zantholeuca TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAAGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTAATCCCGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAAACAGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACCATCTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTAGCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCGGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGCATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTCCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGACGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACACGGCAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAACTGTGTTGTAAGCCTTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTTCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATCACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCAATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGTGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGATCTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAGATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGAAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATGTCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCTACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGTGTAGGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCGCTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Zosterops_senegalensis TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCA{AG}AACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATAGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCTCCAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCTGCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGTTCAGCTAAACAAAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTATCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAA{CT}TTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTAAGTATAAGATGCCCCGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACAGCCAACACCTCTCTAGTCACAAGGAGACGAAAGAGGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCA{CT}CTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGACGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATATCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTAATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATTTCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTCCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAAC{AG}GAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGT{AG}TCTAAAGAGGAGAAGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAGGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAAATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTATAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTATTTGCACGCTCAGGAGCGATGCAGGGGCTGATGAGTACCAGTATGTCATCCACGGGGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCCTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGCAGGACATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGATTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTGTCACTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTCGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACG{CG}CTGGCATGTCACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGATGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCC{AG}TTTGAAGATTCAGAGGAATTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC ; END; BEGIN SETS; CHARSET rag1_2nd (CHARACTERS = Passerine_RAG) = 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69 72 75 78 81 84 87 90 93 96 99 102 438 105 108 111 114 117 120 123 126 129 132 135 138 441 444 141 447 144 450 147 453 150 456 153 459 156 462 159 465 162 468 165 471 168 474 171 477 174 480 483 177 486 180 489 183 492 186 495 189 192 195 198 201 204 207 498 210 213 501 216 504 219 507 222 225 510 228 513 231 516 234 519 237 522 240 525 243 528 246 531 249 534 252 537 255 540 258 543 261 546 264 549 267 552 270 555 273 558 276 561 279 282 564 285 567 288 570 291 573 294 576 297 579 300 582 303 585 306 588 309 591 312 315 594 318 597 321 324 327 600 330 333 603 336 339 606 342 345 348 351 354 357 360 363 366 369 372 375 378 381 384 387 390 393 396 609 399 402 405 408 612 411 414 417 615 420 423 618 426 429 432 621 435 624 627 630 633 636 639 642 645 648 651 654 993 657 996 660 999 1002 663 1005 1008 1011 666 1014 1017 1020 669 1023 1026 1029 1032 672 1035 1038 675 1041 1044 678 1047 1050 681 1053 1056 684 1059 1062 1524 687 1527 1065 1068 1071 690 1074 1077 1530 1533 1080 693 1083 1536 1086 1539 696 1542 1089 1092 1095 1098 1101 1104 1107 1110 1113 1116 1119 1122 1125 1128 1131 1134 1545 1548 1551 1554 1557 1560 1563 1566 1569 1572 1575 1578 1137 1140 1143 1581 699 1584 1146 1149 1587 702 705 1152 708 1155 1158 711 1161 1164 714 1167 1170 717 1173 1176 720 1179 1182 723 1185 1188 726 1191 1194 1590 729 1593 1197 1200 732 1203 1206 1596 1209 1599 735 1212 1215 1602 1218 738 1221 1224 1605 741 1608 1227 1230 1611 1233 744 1236 1239 1614 1242 747 1245 1617 1248 750 1251 1620 1623 1254 1257 753 1260 1263 1626 756 1629 1266 1269 1632 1272 759 1275 1278 1635 1281 762 1284 1638 1287 765 1290 1293 1641 1644 1296 768 1299 1302 1647 771 1650 1305 1308 774 1311 1314 1317 1320 1323 1326 1329 1332 1335 1338 1341 1344 1347 1653 1656 1659 1662 1665 1668 1671 1674 1350 1353 1356 1359 1677 1362 777 1365 1368 1680 1683 1371 780 1374 1377 1686 783 1689 1380 1383 1386 1692 786 1695 1389 1392 789 1395 1398 1698 1401 1701 792 1704 1404 1407 1410 795 1413 1416 1707 1710 1419 798 1422 1425 1713 801 1716 1428 1431 804 1434 1437 1719 1722 1440 807 1443 1446 810 1449 1452 1455 1725 1728 1458 1461 813 1464 1467 1731 1734 1470 816 1473 1476 1737 819 1740 1479 1482 1485 1743 822 1746 1488 1491 1494 825 1497 1500 1749 1752 1503 828 1506 1509 1755 831 1758 1512 1515 834 1518 1521 1761 837 1764 840 843 846 849 852 855 1767 858 1770 861 1773 1788 1791 864 1794 1776 1797 1779 867 1800 1803 1782 1806 870 1809 1785 1812 873 1815 1818 876 1821 1824 879 1827 1830 882 1833 885 1836 1839 888 1842 1845 891 1848 1851 894 1854 1857 897 1860 1863 900 1866 1869 903 1872 1875 906 1878 1926 1881 1929 909 1884 1887 1932 1890 912 1893 1896 1935 915 1938 1899 1902 1941 1905 918 1908 1944 1911 921 1914 