#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 20, 2019; 14:49 GMT TreeBASE (cc) 1994-2008 Study reference: Barker F., Cibois A., Schikler P., Feinstein J., & Cracraft J. 2004. Phylogeny and diversification of the largest avian radiation. Proceedings of the National Academy of Sciences of the United States of America, 101(30): 11040-11045. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11939] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=146; TAXLABELS Acanthisitta_chloris Aegithalos_iouschensis Aegithina_tiphia Ailuroedus_melanotis Alauda_arvensis Arcanator_orostruthus Artamus_cyanopterus Artamus_leucorhynchus Batis_mixta Bombycilla_garrulus Campylorhamphus_trochilirostris Cardinalis_cardinalis Catharus_ustulatus Certhia_familiaris Chaetops_frenatus Chaetorhynchus_papuensis Chloropsis_cochinchinensis Cinclus_cinclus Cisticola_anonyma Climacteris_erythrops Climacteris_picumnus Cnemophilus_loriae Colluricincla_harmonica Conopophaga_ardesiaca Coracias_caudata Coracina_lineata Coracina_novaehollandiae Corcorax_melanorhamphos Cormobates_leucophaea Corvinella_corvina Corvus_corone Corvus_coronoides Corvus_orru Cracticus_quoyi Culicicapa_ceylonensis Cyanocitta_cristata Daphoenositta_chrysoptera Dicaeum_aeneum Dicrurus_adsimilis Dicrurus_hottentottus Dryoscopus_cubla Elminia_nigromitrata Emberiza_schoeniclus Ephthianura_tricolor Eugerygone_rubra Falcunculus_frontatus Formicarius_colma Fringilla_montifringilla Furnarius_rufus Gallus_gallus Garrulax_milleti Grallina_cyanoleuca Gymnorhina_tibicen Hirundo_pyrrhonota Hirundo_rustica Hylophilus_poicilotis Icterus_parisorum Irena_cyanogaster Lalage_leucomela Lanius_excubitor Loboparadisaea_sericea Malurus_melanocephalus Manucodia_atra Manucodia_chalybata Melampitta_gigantea Melampitta_lugubris Melanocharis_nigra Melanocharis_versteri Melanodryas_cucullata Meliphaga_analoga Menura_novaehollandiae Microeca_papuana Mimus_patagonicus Mionectes_macconnellii Modulatrix_stictigula Monarcha_axillaris Monarcha_chrysomela Motacilla_cinerea Muscicapa_ferruginea Nectarinia_olivacea Neodrepanis_coruscans Oedistoma_iliolophum Oreoica_gutturalis Oriolus_larvatus Oriolus_xanthonotus Orthonyx_spaldingii Orthonyx_teminckii Pachycephala_hyperthra Pachycephala_soror Pachycephalopsis_poliosoma Paradisaea_raggiana Paramythia_montium Pardalotus_punctatus Pardalotus_striatus Parula_americana Parus_inornatus Parus_major Passer_montanus Peneothello_bimaculatus Pericrocotus_ethologus Philepitta_castanea Philesturnus_carunculatus Picathartes_gymnocephalus Pipra_coronata Pitohui_cristatus Pitta_sordida Ploceus_cucullatus Polioptila_caerulea Pomatostomus_halli Pomatostomus_isidorei Prionops_plumatus Promerops_cafer Prunella_collaris Psarisomus_dalhousiae Ptilogonys_cinereus Ptilonorhynchus_violaceus Ptiloris_magnificus Ptilorrhoa_caerulescens Pycnonotus_barbatus Regulus_calendula Regulus_satrapa Remiz_pendulinus Rhipidura_hyperthra Rupicola_rupicola Schiffornis_turdinus Scytalopus_magellanicus Sitta_carolinensis Smithornis_rufolateralis Sphecotheres_viridis Strepera_graculina Struthidea_cinerea Sturnus_vulgaris Sylvia_nana Telophorus_dohertyi Thamnophilus_nigrocinereus Thraupis_cyanocephala Tityra_semifasciata Toxorhamphus_novaeguineae Tregellasia_leucops Troglodytes_aedon Turdus_falklandii Tyrannus_tyrannus Vanga_curvirostris Vireo_philadelphia Yuhina_zantholeuca Zosterops_senegalensis ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=146; TAXLABELS Acanthisitta_chloris Aegithalos_iouschensis Aegithina_tiphia Ailuroedus_melanotis Alauda_arvensis Arcanator_orostruthus Artamus_cyanopterus Artamus_leucorhynchus Batis_mixta Bombycilla_garrulus Campylorhamphus_trochilirostris Cardinalis_cardinalis Catharus_ustulatus Certhia_familiaris Chaetops_frenatus Chaetorhynchus_papuensis Chloropsis_cochinchinensis Cinclus_cinclus Cisticola_anonyma Climacteris_erythrops Climacteris_picumnus Cnemophilus_loriae Colluricincla_harmonica Conopophaga_ardesiaca Coracias_caudata Coracina_lineata Coracina_novaehollandiae Corcorax_melanorhamphos Cormobates_leucophaea Corvinella_corvina Corvus_corone Corvus_coronoides Corvus_orru Cracticus_quoyi Culicicapa_ceylonensis Cyanocitta_cristata Daphoenositta_chrysoptera Dicaeum_aeneum Dicrurus_adsimilis Dicrurus_hottentottus Dryoscopus_cubla Elminia_nigromitrata Emberiza_schoeniclus Ephthianura_tricolor Eugerygone_rubra Falcunculus_frontatus Formicarius_colma Fringilla_montifringilla Furnarius_rufus Gallus_gallus Garrulax_milleti Grallina_cyanoleuca Gymnorhina_tibicen Hirundo_pyrrhonota Hirundo_rustica Hylophilus_poicilotis Icterus_parisorum Irena_cyanogaster Lalage_leucomela Lanius_excubitor Loboparadisaea_sericea Malurus_melanocephalus Manucodia_atra Manucodia_chalybata Melampitta_gigantea Melampitta_lugubris Melanocharis_nigra Melanocharis_versteri Melanodryas_cucullata Meliphaga_analoga Menura_novaehollandiae Microeca_papuana Mimus_patagonicus Mionectes_macconnellii Modulatrix_stictigula Monarcha_axillaris Monarcha_chrysomela Motacilla_cinerea Muscicapa_ferruginea Nectarinia_olivacea Neodrepanis_coruscans Oedistoma_iliolophum Oreoica_gutturalis Oriolus_larvatus Oriolus_xanthonotus Orthonyx_spaldingii Orthonyx_teminckii Pachycephala_hyperthra Pachycephala_soror Pachycephalopsis_poliosoma Paradisaea_raggiana Paramythia_montium Pardalotus_punctatus Pardalotus_striatus Parula_americana Parus_inornatus Parus_major Passer_montanus Peneothello_bimaculatus Pericrocotus_ethologus Philepitta_castanea Philesturnus_carunculatus Picathartes_gymnocephalus Pipra_coronata Pitohui_cristatus Pitta_sordida Ploceus_cucullatus Polioptila_caerulea Pomatostomus_halli Pomatostomus_isidorei Prionops_plumatus Promerops_cafer Prunella_collaris Psarisomus_dalhousiae Ptilogonys_cinereus Ptilonorhynchus_violaceus Ptiloris_magnificus Ptilorrhoa_caerulescens Pycnonotus_barbatus Regulus_calendula Regulus_satrapa Remiz_pendulinus Rhipidura_hyperthra Rupicola_rupicola Schiffornis_turdinus Scytalopus_magellanicus Sitta_carolinensis Smithornis_rufolateralis Sphecotheres_viridis Strepera_graculina Struthidea_cinerea Sturnus_vulgaris Sylvia_nana Telophorus_dohertyi Thamnophilus_nigrocinereus Thraupis_cyanocephala Tityra_semifasciata Toxorhamphus_novaeguineae Tregellasia_leucops Troglodytes_aedon Turdus_falklandii Tyrannus_tyrannus Vanga_curvirostris Vireo_philadelphia Yuhina_zantholeuca Zosterops_senegalensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10329] TITLE Passerine_Taxonomy; LINK TAXA = Taxa2; DIMENSIONS NCHAR=59; FORMAT DATATYPE=Standard SYMBOLS= "0 1" MISSING=? GAP= -; CHARSTATELABELS 1 Tyranni, 2 Passeri, 3 Eurylaimides, 4 Tyrannides, 5 Tyrannida, 6 Furnariida, 7 Corvida, 8 Passerida, 9 Eurylaimoidea, 10 Furnarioidea, 11 Formicarioidea, 12 Menuroidea, 13 Meliphagoidea, 14 Corvoidea, 15 Muscicapoidea, 16 Sylvioidea, 17 Passeroidea, 18 Eurylaimidae, 19 Philepittidae, 20 Tyrannidae, 21 Furnariidae, 22 Climacteridae, 23 Ptilonorhynchidae, 24 Meliphagidae, 25 Petroicidae, 26 Irenidae, 27 Laniidae, 28 Vireonidae, 29 Corvidae, 30 Picathartidae, 31 Bombycillidae, 32 Certhiidae, 33 Paridae, 34 Sylviidae, 35 Nectariniidae, 36 Melanocharitidae, 37 Passeridae, 38 Fringillidae, 39 Tityrinae, 40 Corcoracinae, 41 Pachycephalinae, 42 Corvinae, 43 Dicrurinae, 44 Malaconotinae, 45 Sylviinae, 46 Nectariniinae, 47 Emberizinae, 48 Falcunculini, 49 Pachycephalini, 50 Corvini, 51 Paradisaeini, 52 Artamini, 53 Oriolini, 54 Dicrurini, 55 Monarchini, 56 Malaconotini, 57 Vangini, 58 Timaliini, 59 Toxorhamphini, ; MATRIX [ 10 20 30 40 50 ] [ . . . . . ] Acanthisitta_chloris 10000000000000000000000000000000000000000000000000000000000 Aegithalos_iouschensis 01000001000000010000000000000000000000000000000000000000000 Aegithina_tiphia 01000010000001000000000000001000000000000000000000000000000 Ailuroedus_melanotis 01000010000100000000001000000000000000000000000000000000000 Alauda_arvensis 01000001000000001000000000000000000000000000000000000000000 Arcanator_orostruthus 01000001000000010000000000000000010000000000100000000000010 Artamus_cyanopterus 01000010000001000000000000001000000000000100000000010000000 Artamus_leucorhynchus 01000010000001000000000000001000000000000100000000010000000 Batis_mixta 01000010000001000000000000001000000000000001000000000000100 Bombycilla_garrulus 01000001000000100000000000000010000000000000000000000000000 Campylorhamphus_trochilirostris 10010100010000000000100000000000000000000000000000000000000 Cardinalis_cardinalis 01000001000000001000000000000000000001000000001000000000000 Catharus_ustulatus 01000001000000100000000000000000000000000000000000000000000 Certhia_familiaris 01000001000000010000000000000001000000000000000000000000000 Chaetops_frenatus 010000??000000000000000000000100000000000000000000000000000 Chaetorhynchus_papuensis 01000010000001000000000000001000000000000010000000000100000 Chloropsis_cochinchinensis 01000010000001000000000001000000000000000000000000000000000 Cinclus_cinclus 01000001000000100000000000000000000000000000000000000000000 Cisticola_anonyma 01000001000000010000000000000000000000000000000000000000000 Climacteris_erythrops 01000010000100000000010000000000000000000000000000000000000 Climacteris_picumnus 01000010000100000000010000000000000000000000000000000000000 Cnemophilus_loriae 01000010000001000000000000001000000000000100000000100000000 Colluricincla_harmonica 01000010000001000000000000001000000000001000000010000000000 Conopophaga_ardesiaca 10010100001000000000000000000000000000000000000000000000000 Coracias_caudata 00000000000000000000000000000000000000000000000000000000000 Coracina_lineata 01000010000001000000000000001000000000000100000000001000000 Coracina_novaehollandiae 01000010000001000000000000001000000000000100000000001000000 Corcorax_melanorhamphos 01000010000001000000000000001000000000010000000000000000000 Cormobates_leucophaea 01000010000100000000010000000000000000000000000000000000000 Corvinella_corvina 01000010000001000000000000100000000000000000000000000000000 Corvus_corone 01000010000001000000000000001000000000000100000001000000000 Corvus_coronoides 01000010000001000000000000001000000000000100000001000000000 Corvus_orru 01000010000001000000000000001000000000000100000001000000000 Cracticus_quoyi 01000010000001000000000000001000000000000100000000010000000 Culicicapa_ceylonensis 01000001000000100000000000000000000000000000000000000000000 Cyanocitta_cristata 01000010000001000000000000001000000000000100000001000000000 Daphoenositta_chrysoptera 01000010000001000000000000001000000000001000000000000000000 Dicaeum_aeneum 01000001000000001000000000000000001000000000010000000000000 Dicrurus_adsimilis 01000010000001000000000000001000000000000010000000000100000 Dicrurus_hottentottus 01000010000001000000000000001000000000000010000000000100000 Dryoscopus_cubla 01000010000001000000000000001000000000000001000000000001000 Elminia_nigromitrata 01000010000001000000000000001000000000000010000000000010000 Emberiza_schoeniclus 01000001000000001000000000000000000001000000001000000000000 Ephthianura_tricolor 01000010000010000000000100000000000000000000000000000000000 Eugerygone_rubra 01000010000001000000000010000000000000000000000000000000000 Falcunculus_frontatus 01000010000001000000000000001000000000001000000100000000000 Formicarius_colma 10010100001000000000000000000000000000000000000000000000000 Fringilla_montifringilla 01000001000000001000000000000000000001000000000000000000000 Furnarius_rufus 10010100010000000000100000000000000000000000000000000000000 Gallus_gallus 00000000000000000000000000000000000000000000000000000000000 Garrulax_milleti 01000001000000010000000000000000010000000000000000000000000 Grallina_cyanoleuca 01000010000001000000000000001000000000000010000000000010000 Gymnorhina_tibicen 01000010000001000000000000001000000000000100000000010000000 Hirundo_pyrrhonota 01000001000000010000000000000000000000000000000000000000000 Hirundo_rustica 01000001000000010000000000000000000000000000000000000000000 Hylophilus_poicilotis 01000010000001000000000000010000000000000000000000000000000 Icterus_parisorum 01000001000000001000000000000000000001000000001000000000000 Irena_cyanogaster 01000010000001000000000001000000000000000000000000000000000 Lalage_leucomela 01000010000001000000000000001000000000000100000000001000000 Lanius_excubitor 01000010000001000000000000100000000000000000000000000000000 Loboparadisaea_sericea 01000010000001000000000000001000000000000100000000100000000 Malurus_melanocephalus 01000010000010000000000000000000000000000000000000000000000 Manucodia_atra 01000010000001000000000000001000000000000100000000100000000 Manucodia_chalybata 01000010000001000000000000001000000000000100000000100000000 Melampitta_gigantea 01000010000001000000000000001000000000000100000000100000000 Melampitta_lugubris 01000010000001000000000000001000000000000100000000100000000 Melanocharis_nigra 01000001000000001000000000000000000100000000000000000000000 Melanocharis_versteri 01000001000000001000000000000000000100000000000000000000000 Melanodryas_cucullata 01000010000001000000000010000000000000000000000000000000000 Meliphaga_analoga 01000010000010000000000100000000000000000000000000000000000 Menura_novaehollandiae 01000010000100000000000000000000000000000000000000000000000 Microeca_papuana 01000010000001000000000010000000000000000000000000000000000 Mimus_patagonicus 01000001000000100000000000000000000000000000000000000000000 Mionectes_macconnellii 10011000000000000001000000000000000000000000000000000000000 Modulatrix_stictigula 01000001000000010000000000000000010000000000100000000000010 Monarcha_axillaris 01000010000001000000000000001000000000000010000000000010000 Monarcha_chrysomela 01000010000001000000000000001000000000000010000000000010000 Motacilla_cinerea 01000001000000001000000000000000000010000000000000000000000 Muscicapa_ferruginea 01000001000000100000000000000000000000000000000000000000000 Nectarinia_olivacea 01000001000000001000000000000000001000000000010000000000000 Neodrepanis_coruscans 10100000100000000010000000000000000000000000000000000000000 Oedistoma_iliolophum 01000001000000001000000000000000000100000000000000000000001 Oreoica_gutturalis 01000010000001000000000000001000000000001000000100000000000 Oriolus_larvatus 01000010000001000000000000001000000000000100000000001000000 Oriolus_xanthonotus 01000010000001000000000000001000000000000100000000001000000 Orthonyx_spaldingii 01000010000001000000000000000000000000000000000000000000000 Orthonyx_teminckii 01000010000001000000000000000000000000000000000000000000000 Pachycephala_hyperthra 01000010000001000000000000001000000000001000000010000000000 Pachycephala_soror 01000010000001000000000000001000000000001000000010000000000 Pachycephalopsis_poliosoma 01000010000001000000000010000000000000000000000000000000000 Paradisaea_raggiana 01000010000001000000000000001000000000000100000000100000000 Paramythia_montium 01000001000000001000000000000000000000000000000000000000000 Pardalotus_punctatus 01000010000010000000000000000000000000000000000000000000000 Pardalotus_striatus 01000010000010000000000000000000000000000000000000000000000 Parula_americana 01000001000000001000000000000000000001000000001000000000000 Parus_inornatus 01000001000000010000000000000000100000000000000000000000000 Parus_major 01000001000000010000000000000000100000000000000000000000000 Passer_montanus 01000001000000001000000000000000000010000000000000000000000 Peneothello_bimaculatus 01000010000001000000000010000000000000000000000000000000000 Pericrocotus_ethologus 01000010000001000000000000001000000000000100000000001000000 Philepitta_castanea 10100000100000000010000000000000000000000000000000000000000 Philesturnus_carunculatus 01000010000001000000000000000000000000000000000000000000000 Picathartes_gymnocephalus 010000??000000000000000000000100000000000000000000000000000 Pipra_coronata 10011000000000000001000000000000000000000000000000000000000 Pitohui_cristatus 01000010000001000000000000001000000000001000000010000000000 Pitta_sordida 10100000000000000000000000000000000000000000000000000000000 Ploceus_cucullatus 01000001000000001000000000000000000010000000000000000000000 Polioptila_caerulea 01000001000000010000000000000001000000000000000000000000000 Pomatostomus_halli 01000010000001000000000000000000000000000000000000000000000 Pomatostomus_isidorei 01000010000001000000000000000000000000000000000000000000000 Prionops_plumatus 01000010000001000000000000001000000000000001000000000000100 Promerops_cafer 01000001000000001000000000000000001000000000000000000000000 Prunella_collaris 01000001000000001000000000000000000010000000000000000000000 Psarisomus_dalhousiae 10100000100000000100000000000000000000000000000000000000000 Ptilogonys_cinereus 01000001000000100000000000000010000000000000000000000000000 Ptilonorhynchus_violaceus 01000010000100000000001000000000000000000000000000000000000 Ptiloris_magnificus 01000010000001000000000000001000000000000100000000100000000 Ptilorrhoa_caerulescens 01000010000001000000000000001000000000000000000000000000000 Pycnonotus_barbatus 01000001000000010000000000000000000000000000000000000000000 Regulus_calendula 01000001000000010000000000000000000000000000000000000000000 Regulus_satrapa 01000001000000010000000000000000000000000000000000000000000 Remiz_pendulinus 01000001000000010000000000000000100000000000000000000000000 Rhipidura_hyperthra 01000010000001000000000000001000000000000010000000000000000 Rupicola_rupicola 10011000000000000001000000000000000000000000000000000000000 Schiffornis_turdinus 10011000000000000001000000000000000000100000000000000000000 Scytalopus_magellanicus 10010100001000000000000000000000000000000000000000000000000 Sitta_carolinensis 01000001000000010000000000000000000000000000000000000000000 Smithornis_rufolateralis 10100000100000000100000000000000000000000000000000000000000 Sphecotheres_viridis 01000010000001000000000000001000000000000100000000001000000 Strepera_graculina 01000010000001000000000000001000000000000100000000010000000 Struthidea_cinerea 01000010000001000000000000001000000000010000000000000000000 Sturnus_vulgaris 01000001000000100000000000000000000000000000000000000000000 Sylvia_nana 01000001000000010000000000000000010000000000100000000000000 Telophorus_dohertyi 01000010000001000000000000001000000000000001000000000001000 Thamnophilus_nigrocinereus 10010000000000000000000000000000000000000000000000000000000 Thraupis_cyanocephala 01000001000000001000000000000000000001000000001000000000000 Tityra_semifasciata 10011000000000000001000000000000000000100000000000000000000 Toxorhamphus_novaeguineae 01000001000000001000000000000000000100000000000000000000001 Tregellasia_leucops 01000010000001000000000010000000000000000000000000000000000 Troglodytes_aedon 01000001000000010000000000000001000000000000000000000000000 Turdus_falklandii 01000001000000100000000000000000000000000000000000000000000 Tyrannus_tyrannus 10011000000000000001000000000000000000000000000000000000000 Vanga_curvirostris 01000010000001000000000000001000000000000001000000000000100 Vireo_philadelphia 01000010000001000000000000010000000000000000000000000000000 Yuhina_zantholeuca 01000001000000010000000000000000010000000000100000000000010 Zosterops_senegalensis 01000001000000010000000000000000000000000000000000000000000 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10328] TITLE Passerine_RAG; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4126; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acanthisitta_chloris TAAAGTGCGATCGTTTGATAAAACACCCTCCGATGGCAACCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATGAAGATGAAGTGGTGCCAAGAGGAGAAGGG---------------ATGGAGTTAATGGGCAACAGG---GAGGCAGTCAAGAAAGATGCCCAT---------GACATGAAGACACAAGACAAC---AGAGATCACCAGAGCAATCTGGAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTACATGGGCCAGTGGATGATGAAACTCTGTGGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATAGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCGATTTTGTCACAA{CT}TGCTGGAGTATTATCCACAGGAAATTCAGTAATAC{AT}CTATGTGAAGTATATTTTCCTAGGAACAGCACAGTGGAGTGGCAGCCTCACTCTCCAAACTGTGATGTGTGCCATACTACCCGACAAGGAGTCAAGAGAAAAAACCAACAACCGAGAGTGCAACATGGCAAACGTGTGAAGACCATTGTGGAATGTGCTCGACTAAACAGAGGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAAAATATACATCTCAGCACCAAGATGCTTACAGTTGATTACCCAGAGGATTTCATTAAATCCTTATCTTGCCAGATTTGTGAACATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGTCCTTCCTGCTGGTATCCTTGTTTTCCTACTGATCTGGAAATACCAGTGAAATCCTTCCTGAACACCCTTGATAGCCTGAGTATAAGATGCCCTGTAAAAGACTGTGATGAAGAAATCAGGTATGGAAAATATAGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACATCCACATAAATAAAGGTGGCAGACCGAGGCAGCATCTCCTAACTTTGACCAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGCCTGGCAATTCGAATCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAAATCTTCCAGCCTTTGCATTCTCTTCGCACTGCTGAGAAAGCTCTCCTGCCAGGTTATCATCCATTTGAGTGGAAACCTCCTTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAACACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTCAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGCAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAGCATTGCTATAGCACAGGGGAATGAAAACAAGAGGATCTTTGAGGAAGGAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCGATCCTGAGCCCCCTCATTGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGTATCCTGAGAACATTCAGGTTCATCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATCACCAGGAGTCATGCTGAAAATCTGGAGCGATATGAAATTTGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGCAACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACTGTTCCCTCTATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCTGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCA{CT}GTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGTAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGG{CT}GTTTTCCTTCTTGATATAACACAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCCTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAAGTCTGACGAGTACCAGTATATCATCCATGGTGGTAAAACCCCTAACAATGACCTTTCTGATAAAATTTACATTATGAGTCTGGTCAGCAAAAATGGTAAGAAAACCACATTCCAATGTGTTGAGAAAGACCTGGGTGGAGATGTCCCTGCAGCTAGATATGGGCACACAATTAATGTTGTTCATAG{CT}CGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATATTCCTCTTGCACAAAGAACTACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGTTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAGTTGATCTTCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATTAGTGATACCGAATTTGTCCTTGTTGGAGGTTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTCCTGGAAGACAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAGCACTGCAGAATATGGTTTGGCTGTGATATGGGCAATGGATCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTACCCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAAGAGCAGAAGAGGAGAAGGAGGAAGAACTGACATCACAAATGTGTAGTCAAACATCAACTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATACTGACACTTACAACGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Aegithalos_iouschensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAGAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAGCTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAG{AG}TTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCACACGAGGAGTCAAGAGAAAAAAACAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCA{CG}AGATAAAC---AAAAATTTAATTAAAGAGATTGTGAACTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCGTTAAATCCATCTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTT{CT}TGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCAGAACATTCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGCTCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTACCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAGAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCGTCCTGAGAACATTTAGATTTGTCTTTAGGGGTACGGGATATGATGAGAAACTCATGCGGGAAGTAGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACAGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTTCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAAATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTG----------------------------TCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CT}GCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCCAACAACGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCC{AG}CTTGCACAAAGAACCACTGAAAAATGGAATAGCGTAGTCGATTGTTTACCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCAAACTTGTACAAGTTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATCGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGAGAACCCAGAGTGGACACCGGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---TTGATAACACAAATTTGCAGTCAGACATCGAGTGAAGATGCTGGAGACTCTGCTCCATTTGATGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Aegithina_tiphia TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGAAGAAGAGGCTGTTTCT------------------------------------------------------------TCGAACGAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAAGGACTTGAGGAAGATGCCCAT---------GCCAGGCAAACACGAGAGAGT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCTGTACTACCAAACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCTACTGATTTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGAAAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTATATAAATAAAGGTGGTCGACCGAGGCAGCATCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTAGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGACGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGGTTTTCTTTCACAGTGATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTCACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGAT{CT}TTCCAGATGGAGATCGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCCGA---------AGGGCTGATGAGTATCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAAAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATATCCTTCCAGAACTTCAAGATGGACTCTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTATAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAA{CT}GTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGATCAGAAGAGGACAAGGAAGAAGAATCAATAACACA{AG}ATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Ailuroedus_melanotis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAGACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCAT---------GCCATGAAAACCCAAGACAAT---AGAGGTCATCAAAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATC{AG}CTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTTTGCCGTACTACCAGCCGAGGAGTCAAGAGAAGAAGCCAGCCCCCGAGTGTGCAACATGGCAAACGTGCCAAAACCACTGGGGAACGTCCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAAGCTATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATAAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATACAGCAAACACCTCTCCAGCCAT---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGACTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGAAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTACCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCTTGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACGGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGGGACGTCAGTGAAAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATTTTTGAGGAACTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAATGCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACGTACATTTGCACCCTGTGTGATGCAACGCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTCTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCCACAAAGTTCAAGTACAGATATGAAGGCAAAATTACAAATTACTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCCCACTCAGAAGCAAT---------GACGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTAGTAAGCAAAAATAGCAAGAAAATGATGTTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATTAGTGTCCTGTTTGGAGGGAGATCATATACTCCTCTCGCACAAAGAACCACTGAAAAATGGAACAGCGTGGTTGACTGTTTGCCGTCTGTGTTTCTCATCGATTTTGAGTTTGGATGCAGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCGCTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGTCCAGCTGTGACCTGCACCGTCATGCCAGGGGGGATATCGGTGTCAAGTGCTATTGTGACTCAGATCAGTGATACTGAATTTGTCCTGGTTGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGGTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATATGGTTTGGCTGTGATATGGGTAAAGGGTCTATATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGGCAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCAAGTGAAGA{CG}CCGGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Alauda_arvensis TAAATTGCCATCTTTTGA{AC}AAAACACCCTCTGATGACAGCCAGCACATAAACAAAGA{CT}CAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGCTAATGGGCAGTAGG---CAGG{AG}ACTTGAGGAAGATGCCCAT---------GCCCTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTCAAGCAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAGACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATGCTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAATGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGG{AC}AGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTAC{CT}CCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGACGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCCAG{AG}CAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAATTGGAAGCTATAATGAAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACT{GT}CTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACAC{AT}GAAGTGGGAATTATAGATGGACTATC{AG}GGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGCGATTCCG{AG}TATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGG{AC}ATGAAAGCAAACAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGAT{CT}GGTGAACTTTACAAGAATCCTGATGTGTCTAA{AG}GAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTT{CT}GCAGAACTC{CT}TATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCAT{CT}GGGGCCTGGGCAAGTGAAGGAAATGAGTCTGG{AC}AACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCCATGGTGTTTTCCTCCTCGATATAAAACAGAATGAGCTCAAAATGAAACCTGCCTTCTTT---AAAGATTTGTGCTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATCCAAGGGCTGAGGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAACGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGAGCTGGGTGGAGATGTCCCTGAAGCTAGATATGGCCATACAATTAATGTAGTTCACAGCTGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTTTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACTTACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---GAATTAACACAAACTTGCAGTCAGACATCAAGTGAGGACCCTGGAGACTCTGGTCCATTTGAAGATTCGGAAGAGTTTTGTTTTAGTCCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Arcanator_orostruthus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAATGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAATCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGACAATAGG---CAGGGACTTGAAGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGCGGAGTTCCATTTAAAATTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAG?CCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAAACAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGACCCAGTGGAAACAACATGTAGACACTTGTTTTGCAGACCTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCT{AG}TAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCACTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCC?GAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATA{CT}CACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCATCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAATTTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGCTTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGAT{CT}TACCCCTGGGCAGCCCGGAGGTGACCTGCAGCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCATTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATACTCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCGGAAACAGGCTACTGGATCACCTGCTGTGCC Artamus_cyanopterus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGAGCACTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAACTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACGGTGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCATCCCCCAAGTGTACAAC{AT}TGGCAAACGTGTCAAAACCACAGGCGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGATGCTTGTAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTG{CT}GATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTACTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAGGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCACGGAAAATATGGACAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCGCTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATATGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAAGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAGGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAGGCCATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAAAGCGTAAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCTAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACTCCGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGGAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTCTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGTGAACTACTTTTACATTCTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATGACACAAATTTGCAGTCAGAC{AG}TCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCTGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Artamus_leucorhynchus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGAGCACTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAACTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAGGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACGGTGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCATCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACAGGCGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGATGCTTGTAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAGGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCACGGAAAATATGGACAACACCTCTCCAGCCATAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGC{AG}TGAAAGCAAAAAACCTGGATGACTATATGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTAAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAGGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCCATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAAAGCGTAAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCTAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACTATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACTCCGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGGAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTCTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCGAACTACTTTTACATTCTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATGACACAAATTTGCAGTCAGACGTCAAGTGAAGACCTTGGAGACTCCACTCCATTTGAAGACTCTGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Batis_mixta TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAA{CT}GGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACGAGACAGT---AGAGTTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTACATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAAC{CT}TCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCACTTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAACCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGCTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGTTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCCGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCCTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACA{CT}GGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGTAAGCCCTTGTGTCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCC{CT}CTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCAATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGA{CT}GTTCCAATGCATTGAGAAAGGCCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCGCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTA{CT}CGGTGTCAAGTGCTATAGTGACCCAGATTAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGC{AG}GAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCGAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGG{CT}TACTGGATCACCTGCTGTGAG Bombycilla_garrulus TAAACTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCA{AG}TGGGCAACAGGCAACAGGGAC{CT}TGAAGAAGATGCTCAT---------GCCATGAAAACACAAGACACA---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCGTTTAAAAGTGACTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGGAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAAGGGATGTTGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGTGGCAAACGTGTCAAAACCACTGGGGCACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGCTTGTCAATTGCAAGGATAAACATCTCAGCACCAAGTTCCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAAACCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTAACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAGGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGC{AC}GATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTCCGCACTGCTGAGAAAGCTCTCCTACCCGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACT{CT}TCAATTGATGATTACCCAGTAGAAACAATTGCAAAAAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACCGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAACAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGGGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACCGCATTTTCCAGATGGAAATTGGTGAACTTTACAAAAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAGTTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAAATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAC{AG}CTC{AG}GAAGCGATGCTAGTGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGAGAAAGTTTACTTTATGAGTCTG{GT}TAAACAAAACTGGCAAGAAAATGACGTTCCAATGCATTGAAAAAGACCTGAGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTCGCACA{AG}AGAACCACTGAAAACTGGAACAGCGTAGTCGATTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTCTACATCTTACGTATTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGTCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCTTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATTGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGTTTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAA---CCGGTAACCCAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGTTACTGGATCACCTGCTGTGCC Campylorhamphus_trochilirostris TAAAGTGCGATCATTTGAAGAAACACCCTCTGATGACAGGCAGCATATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAATGAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ACAGACTTAATGGGCAGTAGG---CAGGAACTTGAGAAAGAGGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGTTACAACAGAACTCATCCAGTTCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTTAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAATAATACTCTATGTGAAGTATATTTTCCTAGGAATAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATGCTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGCAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCCGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGTCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCAGAGTCAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCAATCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTCACCGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTTCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCCATTGCACACGGGAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGCCTTATGCTGGCGGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGATGCTTGAAATGGGAGGCGTCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACACGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCATTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTGTGATGAGGATGACTGGAAATTTTGCTAGAAAACTTATGTCAAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGAACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCGTCATGCCCTGCCAAGGAGTGCCCAGAACTACTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTGTCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATC{AG}TTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTCAAAATGAAACCCACCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTTTCTGATAAGATTTACCTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGGTGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACAGAAAAATGGAACAGCGTAG{CT}TGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCATTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAACAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCGATGATACTGAATTTGTCCTTGTTGGTGGGTACCACTCTGACAACCAGAAACGGTTAGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCAAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGTCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTCCACC Cardinalis_cardinalis TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACACAGAAATCATCCTGCATGAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTCTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAA{CT}GTGCTCAG{CT}TAAACAGAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTATTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACACGGAAAATATGGCCAACACCTTTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGA{CT}GGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCAT{AT}CTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATCGGCAACGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTTGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAGATGAAACCTGTCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATAAGTTTGGTAAGCAAAACTAACAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGCCATACAATTAACGTAGTTCACAGTCGGGGGAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACGTGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTACCCCTGGGCAGCCCGGCTGTGACCTGCACTGTTCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATAAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATTCCAGATGCAAACTACTTCTACATTTTGAGATGCATAGGAACAGAAGAGGACAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACCCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAA{AG}CCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Catharus_ustulatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGTCAGAAGAGGCTGTTTCT------------------------------------------------------------{CT}CAAACAAAGAATTCATTC{CT}GCATGAAGATGAAGCAGTACCAAGTGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACCCACTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAACACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGACGTGTGCCATACTACCAGAAGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACCGGGGAACATGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GTACAGATAAACAACAAAAATTTAATGAAAGAGATTCTCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAGTTGATTATCCACCGGATTTCATTAAATCCATGTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAATGTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCCACTGACCTGG{CT}AACCCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCACAGCTACATAAATAAAGGTGGC{AC}GACCGAGGCAACACCTCCTGTCCCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAACCTGGATGACTATTTGACTGGCCCCTTCACTGTGGTGATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCAC{AT}GTCATGAACATTTCTATAGCACATGGAAATGAAAACAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACT{AG}CTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTGCACTCCATAACCCGGAGCCATGCTGAAAACCTGGC{AG}CGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTCCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTGGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAGTAACGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCAACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTT{CT}CACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCAGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCT{CG}CCCCCTCTCCGCTACCCTGCTCTCTGCACACTCGGAAGCGATGCTAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAACAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCT{AG}CCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTGGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATCAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTAGGCATTCCAGGGACCAACAAACAAATAAGCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAAGGCAGAAGA{AG}TTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAG{CT}GCTGAAGCCAACAGCTTTGATGCTGA{CT}GATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Certhia_familiaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGGCCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAGGAATTCACC{CT}TGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAACAGGCAATAGG---CAGGGACT{AG}GAGGAAGTTGCCCAT---------GCTCTGAAAACACAAGACAAG---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATCATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGTGCAAAGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGTCATACTATTAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACTACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTATATAAATAAAGGTGGCCGGCCGAGGCAGCACCTTCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCA{CT}CCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGT{GT}GGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCCGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGAAAACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAATATTGCTATAGCACATGA{CG}AATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAGATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATAGGTGAACTTTACAAGAATCCTGACATTTCTAAAGAGGAGAGGAAGAGGTGGCAGTCGACCCTTGACGAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAGTAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTCTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAATGCCCAGATCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTC{CT}AAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCAAAAGACTCGTGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCCGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCGGCTGTGTCCTGCACGATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGATAACCAGAAACGGCTGGCATGCAACACCATAGTTCTGGAAGATAGTAAGATAGAAATAGTTGAAAGTGCTAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATGTGGTTTGGCTGTGACATGGG{GT}AAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAATTCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACATCCAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGA{AG}GAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGATGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Chaetops_frenatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAACCAGCACCTAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAGTTCATCCTGCATAAAGATGGAGCAGTGCCCAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATCAG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATGCAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAGCTCTGCCGGATCTGTGGAGCTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCCAGGAACAGCACGATGGAGTGGC{AG}ACCCCACTCCCCGAAGTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTATACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTTAATTGC{AG}AGGACATACATCTCAGCACCAAACTGATTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATGTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAGTCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCACGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAA{AG}ATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTC{AC}GAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTCTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCTTTGCATGCTCTTCGTATGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATTGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGACGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTTATGAACGTTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGGACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAAATGAGTGGAAATTTTGCTAGGAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGA{CT}GGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATCCAAGGACTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTT{CG}CAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTC{CT}TGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGT{CT}TCAATTGCCAGAGGTGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATAATGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGTCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCTGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTG{AG}TAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGGTGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Chaetorhynchus_papuensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCACCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGAT{AG}CCCCT---------GCCATGCAAACACAGGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTCACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGACGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAATATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGC{AC}GTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAAC{GT}TGTCAAAACCACTGGGAAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAAGAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTACCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGT{CT}TGTCTGGCCATCCGAATCAACAC{AG}TTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCGCTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTGTAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCCGATCA{CT}GAAACTCTGACTGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTTCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTGTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTAAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGT{AG}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTC{AG}TGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGTAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTGTTGAGATCCTGCCCCACTGGTGTTTTCCTC{AC}TCGATATAAAGCAGAACGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGTGAT{GT}CAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACATTTCTGATAAGATTTACTT{CT}ATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGATGTTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAGGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGTATGAGTGTGCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTTCATGTTTCAATTGCCAGAGATGATACAATCTAC{AG}TCTTGGGCGGCCACTCACTTCAAAACAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATTCTGCCAGGGGG{GT}GTATCAGTGTCCAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGAGACTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTT{CT}TACATTTTGAGATGCAAAGGAGCAGAAGTGGACAAGGAAGAAGAATC{AG}ATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCTGGAGACTC{CT}ACTCC{GT}TTTGAAGACTCGGAGGAGTTTTGTTTCAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Chloropsis_cochinchinensis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGGCAGCCAGCACATAAACAAAGATCAGGCAGAAGAAACTGTTTCT------------------------------------------------------------TCAAACAAAGACTTCCTCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGA---CAGGGACTTGAGGAAGATGCCAAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCTTTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACAACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACCACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAGCCAA------------GCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGTAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAATACCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGACCAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGACTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCCATCCGAATCAACACGTTTCTCAGCTGTGGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACGGAAGTGGGAATTATTGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGA{CT}ACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTCGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATGGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTGTACAAGAATCCTGACGTGTCCAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGTATTGTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATTATGTTGCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCGTATGCTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGATGCTGTACATCCTACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACATCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTCGGCAGCCCGGCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAGCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACCCAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCTGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Cinclus_cinclus TAAATTGCGATCGTTTGAAAAGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTC{CT}TTCTGCATAAAGATGAAGCAGTGCCAAATGGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAATCACAAGACAAT---ATATCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGCTACAAGAAAACATACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTAT{CT}CATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGAAACAGCACTATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGGGGAGTCAAGAGAAAAAGCCAGACCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGAGGAACATGCTCAGCTAAAAAGAGGTGTAAAGAATCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCA{AG}TTGCAAGGATATACATCTGAGCACTAAGCTGCTTGCAGTTGACTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTTCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGA{CT}GGACTATCAGGACTGCCACTGTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCTCTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGTAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTCGGTTCGTCTTTAGAGGAACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCTACCCGCTGGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGC{CT}CTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTTCGCTACCCTGCTCTGTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGATAAACAAAACTAACAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATTCTTGGAGGCCACTCGCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTACCCCTGGGCAGCCCAGCTGTAACCTGCACCATCTTGCCAGGAGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAAGAAGAATTGATAACGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCAGACAATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Cisticola_anonyma CAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAGTTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGAAGTTAACGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATAAAAATACAAGACAAT---AGAGATCATCGGAAAAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATGCACAGAAAGTTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAATCAAGAGAAAAAAACAGTCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGACTTCATTAAATCCATCTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACCTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACTCCAGTGAAATCCTTCCTGAGCATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAAGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTCAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACCATCATGAACATTTCTATAGCACATGGGAATGAAACCAAGAGGATCTTTGAGGAAATAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGTTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGAGGTACAGGCTATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCTCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATCGGTGAACTCTACAAGAATCCTGATGTCTCTAAAGAGGAGAAGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGCGGTAAAACACCTAACAATGAACTGTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATTGTGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCGTAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTACCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGAGGACACAATCTACATCTTGGGAGGTCACTCTCTTCAAAATAACACCAGGTCCCCCAACTTGTATAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCGGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAGGTCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGA{CT}{AT}GTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGCTTGATTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGA{CT}{AG}AGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCC{AG}TTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATATCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Climacteris_erythrops TAAATTACGATCATTTGAAAAAACACCCTCTGATGATAACCAGCACATAAACAAAGATGAGGCAGAAGATGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGACATAATGGGCAATAGG---CAGGGACTTGAGAAAGATGCCCAC---------ACCACGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGACTTCTGAGAAAGAAAGAAAAAAGAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACGCCATGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCACCCCCATTCCTCAAACTGTGATGTGTGCTGTACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAGCATGGCAAACGTGCCAAAACCACTAGGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCACGAATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTAATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTTTGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTCCCTACTGACCTGGTAATTCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAAATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCATTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGACGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGTTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAACGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCATTTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTGGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGGAGAATGAGCTGAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGCACTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAGTCTGGTAAACAAAAATAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCCGAAGCTAGATACGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCTATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGACAAATGGAACAGCGTCGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCCGTGACCTGCACCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATTGTGACTCAGGTCAGTGATACTGAATTTGTCCTAGTTGGTGGCTACCAATCTGACAGCCAGAAACGATTGATGTGTAACACCATAATTCTGGAAGACAGTAAAATACAGATTGTTGAAAGTGTGAACCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTACTGCTCGGCATACCAGGGGCCAACAAACAATTAATGCCAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAGTTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Climacteris_picumnus TAAATTACGATCATTTGAAAAAACACCCTCTGATGACAACCAGCACATAAACAAAGATGAGGCAGAAGATGCTGCTTCT------------------------------------------------------------TCAAAGAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGACATAATG{AG}GCAATAGG---CAGGGACTTGAGAAAGATGCCCAC---------GACATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTACCAGAGAACTTACCCAGTGCACGGGCCGGTGGATGATGAAACTCTGGGACTTCTGAGAAAGAAAGAAAAAAGAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTATTCAGGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACACTATGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCACCCCCATTCCTCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGCGTCAAGAGAAAAAGCCAGCCCTCAAGTGTGCAGCATGGCAAACGTGCCAAAACCACTAGGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCACAAGTATACATCTCAGCACTAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGTAGAAC{CT}TGCATCCTTAAGTGTATCAGGGTTTTGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAATTCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTATAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGATAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCA{AG}GTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTGAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCATTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGTTTTTCCTTCACAGTCATGAGCATTTCTATAGCACATGAGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGAGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCCGAGCTCTTATCTACAAAATTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGGAGAATGAGCTGAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCC{GT}GCTCTTTGCGCACTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAG{CT}CTGGTAAACAAAAATAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCT{AG}TTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGACAAATGGAACAGCGTGGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCCTTGACCTGCACCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATTGTGACTCAGGTCAGTGATACTGAATTTGTCCTAGTTGGTGGCTACCAATCTGACAGCCAGAAACGGTTGCTGTGTAACACCATAATTCTGGAAGACAGTAAAATAGAGATTGTTGAAAGTGTGAACCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTACTGCTGGGCATACCAGGGGCCAACAAACAATTAATGCCAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Cnemophilus_loriae TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGTGTTAATGGGCAATGGG---CAGGGACTTGAGGAAGATGCCCGT---------GCCATGAAAATACAAGACAA{CT}---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGACCAGTGGATGATGAAACACTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCAGACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATGTACAACATGGCAAACGTGTCAAAACCACTGCGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATCCATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACTCCAGTGAAATCCTTCCTAAGCATCCTTGATAACCTGAGTATAAGATG{CT}CCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCGTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGACGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAATATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACTCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACGAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GCGTCTAAAGAGGA{AG}AGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAA{AG}CCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGC{AT}GTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCA{CT}TAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTACAGCTACAACTCACAGCGTTTTGCAGAGCTCTTGTCTAC{AG}AAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCGAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTTCTCCTTGATGTAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACTCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCCGAGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGTACCATCCTGCCGGGAGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAT{CT}CCAGATGCAAACTACTTCTACATTTTGAGATGCAAAAGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACCTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Colluricincla_harmonica TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCG{AC}GGGGATGTCGATACTATCCATCCCACTCAATTTTGCCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGAAA{AG}CGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAATGAGATGAAAGACGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGAGACAATTGCAAAGAGATTTCGATACGATG{CT}GGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTAGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGA{CT}GAATCAGACCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGA{AG}GCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGC{AG}TCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCA{CT}AAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGCGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAAAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTCCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCCATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGTATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGAC{AG}TCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGACTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGACGTTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Conopophaga_ardesiaca TAAAGTGCGATCATTTGAAAAAACACCCTCTGATGAC{AG}GGCAGAACATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGAGTAAAGATGAAGCAGTGCCAACAGGAGAAAAG---------------ATGGAGTTATTGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCCAT---------GACATGAAAATACAAGACAAT---AGAGCTCATCAGAACCATCTAAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAGACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCCGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCACTCGAGG{AG}GTCAAGAGAAAAAGCCAGCCACCAAATGTACAACATGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGTAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGTCTGGGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGG{AG}AAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGTCGGCCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACCGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTACATGCTCTTCGCACTGCTGAGAAAGCCCTGCTACCAGGCTATCA{CT}CCTTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACTGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTGAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTTACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATTGCACATGGGAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGCCTTATGCTGGCGGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGGTTTGTCTTTAGGGGTACAGGATATGACGAGAAACTTGTGCGGGAAGTAGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGGTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCCGGAGCCATGCTGAAAATCTGGAACGGTATGAAATATGGAGATCCAACCCCTATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTGATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGAGCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCTGAGCTCTTATCTACCAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACCGGTGTTTTCCTTCTTGATATAAAGCAGAGTGAGCTCAAAATGAAACCTGCCACCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAAGTCTGAGGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGGTGCTCCGATGCGTTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTTCACAAAGAACAAC{CT}GAAAAATGGAACAGTGTAGTGGACTGCTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGCCATTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACAATAGTTCTGGAAGATGGTAAGATAGAGATTATTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAGAAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGGCGTCAAACGAAGATCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Coracias_caudata TAAAGTGAGATC{AG}TTTGAGAAAACACCTTCTGATGACAGTCAGCACATAAACAAAGACCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCGTAAAGATGAAGCAGTTCCAAGAGGAGAAAAC---------------ATAGACTTAATGAGCAACAGG---CAGGCACTTGAGAAAGATGCCAGT---------GGCATGAAAACACAAGAC{AG}AT---CAAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGAGCTTATTGCTAAGGTTTTTAAGATTGATGTGCGGGGGGATATTGATACTATCCATCCCACTCGATTTTGTCAAAATTGCTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCC{CT}AGGAACAGCACAATGAAGTGGCAGCCGCACTCCCCAAACTGTGATGTGTGCCACACCACCAGTCGTGGAGTCAAGAGAAAAGGTCAGCCACCCA{CG}TGTACAACATGGCAAACGTGTGAAGACCATTGCAGAATGTGCTCGAATAAAGAGAGGTGTAAAGGACCAA------------GCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACAAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATCTCTTGCCAGGTCTGTGAGCATATTTTGGCAGATCCAGTGGAAACCACATGTAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATTAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAACCTGGGTATAAGATG{CT}CCTGTAAAGGAATGTGATGATGAGATCTTGCATAGAAAGTATGGCCAGCACCTCTCCAGCCACAAGGAGATAAAAGATAGAGAGCTTTACAGCCACATAAATAAAGGTGGCCGGCCAAGGCAGCATCTCCTGTCTTTGACCAGGAGGGCTCAAAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCACCCTGCCGTCTGCCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAATATCATAAAATGTATAGAACGGTAAAAGCCGTCACTGGGAAGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAATCTCTCCTACCCGGTTATCATCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGACGAGATTTTGGAAGGCATGAAAGCAAAAAACCTTGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGAAGTCAGCGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATAATGAACATTGCTATAGCACATGGGAATGAGAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTACTTGAAATGGGAGGCATCCTGAGAACATTCAAATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATTTGGTGTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAG{AG}TCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACTGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAAGTTTACAAAAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGATGAGGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACAGTAGAAGCGGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCC{GT}GCCAAGGAGTGTCCAGAATTGATGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCCTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATCACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGACGGGTCCATTGGGGCATGGGC{AG}AGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAATGCTATGAGATGGAGGATGTCCTG----------CCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCCTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAGGCAATGCAGAGTCTGATGAGTACCAGTATATCATCCATGGTGGGAAAACACCTAACAATGACCTTTCTGATAAGATTTATGCTATGAGGCTGGTAAGCAAAAGTAGCAAGAAACCCACGTTCCAATGTGTTGAAAAAGACCTATGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTCATTCATAGCCGGGGAAAAAGCATGAGCGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATTTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTGCTTTCCATGTTTCAGTTGCCAGAAATGATACAGTCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGAGCACCCAGCTTGTACAAGCTAAAGATTGATCTCCCACTGGGGAGCCCGTCTGTGACCTGCACCGTCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAACTGGTGATACCGAATTTGTCCTTGTCGGGGGCTACCAGTCTGATGATCAGAAACGGTTGGTGTGTAACACTATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGGGAGGGCCCAGACTGGACACCAGATATTAAACACTGCAGGATCTGGTTTGGCTGTGATATGGGTGAAGGATCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAGGAAGAACCAACAGCACAAATTTGCAGTCAGACATCGACCGAAGACGCTGGAGACTCCACTCCATTTGAAGATTCGGAAGAGTTTTCTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACGGGCTACTGGATCACCTGCTCTGCC Coracina_lineata TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAATGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGAGGGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGA{CT}GAATCAGATCACGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCCGGAGACTCCACTCCATTCGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACTTGCTGTGCC Coracina_novaehollandiae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---A{CG}AGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAATGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGAGAGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTCCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCTTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAAGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTT{AG}TTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGGAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCT{AG}ATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAAGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACTTGCTGTGCC Corcorax_melanorhamphos TAAATTGCGATCATTTGAAAAACCACCCTCTGATGACAGCC{AG}GCACATAAATAAAGATCAGGCAGAAGAGTCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAT---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACGAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAGAATTTAATGAAGGAGATTATCA{AG}TTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTGTAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTTATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTGGTTGACTGTGTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTCCAAAATAACACCAGGTCCCCCAACCTGTACAAGGTAAAAATTGATCTTCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTAC{AC}ACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTGAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAGTAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Cormobates_leucophaea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGTGAGCACATAAACAAAGATGAGGCAGAAAATGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGTAGTGCCAAGAGGAGAAAAG---------------ATGGACTTAAGGGGCAATAGG---CAGGGACTTGAGAAAGATGCCCAC---------GCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGCAGCTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACCAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTTACAACTGTTGGAGTATTATACACAGGAAATTCAGTAATACGCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCACCCCCACTCCTCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGAGTCAAGAGAAAGAGCCAGCCCCCAAGTGTGCAGCATTGCAAAC{AG}TGCCAAAACCGCTGGGGAACGTGCTCGGCTAAACAGAGTTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCATGAATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCTGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGACAGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCGAGACAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAAGCTGTATGCATGACATTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCCTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCTAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCTGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGATGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGGAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGA{CT}GGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAG{AG}TTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAGGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGTACACTCAGAAGCAAT---------GATGAGTATCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTGATGAGTTTGGTAAGCAAAAATAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGCTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATCAGTGTTCTATTTGGAGGCAGGTCATATAC{AG}CCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTG{AG}TTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCT{CT}CAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACTCCAGGTCCCCCAACTTATACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCATCTGTGACCTGCTCCATCCTGCCAGGGGGGATATCGATGTCAAGTGCTATCGTGACTCAGGTCAGTGATACTGAATTTGTCCTGGTTGGTGGCTACCAATCTGACAATCAGAAACGGTTGCTGTGCAACACC{AG}TAGTTCTGGAAGACAGTAAAATAGAGATTGTTGAAAGTGTGAGCCCAGACTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATACCAGGGGCCAACAAACAATTAATGACAGATGCCAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Corvinella_corvina TAAATTGCGATCATTTGAGAAAACATCGTCTGATGGCAGCCAGCACGTAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCTTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CACGGACTTGAGGAAGATGCCCAT---------GTGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAACACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAATAGAGGTGTAAAGAACCAA------------GCACGGATAAACAACAAAAATATAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATAGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCGAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAGAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGAGTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTTAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAG{AG}AGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCTGTGTGGCGATCCTCATGTCCTGCCAAGGAATGCCCAGAACTGCTATGTCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATATATTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACATCAGGTCCCCCAACTTGTATAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTCACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTCTAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGATGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAGGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGACGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_corone TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCT{AG}TGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCGTACTACCAGAC{AG}AGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGAAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCA{CT}CCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGGCGAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTC{CT}TGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACGCAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_coronoides TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGGGGTAAAACGCCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACACAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGATGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Corvus_orru TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTTGACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCTTCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGCGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCACCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTAATGTGTGCCATACTACCAGACGAGG{AC}GTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAA{CT}ATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCC{AT}CTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAACAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTCATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCATCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCCGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCATGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGGGGTAAAACGCCTAACAATGACCTCTCTGATAAGATTTACTTTATGAGTCTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGTAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGCACATCATACATCCTTCCAGAGCTTCAGGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCGCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACACAGATAAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGGTAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGATCTATTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGCGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGATGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Cracticus_quoyi TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACGTAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGATTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTC{AT}C{CT}AGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGC{GT}GAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGA{AG}GCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAGAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGT{AC}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTAC{AG}AAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAAT{CT}ATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGAC{AG}TTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAACATAAGTGTTCTGTTTGGAGGTAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTCTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGC{AG}AACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Culicicapa_ceylonensis TAAATTGCGATCATTTGAAAAAGCACCCTCTGATGACAGCCAGCACCTAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAGAGAATCCATCTTGCAAAAAGATGAAGCAGTGCCAAGGGGAGAAAAG---------------ACAGAGTTAACAAGCAAAAGG---CAGGGACTTGAGGAAGATGCCCAC---------GCAATGAAAACACAAGACAGTGTTTTCACTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATAAGACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAATAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCATTCCCCAAACTGTGATGTATGCCATACTACAAGACAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTTCAAGGCAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTAACCCCAGTGAAATCCTTCCTCCACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCAGGCCACAAGGAGGTGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGGCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCCTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATAATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCGGTGGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTGATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGA{AG}GAAGT?AAGCCCAATTCAGAGTTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCCTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATTCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATCGGCAACGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAGGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAGCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAGGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAA?GAGTCTGGAAACAAACTGTTTAGG?GGTTCCGAAAAATGAATGCTAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACAGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAACTGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCAGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCAGCTGTGTTTCTCATTGATTTTGAGTTTGGTTGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTATCAATTGCCAGAGATGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACTAGGTCCCCCAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCGGACAACCAGAAACGGCTGGTGTGTAACACCGTAGTTCTGGAAGATAGTAAGATAGAGATTCATGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTCTACTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGTTAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGCACTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGACGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Cyanocitta_cristata TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATCGTTACAAGAAGACTTACCCAGTGCATGGGCCAGTGGAT{AG}ATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGC{CT}CCCAAGCGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAGCGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTTCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTCGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTG{CT}ACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAAAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATTGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACGGTAGAGGCCGT{AT}TGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGTCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCCGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGC{AG}TGCTCAGAAGCGATGCAAAGGCTGATGAGTACCA{AG}TATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCGTAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCTGTGTCAAGTGCTATAGTGACCCAGATAAGTGATAATGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCGTTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAGTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGACGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Daphoenositta_chrysoptera TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATGAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGGTGAAGCA{AG}TGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGA---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAA{CT}ACAAGAC{AG}AT---AGAGCCCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAGGAGAACGTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGCCACAACTGTTGGACTATTATACATAGAAAATTCAGCAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGC{CT}CCCAAGTGTACAACGTGGCAAACGTATCAAAACCAC{GT}GGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGACATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTA{CT}AGCTACATAAATAAAGGTGG{AC}CGACC{AG}AGGCAGCACCTCCTGTCTTTGACACGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGT{AG}TGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGG{AT}TTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACGTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGA{AG}TCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACGTTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTCATGCTGGCTGACGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGA{AG}GGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTTTGTGAACTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTT{CT}AAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCAT{CT}GGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGCACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCTTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAG{CT}CGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTCGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCGGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCA{CG}CATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCAGTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGA{AG}TGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGGCATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTGGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATC{GT}GAAAC{AG}GGCTACTGGATCACCTGCTGTGCC Dicaeum_aeneum TAAATTGCGATCATTTGAAAAAA{CT}ATCCTCTGACGACAGCCAGCACATAAACAAAGATCAGGCAAAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CA{AG}GGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATG{AC}AACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGACGTGTGCCATACTACCAGAC{AG}AGGAATCAAGAGAAAAAGCCAGCCCCCACGTGTACAACCTGGTAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACGGACAAACAACAAAAATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTCGATAATCTGAGTATACGATGCCCTGTAAAGGAGTGTGATGAAGAGATCTC{AC}CATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACC{AG}AGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTC{AC}GGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATCGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCCGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTATATCTGAGGATGAAGCCAGTGTGGAGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTCTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCTTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATCAGGACCAGTATATCATCCATGGTGGTAAAACACCTAACAACGACCTTTCTGATAAGATTTACTTCATGAGTTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTACGCTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGATAACCAGAAACGCCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCGATTTTGCTGGGCATTCCAGGAGCCAGCAAACAAATAATCCCGGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Dicrurus_adsimilis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCTATGCAAACAGAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGA{CT}CTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGCGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAA{CT}AGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGT{CT}AATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTGCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTCTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATCATAGATGGACTATCAGGTCTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAACTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCGGCCTTCTTCTC{CT}AAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAG{AG}TCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCA{AT}CCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACAATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCA{AG}TAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Dicrurus_hottentottus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCTAT{AG}CAAACAGAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTATAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGCGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGTCTGCCACTCTCAGTTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCTTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAACTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCGTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCGGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAGTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACAATCCTGCCAGGGGGGGTATCGGTGTCAAGCGCTATAGTGACCCAGATCAGCGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGACGAGGACAAGGAAGAAGAATTGATAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Dryoscopus_cubla TAAATTGCAATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTATTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCTTTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAGACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAAGCGATGTTGATACCATCCATCCCACGAAATTTTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAGCGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTACCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCAC---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCTTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATAAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGA{CT}ACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGA{CT}GACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATTCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCTTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACCGGATTTTCCAGATGGAGATTGGTGAACTTTATAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCTACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCCATGCACGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGGTACCGAATTCGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Elminia_nigromitrata TAAATTGCGATCATTTGAAAAAGCACCCTCTGATGACAGCCAGCACCTAAAGAAAGACCACGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACAGAGTTAACGGGTAATAGG---CAGGGTCTTGAGGAAGATGCCCTT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATTTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCACTTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGCAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAATGCAGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGATTACCCA?TAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATGTTTTGGCTGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGACCTGGTAACCCCAGTGAAATCTTTCCTGCACATCCTTGACAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGGCAACATCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGTTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATGGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTGGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAGTCATGAACATTTCTATAGCACATGGGAATGACAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACTTTTAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGTCATTCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCGACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAAGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAGGAGTGCCCAGACCTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATAAATGCTAGGCAGTCCAAAG-----------------------AGATCCTGCCCCACAGGTGTTTTCCTGCTCGCTATAAAGCAGAATGAGCTCAAACTGAAACCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTGAGAAGTGATGCAGGGGCTGATGAGTACC{AT}GTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAATCTAGCAAGAAAATGACATTCCAGTGCCTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGAGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGAGCAGAGAACCACTGAAAAATGGAACAGCGTAATTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACACACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGACACTCACTTCAAGATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGTCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCGTCGTTCTGGAAGACAGTAAGATAGAGATTCATGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTGGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Emberiza_schoeniclus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGAAAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTCAAAACTGATT{GT}TTCCAAGAGAACT{CT}ACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGGTTGATGTGCGAGGGGATGTTGACACTACCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAGCCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGT{AT}ACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCAAACACCTTTCTGGCCACAAGGAGATGAAAGAAG{CG}AGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGTAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTTTAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAATCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACAAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAA{AG}TGTGAGGAAAGGCATGAAGCCCTCAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTCCTTCTCCAGAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAATTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTAGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACGGAAACATGGAACAGTGTAGTTGACTGTTTGCCATTTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAGTTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAGGATAATAAGATAGAGATTGTTGAAAGCGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGATAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACAATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Ephthianura_tricolor TAAATTGCGATCATTTGAAAAAATAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGGGGCTGCTTCT------------------------------------------------------------TCAAACAAGGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCTTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTTAGAAAGAAAGAAAAAACAGCAACGTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAAGTGTGATGTGTGCCATATTACTAGGCGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACTACGTGGTAAATGTGTCAAAACCACTGGGGAACGTGCTTGGCCAAACAGAGGTGTAAAGAACCAA------------GCACAGATGAATAACAAAATTTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCCACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCATCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGAGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTAAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGTATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTGAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGATACAATTGCAAAGAGATTTCGGTATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGAATGGTCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCGGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCCTCCGGGAAGTAGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCTTATCACGAATCTGTTGATGAGCTCCGC{AG}ACAGAGTGAAGGGTGTTTCAGCCAAACCGTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATC{CT}TCATGCCCCACCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATCACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAACGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTTGTGTTTTCGTCCTCGATATAAGGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGTACGCTCAGTAGCGAAGCAAGCAATGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAATTGACGCTCCAATGCACTGAGAAAGACCTGTGTGGAGATTTCCCTGAAGCCAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGTGTGTTCTGTTTGGAGGGCGATCATATACTCCTCTTGCCCAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCGTACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACTAGGTCCCCCAACCTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAATACCATAGTTCTAGAAGACAGTAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTCTTGCTGGGTATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGGCATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACATGCTGTGCC Eugerygone_rubra TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAAGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAACAATTCATCCTGCATAATGATGAAGCAATACCAAGGGGAGAAAAG---------------ATGGAGTTG---------AGG---CAGGGACTTGAGGAAAATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGACAAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGA---GGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGCACAACAGGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAGAATTTAATGAAAGAGATTGTCAATTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTCTGCAGAACCTGCATCCTGAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCGTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTGAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGCTACATCAATAAAGGTGGCCG{AG}CCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACAGTCATAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGA{AG}CATTTCTATAGCACATGGGAATGAAAGCAAAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCCGATCATGAGACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAGACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAAAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCCGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGGTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAACTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCATCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGAGGTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAGGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTTTCTGATAAGATCTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCATTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCAGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCTGTGTCAAGTGCCATAGTGACCCAGATCAGTGATAGTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCCGTGATATGGGTAAAGGGTCTGTCTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATACAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGA{CG}GACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAG{AT}GGAGTTTTGTTTTAGTGCTGAAGCCAATAACTTTGATGGTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Falcunculus_frontatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTTATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTCTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTAGCCACAGGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTCGAGTGGAAACCTCCTTTGAAAAACGTATCCACTAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGAATGGCCCTTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGCAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACCCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCGTTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTATGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAACAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGAGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGA{CT}GTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTC{AG}TATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTCACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAATAAGATCGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGAACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTT{CT}AGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Formicarius_colma TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGGCAGCATATAAACAAAGATCAGGCAGAAGGGGTTACTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGACCCA{CT}---------GACATGAAGACACAAGACAAT---ATTGCTCATCAGAACAATTTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCCGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAGGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGAGAGGGGATGTTGATACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATAATCCACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCGTATTGCCGCTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGCAAACGTGTGAACACCATTGTGGAATGTGCTCGACTGAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAACTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTTAAGTGTATCAAGGTTGTGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCTTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTATAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTCTCTTTGACAAGGAGAGCTCAGAAACATCGTCTCAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTGTAATGCAAGGGAGGGGATCGGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCAGTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCAGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATT{AG}CCATTGCACATGGGAATGAAAGCAAGAGAATCTTTGAGGAACTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCAGATGAATCAGATCATGAAACTCTGACAGCAATCTTGAGCCCACTCATAGCAGAAAGAGAGGCCATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGAATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCATTGTGACATTGGCAATGCAGCAGAGTTCTATAGGATTTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCAAAAGAGACAGTAGAGGCAGTATGTGAATTAGTAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGAGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTTTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGGGCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTGTGCATGCTCAGAAGCAATGCAAACTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAGTAGCAAGAAAATGATGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACCATTAATGTAGTTCATAGCCGGGGCAAAAGCATGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATATATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATTTCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTCCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGCCCAACAAACAGTTAATCTCTGATGCAAACTACTTCTACATTTTGAGGTGCAAAGGAGCAGAAGAGGAAAAGGAAGAAGAATTGACAACACAAACTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAACGAGGACGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCATCTGCTCTGCC Fringilla_montifringilla TAAATTGCGATCATTTGAAAAAACAGCCTC{CT}GATGACAGCCAGCACATA{CG}ACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACCAAGAAATCATCCTGCATGAAGAAGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGCTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCC{AC}T---------GCCATAAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCAAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTGTGTGAAGTGTATTT{CT}CCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCACACTTCCAGACGAGGAGTCAAGAGAAAAA{AG}CCA{AG}CCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACGACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATGCATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCGTTAAATCCATTTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAAC{AG}ACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGA{CT}GACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTGATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAACTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTTTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTG{CT}GACATTGGCAATGCCACAGAATTCTACAGGAT{CT}TTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCC{AG}GAACTGCTGTGCCAATATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCACGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTGTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGCTTGGTAAGCAAAACAAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATACGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATACACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGGGAGGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAAATCAGTGACAATGAATTTGTCCTCGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCGTGTAACACCATACTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTAGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAGCACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTATTTTAG{CT}GCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Furnarius_rufus TAAAGTGCGATCATTTGAAGAAACACCCTCTGATGACAGGCAGCATATAAACAAACATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATTATACTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ACAGAGTTAATGGGCAATAGG---CAGGAACTTGAGAAAGAGGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAACA{AC}CTTTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGTTACAACAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCT{AG}TGGCTTCTTAGAAAGAAAGAAAAACAAGCAACCTCTTGGCCAGACATTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATATTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTATGTGAAGTCTATTTTCCTAGGAACAGCACAGTGGAGTGGCAACCTCACTCCCCAAATTGTGATGTATGCCATACTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCATCAAGTGTACAATATGGCAAACGTGTGAAGACCATTGTGGAACGTGGTCGACTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCA{AG}TTGCAAGGATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCC{CT}GTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTCCTGAACATCCTTGGTAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAATCAACACGTTTCTCAGTTGTAGCCAGTACCATAAAATGTACAGGACCGTAAAAGCTGTCAGTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTAGATA{CT}GATGCAGCCTTGGTTTGTGCCTTAAAGGACATAGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTAGATGACTATTTGAATGGTCCCTTCACCGTGACAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTAATGAACATTGTCATTGCACATGGTAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTATGCCTTATGCTAGCAGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTAAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTAGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTACACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCGAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGAACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCGTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAGCTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACAGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTGAAAATGAAACCAACCTTCTTCTCCAAAGACTCATGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAACAATAGCAAGAAAATGGTGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCAGGGGAAAAGCGTGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCATTCCA{CT}GTTTCAATTGCCAGAGATGATACAATCTACATATTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAATTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATATTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGGTACCACTCCGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGCAAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGATGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Gallus_gallus