1917 1947 924 1950 1920 1923 927 1953 930 1956 933 936 1959 939 1962 942 1965 945 948 1968 951 1971 954 1974 957 960 1977 963 1980 966 1983 969 972 1986 975 1989 978 1992 981 984 1995 987 1998 990 2001 2019 2004 2007 2010 2013 2016 2022 2025 2028 2031 2034 2037 2040 2043 2046 2049 2052 2055 2058 2061 2064 2067 2070 2073 2076 2079 2082 2085 2088 2091 2094 2097 2100 2103 2106 2109 2112 2115 2118 2121 2124 2127 2130 2133 2136 2139 2142 2145 2148 2151 2154 2157 2160 2163 2166 2169 2172 2175 2178 2181 2184 2187 2190 2193 2196 2199 2202 2205 2208 2211 2214 2217 2220 2223 2226 2229 2232 2235 2238 2241 2244 2247 2250 2253 2256 2259 2262 2265 2268 2271 2274 2277 2280 2283 2286 2289 2292 2295 2298 2301 2304 2307 2310 2313 2316 2319 2322 2325 2700 2703 2706 2709 2712 2715 2718 2721 2724 2727 2730 2733 2328 2331 2334 2337 2340 2343 2346 2349 2352 2355 2358 2361 2364 2367 2370 2373 2376 2379 2382 2385 2388 2391 2394 2397 2400 2403 2406 2409 2412 2415 2418 2421 2424 2427 2430 2433 2436 2736 2739 2742 2745 2748 2751 2754 2757 2760 2763 2766 2769 2772 2775 2778 2781 2784 2787 2790 2793 2796 2799 2802 2805 2808 2811 2814 2439 2442 2445 2448 2451 2454 2457 2460 2463 2466 2469 2472 2475 2478 2817 2820 2823 2826 2481 2484 2487 2490 2493 2496 2829 2832 2835 2499 2502 2505 2508 2838 2841 2511 2514 2517 2844 2520 2523 2526 2847 2850 2529 2853 2532 2856 2859 2535 2538 2541 2544 2862 2547 2550 2553 2556 2559 2562 2865 2565 2868 2568 2571 2574 2871 2874 2577 2580 2583 2586 2877 2589 2880 2592 2595 2883 2598 2601 2604 2607 2610 2613 2616 2619 2622 2625 2628 2631 2634 2637 2640 2886 2889 2892 2895 2898 2901 2904 2907 2643 2646 2649 2652 2655 2658 2910 2661 2913 2916 2664 2667 2670 2919 2673 2676 2679 2922 2925 2682 2685 2688 2691 2928 2694 2931 2697 2934 2937 2940 2943 2946 2949 2952 2955 2958 2961 2964 2967 2970 2973; CHARSET rag2 (CHARACTERS = Passerine_RAG) = 2975-4126; CHARSET rag2_3rd (CHARACTERS = Passerine_RAG) = 3256 3259 3262 3265 3268 3271 3274 3277 3280 3283 3286 3289 3292 3295 3298 3301 3304 3307 3310 3313 3316 3319 3322 3325 3328 3331 3334 3337 3340 3343 3346 3349 3352 3355 3358 3361 3364 3367 3370 3805 3373 3808 2977 3376 2980 3811 3814 2983 3817 3379 3820 3823 2986 3826 3382 3829 2989 3832 3385 3835 3838 2992 2995 3841 3388 3844 3847 3391 3850 3394 3397 3400 3853 2998 3856 3403 3859 3862 3001 3004 3865 3406 3007 3868 3409 3871 3874 3010 3877 3412 3880 3883 3886 3889 3892 3895 3898 3901 3904 3907 3013 3016 3019 3022 3025 3028 3910 3913 3916 3031 3919 3415 3922 3925 3034 3037 3928 3931 3418 3934 3937 3040 3421 3043 3940 3943 3046 3424 3049 3427 3052 3430 3433 3055 3946 3436 3949 3439 3952 3955 3058 3061 3958 3961 3442 3445 3448 3451 3454 3457 3964 3460 3967 3970 3463 3973 3976 3466 3979 3469 3982 3985 3472 3988 3991 3475 3994 3997 4000 3478 4003 4006 3481 4009 4012 3064 3484 3067 4015 4018 3487 4021 4024 3070 4027 3490 4030 3073 3076 4033 4036 3493 4039 4042 3079 3496 3082 4045 4048 4051 3085 4054 3499 4057 4060 3088 3502 3091 4063 4066 4069 3094 3505 3097 4072 4075 3508 4078 4081 3100 4084 3103 3511 4087 4090 4093 4096 4099 4102 4105 4108 4111 4114 4117 3106 3109 3112 3115 3118 3121 4120 4123 4126 3124 3514 3127 3130 3517 3133 3136 3520 3139 3523 3142 3145 3526 3148 3529 3151 3154 3532 3157 3535 3160 3163 3538 3166 3541 3169 3172 3544 3175 3178 3547 3181 3184 3550 3187 3553 3190 3193 3556 3196 3559 3199 3202 3562 3205 3565 3208 3211 3568 3214 3571 3217 3574 3220 3577 3223 3580 3583 3226 3229 3232 3235 3238 3586 3241 3244 3247 3250 3589 3253 3592 3595 3598 3601 3604 3607 3610 3613 3616 3619 3622 3625 3628 3631 3634 3637 3640 3643 3646 3649 3652 3655 3658 3661 3664 3667 3670 3673 3676 3679 3682 3685 3688 3691 3694 3697 3700 3703 3706 3709 3712 3715 3718 3721 3724 3727 3730 3733 3736 3739 3742 3745 3748 3751 3754 3757 3760 3763 3766 3769 3772 3775 3778 3781 3784 3787 3790 3793 3796 3799 3802; CHARSET rag1 (CHARACTERS = Passerine_RAG) = 1-2974; CHARSET rag1_3rd (CHARACTERS = Passerine_RAG) = 1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88 91 94 97 100 103 106 109 112 115 118 121 124 127 130 133 136 139 142 145 148 151 154 157 160 163 166 169 172 175 178 181 184 187 190 193 196 199 202 205 208 211 214 217 220 223 226 229 232 235 238 241 244 247 250 253 256 259 262 265 268 271 274 277 280 478 481 484 487 490 283 493 496 499 286 289 502 505 508 292 295 511 514 517 520 298 301 523 526 529 532 304 307 535 538 541 310 313 544 547 550 553 316 319 556 559 562 322 565 568 325 571 574 577 580 583 586 589 592 595 598 601 604 607 328 331 334 337 340 343 346 349 610 613 616 619 352 355 622 625 358 361 628 631 364 367 634 637 640 643 370 373 646 649 652 655 376 658 379 661 664 382 385 667 670 673 676 388 679 682 685 391 394 688 691 397 694 697 400 700 703 403 706 709 406 712 409 715 718 412 721 724 415 727 730 418 733 736 739 421 424 742 745 427 748 751 430 433 436 439 442 754 1033 757 760 763 766 769 772 775 778 781 784 787 790 793 796 799 802 805 808 811 814 817 820 823 826 829 832 835 838 841 844 847 445 448 451 454 457 460 463 466 469 472 475 850 853 856 859 862 865 1036 868 871 874 877 1039 880 883 1042 886 889 1588 1045 892 895 1591 898 1048 901 904 1594 1051 1597 907 910 913 1600 1054 1603 916 919 922 1606 925 1057 1609 1060 1612 928 1063 931 934 1615 1066 1618 937 940 1621 943 1069 946 949 1624 1072 1627 952 955 958 1630 1075 1633 961 964 1078 967 970 1636 1081 1639 973 976 979 1642 982 1084 985 1645 988 1648 1087 991 994 1651 997 1090 1000 1003 1654 1093 1657 1006 1009 1012 1660 1096 1663 1015 1018 1099 1021 1024 1027 1030 1666 1669 1672 1675 1678 1102 1681 1105 1684 1108 1687 1111 1690 1114 1693 1117 1120 1123 1126 1129 1132 1135 1138 1141 1144 1147 1150 1153 1696 1156 1159 1699 1162 1702 1165 1705 1168 1171 1708 1174 1711 1177 1714 1180 1183 1717 1186 1720 1189 1723 1192 1195 1726 1198 1729 1201 1732 1204 1735 1207 1738 1210 1741 1213 1216 1744 1219 1747 1222 1750 1225 1753 1228 1231 1756 1234 1759 1237 1240 1243 1246 1249 1252 1255 1258 1261 1264 1267 1270 1273 1276 1279 1282 1285 1288 1291 1294 1297 1300 1303 1306 1309 1312 1315 1318 1321 1324 1327 1330 1333 1336 1339 1342 1345 1348 1351 1354 1357 1360 1363 1366 1369 1372 1375 1378 1381 1384 1387 1390 1393 1396 1399 1402 1405 1408 1411 1414 1417 1420 1423 1426 1429 1432 1435 1438 1441 1444 1447 1450 1453 1456 1459 1462 1465 1468 1471 1474 1477 1480 1483 1486 1489 1492 1495 1498 1501 1504 1507 1510 1513 1516 1519 1522 1525 1528 1531 1534 1537 1540 1543 1546 1549 1552 1555 1558 1561 1564 1567 1570 1573 1576 1579 1582 1585 2014 1762 1765 1768 1771 1774 1777 1780 2017 1783 1786 1804 1807 1810 1789 1792 1813 1795 2020 1798 1816 1819 1822 1801 2023 1825 1828 2026 1831 1834 1837 1840 1843 1846 1849 1852 1855 1858 1861 1864 1867 1870 1873 1876 1879 1882 1885 1888 1891 1894 1897 1900 1903 1906 1909 2029 1912 1915 1918 2569 2572 2575 1921 1924 2578 2032 2581 2584 1927 1930 1933 1936 1939 1942 1945 1948 1951 1954 1957 1960 1963 1966 1969 1972 1975 1978 1981 1984 1987 1990 1993 2587 2590 2593 2596 2599 2602 2605 2608 2611 2614 2617 2620 2623 2626 2629 2632 2635 2638 2641 2644 2647 2650 1996 1999 2002 2005 2008 2653 2656 2659 2011 2662 2035 2665 2668 2671 2674 2038 2677 2680 2041 2683 2686 2044 2689 2692 2047 2695 2698 2050 2701 2704 2053 2707 2710 2056 2713 2059 2716 2719 2062 2722 2725 2065 2728 2731 2068 2734 2737 2071 2740 2074 2743 2077 2746 2080 2749 2752 2083 2755 2086 2758 2761 2764 2767 2089 2770 2773 2776 2779 2782 2092 2785 2788 2095 2791 2794 2098 2797 2800 2101 2803 2806 2104 2809 2812 2107 2815 2818 2110 2821 2824 2113 2827 2830 2833 2836 2839 2842 2845 2848 2851 2854 2857 2860 2863 2866 2869 2872 2116 2875 2878 2881 2119 2884 2887 2122 2890 2125 2893 2128 2896 2131 2134 2899 2137 2902 2140 2905 2143 2908 2911 2146 2914 2917 2149 2920 2923 2152 2926 2929 2155 2932 2935 2158 2938 2941 2161 2944 2947 2164 2950 2953 2167 2956 2959 2962 2965 2968 2971 2170 2974 2173 2176 2179 2182 2185 2188 2191 2194 2197 2200 2203 2206 2209 2212 2215 2218 2221 2224 2227 2230 2233 2236 2239 2242 2245 2248 2251 2254 2257 2260 2263 2266 2269 2272 2275 2278 2281 2284 2287 2290 2293 2296 2299 2302 2305 2308 2311 2314 2317 2320 2323 2326 2329 2332 2335 2338 2341 2344 2347 2350 2353 2356 2359 2362 2365 2368 2371 2374 2377 2380 2383 2386 2389 2392 2395 2398 2401 2404 2407 2410 2413 2416 2419 2422 2425 2428 2431 2434 2437 2440 2443 2446 2449 2452 2455 2458 2461 2464 2467 2470 2473 2476 2479 2482 2485 2488 2491 2494 2497 2500 2503 2506 2509 2512 2515 2518 2521 2524 2527 2530 2533 2536 2539 2542 2545 2548 2551 2554 2557 2560 2563 2566; CHARSET rag2_1st (CHARACTERS = Passerine_RAG) = 2975 2978 2981 2984 2987 2990 2993 2996 2999 3494 3002 3005 3008 3011 3014 3017 3020 3023 3026 3029 3032 3035 3038 3041 3044 3047 3050 3053 3056 3059 3062 3065 3068 3071 3497 3074 3077 3500 3080 3083 3503 3086 3506 3089 3509 3092 3095 3512 3515 3518 3098 3521 3101 3524 3104 3527 3530 3107 3533 3110 3536 3113 3539 3116 3542 3545 3119 3548 3122 3551 3125 3554 3128 3557 3560 3131 3563 3134 3566 3137 3569 3140 3143 3146 3149 3152 3155 3158 3161 3164 3167 3572 3170 3173 3176 3179 3182 3185 3188 3575 3191 3578 3194 3581 3197 3584 3200 3587 3590 3203 3593 3206 3596 3209 3599 3602 3212 3605 3215 3608 3218 3611 3614 3221 3617 3224 3620 3623 3626 3227 3230 3629 3233 3632 3635 3236 3638 3239 3641 3242 3644 3647 3245 3650 3653 3656 3659 3662 3665 3668 3248 3671 3674 3251 3677 3254 3680 3257 3683 3686 3260 3689 3263 3692 3266 3695 3269 3698 3701 3272 4049 3704 3275 4052 3707 4055 3278 3281 4058 4061 3710 4064 4067 3284 3713 4070 3716 3719 3287 3722 4073 4076 4079 4082 3290 3293 4085 3725 4088 4091 3296 3299 4094 3728 4097 3302 4100 3731 4103 4106 3305 4109 3308 3734 4112 4115 4118 3311 3737 3314 4121 4124 3317 3740 3320 3323 3326 3329 3332 3335 3338 3341 3743 3344 3347 3746 3350 3353 3749 3356 3359 3752 3362 3755 3365 3368 3758 3371 3374 3761 3377 3764 3380 3383 3386 3767 3389 3770 3392 3773 3395 3776 3779 3398 3401 3782 3404 3785 3407 3788 3410 3791 3413 3794 3416 3419 3797 3422 3800 3425 3803 3428 3806 3431 3809 3434 3812 3437 3440 3815 3443 3818 3446 3821 3449 3452 3455 3458 3461 3464 3824 3467 3470 3827 3473 3830 3476 3479 3482 3485 3833 3488 3491 3836 3839 3842 3845 3848 3851 3854 3857 3860 3863 3866 3869 3872 3875 3878 3881 3884 3887 3890 3893 3896 3899 3902 3905 3908 3911 3914 3917 3920 3923 3926 3929 3932 3935 3938 3941 3944 3947 3950 3953 3956 3959 3962 3965 3968 3971 3974 3977 3980 3983 3986 3989 3992 3995 3998 4001 4004 4007 4010 4013 4016 4019 4022 4025 4028 4031 4034 4037 4040 4043 4046; CHARSET rag1_1st (CHARACTERS = Passerine_RAG) = 191 746 749 2 752 194 755 758 761 764 767 770 5 8 11 14 17 20 23 26 773 776 779 782 29 32 785 35 788 197 791 794 38 41 44 47 797 800 803 50 53 806 200 809 812 56 59 62 815 65 818 68 821 203 824 827 71 74 77 830 80 833 206 836 839 83 86 89 842 92 845 209 848 851 95 98 101 854 104 857 212 860 863 107 110 113 866 116 869 119 872 122 875 215 878 125 128 131 881 884 134 218 137 140 887 890 893 143 146 896 221 149 152 224 899 902 905 908 911 155 158 161 164 167 170 914 917 920 923 173 176 179 926 929 182 932 935 938 941 944 947 950 953 956 959 962 965 968 971 974 977 980 983 986 989 992 995 998 1001 1004 1007 1010 1013 1016 1019 1022 1025 1028 1031 1034 1037 1040 1043 1046 1049 1052 1055 1058 1061 1064 1067 1070 1073 1076 1079 1082 1085 1088 1091 1094 185 188 1097 227 1100 1103 1106 1109 1112 1115 230 1118 1121 233 1124 1127 236 1130 1133 239 1136 1139 242 1142 1145 245 248 1148 251 1151 254 1154 257 1157 260 1160 263 266 1163 1166 269 1169 1172 272 1175 1178 1181 1184 1187 1190 1193 1196 1199 1202 1205 1208 1211 1214 1217 1220 1223 1226 1229 1232 1235 1238 1241 1244 1247 1250 1253 1256 1259 1262 1265 1268 1271 1274 1277 1280 1283 1286 1289 1292 1295 1298 1301 1304 1307 1310 1313 1316 1319 1322 1325 1328 1331 1334 1337 1340 1343 1346 1349 1352 1355 1358 1361 1364 1367 1370 1373 1376 1379 1382 1385 1388 1391 1394 1397 1400 1403 1406 1409 1412 1415 1418 1421 1424 1427 275 1430 1433 278 281 1436 284 1439 287 1442 290 1445 293 1448 296 1451 299 1454 302 1457 305 1460 308 1463 311 314 1466 317 1469 320 1472 323 1475 326 329 332 335 338 341 1478 344 347 1481 350 353 356 359 362 365 1829 368 371 1832 374 1835 1838 377 1841 1844 380 1847 1850 383 