TAAAGTGAGGCCATTTCAAAAAGAACCTTCTGATAAAAGCCAATGCATAAACAAGGATCAAGAACAAGAGGTAGCTTCT------------------------------------------------------------ACAGACAAAAACATCACGCTGCATAAAGATGAAGAAGTTCCAAGAGGAGAAAAGTTAATTCTGACACAGAAGGACTTCATGGGCAATACG---CAAGCACTTGAGAAAGATGTCAAT---------GACATGAAAATACAAGACAAC---ACAGCTCACCAGAACAACCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCGTTTAAAACTGATTGCTACAAGAGAACTCATCCAGTACATGGACCAGTAGATGATGAAACTCTGTGGCTACTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGATCTTATTGCAAAAGTTTTCAAGATTGATGTGAGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATCCACAGGAAATTCAGTAATACTCCATGTGAAGTTTATTTTCCTAGGAACAGCACGATGGAGTGGCAGCCCCACTCTGCAAACTGTGAAGTGTGCCACACGCCCAGCCGGGGAGTCAAGAGAAAGAGCCAACCACCCAACGTACAACATGGCAAACGTGTGAAGATCATTGCAGAACGTGCTCGAGTTAACAGAGGCATAAAGAACCAA------------GTG---ATAAAGAACAAAAATGTAATGAAAGAGATTACAAACTGCAAGAACAGACATCTCAGCACCAAACTGCTTGCAGTTGATTATCCAGCAGATTTCATTAAATCCATCTCTTGCCAGATCTGTGAGCATATTTTGGCAGACCCAGTGGAAACAACGTGTAGACACTTGTTTTGCAGAACTTGCATTCTCAGTTGCATCAAAGTTATGGGATGCTATTGCCCTTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGAGCATAAGATGCCCTGTTCCAGAATGTGATGAAGAGATCTTGCACGGAAAATATGGCCAACACTTCTCTAACCACAAGGAGATGAAAGATAAAGAGCTCTATAACCCCATAAATAAAGGTGGCCGACCAAGGCAGCATCTTCTGTCTTTGACCAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAACGAACACAAGCAAGCAGATGAATTGGAGGCTATAATGCAAGGCAGAGGATCTGGACTTCATCCCGCTGTTTGCCTGGCAATACGAATCAACACTTTTCTCAGCTGTAGCCAGTATCACAAAATGTACCGAACTGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCACTGCATGCTCTTCGCACCGCCGAGAAAGCCCTCTTACCAGGTTATCATCCTTTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTACCCCTCTCGATTGATGACTACCCAATAGACACAATTGCAAAGAGATTTCGATATGATACAGCCTTGGTTTCTGCTTTAAAGGACATGGAGGAAGAAATCTTGGAGGGCATGAAGGCAAAAAACCTGGATGACTATCTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTGCTGTGACGGAATGGGAGATGTCAGCGAGAAGCATGGAAGTGGTCCTGCTGTCCCAGAGAAGGCTGTACGCTTTTCATTTACAGTCATGAACATTGCTATAGACCACGAGAACGAAAGGATAAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGTCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTCAGCCCTCTCATAGCAGAGAGAGAGGCTATGAAGAACAGTGAACTGCTTCTTGAAATAGGAGGCATCCTGAGAACATTCAAATTCATCTTTCGAGGTACAGGCTATGATGAGAAACTTGTAAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATCTGTACCCTCTGTGATGCAACCCGCCTAGAGGCCTCCCAGAATTTGGTCTTCCACTCCATCACCAGGAGCCACACTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATAGAGACTGTTCCCTCCATAGACGCGTTGCACTGTGACATTGGCAACGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAAGTCTATAAGAATCCTGATGCGACTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAAATTAAAACCTATGATGAGGATGAGTGGGAACTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAAATGAAACCAGTATGGCGATCTTCGTGCCCTGCCAAAGAGTGTCCAGAATTGCTGTGCCAGTACAGCTATAATTCACAGCGTTTTGCGGAGCTCCTGTCTACCAAGTTTAAATACAGATATGAGGGCAAGATTACCAATTATTTCCACAAAACCCTTGCTCATGTACCTGAAATCATTGAAAGAGATGGGTCCATTGGTGCTTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTATTTAGGAGGTTCCGAAAAATGAATGCGAGGCAGTCCAAATTCTATGAAATGGAGGATGTCTTA----------CCACGGGTGTTTTCTTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAGGGATTCATGTTACCTTCCCCCACTCCGCTACCCAGCTATTTGCACACTTAGAGGCAACGGGGAGTCTGATAAGCACCAGTACATCATTCATGGTGGGAAAACACCTAACAATGATCTTTCTGATAAGATTTACATTATGAGTATGGTAAACAAAACTACCAAGAAAACCACATTTCAGTGCATTGAGAAAGATCTAGGTGGAGATGTCCCTGAAGCTAGATACGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGATTGTTATATTTGGAGGTAGATCATATATTCCTCTTGCACAGAGAACTACTGAAAAATGGAATAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCATGTTTCAGTTGCCAGGGATGATACAATCTACATTCTGGGAGGCCATTCACTTCAAAACAACACCCGGCCTCCCAGCCTATACAAGCTAAAAGTTGATCTCCCGCTGGGCAGCCCATGCGTGACCTGCTCTATCTTGCCAGGGGGAATATCTGTGTCGAGTGGTATTGTGACTCAGACTGGTGATACTGAATTTGTCCTTGTTGGGGGCTACCAGTCTGACAACCAGAAACGGATGATCTGTAACACTATAGTTTTGGAAGATAATAAAATAGAGATTGTTGAAAGGGTGAGCCCAGACTGGACACCTGATATTAAGCACTGTAGGATGTGGTTTGGCTGTGATATGGGCAAAGGGTCCGTATTGTTGGGCATTCCTGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAACAAAGCAGAAGAGGATGAAGAGGAAGAACTGACAGCACAAACATGCAGTCAGGCATCTACCGAAGACCAAGGAGACTCCACTCCATTTGAAGATTCCGAAGAGTTTTCTTTCAGTGCTGAAGCCAGTAGCTTTGATGTTGATGACATTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGGTACTGGATCATCTGCTGTGCC Garrulax_milleti CAAATTGCGATCATTTGAAAAAACACCTTCTGAAGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCGTAAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAGACACAAGACAAC---AGAGCTCATCAGAGCAATCTGAACCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTTGCAAGAGAATTTACCCAGTGCATGGACCAGTGGATGAGGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACCGCAACCTCTTGGCCAGATCTGATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCGCAATGCAGTGGCAACCACATTCCCCAAACTGTGATGTGTGCCATACTACCAGACAAGGAGTCAAGAGAAAGAAACAGCTCCCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTTGATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTCAAATGTATCAGGGTTATGGGCAGCTATTGCCCCACCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTCTCTGGTCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAAAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCCAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAGTGGCCCCTTCACTGTG{CG}TAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTATAAGAATCCTGATGTGTCTAAAGTGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAACTCTTATCCACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCGCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACGCCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGGTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCGCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCA{CT}GTATCAATTGCTAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGTACCATCCTGTCTGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAAACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGATACCTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Grallina_cyanoleuca TAAATTGCGACCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGACTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAG{CG}AGAAAAG---------------ATGGAGTTAGCAGGCAATAGG---CAGGGACTCGAGGAAGATGCCCAT---------GCCATACAAACAGAAGACAAC---ATAGCTCATCAAAACATTTTGAAAGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACAGATTGCTACAAGAGGACTTACCCGGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCGCACTCCCCAAAGTG{CT}GATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATGTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCACATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAG{AG}AATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAG{AG}GATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGACCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTCGATTCGTCTTTAGGGGTACAGGGTATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGAC{CG}GTTCCCTCCATAGATGCCTTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAACTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTC{CT}TATCTACAAAGTTCAAGTATAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAATCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTCCATAGCCGGGGAAAAAGCAT{AG}AGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCA{CT}GTTTCAATGGCCAGAGATGACACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTGAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACC{AG}TAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCGGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAA{GT}TAA{GT}CCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCCAGTGAAGACCC{AT}GGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCT{AG}TGCC Gymnorhina_tibicen TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACGTAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGATTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTAGCCACAACGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCGGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACGAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTC{CG}TCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGAC{AG}TTCCAATGCATTGAGAAAGA{CG}CTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAACATAAGTGTTCTGTTTGGAGGTAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACAT{CT}TTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTCTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTACTCCCAGATGCGAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Hirundo_pyrrhonota TAAATTACGATCATTTGAAAAAACACCCTCAGATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTGACCCTGCATAAAGATGAAGCAGTGTCAA{CG}ACGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CATGGACTTGAGGAAGATGTCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTCACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGACGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGACAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAAGATATACACCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCCGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTTTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGCGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGTTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTCCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCC{CT}CTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGA{CT}GATTACCCAGTAGACACAATTGCAAAAAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGGATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAACGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTCAGGGGTACAGGATATGATGAGAAACT{CT}GTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATA{CT}GAAATATGGAGGTCCAACCCATATCATGAGTCTG{CT}TGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCATTGCGACATTGGAAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAAAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAATGTGAGGAGAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCAATGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCACAGAAGCAATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACTTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTGTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAAAGATGATACAGTCTACATCTTGGGAGGCTACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTTCTTGT{CT}GGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATGGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCAGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATTCCAGATGCAAACTACTTCTACATTTTGAGGTGCAAAGGAGAAGAGGACAAAGAAGAAGAA---TTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGATGCTGGAGACACTGCTCCACTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAGACAGGCTACTGGATCACCTGTTGTGCC Hirundo_rustica TAAATTGCGATCATTTGAAAAAACACCCTCAGATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTGACCCTGCATAAAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ATGGA{AG}TTAACGGGCAATAGG---CATGGACTTGAGGAAGATGTCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATGGTCACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGACGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGGTAAGGTTTTCAAGATTGATGTG{AC}GAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAGTCAAGAGAAAAAGACAGCCCCCA{AT}GTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAAGATATACACCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCCGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCAGAACATCCTTGATAACTTG{AG}GTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCACCTTTCCAGCCACAGGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGACGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCAC{AT}GCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGA{CT}GATTACCCAGTAGACACAATTGCAAAGAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTACTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAACGAGAGGCTATGAAGAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTCAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGAAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAAAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGTGAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGC{AG}TGAGTGTTCTGTTTGGAGGGAGGACGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTGTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTGTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACGCTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTAATGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGGTGCAAAAGAGAAGAGGATAAGGAAGAAGAA---TTGA{CT}AACACAAA{AT}TTGCAGCCAGACGTCAAGTGAAGATGCTGGAGACACTGCTCCACTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAGACAGGCTACTGGATCACCTGTTGTACC Hylophilus_poicilotis TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAGAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAAAGGGCAACAGG---CAGGGACTGGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTCTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTGCAACGTGGCAAATGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCCGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGCGGTCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGGCTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAAATCTTTCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCCCATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGTTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACAGCAATCTTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATGTAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTA{CT}CCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGTGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGATGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGACTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTCCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCACTAATACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Icterus_parisorum TAAATTGCGATCATTCCAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCC------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATACAAGACAAC---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACAC{CT}ATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTTTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTGCAACATGGCAAACGTGTAAAAAAGACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAACATATCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATCGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCAACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAAT{CT}TGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTTTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCGGTGTGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGCAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGATTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATAAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGAGGGAAGTGGAAGGGCTTGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCATGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATTCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGCAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCCTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGGGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTCTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGC{CT}ATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGCGGCTACCTCTCAGACAACCAGAAACGGCTGGTATGTAACACCATAGTTTTGGAGGATAATAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACAGCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAAATGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGAAGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Irena_cyanogaster TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAAGCAGTGACAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAA---------GCCATGAAAACACAAGGCAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTAAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGAGATGTTGATACTATCCATCCCACTCTATTTTGTCACAACTGTCGGAGTATTATGCATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCATTCCCCAGACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCTCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGGACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGGAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCTCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGGTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATTCTCTTCGCACGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCTCTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCGGTCTCAATTGATGATTACCCAGTAGAGACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAACAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCGCATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTAATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGTGTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCCTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAGTTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTATCTAAAGAGGAGAGGAAGAGGTGGCAG{CT}TGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCGGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCT{AG}AAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTATTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGTTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTCGTTCATAGCAGGGGGAAAAGCATGAGTGTTCTATTTGGAGGGCGGTCATACACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTCGCCGTCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAGTTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCCCTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGAGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCAAGCAAACA{AG}ATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGA{AG}GAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTCGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATATGTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Lalage_leucomela TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATGTAAACAAAGATCAGGTAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAGAGATGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACGTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGACGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTCTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCACAGTGTACAACGTCGCAAACGTGTCAAAACCACTGGGGAACGTGTTCGGCTAAACAGGAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGGTTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGAGAATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCACAAAATGTATCGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAAATCTTGGAAGGTATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACCGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTTGGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTGATGGATCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGAGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCAGCTCTTTGCACACTCAGAAGCGATGC{AC}AGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAG{CT}CTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTGCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGAC{CT}TGCACCATCCTGCCAGGGGGTTTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACG{AG}TTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Lanius_excubitor TAAATTGCGATCATTTGAGAAAACATCCTCTGATGGCAGCCAGCACGTAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCTTGCATAAAAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAAG---CACAGACTTGAGGAAGATGCCCAT---------GTGATGCAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAACACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCGTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACAACGTGGAAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAATAGAGGTGTAAAGAACCAA------------GCACGGATAAACAACAAAAATATAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATAGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGAGTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTACTTGAATGGCCCCTTCACTGTGGTAGTTAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATAGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACGCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCTGTGTGGCGATCCTCATGCCCTGCCAAGGAATGCCCAGAACTGCTATGTCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTTGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGCGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGATTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATATACTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAGAATAACATCAGGTCCCCCAACTTGTATAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTCTAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAATGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGCGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGATGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAGGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Loboparadisaea_sericea TAAATTGCGATCATTTGAAAAAACATCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAGCAAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGTGTTAACGGGCAATGGG---CAGGGACTTGAGGAAGATGCCCGT---------GCCATGAAAATACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACACTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACCATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCATAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCAGACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATATACAACGTGGCAAACGTGTCAAAACCACTGCGGAACGTACTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGACAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATCCATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACTCCAGTGAAATCCTTCCTAAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCGTTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGACGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAATATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGAGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACTCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACGAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAGGCACTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTACAGCTACAACTCACAGCGTTTTGCAGAGCTCTTGTCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCGAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCGTTGATGTAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCGTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGAGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACTACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCGGGAGGGATATCCGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATACAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCCGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGATAGCACAAATTTGCAGTCAGACCTCAAGTGAAGATCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Malurus_melanocephalus TAAATTGCGATCATTTGAAAAAGCAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCAAAATGATGAG{GT}CTGTGCCAAGAGGAGAAAAG---------------ATTAAGATAGCAGGTGATAGG---CAGG{CG}ACTTGAGGAAAATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTCTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGCGATGTGTGCCATATTACCAGGCAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACG{CT}{AG}TCAAAACCACTGGGGAACGCGCTCGGTTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTGATGAAAGAGATTGTCAATTGCAATGATATACATCTCAGCACCAAGCTGCTTGC{AC}ATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTTCTGAGTATCCTTGATAACCTGAGTATTAGATGCCCTGTAAAGGAATGTGGTGAAGAGGTCTTGCATGGAAAATATGGCCAGCACCTCTCCAGCCACAAGGAGATCAAAGATAGAGAGCTCTACAGCTACGTAAACAAAGGTGGCCGACCAAGGCTTCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCT{CT}TGCATGCTCTTCGCAA{CT}GCTGAGAAAGCCCTCTTACCAGGTTACCACCCATTCGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCCT{AG}GTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGATTATTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCA{AG}AGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAGCACATGGCAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAA{CT}GTTTAGATT{CT}GTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGTTATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCAAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACAT{CT}GGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACCCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCAATGCTGAAGATGAG{CT}GGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCTTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGCTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACGAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGTAATGAATCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAACGAGCTCAAAATGAAACCAGCCCTCTTCTCTAAAGATTCATGTTACCTTCCCCCTCTCCGTTA{CT}CCTGC{CT}CTTTGCA{CT}ACTCAGAAGTGATGCTAGTTCTGATGAGTACCAGTATATCATCCATGGAGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCA{AG}TGCATTGAGAAAGACCTGTGTGGAGATGTCCCCGAAGCTAGATATGGGCATACAATTAATGTCGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACTAC{CT}GAAAAATGGAACAGTGTGGTTGACTGTTTGCCGTCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTCCC{AG}GAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACACGGTCCCCCAACTTGTACAAGCTAAAAATCGATCTGCCCCTGGGCAGCCCATCTGTGACCTGCACCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCAC{GT}CTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGCGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCTAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTAAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGA{AG}TTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTATTGGATCACGTGCTGTGCC Manucodia_atra TAAATTGCGATCGTTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGTGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCCTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATAGTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAAGCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATGTTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGGTTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCCTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGCACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGG{CT}TGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGAC{CT}GTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGC{CT}TTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CT}GCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACGTGCACCGTCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCG{AT}TAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGA{CT}GTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Manucodia_chalybata TAAATTGCGATCGTTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATGAAGACGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCCTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATAGTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAAGCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATGTTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCT{AG}AGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCT{CG}TCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGGTTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGCACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGC{CT}TTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGCTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAAC{CT}TGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACGTGCACCGTCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGCTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Melampitta_gigantea TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACTGAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGAGTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCGATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGGAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTCCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCC{AT}GTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACAGCCAACACCTCTCCAGCCACAAAGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCATCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTACATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACTATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCCAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAACGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACTCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCGAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCGGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCTATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Melampitta_lugubris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATACAGATGAAGC{AG}GTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACAGAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAATTTCATTTAAAACTGAGTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCGATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAATGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGGAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTCCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCATCTC{CT}TGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTACATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCC{AG}TTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCCAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCA{AG}AAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGCGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGATAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTC{AG}TATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCAT{CT}GGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCA{AG}CTTGTACAAGGTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCA{AG}CAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Melanocharis_nigra TAAATTGCGATCATTTGAAAAAACACCCTCCGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------CCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---GGAGATCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCTCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAGACAACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGCCTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGAAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTATGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGA{AG}CTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAG{AG}TGGCAGTTGACTCTCGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCCATGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTC{AG}TGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACATTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGT{AG}TTGAGAAGGACCTGGGTGGAGATGT{CG}CCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGTGTGAGTGTTCTATTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAA{CT}CACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCC{AG}TCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGA{CG}TTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACTCAGGTCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGCAAGATAGAGATTATTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCCAA{CT}AGCTTTGACGTTGGTGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Melanocharis_versteri TAAATTGCGATCATTTGAAAAAACACCCTCCAATGACCGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------CCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAAGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGATCATCAGAACAATTTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCTCACTCCCCAAACTGTGATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGG{AT}GTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGCCTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGAAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTATGCTGTAAGCCCTTGTGCCTTATGCTAGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCGCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAAAAACTTGTGCGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCTATAACCAGGAGCCACGCTGAAAATCTAGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATCGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTCGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAACGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAGGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACA{AG}TCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGCAAGATAGAGATTATTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Melanodryas_cucullata TAAATTGCGATCATTTGAAAAAACACCCTCTGGTGACAGCCAG{AC}ACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAGGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGATGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATAGTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCACCGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGACTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAATCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAGAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAATGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTCTGCCTTAAAGGATATGGAAGAGGAGATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAATTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGCTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGCCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGTGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCAGAGCCGGGGAAAAAGCATGAGTGTTTTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAATTTGGATGCTGTACGTCATAC{AG}TACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAATTTGTACAAGCTAAAAATTGATTTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAAAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGA{CT}GCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGA{CT}GATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Meliphaga_analoga CAAATTGCGATCATTTGAAAAAATAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAGGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAAGAAAAAAG---------------ATGGAGTTAATGGGTGACAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCTTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACCGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAAGCGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTACTACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCCAAACAGAGGTGTAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCA{CT}ATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGTTGGTATCCTTGCTTTCCCACTGATCTG{AG}TAAC{CT}CCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAGCATCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCATGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTGAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACAACTATTTGGATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGG{AC}ATGGGAGATGTCAGTGAGAAGCA{CT}GGAAGTGGGCCTGCTGTCCC{AG}GAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATG{CT}TGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAG{AG}TTCATCTTTAGGGGTACAGGATATGATGAGAAACTCCTCCGGGAAGTAGAAGGGCT{AG}GAGGC{CT}TCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCA{CT}GAATCTGTTGATGA{AG}CTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTAT{CT}GAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAGCACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTGATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCCGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATCACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCC{CT}ACTGGTGTTTTCGTCCTCGATATAAAGCAGAATGAGCT{CG}AAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTGCGCTACCCTGCTCTTTGTACGCTCAGA{AG}GCGA{CT}GCAAGCAATGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCCAG{AG}TATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCAT{AG}TGTGTTCTGTTCGGAGGGCGATCGTATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATC{CT}TGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACA{AG}GCTAAAAAT{CT}GATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACTATAGTTCTAGAAGA{CT}AGTAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTCTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGCGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGGTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGGCATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Menura_novaehollandiae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAACACATAAACAAAGATCAGGCACAAGAGGCTGCTTCT------------------------------------------------------------TCAAATGAAGAATTAATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGACAATAGG---CAGGGACTTGAGAAAGATGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAGGCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCGGTGGATGATGAAACTATGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCTCTAAGGTGTTCAAGATTGATGTGCGAGGCGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCGTACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGCGTACAACACAGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGACTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGAGCATGTTTTGGCAGATCCTGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGTGTATAAGATGCCCTATACAGGAATGTGATCAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAGGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGGGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTAAAAAATGTATCCACAAACACAGAAGTGGGCATTATAGATGGACTATCAGGATTGCCACTCTCTATTGATGACTATCCAGTGGACACAATTGCAAAGAGATTTCGCTATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTCTCTTTCACAGTCATGAACATTTCTGTAGCACATGAGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGTAAGCCCTTGTGCCTTATGCTCGCTGATGAATCTGATCATGAAATTCTGACTGCAATCCTGAGCCCCCTCATCGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGATCCTTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATGTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCTTACCACGAATCTGTTGACGACCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCCAAAGAGGAGAGGAAGCGGTGGCAGTTGACTCTTGATAAACACCTCAGGAAGAAGATGAACTTGAAACCTATGCTGAGAATGACTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAATTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACCAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTGCTTCTCTAAAGACTCATGTTACCTTCCGCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAGGTCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGACATTCCAATGCAGTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAGAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACTTCATACATACTCCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAACAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTTCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCGAGTGCTATAGTGACTCAGATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCTTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATCGATGATACTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Microeca_papuana TAAATTGCGATCATTTGAAAAAACACCCTCCGATGACAGCCAGCACATAAACAAAGATCAGGCAGAGGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTGCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCATATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTGTGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACAAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTAGCAAACGTGTCAAAACCACCGGGGAATGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATC{AG}TCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCATTTGACTACCCAGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCC{CG}TCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGATATGAAAGACGGAGAGGTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCTGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCCGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAGGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCAAGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACAAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAACGAAAGCAAAAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTGGAACTGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTC{CT}TGCGGGAAGTGGAAGGGCTGGAGGC{CT}TCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTGGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATTAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTCATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTAGGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATATGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGTAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGCTGAAAGTGTGAGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAATGTGGTTTGGCTATGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCC{CT}GGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAACAGGACAAGGAAGAAGAATTAATAACGCAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTTCC Mimus_patagonicus TAAATTGCGCTCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATTCTGCATAAAGATGAAGCAGGACCAAGACGAGAAAAG---------------ATGGAGTTAATGGGAAATAGG---CAGGCACTTGAGGAAGATGCCCAC---------GCCGTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACCATCCATCCCACTCAATTTTGTCGCAACTGTTGGAGTATTATACATAGCAAATACAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGGGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACCACGTGGTAAACGTGTCAAAACCACTGGTGAACGTGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTAAATCGATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGCAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTACAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCCATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCCCTTACAAGGAGAGCTCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAGATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACTGAAGTGGGAATTATAGATGGACTATCAGGACTGCCAGTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGGTTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAACACAAGGGAATGAAAGCAAGAGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGATGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCCGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGG{AC}AATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAACTTACTTTATGAGTCTGGTAAACAAAGCCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAGTCAATGTAGTTCATAGCCGGGGGAAAAGCGTGACTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCTCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACCTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACTGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAGGGGTCTGTTCTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACGTTTTGAGATGCAAAGAGGCAGAAGAAGACAAGGAAGAAGAATTGATA------ATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAGGAAGACGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Mionectes_macconnellii TAAAGTGCAACCATTTGAAAAAATGCCCTCTGATGACAAGCAGCACATACACAAAGATCAGGCAGAAGGGATTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATAAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCTGT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCGTTTAAAACTGATTGCTACAAGAGGACTCATCCCGTGCATGGGCCGGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCTACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTGTCCATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATCCATAGAAAATACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGACACCAAGTATACAACAAGGCAAACGTGTGAAGACCACCGTGGAACGTGCCCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAACAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCATGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAGCTTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAATCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTATAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACGTAAATAAAGGCGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCATTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCGAAAAACGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGTCTTCATCCCGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCACAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCACGCTCTTCGCACGGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAGGTGGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGATACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCGAAAAACCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTTCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGCTGCAAGCCCCTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACCCTAACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGGGGCATCCTGAGAACGTTCAGGTTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTTTGGATAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTACTGTGCCAGTATAGCTACAATTCACA{AG}CGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGAGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAATCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTCTTCCTGCTTGATATAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTAGTAAGCAAAAGTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGAGCTGGGGGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGCTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATAGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGTTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTATGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGATCTGTATTGCTGGGCATCCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGACGACCCTGGAGATTCCACTCCATTTGAAGACTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACTGGTTACTGGATCACCTGCTGTGCC Modulatrix_stictigula TAAGTTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATGAAGATGAATCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACTGGCAATAGG---CAGGGACTTGAAGAAGATGCCCAT---------GCCATGAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTG?CGCATCTGTGGAGTTCCATTTAAAATTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCTACCCCATTCCCCAAACTGTGATGTGTGCCATGTTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAAACAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGACCCAGTGGAAACAACATGTAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAACAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCGCTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTACTGCTTGAAATGGGAGGCATCCTGCGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCATCCATAGATGCATTGCACTGCGACATCGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAGGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAATCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCCAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTAGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGCTTGCCATCCGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGATAAAAATTGAT{CT}TACCCCTGGGCAGCCCAGCGGTGACCTGCAGCATCCTGCCAGGAGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTGTGGAAGATAGTAAGATAGAGATTATTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCAGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATACTCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAGGAATTGATAACACAAATTTGCAGCCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTA?TGGATCACCTGCTGT?CC Monarcha_axillaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------AT{AG}GAGTTAGCGGGCAATAGG---CAGGGACTCGAGGAAGATGCCCAT---------GCC{AG}TGCAAACAGAAGACAAT---A{CT}AGCTCATCAAAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCTAAA{AG}TGCAATGTGTGCCATCCTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGTAGTAGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACATGCATCCTTAAATGTATCAGGGTTATGGGAAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGCGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATACAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCGGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAA{AT}TGGGAGG{CG}ATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTAC{AC}CTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCA{CT}GAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTC{CT}GGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCAATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGGGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCGTACATTCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGACACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCGCTGTCAAGTGCTATAGTGACCCAGATCAGTGATACGGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCGTAGTTCTGGAAGATAGCAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCTGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCAGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGGTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Monarcha_chrysomela TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCATATAAATAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATACAGATGAAGCAGTGCCAAGAGAAGAAAAG---------------ATGGAGTTAGCTGGCAATAGG---CAGGGACTCGAGGAAGATGCCCAT---------GCCATGCAAACAGAAGACAAT---ATAGCTCATCAAAACAATCTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAAGTGCGATGTGTGCCATCCTACCAGACAAGGAGTCAAGAGAAAAAGCCGGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGCAAAGAACCAA------------GCACAAATAAACAACAAAAA{CT}TTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTTCTTGTAGTAGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACATGCATCCTTAAATGTATCAGGGTTATGGGAAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACATCTTTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGTCT{AG}AGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGTTGGCTGACGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAG{AG}TTCGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATTTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACAGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTAGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTTTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATC{AG}TACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGACACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCAGCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACAGAATTTGTCCTTGT{CT}GGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACC{AG}TAGTGCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTACTGGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCTGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGATCCAGGAGACTCCACTCC{AG}TTTGAAGACTC{AG}GA{AG}GAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Motacilla_cinerea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATATG---CAGGGACTTGAGGAAGAT---------------GCTGTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCACTTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTTAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAAACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGGGGCAAACGTGTAAAAGCCACTGGGGAAC{AG}TGCTCAGCTAAACAGAGGTATAAAGAACCAGCAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTG{CT}AGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAATATTCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGA?GAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACGGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTATCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGATTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATG{CT}TGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTT{AG}CGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGGAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTC{GT}AAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAGGTGTGAGGAAAGGCATGAAGCCCT{AT}AAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTC{AG}TGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTTTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACCCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACGAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGA{CT}GTGCCTGAGGCTAGATATGGGCATTCAATTAACGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATATGCTTCCAGAGCTTCAAGACGGACTTTCTTTCCACGTCTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCC{CT}AACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCCATAGTGACCCAGGTCAGTGACAATGAATTTGTCCTTGTCGGTGGCTATCACTCAGACAACCAAAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTGTTGCTGGGCATTCCAGGAGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAGGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Muscicapa_ferruginea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCT---TCT------------------------------------------------------------TCAAACAAGGAACT{CT}ATTCTGCATAAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAATGGGCAAT{AC}GG---CAGGCACTTGAGGAAGATGCCCAC---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGTATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGA{CT}GTGCGAGGGGATGTTGATACCATCCATCCCACTCACTTTTGTCACAACTGTTGGAGTATTATACACAGCAAATACAGTAATACTCTATGTGAAGT{AG}TATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGCGATGTGTGCCATACTATCAGGAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAATGTACAGCGTGGCAAACGGGTCAAAACCACCGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGTACCAAGCTGCTTGCAGTTGATTATCCACCAGATTTCATTAAATCCATTTCTTGCCAGGTTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTCATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAGAGGAGTGTGATGAAGAGATCATGCATGGAAGGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACCGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTGCTGTCTCTGACCAG{AG}AGAGCTCAGAAACATCGTCTGAGGGAACTGAAACG{CT}CAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGG{AT}TCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTA{CT}CATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGGTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTCCCACTCTCAATTGATGATTACCCAGTAGACACTATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGTACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAACTCAGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTC{AG}TCTT{CT}AGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACGTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGA{CT}GTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCACGAAGCCTTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAGCTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAA{CT}TGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAA{AG}CAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTCTGCACGCTCAGAAGTGATGCAGAGGCTGATGAGTATCAGTACATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGACAAGATTTACTGTATGAGTCTGGTAAACAAAACTAGCAAGAGAATGACATTCCGATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGACTGTTCTCTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTCTCAATTGCCAGATATGATACAATTTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGACCTACCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTG{CT}AGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTT{CT}TGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCGAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAGGACAAGGAAGAAGAATT{AG}ATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTC{AG}GAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Nectarinia_olivacea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGTATAAATATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTGCAAGACAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAGA{AT}CAGCAACCTCTTGGCCAGAACTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTTCCAGACGAGGAATCAAGAGAAAAAGCCAGCCTCCAAGTGTAAAACGCGGCAAACGTGTCAAAACCACTCAG------------CTAAATAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAACTGCTTGCAGTTGATTTCCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCT{CT}AAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCTTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTCAAGGAATGTAATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAGGTCAGAGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGCATCAATACATTTCTCAGCTGCAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCT{CT}CGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGTCCCTTCACAGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCTCTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTACTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGGTATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAAAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGGAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCTTGTCCAACTGGTGTTTTCCTCCTTGATATAAAGCAGCATGAGCTCAAAATGAAACCTGT{CG}TTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCT{AC}CGGTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAGGGCTGATGAGCACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTTTGGTAAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAG{CT}GTGAGTGTTCTGTTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTT{CT}TCATTGACTTTGAGTTTGGATGCTGTACATCATACATACTTCCTGAGCTTCAAGATGGACTTTCTTTCCACGTTTCGATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATTCCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAG{CT}GTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTGAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAGAGGAAC{AG}GAAGAGGACAAGGAAGAAGAATTGGTAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Neodrepanis_coruscans TAAAGTGCGAACATTTGAAAAAACTCCCTCTGATGGGAAGCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAACAGC---CAGGCAGTTGAGAAAGATGCCCAT---------GACATTAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTACATGGGCCAGTGGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGAT{AG}TTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATTCATAGAAAATTCAGTAATGTTCCATGTGAAGTATATTTTCCCAGGAACAGCATGATGGAGTGGCAACCTCACTCCCCAAAGTGTGATGTATGTCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACTGAGTATACAACATGGAAAACGTGTGAAGACCATTGTGGAATGTACTCGATTAAACAGAGGTGTAAAGAACCAA------------GCACAAAGAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCATTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGCGGCCGACCAAGGCAGCATCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATTACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCGCTAACGCAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAATCTGGATGACTGTTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGGTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAGGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAACAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGAGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAACCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTGATGGACCTTTATCTCAGGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGGAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCAAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGTGTACTCGGGAGCAATGCAAAGTCTGATGAGTACCACTATATCATCCATGGTGGTAAAACACCTAACAATGACCTGTCTGATAAGATTTACTTTATGAGTCTGATAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGATGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAGTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCGGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGAAGATACTATATACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACTATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAAATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCCGTGACCTGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACGACACAAATTTGCAGTCAGACATCAAATGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTCAGTGCTGAAGCCAATAGCTTTGACATTGGTGATAATGATACTTACAATGAGAATGATGAAGAAGATGAATCAGAAACAGGCTACTGGACCACCTGCTCTGCC Oedistoma_iliolophum TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACGAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGC{CT}CAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTG{CT}GGAGTTTCATTTAAAACTGATTG{CT}TACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAATGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAGGACAGCCCCCAAGTGTACAGCGTGGCAAACGGGTCAAAA{CT}CACTGGGGAACGGGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATCTAATGAAAGAGA{CT}TGTCAATTGCAAGGATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGA{AG}CATCCT{CT}GATAACGTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAAGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCCGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTGTGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGA{AG}GGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCC{AC}TTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCCGGACTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGGTATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGATTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGC{AC}AGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGG{CG}AAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTGCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCTGTGTTTCTCATTGATTTTGAGTTTGGTTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCGAGTGCTATAGTGACCCAGGTCAGTGATACT{AG}AATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGCGTGTAACACCGTAGTTCTGGAAGATAACAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAGGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTGGC Oreoica_gutturalis TAAATTGCGATCATTTCAGAAAACACCCTCTGATGACAGGCAGCACATAAACAAAGGTCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTTATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGCGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATAATACACAGAAAATTCAGCAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGGTGTAAAGAACCAA------------{AG}CACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTCAACACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTT{AG}GCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGC{AG}TATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGA{CT}AGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAGCAAGCAGATGAACTGGAGGCTATACTGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAGACCCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCGTCTTTAGGGGTACAGGATATGATGAGAAGCTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTG{CG}CAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGTTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCATGCTCAGAAGCGATGCAAGGGCTGGTGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAG{AG}TTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTCATCGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCA{CG}{AG}GGGAATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGGTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCCTTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTCTACATGTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAAGCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Oriolus_larvatus TAAATTGCGATCATTTGAAAAAACGCCCTCTGATGACAGCCAGCACATAAACAAAGGTCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACGGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACCGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAG{AG}TTAACAACAAAAATTTAATGAAAGAAATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCGTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCA{CT}CTCCTGTCTTTGACGAGGAGAGCACAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATACTGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTGTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGATATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACGATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCTTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAA{AG}CTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTATCTAAAGAGGAGAGGAAGAGGTGGCAGCTGAC{AG}CTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAACTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCGGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCATGCTCAGAAGTGATGCAAAGGCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGA{CT}CTTTCTGATAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGATCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAAAGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGA{CG}ATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTATATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTGCATT{GT}GAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATTGCTTTGATGTTGATGATGCCGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Oriolus_xanthonotus TAAATTGCGATCATTTGAAAAAACAC{CT}CTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCGGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACCGGCAGTAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATTAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCGTTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCGCAGAAACATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACGATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCTTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACGCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTGTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGC{CT}AAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCGGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCGCTTTGCACACTCAGAAGTGATGCAAAGGCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTTTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGATCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCC{AG}GGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAAAGGTTGGTGTGCAACAGCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGACATGGGTAAAGGGTCTGTATTACTGGG{AC}ATTCCAGGGGCCA{AG}CAAACAATTAATCCCAGATGCAAACTACTTCTATATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTGCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCCGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Orthonyx_spaldingii TAAATTGCGATCATTTGAAAAAACACCTTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGGAAGACGCCCAT---------GCCATCAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTTTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTCATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGCCGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTAGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGGAGAGATCTTGCATGGAAAATATGGCCAACACCTTTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGTCTGGCCATCCGGATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATCTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCTCACGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCAGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGCGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAAACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAACGAGTCTGGAAACAAACTCTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAACCAGAGTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCTCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAAAGCTGATGAGTTCCAGTATATCATCCATGGTGGCAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACTTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAG{CG}CCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGATTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACACCCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCCGGGGCCAACAAACAACTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGTAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Orthonyx_teminckii TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTAT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCA{AG}TGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATCAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTCCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTCATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGT{AG}TATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGCCGAGGAGTCAAGAGAAAATGCCAGCCCCCAACTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATGTCTTGCCAGATTTGTGATCATATTTTAGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCGTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTTTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGTCTGGCCATCCGGATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATCTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCTCATGGGGATGAAAGCACGAGGGTCTTCGAAGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGCTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTTCACTCCATAACCAGGAGCCATGCAGAAAATCTGCAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTAGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATA{CT}GAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTCTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAACCAGAGTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCAAAAGCTGATAAGTTCCAGTATATCATCCACGGTGGCAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCTAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGATTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACACCCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCCGGGGCCAACAAACAACTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGTAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pachycephala_hyperthra TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAAACACTGTTTCT------------------------------------------------------------TCAAACAAAGAATGCATCCTGCATAACAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGATTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---ACAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGCGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCAATACTACCAGGCAAGGAGTCAAGAGAAAAAGCCAGCCCCTAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCGCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCAGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACTGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCAAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGATGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTAATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTGGTTCATAGCCGGGGAAAGAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGACCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACGGAAGAGGACAAGGAAGATGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTTTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACAATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACTGGCTACTGGATCACCTGCTGTGCC Pachycephala_soror TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGATCAGGCAGAAAAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATG{CT}ATCCTGC{AG}TAACAATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGATTTAACGGGCAA{CT}AGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---ACAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCC{AG}GAGCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACGCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCAATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAGCCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAGCGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATCATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAAGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCAAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTT{CT}CGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCT{CT}AAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGATGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTCCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGACTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGACCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGTGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGCAACACCATAGTTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAGGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCAC{CT}CCGTTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACAATGCTGACACTTACAATGAAGATGATGAGGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pachycephalopsis_poliosoma TAAATTGAGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAATTCATCCTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------A{CT}GGAGTTAATGAACAAGAGA---CAGGGACTTGAGGAAGATGCCCAT---------TCTATGAAAACACAACACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTG{CG}CTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGAAACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCTAT{AG}CGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACAACCCAACGAGGAGTCAAGAGAAAAAGCCAGTCCCCAA{AG}TGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGGGTGTAAAGAACCAA------------GCACA{AG}ATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAAATTTGTGATCATATTTTGGCAGATGCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCCTGAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTTCTGAACATCCTTGATAACCTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGCTACATAAATAAAGGTGGCCGGCCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAGCATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCCATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACGAACACAGAGGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCGG{CT}AGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCA{AG}AAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAGACTCTGACAGCAATCCTGAGCCCCCTCAAAGCAGAAAGAGAGGCTATGAAAACCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAAC{CT}CGCTTGGAGGCATCCCAGAATCTGGTATTCCACTCTATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCCTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGAT{AC}TTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGATGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTCGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGGAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCTTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGTTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAAAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTCTTTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTGAAAGTTGATTTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATCGTTCTGGAAGGTAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACTCCAGATATTAAACACTGCAGAATGTGGTTCGGCTGTGATATGGGTAAAGGATCTGTCTTGATGGGCATTCCAGGGGCCAGCAAACAGCTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTACC Paradisaea_raggiana TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGCAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGACGTGTGCCATACTACCAGACGAGGAGTTAAGAGAAAAAGCCAGCCCCGAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTGTCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGG{CT}GATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAA{CT}CCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAGAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAACTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTTAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATC{AG}ATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGA{CT}GTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Paramythia_montium TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAACGAATTCATCCTGCATAAAGATGAAGCCGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATCATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCCAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCC{AG}AGAGTGCAACGTGGCAAACGTGTCAAAAACACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTGTCAA{CT}TGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATCAAATCCATTTCTTGCCAGATTTGCGATCATATCTTGGCAGATCCAGTGGAAACAACTTGCAGACACTTGTTTTGCAGAAGTTGCATCCTTAAGTGCATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGA{AG}ATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTCTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTTGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAAGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTCAGGGGTACGGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCTGGTTCCACTTATATTTGTACCCTATGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGCGAGCTTTACAAGAATCCTGATGTGTCTAAAGAAGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTTGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCTCTAAAAGAACTGATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAA{CG}TTCAAGTACAGATACGAGGGCAAGATTACGAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGAGCCTGGGCAAGCGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATGTAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGC{CG}ATGCAAAGGCGGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGGTATGGGCATACGATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATGTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAGTTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGCGTGTAACACCTTAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGATGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pardalotus_punctatus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCCTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAGGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGATAGG---CAGGGACTTGAGAAAGATGCC---------------CTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTTCATTTAAAACGGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTGGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTAGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACTTGTCAAAACCACTGGGGAACGCACTCGGCTAAACAGAGGTGTAAAGAACCAA------------ACACAGATAGACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAATGATATACATCTCAACACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCCGGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAGCCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGGAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCCCTGCAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTTTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAC{AG}AGGATCTTTGAGGAAGTAAAGCCCAATTCTGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCATGAATCAGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAGCTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGATTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAACGCGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGTTACCCCGCTCTTTGCACACTCAGAAGCGAT---GAGTCTGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAGGACCTGGGTGGGGATGTCCCTGAAGCCAGATACGGGCATACAATTAATGTAGTTCACAGCAGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGATCATATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGGTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTCCAAAATAATGCCAGGTCCCCCAACTTGTACAAGCTCAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATGGTAAGATAGGGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACATCAAGTGA{AG}GACCCTGGCGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTTCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Pardalotus_striatus TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGTCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGAAGTTAATGGGTGATAGG---CAGGGACTTGAGAAAGATGCC---------------CTGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAAAGCACTTACCCAGTGCATGGGCCAGTAGATGATGAAATTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGGCGAGGAATCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACTTGTCAAAACCACTGGGGAACGCACTCGGCTAAACAGAGGTGTAAAGAACCAA------------ACACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAATGATATACATCTCAGCACCAAGCTGCTTCCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCCGGGTTATGGGCAGTTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGGAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTGCAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCCGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCTTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAGAAGCATGGGAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACAAGGATCTTTGAGGAAGTAAAGCCCAATTCTGAGCTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGCTATGAAATATGGAGGTCCAACCCATATCATGAATCAGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTAAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCGCAGCGATTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAACGCGATGGGTCCATTGGG{AG}CCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGTTACCCCGCTCTTTGCACACTCAGAAGCGAT---GAGTCTGATGAGTTCCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGGGATGTCCCTGAAGCCAGATACGGGCATACAATTAATGTAGTTCACAGCAGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAG{AG}TCATATACTCCTCTTGCCCAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCGTACGTACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTCCAAAATAATGCCAGGTCCCCCAACTTGTACAAGCTCAAAATCGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATGGTAAGATAGGGATTGTTGAAAGTGTGAGCCC{AG}GAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTATTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGGTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGCGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTTCTGAAGCCAATAGCTTTGACATTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACGTGCTGTGCC Parula_americana TAAATTGCGATCATTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGTAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATGAAGAAATCATCCTGCATGAAGATGAAGCAGTGCCAAGAGGTGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGTACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAAAGGTGTAAAGAACCAACATCTCAAACAAGCACAGATAAAAAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTTTCTGGCCACAAGGAGATGAAAGAAGGAGAGGTCTATAGTTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCGGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCTTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAATGTATCTACTAACACAGAAGTGCGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTATCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATTTGAATGGCCCATTCACCGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACA{AT}GAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCACAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCATATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATATGTGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAGAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTTTCCTTGTAGGTGGCTACCTCTCAGACAACCAGAAACGGCTAGCATGTAACACCATAGTTTTGG{AG}GGATAATAAGATAGAGATTGTTGAATGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGTGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAAGTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Parus_inornatus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCTCATAAGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGAAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACATGCAATAGG---CAGGGTCTTGAGGAAGATGCCCAT---------GCCATGAAAACACA{AG}GACAAT---AGAGTGCATCAGACTAATCTGAAGCAATTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCGACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATGGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCGCAATGGAGTGGCAACCCCATTCCTCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGTAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGACATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTTCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCATTGGAAACAACGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCACGGAAAATACGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACACCAATAAAGGCGGTCGACCAAGGCAGCACCTCCTGTCCTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTTTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCTCTCTTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTGTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTTGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCTGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGTTATGATGAGAAACTCGTGCGGGAAGTGGAAGGACTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGGTATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGAGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCAATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCGCTTTGCACGCTCAGAAGCGATGCAAGGGCCGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGAAGGTCGTATACTCCTCTTGAACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCGTCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGACACTATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGGTCAGTGACAATGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGATCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCTGGTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Parus_major TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCTCATAGGCAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTGCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGCCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATTCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATGGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCGCAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTGCCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGTAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGACATTGTCAATTGCA{AC}GGATATACATCTCAGCACCAAGCTGCTTTCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACGTGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGACTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCACGGAAAATATGGCCAACACCTCTCTGGTCACAAGGAGATGAAAGACAGAGAGCTCTGTAGCTACATCAATAAAGGTGGTCGACCAAGGCAGCACCTCCTGTCCTTGACGAGAAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGAGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTTTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGC{CT}CTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTGTCAATCGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATCTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGACGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCCGAGAAGGCTGTTCGATTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTCGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAGCTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGGTTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGACTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTTAGGAAGAAGATGAACCTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGGTCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTCTGCCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCCTATCTACAAAGTTCAAGTACAGGTATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCAATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCACTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGAGCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGAACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCGTCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGACACTATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGATCTGCCGCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACAATGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGACTGGCATGTAA{CT}ACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAGGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGCGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGACGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Passer_montanus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAATAAAGAAATCATCCT{CG}CATGAAGATGAAGCAGTGCCAAGAGAAGAAGAG---------------ATGGAGTTAACAGACAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAGGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACAGATTGTTCCAAGAGAACCTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTTTGGCTTCTGAGAAAGAAGGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACCAGAGGAGGAGTCAAGAGAAAAAGCCAGCCCCCACATGTGCAACGTGGCAAACGTGTCAAAACCACTGGGAAACATGCTCAGCTAAACAGAGGTGTAAAGAACCAACAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAAGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGACTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATATGGCCAACACCTCTCTGGCCA{CT}AAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGCAGTCAGTATCATAAAATGTACAGAACGGTAAAAGCTGTCACTGGCAGGCAGGTCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTCTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGACGACTACTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTCAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCA{CT}GCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAAATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCGGCCAA{AG}GAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGA{AG}GGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGCGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTGTATAAGTTTCGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGGTATGGGCATACAATTAA{CT}GTAGTTCATAGTCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGCGTAGTCGACTGTTTGCCC{AT}CTGTGTTTCTGATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCC{AT}GAACTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTTCAAAATAA{CT}ACCAGGTCCCCTAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACAATGAATTTGTCCTCGTCGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGC{AT}TGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGAGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAACTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTCGAAGATTCGGAGGAGTTTTGTTTTGGTGCTGAAGCCAATAGCTTTGATGCTGGCGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Peneothello_bimaculatus TAAATTGCGATCATTTGAAAAAACACCCTCTGGTGACAGCCAGCACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAGGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAGT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCACTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATAGTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCAC{CT}GGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGAGTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGA{CG}ATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAGAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTGGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTCTGCCTTAAAGGATATGGAAGAGGAGATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATGAAGGAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAACAAAACAAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGTGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAATATGAGTGTTTTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAATTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAATCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Pericrocotus_ethologus TAAATTGCGATCATTTGAGAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTAATCCTGCATAAAGATGAAGCAGCGCCAAGAGGAGAAAGG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACCTGAGGAAGATGCCCATGATGCGCATGCCATGGAAACACAAGACAAC---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTGCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTCTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCACACTACCAGACGAGGCGCCAAGAGGAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTTGGGAACATGCTCGGCTAAACAGGAGTGCGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAAACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGC{AC}GACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTCAAATCCTTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTGAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATACCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAATATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTTCAGCCTTTGCATGCTCTCCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCCATTGATGACTACCC{AC}GTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGAATGAAAGCAAAACACCTGGACGACTATTTGAACGGGCCCTTCAGTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGCTGTGCTGTAAGCCCTTGTGTCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCCATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAGGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAAAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCCATGTTGAAGATGAGTGGAAATTTTGCTAG{AG}AAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCCGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGCGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCGGCTCTTTGCACACTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTCATGAGTCTGGCAAACAAAACTAGCAAAAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAGGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGCACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACCTGTACA{AG}GCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTGTCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGTTACCACTCTGACAACCAGAAGCGGTTGGTGTGTAACACCATAGTTCTGGAAGA{CT}AGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCGTTTGAAGACTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Philepitta_castanea TAAAGTGCGAACATTTGAAAAAACACCCTCTGATGGCAAGCAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAACAGC---CAGGCACTGGAGAAAGATGCCCAT---------GACATGAAAATACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTACATTTAAAACTGATTGGTACAAGAGAACTCATCCAGTACATGGACCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTACGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCA{CG}AACTGTTGGAGCATTATCCATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCATGGTGGAGTGGCAACCTCACTCCCCAGACTGTGATGTATGTCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAATGTACTCGATTGAACAGAGGTGTAAAGAACCAA------------GCACAAAGAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATACATCTCAGCATGAAGCTGCTTGCAGTTGATTATCCAGCAGATTTCATTAAATCAATTTCTTGCCAAATTTGTGAGCATGTTTTGGCAGATCCAGTCGAAGCAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCGTTCCTGAACATCCT{GT}GATAACTTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTATATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGCCGGCCAAGGCAGCATCTTCTATCTTTGACAAGAAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTGGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCACAAAATGTATAGAACCGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACCCAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTAGAAGGCATGAAAGCAAAAAATCTGGATGACTGTTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAATTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTCAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAAAGATATGAAATATGGAGGTCCAATCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATATTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGACATGAAGCCCTAAAAGAACTGATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCTCTTTGCATACTCAGAAGCAAGGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGCTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAGAGATGACACCATTTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTACCCCAACTTGTACAAGGTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACTATCTTGCCAGGGGGAATATCGGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGATTGGTGTGTAACACCATAGTTGTGGAAAATAGTAAAATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATCTGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAAAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAACGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGATACTTACAATGAGGATGATGAA---GATGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Philesturnus_carunculatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATTCATCCTCCATAAAGATGAAGCAGTGCCAGGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAACATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTTATTTAAAACTGATGGTTACAATAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTTAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCATAACTGTTGGAGTATTATAAATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGCGCTCGGCTAAACAGAGGTATAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCGGCACCAAGCTGCTTGCCGTTGATTACCCGGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAAGGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTCGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAA{GT}GAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAAGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCTGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGCGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGTATCTTGAGAACATTTAGATTCATCTTTAGGGGTACAGGGTATGATGAGAAACTCCTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTATAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGTTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCCCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATGTCATCCATGGTGGTAAAACACCAAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAGGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAACGTAATTCATAGCCGGGGAAAAAGC{AG}TAAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTCGGATGCTGTACATCATACATACTACCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTTACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGGTAGAGATTGTTGAAAGTCTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAGGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAAGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACATTTACAATGAAGATGATGAAGAAGATGAATCCGAAACGGGCTACTGGATCACCTGCTGTGCC Picathartes_gymnocephalus TAAATTGCGATCATTTGAAAAAACACCCTCTGATAACAACCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATACATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAAG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAATGCAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTTCATTTAAAACTGATTGCTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGCGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGTCAGCCCCCAAATGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTTGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAATAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGATTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATCTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACGTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAGTCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGACATCTTGCACGGAAAATATGGCCAACACCTCTCCAACCACAAGGATATGAAAGATAGAGAGCTTTATAGCTACATAAATAGAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGGCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCCGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATCTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCGGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGATGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGAGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTTTGTGATGCAACGCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGATCCAACCCATATCACGAATCTGTTGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGATTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAGCTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCTTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTTCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTATCCCGCTCTTTGCACGCTCAGAGGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACACCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACCATCTACATCTTGGGTGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCGTCCTGCCAGGGGGAATATCAGTATCAAGTGCTATAGTGACCCAGATCAGTGATAATGAGTTTGTTCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACGTTTTGAGATGCGAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pipra_coronata TAAAGTGCGATCATCTGAAAAAACGCCCTCTGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGGGATTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAATGACCAATAGG---CAGGCACTTGAGAAAGAGGCCCAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTATAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGCGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACCCTATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACAAGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAAGAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACGTCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTAAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAGGTAGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAATATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTAACGGCAATTCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGTTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTCTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCCATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCGCCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTGTAAGTCTGGTAAGCAAAAATAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGGTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGCTATATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCTAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCATCTGTGACCTGCACCATCTTGCCAGGGCGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAGTTTGTCCTTGTCGGTGGCTACCACTCTGACAACGAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAAAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAACGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pitohui_cristatus TAAATTGCGATCATTTCAAAAAACACCATCTGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTTATCCCGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGCGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGGCTTCTGAAAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATAATACACAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCTTTCCTGAACATCCTTGATAACCTGCGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATA{CT}TGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAAC{AC}GTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATTTTTGTGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAGACCCTGACG{AG}CAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCGTCCCAGAATCTCGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCAAGAATCTGTTGATGAGCTTCGCGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTACACTGCGACATTGGCAATGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTGATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGTTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCGTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCAT{GT}CTCAGAAGCGATGCAAGGGCTGGTGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGCTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCACAGCC{AG}GGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAA{AG}TGGAACAGCGTAGTTGACTGTTTGCCATCT{CG}TGTTTCTCATCGATTTTGAGTTTGGGTGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAAC{CT}TGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGAATATCAGTGTCAAGTGCCA{CT}AGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATACTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Pitta_sordida TAAAGTGCGACCATTTGAAAAAACGCCCTCTGATGGCAAGCAGCACATTAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAATAAGAAAATCCTATTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAACAGG---CAGGCACTTGAGAAAGATGCCCAT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATAATCCACAGAAAATTCAGTAATAATTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGAGGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAACGTGCTCGATTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGAACATACATCTGAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAAGCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAGTATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTCTCAAGGTTATGGGCAGTTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCATTCCTGAACATCCTTGATAGCCTGACTATAAGATGCCCTATAAAGGAATGTGATGAAGAGGTCTTACATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGAGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAGTTGGAGGCTATAATGCAAGGGAGAGGATCTGGTCTTCATCCTGCTGTCTGTCTGGCAATTCGAGTCAACACATTTCTCAGCTGTAGCCAATACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTTCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTTGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGACTATCCAGTAGACACAATTGCAAAAAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGACCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAATCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCGGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTTGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTATGTGATGCAACTCGCTTGGAGGCATCACAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAGAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAATGCAGCAGAATTCTATAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAACCCCGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCCAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTTGACATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATG{CT}TACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAATGCAAAGCCTGATGAGTACCAGTACATCATACATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTCATAAGCAAAAATAGCAAGAAAATGACGTTCCGATGCATTGAGAAAGATCTGGGTGGAGATGTCCCT{AG}AAGCTAGATATGGGCATACCATTAATGTAGTTCATAGC{CT}GGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATATTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTCCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACGTACTTCCAGAGCTTCAAGATGGACTTTCGTTCCATGTTTCAATTGCCAGAGATGATACCATCTACATTTTAGGAGGCCATTCACTTCAAAATAACACCAGATGCCCCAACTTGTACAAGCTAAAGGTTGATCTCCCGCTGGGCAGCCCAGCTGTGACGTGCACCATCTTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGATAGTAAGATAGAGATTGTCGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCCATATTGCTTGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATACAAACTACTTCTACATTTTGAGATGCAAAG{CG}AGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATCTGTAGTCAGACATCATCCGAAGACCCTGGAGACTCCATTCC{AG}TTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGTTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGACGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Ploceus_cucullatus TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGTC{AC}GCACATACACAAAGATCAGGAAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCGTCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAGT---AGAGCTCATCAGAACAATCTGAAGCAATTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAA{AC}TGTGATGTCTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTGCAACGTGGCAAACGTGTCAAAA{AC}CACTGGGGAACGTGTTCAGCTCAACAGAGGCGTAAAGAACCAACAACTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGTATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGCATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATTAACACCTTTCTCAGCTGTAGTCAGTATCA{CT}AAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCCTTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACGTGGACGACTA{CT}TTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGG{CT}GATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGCGAACTGCTGCTTGAAATGGGAGGCATCCTGCGAACATTTAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTC{CT}ATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGCGGTCCAACCCATATCA{CT}GAGTCTGTTGATGAACTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAATTAATTAAATGTGAGGAAAGGCACGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCTAGGCAGTCCAAGGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTTTTCTTCTCTAAAGACTC{CT}TGTTACCTTCCCCCTCTGCGCTACCCTGCTCTGTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTATCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGA{AG}AAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAACGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACGGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACA{AG}TCTACATCTTGGGAGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGG{GT}ATATCAGTGTCAAGTGCTATAGTGACTCAGATCAGTGACAATGAATTTGTCCTTGTCGGTGGCTACCACTCGGACAACCAGAAACGGCTAGAGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGTCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGAT{CT}ACCTGCTGTGCC Polioptila_caerulea TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACAGAAACAAAGATCAGGCGGAAGAAACTGTT{CT}CT------------------------------------------------------------TCAAACAAGGAATTCACCCTGCATAAAGATGAAGCAGCACCAAGAGGAGAAAAG---------------ATGGAGTTAGCAGGCGACAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCCATGGAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAATGGATAGTCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGCCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCATTCCCCAAACTGTGACGTGTGCCATACTACT{AG}GACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGAGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACCGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGACTGTGATGATGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGAC{AG}AAAGATAGAGAGCTCTGTAGCTACATAAACAAAGGTGGCCGACCGAGGCTGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCGGCTGTCTGTCTGGCCAT{CT}CGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGGTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACACTCAATTGATGATTACCCAGTAGAAACAATTGCAAAGAGATT{CT}CGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAACAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTGAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTGTAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCAAGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATACGATGAGAAACTTCTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGATGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTAAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTTCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGGTCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAGCCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTGAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACCGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGGTGCAGTACATCATATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGAGCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGCAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGACATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCTACCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGCTGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTT---TTTAGTGCTGAAGCCAACAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Pomatostomus_halli TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGCTTTT------------------------------------------------------------TCAAACAAAGACTTCATCGTGCATAAAGATAAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCCATCAAAACAGAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGCGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCCAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTATCAGTTGCAAGGATACACATCTCAACACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCAATTTCTTGCCAGGTTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGATCTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTTGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCATGGAAAATATGGCCGACACCTCTCCAGCCACAAGGATATGAAAGATAGAGATTTCCATAGCTACACAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAAGGAACTGAAACGTCAAGTGAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCCTTTGAGTGGAAACCGCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCGATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGACATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAAGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGACGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTAGATGAACTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCACGAAGCCATAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAGGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCATGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTTAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATAGAGAAAGACCTGGGTGGAGATGTGCCTGAAGCTAGATATGGACATACAATAAACGTAGTTCATAGCCGGGGAAAAAGTATGAGTGTTCTATTTGGAGGGAGGTCCTATACTCCTCTTGCACAGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCCTCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGGTGACACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTACCCCTGGGCAGCCCAGCTGTGAGCTGCACTATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTTGGTGGCTACCACGCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCATGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGCAGCAGAAGCAGACAAGGAAGAAGAATTGATGACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCTACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCCATAGCTTTGACACTGATGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGG{CG}TACTGGATCACCTGCTGTGCC Pomatostomus_isidorei TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAAGAAAGATCAGGCAGAAGAGGCTGCTTTT------------------------------------------------------------TCAAACAAAGACTTCATCGTGCATAAAGATAAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGGCTTGAGGAAGATGCCCAT---------GCCATCAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCACCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCCCACTCCCCAAAGTGTGATGTGTGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCCCAAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGCGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAAATTATCAATTGCAAGGATACACATCTCAACACCAAGCTGCTTGCAGTTGATTATCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGACCATATTTTGGCAGATCCAGTGGAAACGACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTAGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGGTCTTGCATGGAAAATATGGCCGACACCTCTCCAGCCACAAGGATATGAAAGACAGAGATTTCCATAGCTACACAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAAGGAACTGAAACGTCAAGTGAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTCTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGCCAGTATCACAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCCTTTGAGTGGAAACCGCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTATCAGGACTGCCACTCTCGATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGACATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGACTGAAAGCAAGAAGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTAGATGAACTCCGTGACAGAGTGAAGGGGGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACGGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCACGAAGCCATAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGCAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTAAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTTTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTTAGAAGCAATGCAAGGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATGGAGAAAGACCTGGGTGGAGACGTGCCTGAAGCTAGATATGGACATACAATAAACGTAGTTCATAGCCAGGGAAAAAGTATGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACTGAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGGTGACACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATATACCCCTGGGCAGCCCAGCTGTGAGCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTGGTCGGTGGCTACCACGCTGACAACCAAAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGCGGACAAGGAAGAAAAATTGATGACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTACTCCGTTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCCATAGCTTTGACGCTGATGATACTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Prionops_plumatus TAAATTACGACCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGCGTTAACAGGCAGTAGG---CAGGGACTTGAGGAAGATACCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGTGTCAAAACCATTGGGGAACGTGGTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACATTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACCAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAATTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTGTGCCAATATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAATAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGATTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCGGTTTGCGCGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCGGATAAGATTTACTTTATGAGTCTTGTAAGCAAGACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTCGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATCAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATATCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATATACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGTAGAAGAAGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGCGAGGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Promerops_cafer TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAAAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTCCGTTTAAAACTGACTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGAT{CT}GATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGCATTATACATCGAAAATTCAGTAATACTCT{AG}TGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGGGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATATAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAACTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCGCATGGAAAATACGGCCAACACCTCTCC{AG}GCCACAAGGACATGAAAGAGAGAGAGCTCTA{CT}AGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTCTGTT{CT}CTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAACCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGAAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCGGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTAAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCGCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCA{CT}TGCACTGTGATATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGATGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGCGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTGTTGTCTACAAAGTTCAAGTACAGATATGAGGGCAAGATCACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTTTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAAAGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGCTTTACTTTATGGGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCGTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAATTCATAGCCGGGGAAAAAGCGTGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCACTTCAAAATAACATCAGGTCCCCTAACTTGTACAAGCTAAAAGTTGATCTGCCCCTGGGCAGCCCGGCGGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGAGCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTTTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAATAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCC{CT}GGAGACTC{CT}ACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGTTGTGCT Prunella_collaris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATGAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCTGCATGAGGATGAA{GT}CAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAACAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGATAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAGCTAATTGTTCGAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGAGAGGGGATGTCGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATG{CT}GAAGTGTATTTTCCTAGGAACAGCACCATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTATGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCACCTAAACAGAGGCATAAAGAACCAACAACACAAACAAGCACAGATAAACAACAAAAATTTAATGAAGGAGATCGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTAAACATCCTTGATAATCTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACATGGAAAATATGGCCAACACCTCTCTGGCCATAAGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATTAACACGTTTCTCAGCTG{CT}AGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTCTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGGTACGATGCAGCCTTGGTCTGCGCC{CT}TAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAATCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAATCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCC{CT}AATTCTGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAG{AC}G{AG}TATGAAATATGGAGGTCCAACCCGTATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGCGGGAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAA{AG}TACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTAAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCAGTCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAAAAGCGATGCAAGGGCTGATGAGCACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGGTAAGCAAAACTAGCAAGAAAATTACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTTCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCCGGGGGGATATCAGTGTCAAGTGCCATAGTGACCCAGATCAGTGACACTGAATTTGTTCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGACATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGGGACTCCACTCTATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Psarisomus_dalhousiae TAAAGTGCGAACATTTAAAAAAACACCCTCTGATGGCAAACAGCACATAAACAAAGATCAGGCAGAAGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAAGAGC---CAGGCACTTGAGAAAGATGCCCAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATTTAAAGCAGCTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACTTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACCCCATGTGAAGTATATTTTCCTAGGAACAGCACGATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACTGAGTGTACAACATGGAAAACGTGTGAAGACCATTGTGGAACGTGCTCGATTAAACAGAGGTGTAAAGGACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTGAATTGCAAGAATATGCATCTCAGCACCAAGCTGCTTGCAGTCGATTACCCAGTAGACTTCATTAAATCAATTTCTTGCCAAATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGCTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCGTTCCTGAACATCCTTGATAACCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCCACATAAATAAAGGCGGCCGACCAAGGCA{AG}CATCTTCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTGAGAGCACAAAATGAACACAGACAAGCAGATGAGTTAGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGCTTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCGGTCACCGGGAGACAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGGCTGTCAGGATTGCCACTCTCAGTTGATGACTACCCAATAGACACAATTGCAAAGAGGTTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAGTGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGCGAGAAGCATGGATGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCAATAGTACATGGGAATGAAAGTAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACGGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAATCCATATCATGAATCGGTTGATGAGCTCCG{CT}GACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTTTATAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTTTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACAGTAGAGGCAGTTTGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCTAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAACTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTATTTCGGAGGTTTCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACTGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAATTTACTTTATGAGTCTTGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTCCATAGCCGGGGAAAAAGTGTGAGCGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCGTCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCGCCAAAGATGATACTATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCCCTGGGCAGCCCAGCTGTGACTTGCACAATCTTGCCAGGGGGGATATCTGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAGTTTGTCCTTGTTGGTGGCTATCATTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGATGATAGGAAGATAGAGATTATTGAAAGGGTGAGCCCAGAGTGGACAGCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATCTGGGCAAAGGATCTGTATTGCTGGGCATCCCAGGGTCCAACAAGCAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAATGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTACTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAGACAGGCTACTGGATCACCTGCTCCTCC Ptilogonys_cinereus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAA{CG}AAAGATCAGGCAGAAGTGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATCCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAA---------------AT{AG}GAGTTAATGGGCAA{CG}AGGCAACAGAGTCTTGAGGAAGATGC{CT}CAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAACCTGAAGCAGCTCTGCCGCATCTGTGGAGTTTCGTTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCGGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAATTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCGTACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGCCACTTGCTCAGCTAAACAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGCTCATCAGTTGCAAGGATAAACATCTCAGCACCAAGCTCCTTGCAGTTGATTTCCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGAGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAATACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGG{CG}AGGCAGATCTTCCAGCCTTTGCATGCTCTCCGCACCGCTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGACGGGCTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGAAACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGCGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACCGGATTTTCCAGATGGAAATTGGTGAACTTTACAAAAATCCTGACGTATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGCGAGTTAATAAAGTGTGAGGAAAGGCACGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAGGGAGTGCCCAGAACTGCTGTGTCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTATAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAAATGGAGGATGTCCTGCGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGATCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCGATGCTAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACGATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACACCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCCTATGTACTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACCGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGACGGTAAAATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAAGAGTTTTGTTTTAGTGCTGAAGCCAATACCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Ptilonorhynchus_violaceus TAAATTGCGATCATTTGAAAAAACAC{CT}CTCTGATGACAGCCAGCACA{CT}AGACAAAGATCAAGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAAAACAATCTGAAGCGACTCTGCCGCATCTGTGGAGTTTCTTTTAGAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGGAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAA{CT}AGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTTTGCCGTACTACCAGCCGAGGAGTCAAGAGAAGAAGCCAGCCCCCGAGTGTGCAACGTGGCAAACGTGCCAAAACCACTGGGGAACGTGCTCGACTAAACAGAAGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCTATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACCTGTTTTGCAGAACTTGCATCCTTAAGTGTATCAGGGTTATGGGCAGCTATTGCCCCTCTTGCTGGTATCCTTGCTTCCCTACTGACCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACATGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATACGGCAAACACCTCTCCAGCCAC---GAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGACTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGAAAGGGAGGGGATCCGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCACCGGGAGGCAGATCTTCCAGCCTTTGCACGCCCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTACCACCCATTCGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTTTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAATCTGGATGACTATTTGAATGGCCCCTTCACAGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGGGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCATATGGGAATGAAAGCAA{CG}AGGATTTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGCACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCCGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCAACAGAATTCTACAGGATCTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTC{AG}ACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCC{AG}GTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAATTGCTCTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCCACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTACTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCAAT---------GATGAGTACCAGTATATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTGATGTAGTTCATAGCCGGGGGAAAAGTATGAGTGTCCTGTTTGGAGGAAGATCATATACTCCTCTCGCACAAAGAACCACTGAAAAATGGAACAGCGTGGTTGACTGTTTGCCATCTGTGTTTCTCATCGATTTTGAGTTTGGATGCAGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCCTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCTAACTTGTACAAGCTAAAAATTGACCTCCCACTGGGCAGCCCAGCTGTGAGCTGCACCATCCTGCCTGGG{AG}GGATATCAGTGTCAAGTGCTATCGTGACTCAGATCAGTGATACTGAATTTGTCCTGGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTTTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGGATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGA{AG}CAGAAGAGGACAAGGAAGAAGAACTGACAACACAAATTTGCAGTCAGACGTCCAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATGGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACAGGCTACTGGATCACCTGCTCTGCC Ptiloris_magnificus TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCTGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAAT---AGAGCTCATCAAAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTCCAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCGAACTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCGAAGTGTACAAC{AG}TGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTGTCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACTTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCC{AC}TTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTGAAAGAGTC{CG}TGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGTACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGA{AG}TTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGAC{AG}GCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGC{AG}GAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAACGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCCCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTACATCATACATCCTTCCAGAACTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGCGTGTAACACCATAGTTCTAGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGGACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCGGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Ptilorrhoa_caerulescens TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAAAAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTTGCAGGCAATAAG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAACCCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCACGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACTTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATCGAAAAATCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAA{CT}GTGGCAAACGTGTCAAAACCACTGGGGAACGTGCCCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCACGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAGCATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAACGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAGATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGTCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAATCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTGAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCTCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTAGAGGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTCAAAGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAACTCATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTATTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTC{CT}AAAGACTCGTGTTACCTTCCCCCTCTCCGGTACCCTGCTGTTTGCACACTCAGAAGCGCTGCAAAGGCTAATGAGTACCAGTATATCATCCACGGTGGCAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGGACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAGGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCCTGCCAGGGGGGATATCGGTGTCAAGTGCAATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCCTAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCC{AG}GAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTATATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGATTCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGA{AG}GAGTTTTGTTTTAGTGCTGAAGCCAATGGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACTGGCTACTGGATCACCTGCTCTGCT Pycnonotus_barbatus CAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGACTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCGTAAAGATGAAGCGGTAC{CT}AAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGAACTTGAGGAAGACGCCCAT---------GCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACAATCTGAAGGAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTCCATGGACCAGTAGATGATGAAACTCTGTCACTTTTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGAT{CG}TTATTGCTAAGGTTTTCAAGATTGATCTGCGAGGGGATGTCGATACTATCCATCCCACT{AC}GATTTTGTCACAACTGCTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAACCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTCAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCACTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGGACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGAGTATAAAATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACGGCCAACACCTCTCTAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAACACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGACTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCCGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTCCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTACTACCAGGTTACCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCGCTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCGGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAGAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTCTCCTTCACAGTCATGAACATTTCTATAGCATGTGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGAGAGGCATCCTGAGAACATTTA{AG}ATTTGTCTTCAGGGGTACAGGATATGATGAAAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTTGTGTGATGCCACCCGTTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGAGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAATGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCGTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTGCTTGATATAAAGCCGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGTGATGCAGGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAATGCATTGAGAAAGACCTAGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCA{CT}AGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGACACTTGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTTCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACCATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTAGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTGGCATGTAACACCATAGTTGTGGAAGATGATAAGATAGAGATTGTTGAAAGT{AG}TGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGCAAAGGATCTGTTTTGCTGGGCCTTCCAGGGGCCAACAAACAAGTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGACCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGAAGACTCTGCTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCAGAAGCCAGTAGCTTTGATGCTGACAATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Regulus_calendula TAAATTACGATCATTTGAAAAAACACACTCTGATGACAGCCAGAACATAAACAAA{GT}ATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGGAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAGGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCC{CT}GATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCCAGCTGTGACGTGTGCCATACTACCAGAC{AG}AGGAGTCAAGAGAAAAAGTCAGCCCCC{AG}AGAGTACTACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGGGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATAGACATCTAAACACCAAGCTGCTTGCAGTAGATTACCCAGTAGATTTCATTAAATCTGTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGATTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTCCTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTC{AG}ATAACCTGATTAT{AT}AGATGCCCTGTAAAAGAGTGTGATGAGGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACC{AG}AGGCAGCATCTCCTGTCTTTGAC{AC}AGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCTCTGGGAGACAAATCTTCCAGCCTTTGCATGCTCTTCGCACTGCCGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCAATAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACTGTCATGAACATTTCTATAGCACATGGGAGTGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAAGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTCAAAATCTGGAGCGATATGAAATGTGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTCTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAAATTGGTGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAAAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAGGAACTAATGGACCTTTATCTGAATATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGATGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCAGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGAAGAATGAGCTCAAGATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTGTTTGCACGCTCAGAAGTGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAATCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGGTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGTGGCCACTCACTTCAGAATAACACCAGACCCTCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGC{AG}AGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTATCACTCAGACAACCAGAAACGGCTGGCCTGTAACACCATCGTTCTGGAAGATGGTAAGATAGAGATTG{CT}TGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATAGCAGAATGTGGTTTGGCTGTGATATAGG{CT}AAAGGGTC{GT}GTTTTGCTGGGCATTCCAGGGGCCAACAAGCAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGAAAGAAGAATTAATAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGG{AG}GACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGCTACTGGATCACCTGCTGTGCC Regulus_satrapa TAAATTGCGATCATTTGAAAAAACAC{CT}{CG}TCTGATGACAACCAGAACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAGGAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAAAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCCGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAACTGCTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCCAGCTGTGACGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGAGTACTATGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAGAGAGATTGTCAATTGCAAGGATAGACATCTAAACACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCTGTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTCGATAACCTGATTATAAGATGTCCTGTAAAAGAGTGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTA{CT}GTAAATAAAGGTGGCCGACCGAGGCAGCACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTTAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGACAAATCTTCCAGCCTTTGCACACTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTAGGAATTATAGATGGACTATCAGGACT{AG}CCACTCTCAATTGATGATTACCCAGTAGACACAATTGCCAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGAGTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCCATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTTATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAGGTGGAAGGGCTGGAAGCTTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAACCATGCTCAAAATCTGGAGCGATACGAAATGTGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTC{AG}GCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCACTGCATTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCATCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCTCTAAAGGAACTAATGGACCTTTATCTGAATATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAAGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAATTCAAATACAGATATGATGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAGATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTGTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATAAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTCGTCGACTGTTTGCCATCCGTGGTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGGGGCCACTCACTTCAAAATAACACCAGACCCTCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGC{AT}GCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAAC{AG}GCTGACCTGTAACACCGTCGTTCTGAAAGATGGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACATAGCAGAATGTGGTTTGGCTGTGATATAGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAGCAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACATAAAAGAAGAATTAGTAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAACAGCTTTGATGCTGA{CT}GATGCTGATACTTACAATGAAGATGATGAAGAAG??GAGTCGGAAACAGGCTACTGGAT?ACCTGCTGT--- Remiz_pendulinus TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGACAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTACT------------------------------------------------------------TCAAAGAAAGAATTTATCCTGCATCAAGATGAAGCAGTGCCTAGAGGAGAAAAG---------------AGGGAGTTAATGGGCAACAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAACTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAATTTCATTTAAAACTGATTGTTTCAAAAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGCCTTCTGAGAAAGAAAGAAAAGACAGCAACTTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATGTTCTATGTGAAGTATATTTTCCTAGGAGCAGCACAATGGAGTGGCAACCCCATTTCCCAAACTGTGATGTGTGCCACATTACCAGACAAGGAGTCAAGAGAAAAAGCCAGCCTCCAAGTGTACAGCATGGCAAACATATCAAAACCACCAGGGAACGTGCTCGGCTAATCAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAGTGAAAGAGATTGTCAGTTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAATAGACTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGAGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAATCTGACTATAAGATGCCCTGTAAAAGAATGTGATGAAGAGATCTTACATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGGGAGCTCTATAACTACATCAATAAAGGTGGCCGACCAAGGCAACACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACATCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCTTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGAACTGGACTTCACCCGGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGTTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGGTCTTCCAGCCTCTGCATGCCCTTCGCACTGCAGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATCGATGGACTATCAGGACTGGCTCTCTCAATTGATGATTACCCAGTCAACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTAGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCCAAAAACCTGGACGACTATCTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGGATGGGTGATGTCAGTGA{AG}AAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAACCCAATTCAGAGCTGTGCTGTAAGCCTTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTTAGCTTTGCCTTTAGGGGTACAGGATACGACGAGAAACTCATGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGCGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTCTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCGACAGAATTCTACAAGATTTTCCTGATGGAGGTTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGACGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAAGAATGCCCAGAACTGCTGTGTCAGTACAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCCCATGTTCCTGAAATAATTGAACGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCC{CT}CCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTATTCTCTAAAGACTCATGTTACCTTCCCCCTCTTCGCTACCCTGCACTTTGCGTGCTCAGAAGGGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACATTCCAATGCACTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATGCTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTGCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCTAGAGATGATACTGTTTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAATTTTTACAAGCTAAAAATTGATCTGCCCCTAGGCAGCCCATCTGTGACCTGCACCATCCTTCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTATCACTCAGACAGCCAGAAACGGCTGGCATGTAACACCATTGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGTCAGCAAACAAATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAACAGAAGAGGACAAGGAAGAAGAACTGATAACACAAATTTGCAGTCAGACATCAAGGGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATATGTACAATGAAGATGATGAAGGAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Rhipidura_hyperthra