1853 1856 386 1859 1862 389 1865 1868 1484 392 1871 1874 395 1877 1880 1487 1883 1490 398 1493 1886 1889 1892 401 1895 1898 1901 1904 1907 1910 1913 1916 1919 1922 1925 1928 1496 1499 1502 1505 1508 1511 1514 1517 1931 1934 1520 1937 1940 1523 1943 404 1946 1949 1952 1526 1529 1955 407 1958 1961 1532 410 1535 1964 1967 1970 1538 413 1541 1973 1976 1979 416 1982 1985 1544 1547 1988 419 1991 1994 1550 422 1997 2000 425 2003 2006 428 2009 2012 1553 431 1556 2015 2018 2021 434 2024 1559 2027 2030 1562 437 1565 2033 2036 440 2039 2042 1568 1571 2045 443 2048 2051 1574 446 1577 2054 2057 1580 2060 449 2063 2066 1583 2069 452 2072 1586 2075 455 2078 2081 1589 1592 2084 458 2087 2090 1595 461 1598 2093 2096 464 2099 2102 1601 2105 467 470 2108 2111 2114 1604 1607 2117 2120 2123 2126 2129 2132 2135 2138 2141 2144 2147 1610 1613 1616 1619 1622 1625 2150 2153 473 1628 476 1631 479 1634 2156 482 2159 1637 485 1640 2162 2165 488 2168 2171 1643 1646 2174 491 2177 2180 1649 2183 494 2186 1652 2189 1655 2192 497 2195 1658 2198 500 2201 2204 1661 503 1664 2207 2210 2213 1667 506 1670 2216 2219 2222 509 2225 2228 1673 1676 2231 512 2234 1679 2237 515 2240 2243 1682 518 2246 2249 521 2252 2255 1685 524 1688 2258 2261 2264 1691 527 1694 2267 2270 2273 1697 530 2276 1700 533 1703 2279 2282 2285 2288 1706 2291 536 2294 1709 2297 1712 2300 539 2303 1715 2306 542 2309 2312 1718 545 1721 2315 2318 548 2321 2324 1724 1727 2327 2330 2333 2336 2339 2342 2345 2348 2351 2354 2357 1730 1733 1736 1739 1742 1745 2360 2363 2366 1748 2369 551 2372 2375 1751 2378 554 2381 1754 557 1757 560 1760 563 1763 566 1766 2384 2387 569 2390 2393 1769 2396 572 2399 1772 2402 575 2405 2408 1775 2411 2414 578 2417 2420 1778 1781 2423 581 2426 2429 1784 2432 584 2435 2438 1787 587 1790 2441 2444 2447 1793 590 1796 2450 593 2453 1799 596 1802 2456 2459 1805 2462 1808 599 1811 1814 2465 2468 2471 2474 1817 1820 2477 2480 2483 2486 1823 1826 2489 602 2492 2495 2498 605 2501 2504 608 2507 2510 611 2513 2516 614 2519 2522 617 2525 2528 620 2531 623 2534 2537 626 2540 2543 629 2546 2549 632 2552 2555 2558 2561 2564 2567 2570 2573 2576 2579 2582 2585 2588 2591 2594 2597 2600 635 2603 2606 2609 638 2612 2615 2618 641 644 2621 2624 647 650 653 656 659 662 665 668 671 674 677 680 2939 683 686 689 2942 692 2627 695 698 2630 2633 701 2636 2639 2945 2642 704 2645 2948 2648 707 2951 710 2954 2651 713 2654 2657 2957 2660 716 2663 2960 2666 719 2669 2963 2672 722 2675 2966 2678 2969 2681 725 2684 2972 2687 728 2690 2693 731 2696 2699 2702 734 2705 2708 737 2711 2714 740 2717 2720 2723 743 2726 2729 2732 2735 2738 2741 2744 2747 2750 2753 2756 2759 2762 2765 2768 2771 2774 2777 2780 2783 2786 2789 2792 2795 2798 2801 2804 2807 2810 2813 2816 2819 2822 2825 2828 2831 2834 2837 2840 2843 2846 2849 2852 2855 2858 2861 2864 2867 2870 2873 2876 2879 2882 2885 2888 2891 2894 2897 2900 2903 2906 2909 2912 2915 2918 2921 2924 2927 2930 2933 2936; CHARSET rag2_2nd (CHARACTERS = Passerine_RAG) = 2976 2979 2982 2985 2988 2991 2994 2997 3000 3003 3006 3009 3012 3015 3018 3021 3024 3027 3030 3033 3036 3039 3042 3045 3048 3051 3054 3057 3060 3063 3066 3069 3072 3075 3078 3081 3084 3087 3090 3093 3096 3099 3102 3105 3108 3111 3114 3117 3120 3123 3126 3129 3132 3135 3138 3141 3144 3147 3150 3153 3156 3159 3162 3165 3168 3171 3174 3177 3180 3183 3186 3189 3192 3195 3198 3201 3204 3207 3210 3213 3216 3219 3222 3225 3228 3231 3234 3237 3240 3243 3246 3249 3252 3255 3258 3261 3264 3267 3270 3273 3276 3279 3282 3285 3288 3291 3294 3297 3300 3453 3303 3306 3456 3309 3312 3315 3459 3462 3318 3321 3324 3327 3465 3468 3330 3333 3336 3471 3474 3339 3342 3345 3477 3348 3480 3351 3483 3354 3486 3357 3489 3492 3360 3495 3363 3366 3498 3501 3369 3372 3375 3378 3504 3381 3507 3384 3387 3390 3393 3396 3399 3402 3405 3408 3411 3414 3417 3420 3423 3510 3513 3516 3519 3522 3525 3528 3426 3429 3432 3435 3531 3534 3438 3441 3444 3447 3537 3540 3450 3543 3546 3549 3552 3555 3558 3561 3564 3567 3570 3573 4008 4011 4014 3576 3579 4017 4020 4023 3582 4026 4029 3585 4032 4035 4038 3588 4041 3591 3594 4044 4047 4050 4053 4056 3597 3600 4059 4062 4065 3603 3606 4068 4071 4074 4077 3609 4080 3612 4083 4086 3615 4089 4092 4095 3618 4098 3621 4101 4104 3624 4107 4110 4113 3627 3630 4116 4119 4122 3633 4125 3636 3639 3642 3645 3648 3651 3654 3657 3660 3663 3666 3669 3672 3675 3678 3681 3684 3687 3690 3693 3696 3699 3702 3705 3708 3711 3714 3717 3720 3723 3726 3729 3732 3735 3738 3741 3744 3747 3750 3753 3756 3759 3762 3765 3768 3771 3774 3777 3780 3783 3786 3789 3792 3795 3798 3801 3804 3807 3810 3813 3816 3819 3822 3825 3828 3831 3834 3837 3840 3843 3846 3849 3852 3855 3858 3861 3864 3867 3870 3873 3876 3879 3882 3885 3888 3891 3894 3897 3900 3903 3906 3909 3912 3915 3918 3921 3924 3927 3930 3933 3936 3939 3942 3945 3948 3951 3954 3957 3960 3963 3966 3969 3972 3975 3978 3981 3984 3987 3990 3993 3996 3999 4002 4005; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10329] TITLE Passerine_Taxonomy; LINK TAXA = Taxa1; DIMENSIONS NCHAR=59; FORMAT DATATYPE=Standard SYMBOLS= "0 1" MISSING=? GAP= -; CHARSTATELABELS 1 Tyranni, 2 Passeri, 3 Eurylaimides, 4 Tyrannides, 5 Tyrannida, 6 Furnariida, 7 Corvida, 8 Passerida, 9 Eurylaimoidea, 10 Furnarioidea, 11 Formicarioidea, 12 Menuroidea, 13 Meliphagoidea, 14 Corvoidea, 15 Muscicapoidea, 16 Sylvioidea, 17 Passeroidea, 18 Eurylaimidae, 19 Philepittidae, 20 Tyrannidae, 21 Furnariidae, 22 Climacteridae, 23 Ptilonorhynchidae, 24 Meliphagidae, 25 Petroicidae, 26 Irenidae, 27 Laniidae, 28 Vireonidae, 29 Corvidae, 30 Picathartidae, 31 Bombycillidae, 32 Certhiidae, 33 Paridae, 34 Sylviidae, 35 Nectariniidae, 36 Melanocharitidae, 37 Passeridae, 38 Fringillidae, 39 Tityrinae, 40 Corcoracinae, 41 Pachycephalinae, 42 Corvinae, 43 Dicrurinae, 44 Malaconotinae, 45 Sylviinae, 46 Nectariniinae, 47 Emberizinae, 48 Falcunculini, 49 Pachycephalini, 50 Corvini, 51 Paradisaeini, 52 Artamini, 53 Oriolini, 54 Dicrurini, 55 Monarchini, 56 Malaconotini, 57 Vangini, 58 Timaliini, 59 Toxorhamphini, ; MATRIX [ 10 20 30 40 50 ] [ . . . . . ] Acanthisitta_chloris 10000000000000000000000000000000000000000000000000000000000 Aegithalos_iouschensis 01000001000000010000000000000000000000000000000000000000000 Aegithina_tiphia 01000010000001000000000000001000000000000000000000000000000 Ailuroedus_melanotis 01000010000100000000001000000000000000000000000000000000000 Alauda_arvensis 01000001000000001000000000000000000000000000000000000000000 Arcanator_orostruthus 01000001000000010000000000000000010000000000100000000000010 Artamus_cyanopterus 01000010000001000000000000001000000000000100000000010000000 Artamus_leucorhynchus 01000010000001000000000000001000000000000100000000010000000 Batis_mixta 01000010000001000000000000001000000000000001000000000000100 Bombycilla_garrulus 01000001000000100000000000000010000000000000000000000000000 Campylorhamphus_trochilirostris 10010100010000000000100000000000000000000000000000000000000 Cardinalis_cardinalis 01000001000000001000000000000000000001000000001000000000000 Catharus_ustulatus 01000001000000100000000000000000000000000000000000000000000 Certhia_familiaris 01000001000000010000000000000001000000000000000000000000000 Chaetops_frenatus 010000??000000000000000000000100000000000000000000000000000 Chaetorhynchus_papuensis 01000010000001000000000000001000000000000010000000000100000 Chloropsis_cochinchinensis 01000010000001000000000001000000000000000000000000000000000 Cinclus_cinclus 01000001000000100000000000000000000000000000000000000000000 Cisticola_anonyma 01000001000000010000000000000000000000000000000000000000000 Climacteris_erythrops 01000010000100000000010000000000000000000000000000000000000 Climacteris_picumnus 01000010000100000000010000000000000000000000000000000000000 Cnemophilus_loriae 01000010000001000000000000001000000000000100000000100000000 Colluricincla_harmonica 01000010000001000000000000001000000000001000000010000000000 Conopophaga_ardesiaca 10010100001000000000000000000000000000000000000000000000000 Coracias_caudata 00000000000000000000000000000000000000000000000000000000000 Coracina_lineata 01000010000001000000000000001000000000000100000000001000000 Coracina_novaehollandiae 01000010000001000000000000001000000000000100000000001000000 Corcorax_melanorhamphos 01000010000001000000000000001000000000010000000000000000000 Cormobates_leucophaea 01000010000100000000010000000000000000000000000000000000000 Corvinella_corvina 01000010000001000000000000100000000000000000000000000000000 Corvus_corone 01000010000001000000000000001000000000000100000001000000000 Corvus_coronoides 01000010000001000000000000001000000000000100000001000000000 Corvus_orru 01000010000001000000000000001000000000000100000001000000000 Cracticus_quoyi 01000010000001000000000000001000000000000100000000010000000 Culicicapa_ceylonensis 01000001000000100000000000000000000000000000000000000000000 Cyanocitta_cristata 01000010000001000000000000001000000000000100000001000000000 Daphoenositta_chrysoptera 01000010000001000000000000001000000000001000000000000000000 Dicaeum_aeneum 01000001000000001000000000000000001000000000010000000000000 Dicrurus_adsimilis 01000010000001000000000000001000000000000010000000000100000 Dicrurus_hottentottus 01000010000001000000000000001000000000000010000000000100000 Dryoscopus_cubla 01000010000001000000000000001000000000000001000000000001000 Elminia_nigromitrata 01000010000001000000000000001000000000000010000000000010000 Emberiza_schoeniclus 01000001000000001000000000000000000001000000001000000000000 Ephthianura_tricolor 01000010000010000000000100000000000000000000000000000000000 Eugerygone_rubra 01000010000001000000000010000000000000000000000000000000000 Falcunculus_frontatus 01000010000001000000000000001000000000001000000100000000000 Formicarius_colma 10010100001000000000000000000000000000000000000000000000000 Fringilla_montifringilla 01000001000000001000000000000000000001000000000000000000000 Furnarius_rufus 10010100010000000000100000000000000000000000000000000000000 Gallus_gallus 00000000000000000000000000000000000000000000000000000000000 Garrulax_milleti 01000001000000010000000000000000010000000000000000000000000 Grallina_cyanoleuca 01000010000001000000000000001000000000000010000000000010000 Gymnorhina_tibicen 01000010000001000000000000001000000000000100000000010000000 Hirundo_pyrrhonota 01000001000000010000000000000000000000000000000000000000000 Hirundo_rustica 01000001000000010000000000000000000000000000000000000000000 Hylophilus_poicilotis 01000010000001000000000000010000000000000000000000000000000 Icterus_parisorum 01000001000000001000000000000000000001000000001000000000000 Irena_cyanogaster 01000010000001000000000001000000000000000000000000000000000 Lalage_leucomela 01000010000001000000000000001000000000000100000000001000000 Lanius_excubitor 01000010000001000000000000100000000000000000000000000000000 Loboparadisaea_sericea 01000010000001000000000000001000000000000100000000100000000 Malurus_melanocephalus 01000010000010000000000000000000000000000000000000000000000 Manucodia_atra 01000010000001000000000000001000000000000100000000100000000 Manucodia_chalybata 01000010000001000000000000001000000000000100000000100000000 Melampitta_gigantea 01000010000001000000000000001000000000000100000000100000000 Melampitta_lugubris 01000010000001000000000000001000000000000100000000100000000 Melanocharis_nigra 01000001000000001000000000000000000100000000000000000000000 Melanocharis_versteri 01000001000000001000000000000000000100000000000000000000000 Melanodryas_cucullata 01000010000001000000000010000000000000000000000000000000000 Meliphaga_analoga 01000010000010000000000100000000000000000000000000000000000 Menura_novaehollandiae 01000010000100000000000000000000000000000000000000000000000 Microeca_papuana 01000010000001000000000010000000000000000000000000000000000 Mimus_patagonicus 01000001000000100000000000000000000000000000000000000000000 Mionectes_macconnellii 10011000000000000001000000000000000000000000000000000000000 Modulatrix_stictigula 01000001000000010000000000000000010000000000100000000000010 Monarcha_axillaris 01000010000001000000000000001000000000000010000000000010000 Monarcha_chrysomela 01000010000001000000000000001000000000000010000000000010000 Motacilla_cinerea 01000001000000001000000000000000000010000000000000000000000 Muscicapa_ferruginea 01000001000000100000000000000000000000000000000000000000000 Nectarinia_olivacea 01000001000000001000000000000000001000000000010000000000000 Neodrepanis_coruscans 10100000100000000010000000000000000000000000000000000000000 Oedistoma_iliolophum 01000001000000001000000000000000000100000000000000000000001 Oreoica_gutturalis 01000010000001000000000000001000000000001000000100000000000 Oriolus_larvatus 01000010000001000000000000001000000000000100000000001000000 Oriolus_xanthonotus 01000010000001000000000000001000000000000100000000001000000 Orthonyx_spaldingii 01000010000001000000000000000000000000000000000000000000000 Orthonyx_teminckii 01000010000001000000000000000000000000000000000000000000000 Pachycephala_hyperthra 01000010000001000000000000001000000000001000000010000000000 Pachycephala_soror 01000010000001000000000000001000000000001000000010000000000 Pachycephalopsis_poliosoma 01000010000001000000000010000000000000000000000000000000000 Paradisaea_raggiana 01000010000001000000000000001000000000000100000000100000000 Paramythia_montium 01000001000000001000000000000000000000000000000000000000000 Pardalotus_punctatus 01000010000010000000000000000000000000000000000000000000000 Pardalotus_striatus 01000010000010000000000000000000000000000000000000000000000 Parula_americana 01000001000000001000000000000000000001000000001000000000000 Parus_inornatus 01000001000000010000000000000000100000000000000000000000000 Parus_major 01000001000000010000000000000000100000000000000000000000000 Passer_montanus 01000001000000001000000000000000000010000000000000000000000 Peneothello_bimaculatus 01000010000001000000000010000000000000000000000000000000000 Pericrocotus_ethologus 01000010000001000000000000001000000000000100000000001000000 Philepitta_castanea 10100000100000000010000000000000000000000000000000000000000 Philesturnus_carunculatus 01000010000001000000000000000000000000000000000000000000000 Picathartes_gymnocephalus 010000??000000000000000000000100000000000000000000000000000 Pipra_coronata 10011000000000000001000000000000000000000000000000000000000 Pitohui_cristatus 01000010000001000000000000001000000000001000000010000000000 Pitta_sordida 10100000000000000000000000000000000000000000000000000000000 Ploceus_cucullatus 01000001000000001000000000000000000010000000000000000000000 Polioptila_caerulea 01000001000000010000000000000001000000000000000000000000000 Pomatostomus_halli 01000010000001000000000000000000000000000000000000000000000 Pomatostomus_isidorei 01000010000001000000000000000000000000000000000000000000000 Prionops_plumatus 01000010000001000000000000001000000000000001000000000000100 Promerops_cafer 01000001000000001000000000000000001000000000000000000000000 Prunella_collaris 01000001000000001000000000000000000010000000000000000000000 Psarisomus_dalhousiae 10100000100000000100000000000000000000000000000000000000000 Ptilogonys_cinereus 01000001000000100000000000000010000000000000000000000000000 Ptilonorhynchus_violaceus 01000010000100000000001000000000000000000000000000000000000 Ptiloris_magnificus 01000010000001000000000000001000000000000100000000100000000 Ptilorrhoa_caerulescens 01000010000001000000000000001000000000000000000000000000000 Pycnonotus_barbatus 01000001000000010000000000000000000000000000000000000000000 Regulus_calendula 01000001000000010000000000000000000000000000000000000000000 Regulus_satrapa 01000001000000010000000000000000000000000000000000000000000 Remiz_pendulinus 01000001000000010000000000000000100000000000000000000000000 Rhipidura_hyperthra 01000010000001000000000000001000000000000010000000000000000 Rupicola_rupicola 10011000000000000001000000000000000000000000000000000000000 Schiffornis_turdinus 10011000000000000001000000000000000000100000000000000000000 Scytalopus_magellanicus 10010100001000000000000000000000000000000000000000000000000 Sitta_carolinensis 01000001000000010000000000000000000000000000000000000000000 Smithornis_rufolateralis 10100000100000000100000000000000000000000000000000000000000 Sphecotheres_viridis 01000010000001000000000000001000000000000100000000001000000 Strepera_graculina 01000010000001000000000000001000000000000100000000010000000 Struthidea_cinerea 01000010000001000000000000001000000000010000000000000000000 Sturnus_vulgaris 01000001000000100000000000000000000000000000000000000000000 Sylvia_nana 01000001000000010000000000000000010000000000100000000000000 Telophorus_dohertyi 01000010000001000000000000001000000000000001000000000001000 Thamnophilus_nigrocinereus 10010000000000000000000000000000000000000000000000000000000 Thraupis_cyanocephala 01000001000000001000000000000000000001000000001000000000000 Tityra_semifasciata 10011000000000000001000000000000000000100000000000000000000 Toxorhamphus_novaeguineae 01000001000000001000000000000000000100000000000000000000001 Tregellasia_leucops 01000010000001000000000010000000000000000000000000000000000 Troglodytes_aedon 01000001000000010000000000000001000000000000000000000000000 Turdus_falklandii 01000001000000100000000000000000000000000000000000000000000 Tyrannus_tyrannus 10011000000000000001000000000000000000000000000000000000000 Vanga_curvirostris 01000010000001000000000000001000000000000001000000000000100 Vireo_philadelphia 01000010000001000000000000010000000000000000000000000000000 Yuhina_zantholeuca 01000001000000010000000000000000010000000000100000000000010 Zosterops_senegalensis 01000001000000010000000000000000000000000000000000000000000 ; END; BEGIN TREES; TITLE Passerine_RAG; LINK TAXA = Taxa2; TRANSLATE 1 Acanthisitta_chloris, 2 Aegithalos_iouschensis, 3 Aegithina_tiphia, 4 Ailuroedus_melanotis, 5 Alauda_arvensis, 6 Arcanator_orostruthus, 7 Artamus_cyanopterus, 8 Artamus_leucorhynchus, 9 Batis_mixta, 10 Bombycilla_garrulus, 11 Campylorhamphus_trochilirostris, 12 Cardinalis_cardinalis, 13 Catharus_ustulatus, 14 Certhia_familiaris, 15 Chaetops_frenatus, 16 Chaetorhynchus_papuensis, 17 Chloropsis_cochinchinensis, 18 Cinclus_cinclus, 19 Cisticola_anonyma, 20 Climacteris_erythrops, 21 Climacteris_picumnus, 22 Cnemophilus_loriae, 23 Colluricincla_harmonica, 24 Conopophaga_ardesiaca, 25 Coracias_caudata, 26 Coracina_lineata, 27 Coracina_novaehollandiae, 28 Corcorax_melanorhamphos, 29 Cormobates_leucophaea, 30 Corvinella_corvina, 31 Corvus_corone, 32 Corvus_coronoides, 33 Corvus_orru, 34 Cracticus_quoyi, 35 Culicicapa_ceylonensis, 36 Cyanocitta_cristata, 37 Daphoenositta_chrysoptera, 38 Dicaeum_aeneum, 39 Dicrurus_adsimilis, 40 Dicrurus_hottentottus, 41 Dryoscopus_cubla, 42 Elminia_nigromitrata, 43 Emberiza_schoeniclus, 44 Ephthianura_tricolor, 45 Eugerygone_rubra, 46 Falcunculus_frontatus, 47 Formicarius_colma, 48 Fringilla_montifringilla, 49 Furnarius_rufus, 50 Gallus_gallus, 51 Garrulax_milleti, 52 Grallina_cyanoleuca, 53 Gymnorhina_tibicen, 54 Hirundo_pyrrhonota, 55 Hirundo_rustica, 56 Hylophilus_poicilotis, 57 Icterus_parisorum, 58 Irena_cyanogaster, 59 Lalage_leucomela, 60 Lanius_excubitor, 61 Loboparadisaea_sericea, 62 Malurus_melanocephalus, 63 Manucodia_atra, 64 Manucodia_chalybata, 65 Melampitta_gigantea, 66 Melampitta_lugubris, 67 Melanocharis_nigra, 68 Melanocharis_versteri, 69 Melanodryas_cucullata, 70 Meliphaga_analoga, 71 Menura_novaehollandiae, 72 Microeca_papuana, 73 Mimus_patagonicus, 74 Mionectes_macconnellii, 75 Modulatrix_stictigula, 76 Monarcha_axillaris, 77 Monarcha_chrysomela, 78 Motacilla_cinerea, 79 Muscicapa_ferruginea, 80 Nectarinia_olivacea, 81 Neodrepanis_coruscans, 82 Oedistoma_iliolophum, 83 Oreoica_gutturalis, 84 Oriolus_larvatus, 85 Oriolus_xanthonotus, 86 Orthonyx_spaldingii, 87 Orthonyx_teminckii, 88 Pachycephala_hyperthra, 89 Pachycephala_soror, 90 Pachycephalopsis_poliosoma, 91 Paradisaea_raggiana, 92 Paramythia_montium, 93 Pardalotus_punctatus, 94 Pardalotus_striatus, 95 Parula_americana, 96 Parus_inornatus, 97 Parus_major, 98 Passer_montanus, 99 Peneothello_bimaculatus, 100 Pericrocotus_ethologus, 101 Philepitta_castanea, 102 Philesturnus_carunculatus, 103 Picathartes_gymnocephalus, 104 Pipra_coronata, 105 Pitohui_cristatus, 106 Pitta_sordida, 107 Ploceus_cucullatus, 108 Polioptila_caerulea, 109 Pomatostomus_halli, 110 Pomatostomus_isidorei, 111 Prionops_plumatus, 112 Promerops_cafer, 113 Prunella_collaris, 114 Psarisomus_dalhousiae, 115 Ptilogonys_cinereus, 116 Ptilonorhynchus_violaceus, 117 Ptiloris_magnificus, 118 Ptilorrhoa_caerulescens, 119 Pycnonotus_barbatus, 120 Regulus_calendula, 121 Regulus_satrapa, 122 Remiz_pendulinus, 123 Rhipidura_hyperthra, 124 Rupicola_rupicola, 125 Schiffornis_turdinus, 126 Scytalopus_magellanicus, 127 Sitta_carolinensis, 128 Smithornis_rufolateralis, 129 Sphecotheres_viridis, 130 Strepera_graculina, 131 Struthidea_cinerea, 132 Sturnus_vulgaris, 133 Sylvia_nana, 134 Telophorus_dohertyi, 135 Thamnophilus_nigrocinereus, 136 Thraupis_cyanocephala, 137 Tityra_semifasciata, 138 Toxorhamphus_novaeguineae, 139 Tregellasia_leucops, 140 Troglodytes_aedon, 141 Turdus_falklandii, 142 Tyrannus_tyrannus, 143 Vanga_curvirostris, 144 Vireo_philadelphia, 145 Yuhina_zantholeuca, 146 Zosterops_senegalensis; TREE Fig._1 = [&R] (50:0.0580975,(25:0.049315,(1:0.052216,(((106:0.033811,(128:0.024894,(114:0.022158,(81:0.019308,101:0.018403):0.006128):0.006898):0.001228):0.008156,((135:0.031731,(24:0.027042,(126:0.026993,(47:0.027415,(11:0.014213,49:0.018414):0.007398):0.001088):0.002844):4.51E-4):0.006518,(104:0.013742,((74:0.027731,142:0.019608):0.002516,(124:0.019665,(125:0.015677,137:0.011959):0.002763):0.001142):8.81E-4):0.011684):0.003533):0.005131,(71:0.031982,(((4:0.013878,116:0.012076):0.014567,(29:0.015177,(20:0.008562,21:0.008847):0.01138):0.015186):0.006162,((62:0.037798,((44:0.015744,70:0.008166):0.012755,(93:0.00538,94:0.004928):0.02004):0.002118):0.007361,((109:0.006957,110:0.004932):0.028409,((86:0.009158,87:0.007584):0.017225,(((15:0.018686,103:0.0174):0.008676,(((45:0.02744,90:0.024245):0.004895,(72:0.022544,(139:0.005551,(69:0.004049,99:0.005588):0.003374):0.01795):0.003457):0.003648,((((35:0.023643,42:0.022131):0.011607,(122:0.044169,(96:0.008785,97:0.007319):0.018279):0.003471):5.0E-4,(5:0.024978,((2:0.01761,(54:0.010447,55:0.006869):0.019701):0.001683,(119:0.029812,(19:0.027797,(133:0.021857,(51:0.01973,146:0.023794):0.003055):0.002984):8.05E-4):0.001578):0.00204):0.003207):0.001628,((((14:0.026182,127:0.051362):0.001743,(108:0.016658,140:0.021246):0.005922):0.004829,((120:0.010101,121:0.011839):0.022571,((10:0.022202,115:0.015861):0.009003,((73:0.018916,132:0.019928):0.007774,(18:0.026251,(79:0.024081,(13:0.013936,141:0.012249):0.014749):0.002928):0.002003):0.008068):0.001389):6.36E-4):2.61E-4,((112:0.020596,(6:0.006384,75:0.007744):0.010244):0.002981,((38:0.019848,80:0.022393):0.004304,((17:0.022605,58:0.02505):0.002364,(113:0.020984,(107:0.018687,(98:0.021786,(78:0.017006,(48:0.017785,((57:0.012412,95:0.010617):0.005732,(43:0.0144,(12:0.011134,136:0.013268):0.002777):0.001408):0.00354):0.002154):9.99E-4):0.001887):0.001589):0.006689):6.11E-4):0.001328):0.00122):4.13E-4):0.003684):0.001242):0.001362,(((102:0.019793,(22:0.003709,61:0.005365):0.018231):8.39E-4,((67:0.00572,68:0.005294):0.007562,(82:0.010555,138:0.018189):0.001417):0.010093):0.001507,(37:0.014002,((145:0.020686,(56:0.009553,144:0.008735):0.004464):0.008652,((100:0.022991,(59:0.012615,(26:0.001303,27:0.003647):0.005011):0.002987):0.004407,(((46:0.018352,118:0.021398):0.001016,(23:0.011332,(88:0.00652,89:0.004951):0.010644):0.002129):3.75E-4,(((83:0.009396,105:0.006281):0.011562,(92:0.022502,(129:0.015521,(84:0.005554,85:0.002822):0.012429):0.003622):0.001014):4.64E-4,((((7:0.001603,8:0.003013):0.019219,(130:0.007662,(34:3.05E-4,53:0.002009):0.004336):0.002539):0.004032,(9:0.013392,(111:0.010682,143:0.015509):0.001756,(3:0.018811,(41:0.011442,134:0.020259):0.00264):7.93E-4):9.22E-4):0.004475,((39:0.00276,40:0.00529):0.010068,((16:0.016504,123:0.019353):0.003774,(((30:0.004908,60:0.00536):0.018491,(36:0.005,(31:0.002146,(32:6.04E-4,33:6.03E-4):0.001809):0.009096):0.005731):0.002619,(((63:7.2E-4,64:0.00174):0.009195,(91:0.003057,117:0.003272):0.003362):0.003872,((28:0.006828,131:0.007724):0.006824,((65:0.005831,66:0.0041):0.007015,(52:0.0124,(76:0.006254,77:0.006178):0.006636):0.011315):0.001039):6.8E-4):0.001072):0.001317):3.54E-4):0.004):9.69E-4):7.88E-4):0.001432):0.001387):5.75E-4):0.004702):9.09E-4):0.001917):9.73E-4):0.002606):0.007337):0.003662):0.014218):0.006092):0.014699):0.0580975); END; BEGIN TREES; TITLE Passerine_Taxonomy; LINK TAXA = Taxa1; TRANSLATE 1 Acanthisitta_chloris, 2 Aegithalos_iouschensis, 3 Aegithina_tiphia, 4 Ailuroedus_melanotis, 5 Alauda_arvensis, 6 Arcanator_orostruthus, 7 Artamus_cyanopterus, 8 Artamus_leucorhynchus, 9 Batis_mixta, 10 Bombycilla_garrulus, 11 Campylorhamphus_trochilirostris, 12 Cardinalis_cardinalis, 13 Catharus_ustulatus, 14 Certhia_familiaris, 15 Chaetops_frenatus, 16 Chaetorhynchus_papuensis, 17 Chloropsis_cochinchinensis, 18 Cinclus_cinclus, 19 Cisticola_anonyma, 20 Climacteris_erythrops, 21 Climacteris_picumnus, 22 Cnemophilus_loriae, 23 Colluricincla_harmonica, 24 Conopophaga_ardesiaca, 25 Coracias_caudata, 26 Coracina_lineata, 27 Coracina_novaehollandiae, 28 Corcorax_melanorhamphos, 29 Cormobates_leucophaea, 30 Corvinella_corvina, 31 Corvus_corone, 32 Corvus_coronoides, 33 Corvus_orru, 34 Cracticus_quoyi, 35 Culicicapa_ceylonensis, 36 Cyanocitta_cristata, 37 Daphoenositta_chrysoptera, 38 Dicaeum_aeneum, 39 Dicrurus_adsimilis, 40 Dicrurus_hottentottus, 41 Dryoscopus_cubla, 42 Elminia_nigromitrata, 43 Emberiza_schoeniclus, 44 Ephthianura_tricolor, 45 Eugerygone_rubra, 46 Falcunculus_frontatus, 47 Formicarius_colma, 48 Fringilla_montifringilla, 49 Furnarius_rufus, 50 Gallus_gallus, 51 Garrulax_milleti, 52 Grallina_cyanoleuca, 53 Gymnorhina_tibicen, 54 Hirundo_pyrrhonota, 55 Hirundo_rustica, 56 Hylophilus_poicilotis, 57 Icterus_parisorum, 58 Irena_cyanogaster, 59 Lalage_leucomela, 60 Lanius_excubitor, 61 Loboparadisaea_sericea, 62 Malurus_melanocephalus, 63 Manucodia_atra, 64 Manucodia_chalybata, 65 Melampitta_gigantea, 66 Melampitta_lugubris, 67 Melanocharis_nigra, 68 Melanocharis_versteri, 69 Melanodryas_cucullata, 70 Meliphaga_analoga, 71 Menura_novaehollandiae, 72 Microeca_papuana, 73 Mimus_patagonicus, 74 Mionectes_macconnellii, 75 Modulatrix_stictigula, 76 Monarcha_axillaris, 77 Monarcha_chrysomela, 78 Motacilla_cinerea, 79 Muscicapa_ferruginea, 80 Nectarinia_olivacea, 81 Neodrepanis_coruscans, 82 Oedistoma_iliolophum, 83 Oreoica_gutturalis, 84 Oriolus_larvatus, 85 Oriolus_xanthonotus, 86 Orthonyx_spaldingii, 87 Orthonyx_teminckii, 88 Pachycephala_soror, 89 Pachycephala_hyperthra, 90 Pachycephalopsis_poliosoma, 91 Paradisaea_raggiana, 92 Paramythia_montium, 93 Pardalotus_punctatus, 94 Pardalotus_striatus, 95 Parula_americana, 96 Parus_inornatus, 97 Parus_major, 98 Passer_montanus, 99 Peneothello_bimaculatus, 100 Pericrocotus_ethologus, 101 Philepitta_castanea, 102 Philesturnus_carunculatus, 103 Picathartes_gymnocephalus, 104 Pipra_coronata, 105 Pitohui_cristatus, 106 Pitta_sordida, 107 Ploceus_cucullatus, 108 Polioptila_caerulea, 109 Pomatostomus_halli, 110 Pomatostomus_isidorei, 111 Prionops_plumatus, 112 Promerops_cafer, 113 Prunella_collaris, 114 Psarisomus_dalhousiae, 115 Ptilogonys_cinereus, 116 Ptilonorhynchus_violaceus, 117 Ptiloris_magnificus, 118 Ptilorrhoa_caerulescens, 119 Pycnonotus_barbatus, 120 Regulus_calendula, 121 Regulus_satrapa, 122 Remiz_pendulinus, 123 Rhipidura_hyperthra, 124 Rupicola_rupicola, 125 Schiffornis_turdinus, 126 Scytalopus_magellanicus, 127 Sitta_carolinensis, 128 Smithornis_rufolateralis, 129 Sphecotheres_viridis, 130 Strepera_graculina, 131 Struthidea_cinerea, 132 Sturnus_vulgaris, 133 Sylvia_nana, 134 Telophorus_dohertyi, 135 Thamnophilus_nigrocinereus, 136 Thraupis_cyanocephala, 137 Tityra_semifasciata, 138 Toxorhamphus_novaeguineae, 139 Tregellasia_leucops, 140 Troglodytes_aedon, 141 Turdus_falklandii, 142 Tyrannus_tyrannus, 143 Vanga_curvirostris, 144 Vireo_philadelphia, 145 Yuhina_zantholeuca, 146 Zosterops_senegalensis; TREE SA_Alltax = [&R] (50,(25,(((((((((((((51,((145,6,75),133)),146),19),119),(120,121)),(54,55)),2),((96,97),122)),(127,(14,(108,140)))),(5,((98,(78,(107,113))),(((((136,(12,57)),95),43),48),((112,(38,80)),(92,((67,68),(82,138)))))))),((10,115),(18,(((13,141),(35,79)),(73,132))))),(15,103),((((4,116),71),((20,21),29)),((((44,70),(93,94)),62),(102,((45,90,69,99,139,72),((17,58),((86,87),((109,110),((30,60),((56,144),(118,((28,131),(((83,46,(105,23,(89,88))),37),(((3,((41,134),(9,(111,143)))),(123,((39,40),16,(52,(42,(76,77)))))),(((31,32,33),36),(((65,66),((63,64),(22,61,91,117))),(((((26,27),59),100),((84,85),129)),((7,8),((34,53),130))))))))))))))))))),(1,(((((11,49),47,126),(24,135)),((((74,124),(125,137)),104),142)),((((81,101),114),128),106)))))); TREE SA_Pruned = [&R] (50,(25,(((((((((((((51,133),146),19),119),(120,121)),(54,55)),2),((96,97),122)),(127,(14,(108,140)))),(5,((98,(78,(107,113))),(((((136,(12,57)),95),43),48),((112,(38,80)),(92,((67,68),(82,138)))))))),((10,115),(18,(((13,141),79),(73,132))))),(15,103),((((4,116),71),((20,21),29)),((((44,70),(93,94)),62),((139,72),((17,58),((86,87),((109,110),((30,60),((56,144),(118,((28,131),(((83,46,(105,23,(89,88))),37),(((3,((41,134),(9,111))),(123,((39,40),16,(52,(76,77))))),(((31,32,33),36),(((65,66),((63,64),(91,117))),(((((26,27),59),100),((84,85),129)),((7,8),((34,53),130)))))))))))))))))),(1,(((((11,49),(47,(24,126))),135),(74,((124,104),(142,(125,137))))),((114,128),106)))))); TREE ML = [&R] (((1,((((((((((((((2,(54,55)),((19,((51,146),133)),119)),5),((35,42),((96,97),122))),((((6,75),112),((((((((((12,136),43),(57,95)),48),78),98),107),113),(17,58)),(38,80))),((((10,115),((((13,141),79),18),(73,132))),(120,121)),((14,127),(108,140))))),((45,90),(((69,99),139),72))),(15,103)),((((((((((3,(41,134)),9,(111,143)),((7,8),((34,53),130))),(((16,123),((((28,131),((52,(76,77)),(65,66))),((63,64),(91,117))),((30,60),((31,(32,33)),36)))),(39,40))),((83,105),(((84,85),129),92))),((23,(88,89)),(46,118))),(((26,27),59),100)),((56,144),145)),37),(((22,61),102),((67,68),(82,138))))),(86,87)),(109,110)),(((44,70),(93,94)),62)),((4,116),((20,21),29))),71),(((((((11,49),47),126),24),135),(((74,142),(124,(125,137))),104)),((((81,101),114),128),106)))),25),50); END;