TAAATTGCGATCATTTGAAAAAACACCTCTGGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACAGGCAGTAGG---CAGGGACCTGAGGAAGATGCCCAT---------GCCA{CT}GCAAACACAAGCCAAT---AGAGCTCATCAGAACAACTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTATGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAGTTTTGTCACAAGTGTCGGAGTATTATACATAGAAAATTCAGTAATACT{CT}TGTGTGAAATATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCACACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAAC{AG}TGTGAAAACCACTGGGGAACGTGCTCGGCTGAACAGAGATGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAGGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCATGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATTCTTAAATGTATCAGGGTTATGGGCAGCTATTGTCCCTCCTGCTGGTATCCTTGCTTTCCTACTGA{CT}CTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGCGTATGAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTCCATCCTGCTGTCTGTCTGGCCATCAGAATCAACAC{AG}TTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCGGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAGCCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCTTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCCGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCTTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAACCTGGAGCGATATGAAATATGGAGGTCCAACCCCTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCACTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCGGTATGTGAATTAATAAAGTGTGA{AG}GAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCTATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCTAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCCAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGTGGCCACTCACTTCAAAATAATACCAGGTCCCCCAACCTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGAGGGGTATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGG{CT}TGGTGTGTAACACCATAGTTCTGGAAGAGAATAAGATAGAAATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAGGGATCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAACTGAGCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCAC{AG}CCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Rupicola_rupicola TAAAGTGCGATCATTTGAAAAAATGCCCTCTGATGACACGCAGCACATAAACAAAGATCAGGCAGAAGGGATTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATGCTGCATAAAGATAAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAAAGGGCAATAGG---CAAGCACTTGAGAAAGAGGCCCGT---------GACATGAAAACACAAGACAAT---AGAGCTCATCAGAACAA{CT}CTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTCATCCAGTGCATGGACCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACTTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCATCAAGTGTACAACAAGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAGCAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAACATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGGCACTTGTTTTGCAGAACTTGCATTCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGCTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTCAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAATCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTAAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTAGGAATTATAGACGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGATACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAAGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTTTAACAGCAATCTTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAGAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCAGCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATTTGGTCTTTCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTAAGGAAAGGCATGAAGCTCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCGGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGGGCCTGGGCAAGTGAAGGAAATGAATCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCTAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGACATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCAATGCAAAATCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAATAGCAAGAAAATTATATTCCAATGCATTGAGAAAGACGTGGGTGGGGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGC{AG}TAGTCGACTGTTTGCCATTTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGATTGGTGTGTAATACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATATCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAGGGAAGAAGAATTGACAACACAAACTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTACATTCGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGACACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTATTGGATCACCTGCTGTGCC Schiffornis_turdinus TAAAGTGCGATCATTTGAAAAAACATCCTCTGATGACAGGCAGCACATAAACAAAGATCAGGCAAAAGGGATTACTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATAAAGCAGTGTCAAGAGAAGACAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCTGT---------GACATGAAAACACGAGACAAT---AGAACTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTCATCCTGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGACCTTATCGCTAAGGTTTTCAAGATTGATGTGCGGGGAGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATAATCTATGTGAAGTATATTTTCCTAGGAACAACACCATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATACTACCAGTCGAGGGGTCAAGCGGAAAAGCCAGCCACAAAGTGTACAACAAGGCAAACGCGTGAAGACCATTGTGGAACGTGCTCGACTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATTCTTAAGTGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACCGATCTTGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAGCCTTGGTATAAGATGCCCTGTCAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTTAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAGGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTAAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTAC{AC}CAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTCAGAGTTGTGTTGCAA{AG}CCCTTGTGTCTTATGCTGGCTGATGAATCGGATCATGAAACTCTAACGGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTAGAGGCATCCCAGAATTTGGTTTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTTCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGATAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAATAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTATCCTGCTCTTTGCATACTCAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCCGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAATAGCAAGAAAATGACGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATCGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACCGAATTTGTCCTTGTTGGTGGCTACCACGCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAAGTTGTTGAAAGGGAGAGCCCACAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGTTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGACGAATCAGAAACAGGTTACTGGATCACCTGCTGTGCC Scytalopus_magellanicus TAAACTGCGACCATTTGAAAAAACACCCTCTGATGACAGGCAGCAAAAAACCAAAGATCAGGCAGAAGCAGATGCTTTT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGGAGAG---------------ACAGAGTTAATGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCCAT---------GACATGAAAACGCAAGACAAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGACTGTTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATGCATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCTCACTCCCCAAACTGTGCTGTATGCCACACTATCACTCGAAGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAACATGGCAAACGTGTGAAGACCATTGTGGAATGTGCTCGACTAAACAGAAGTGTAAAGAACCAA------------GCACAGATGAACAACAAAAATTTAATGAAAGAGGTTGTCAATTGCAAGAATACACATCTCAGCACCAACCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTAGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACCCCAGTGAAATCCTTTCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACATCTCCAGCCATGAGGAGATGAAAGATAGAGAGTTCTATAGCTACACAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTGGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAACTGGAGGCTATAATGCAAGGAAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTACAGAACTGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGATTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAAATCTTGGAAGGCATGAATGCAAAAAATCTGGACGACTATTTGAATGGTCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCACGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAGCATTGCTATTGCACATGGGAATGAAAGCAAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTGTGCCTGATGCTGGCAGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAAGCTATGAAAAACAGTGAACTGCTGCTTGAGATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAGGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCGTATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGCGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGCGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACTCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCTGGAAACAAATTGTTTAGGAGGTTCCGAAAAATGAA{CT}GCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTCTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAAGTCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACATTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATTATGTTCCGCTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGACATACAATTAATGTCGTTCATAGCCAGGGCAAAAGCATGAGTGTAATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATCACCAGAGGTGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGTTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGCGGGATATCAGTGTCAAGTGCTATAGTGACTCAAACCGGTGATACTGAATTTGTCCTTGTCGGAGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGGGCGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCGGTGATATGGGCAATGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATACCGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Sitta_carolinensis TAAATTGCGATCATTTGAAAAAACACCCTCGGATGACAGCCAGCACATAAACAAAGATCAGACAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAGGAATTCATCCTGCACACAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------GTGGAGTTAGCAGGGAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGGCAAC---AGAGCTCATCTGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGCTGCATTTAAAACTGATTGCCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCGACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGACACCATCCATCCCACCCGGTTCTGTCACAACTGTTGGAGTATTATACAGAGAAAATTCAGTAATACTCTCTGTGAGGTATACTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGGTGTGTGCCATACTACCAGCCAAGGAGTCAAGAGAAAAAGCCAGCTCCCAGGTGCACATCGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAGCTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTACATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCATAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACGCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATCAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGGAAATATGGCCAACACGTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTGTAGCTACATAAATAAAGGTGGCCGGCCGAGGCAGCACCTGCTGTCTTTGACAAGGAGAGCTCAGAAACACCGTCTGAGGGAACTGAAACGCCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCCAAAAATGAGCACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCACCCTGCTGTCTGCCTGGCCATCCGAATCAACACGTTCCTCAGCTGTAGTCAGTACCATAAAATGTACAGAACAGTGAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCCCTCCGCACTGCTGAGAAAGCCCTCCTACCTGGTTATCACCCATTCGAGTGGAAACCCCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGGCTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGCTACGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGAGGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGGATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACGGTCATGAACATTTCTGTAGCACATGGCAGTGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAGACCCTGACAGCAATCCTGAGCCCCCTCATAGCAGAGAGAGAGGCGATGAAAAGCAGCGAGCTGCTGCTCGAAATGGGAGGCATCCTGAGAACATTCAGATTCGTCTTCAGGGGGACAGGATATGATGAGAAACTGGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTCGGAGGCATCCCAGAACCTGGTCTTCCACTCCATCACCAGGAGCCATGCTGAGAATCTGGAACGATACGAGATATGGAGGTCGAACCCATACCACGAGTCTGTTGATGAGCTCCGGGACAGAGTGAAGGGTGTTTCAGCCAAGCCTTTCATTGAGACTGTCCCCTCCATAGATGCACTGCACTGCGACATTGGCAACGCGACAGAGTTCTACAGGATCTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCCGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCCAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGCTCCTCGTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTACAGCTACAATTCCCAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAATACAGATATGAGGGCAAGATCACAAATTACTTCCATAAAACCCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGCTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTCAGAAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCCTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTCCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCCGAGGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACCAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAATTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGGTGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCGCTTGAAAATAACACCAGGTCCCCCAACTTGTTCAAGCTAAAAATCGACCTGCCCCTGGGCAGCCCGGCTGTGAGCTGCACCATCCTGCCAGGGGGGATATCAGTGTCGAGTGCCATAGTGACCCAGATCAGCGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAACCAGAAACGGCTGTCCTGCAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTAGAAAGTGTGAGCCCAGAGTGGACACCAGACATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGCAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAACCCCAGACGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAGCTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACCCCTTTTGAAGATTCAGAGGAGTTCTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTGCC Smithornis_rufolateralis TAAAGTGCGAACATTTGAAAAAACACCCTCTGATGGCAAGCAGCACATAAACAAAGATCAGGCAGATGAGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCAATAGGCAACAAG---CAGGCACTTGAGAAAGTTACTGAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGGAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGAACTTATTGTTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCCTTGTGAAGTATATTTTCCTAGAAACAGCACAATGGAGTGGCAACCTCACTCCTCAAACTGTGATGTATGCCATACTACCAGTCGAGGAGTCAAGAGAAAAAGCCAGCCACCAAGCGTACAACATGGAAAACGTGTGAAGACCATTGTTGAACGTGCTCGATTAAACAGAGGTGTAAATAACCAA------------GCACAAATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAACATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAAAACTTGCATCCTTAAATGTATCAAAGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACTCCAGTTAAGTCATTCCTGAACATCCTTGATAATCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCCTACATGAAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGATATATAGCCACATAAATAAAGGTGGCCGACCAAGGCAACATCTTCTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAGTTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTAGCAATCCGAGTCAATACATTTCTCAGCTGTAGTCAGTACCATAAGATGTATAGGACCGTAAAAGCTGTCACTGGGAGACAGATCTTTCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTCGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAGTTGATGACTACCCAATAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAACAATCTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTTACAGTTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAAGAAGTAAAGCCCAATTCAGAG{CT}TGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGCACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTATAGGATTTTCCAGATGGAGATTGGTGAGCTTTACAAGAATCCTGA{CT}GTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTGGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAGGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTCAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATA{CT}GAAGGCAAGATTACAAACTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAATCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGACGGAGCTCAAAATGAAACCTGCCTTCTTCTCCAAAGACTCATGTTACCTTCCCCC{CT}CTCCGCTACCCTGCTCTTTGCGTGCTCAGAAGCAATGCAAAATCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGATCTCTCTGATAAGATTTATTTAATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATGTTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCCCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTACCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCGAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGCGGGATATCAGTGTCAAGTGCTATAGTGTCTCAAATCAGTGATACTGAATTTGTCCTTGTTGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTATATTGTTGGGCATTCCAGGGGCAAACAAACAGTTAATCTCAGATGCAAACTACTTCTACGTTTTGAAATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTG{AG}CAACACAAATGTGCAGTCAGACATCAACTGAAGACCCT{CG}{GT}AGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTCTTCC Sphecotheres_viridis TAAAGTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCACCACATAAACAAAGATCAGGCAGAAGAGGCTGTTGCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACGCAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCGTACTAGCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCC{CT}AAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGA{AG}ATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGGACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTA{AG}CCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGA{GT}ATCTTGCATGGAAAATATGGCCAACACCTCTCCGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGA{AG}GGTGGTGATATAAAGGCTGTATGCATGACTTTATTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCT{AG}GCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCACGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACCGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCCTGTGCCTTATGCTGGCTGACGAATCAGACCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTAGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCC{AG}TATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATCGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAAGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCCTGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTACTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGGAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCA{CG}GCTCAGAAATGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAG{AG}TTTACTTTATGAGTCTGGTAAACAAAGCTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATACGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGGTGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACTTATACAAGCTAAAAATTGATCTTCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACTCAGATCAGTGATACTGAATTTATCCTTGTCGGTGGTTACCACTCTGACAGCCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAATCT{AG}GAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTA{CT}ATTTTGAGCTGCAAAGGAGCAGAAGAGGACGAGGAAGAAGAATC{AG}CTAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTGCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAAC{AG}GGCTACTGGATCACCTGCTGTGCC Strepera_graculina TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAAGAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGAGCAATAGG---CAGGGACTTGAGGAAGATG{CT}CCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGT{CT}GATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGAAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACGACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCTA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCCGTTGATTACCCAGTGGATTTCATGAAATCCATTTCTTGTCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTACTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCGGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGTGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAAGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACACGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAGCTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGAATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGACTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGAC{AC}TTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGAAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCATGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATAAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAACTGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCGGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGTAGAATGTGGTTTGGCTCTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCGAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACCCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Struthidea_cinerea TAAATTGCGATCATTTGAAAAACCACCCTCTGATGACAGCCGGCACATAAATAAAGATCAGGCAGAAGAGTCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAATGATGAAGCAGTGCCAAGAGGAGAAAAT---------------ATGGAGTTAA{CT}GGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAA---------GCCATGCAAACAAAAGACAAT---AGAGCTCATCAGAACAATTTGAAGGAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGCATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAACTGTGCTGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAAATAAACAACAAAAA?TTAATGAAGGAGATTATCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTCGCAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTCTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCGGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCC{CT}GCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACC{CT}GCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCCTGAAAGCAAAAAACCTGGATGACTACTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGAAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGCAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGCTGACTCTTGACAAACACCTCAGAAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGGAATTTTGCTAGAAAGCTCATGTCCAA{AG}GAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGA{AC}AGGCATGAAGCCCTAAAAGA{AG}CTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCACGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGG{CT}AAGATTACGAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTATCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAAGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAGAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTGGTTGACTGTGTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGTTGTAC{CT}TCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGCGGCCACTCACTCCAAAATAACACCAGGTCCCCCAACTTGTACAAGGTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACCCAGATCAGTGATACTGAATTCGTCCTTGTCGGTGGCTACCACTCGGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAAC{AG}TGGTTTGGCTGTGATATGGGTAAAGGATCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAATTAAGCCCAGATGCAAACTACTTTTACATTTTGAGGTGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCAATAACACAGATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCGGAAACGGGCTACTGGATCACCTGCTGTGCC Sturnus_vulgaris TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACGAAGAATTCATTCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTCAACAAGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCTGTGAAAATACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACAATCCATCCCACTCAATTCTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGG{AC}AACCCCATTCCCCAAACTGTGA{CT}GTGTGCCATACTACCAGAA{AG}AGGAGTCAAGAGAAAAAGCCAGCCTCCAA{AG}TGTACAACGTGGCAAACGTGCCAAAACCACCAGGGAACATGCTCAGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTGGCGGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCGGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCT{CT}GATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGAGGGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAGGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTGGCTCTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCCGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCTTTGCATGCCCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAATCCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAGTTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGTATGAAAGCAAAAAACCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATCTCTATAACACATGGGAACGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGGTATGAAATATGGAGGTCCAACCCCTACCACGAGTCTGTGGATGAGCTCCGTCACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGGGAACTTTACAAGAATCCTGACGTGTCTAAGGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACATGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTCCCCGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAACGAGTCTGGAAACAAACTGTTCAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGCTGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCAGGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAAATTTACTTTATGAGTCTGGTAAACAAAGCTAGCAAGAAAATGACATTCCAGTGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCACACAATTAATGTAGTTCATAGCC{AG}GGGAAAAAGCGTGACTGTTCT{CG}TTTGGAGGGAGGTCATATACTCCTCTTGCTCAGAGAACCACTGAAAAATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACCTGCTTCCAGAGCTTCAAGATGGACTTTC{CT}TTCCACGTTTCAATTGCCA{AG}AGGTGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCTCCCAACTTGTACAAGATAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCGTCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACATTGAATTTGTCCTTGTCGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCGGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGTTGTGATATGGGTAAGGGGTCTGTTCTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAATGGCCAGAAGAGGACAAGGAAGAAGAATTGATAACACAGACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCT Sylvia_nana TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACCTAAACAAGGATCAGGCAGAAGAGGCAGTTTCT------------------------------------------------------------TCAAACAAAGAAGTCATCCTGCGTAAAGATGAAGCAGTGCCAAGAGGAGA{AG}AAG---------------ATAGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCAATGAAAACACAAGAAAAT---AGAGCTCATCAGAACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTAACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTAT{CT}GCCAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAATAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTGTCAATTGCAAGGATATCCACCTCAGCACCAAACTTCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATCTCCTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACGTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGTTTTCCTACTGATCTAGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATACGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATGGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAGGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCT{AG}GCTTTGAGAGCCAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACATTTCTCAGTTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGT{AC}TCTGGGAGGCAGATCTTCCAGCCTTTGCA{CT}GCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAAGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAGCCTGGATGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTTATGCTGGCTGATGAATCTGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCTT{AG}TGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTCGATGAGCTTCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCTACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTAATGGACCTTTATTTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCCCAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCTTGCCCCACTGGGGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCACCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCGCCCTCAGAAGCGATGCAAACGCTGACGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGAACTTTCTGATAAGGTTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCA{AG}TGCATTGAGAAAGACCTGGGTGGAGATATCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGATGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTCGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTGTCAATTGCCAGAGATGATACAATCTATATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAGTTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGAGAACCAGAAACGGCTGGCATGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGACCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATGCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGGTGACGATGCTGATACTTACAATGAAGATGATGAAGAGGACGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Telophorus_dohertyi TAAATTGCGATCATTTGAAAAAACACCCTCTAATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATAGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAATAACTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCTCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAGAAGAGGTATAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATAGATTTCATTAAATCCATTTCTTGTCAGATTTGCGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGGCACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGTTACTGCCCGTCCTGCTGGTATCCTTGCTTTCCTACTGATTTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGGTGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGGGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTAAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATAAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTATCACCCATTTGAATGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCGCTCTCAATTGATGACTACCCTGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCC{GT}TAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAACGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGCGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACAGGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATACTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGC{AG}TCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAACGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTCTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTACCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGTCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGACGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTTTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCCCTTAGCACGCTCAGAAGCCATGAAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATGTACTTTATAAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCCAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGCATGAGTGTTCTTTTTGGAGGGAGGTCGTATACGCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGCTTGCCATCTGTATTTCTCATTGATTTTGAGTTTGGATGCTGTACGTCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGATCCCCCAACCTGTACAAGCTAAAAATCGATCTGCCCCTGGGCATCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGCATATCGGTGTCAAGTGCTATAGTGAGCCAGATCAGTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCCGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGTCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACACTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Thamnophilus_nigrocinereus TAAAGTGCGATCATTTGAAAAAACACCCTCGGGTGACAGGCAGCGCATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCACACAGATGAAGAAGTGCCAAGAAGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGCCCTTGAGAAAGAGGCCCAT---------GAC---------------AAT---AGAGCTCATCAGAACAATCTGAAACAACTTTGCCGCATTTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTCATCCAGTGCATGGGCCGGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATCGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATTCAGTAATACTCTAGGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAGCCTCACTCCCCAAACTGTGATGTATGCCATACTACCACTCGAGGGGTCAAGAGAAAAAGCCAGCCACCAAGTGTACAGCATGGCAAACATGCGAAGACCGTTGTGGAACGTGCTCGACTAAACAGAGGTGTGAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATACACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAATTGATTTCATTAAATCAATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGGACTTGCATCCTTAAATGTATCAAGCTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTGACACCAGTAAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCTTGGAAAATATGGCCAACACATCTCCAGCCACAAAGAGAAGAAAGACAGAGAGCTCTACAGCCACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAGGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTGAGAGCGAAAAATGAACACAAACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACATTTCTCAGCTGTAGCCAGTATCATAAAATGTACAGAACTGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGCTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTGGGAATTATAGATGGATTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTAGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAGGAGTCTTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCATTCACAGTTATGAACATCGCTATTGCAAATGGGAATGAAAGCCAGAGAATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGTTGCAAACCCTTATGCCTTATGCTGGCTGATGAGTCAGATCATGAAACTCTGACAGCAATCCTGAGCCCACTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTATTGCTTGAAATAGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGGTATGATGAAAAACTTGTACGGGAAGTGGAAGGGCTAGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACAAGGAGCCATGCTGAAAATCTGGAACGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAGCAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAGGATGACTGGAAATTTTGCTAGAAAGCTTATGTCCAAAGAGACAGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCTTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAATGCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTTGATATAAAGCAGAATGAGCTCAAAATGAAGCCTGCCTTCTTCTCCAAAGACTCATGTTATCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAACATAAAGTCTGATGAATACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTATTTTATGAGTCTGGTAAGCAAAAATAGCAAGAAAATGATTGTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAGTGTAGTGCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTACACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACGTAGTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATGTTGCCAGGGGGAATATCAGTGTCAAGTGCTATAGTGACCCAAATCGGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGGGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAGGGATCTGTATTGCTGGGGATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCATACTACTTCTACATTTTGAGATGCAAAGAAGCAGAAGAGGACAAGGAAGAAGAGTTGACAACACAAATCTGCAGTCAGACATCAAGCGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAATTTTGGTTTGGTGCTGAAGCCAATAGCTTTGACATTGATGATAATGACACTTATAATGAGGATGATGAAGACGATGAATCAGAAACGGGCTACTGGATCACCTGCTCTGCC Thraupis_cyanocephala TAAATTGCGATCACTTGAAAAAACAGCCTCTGATGACAGCCAGCACATACACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAAATCATCCCGCATGAAGATGAAGCAATGCCAAGAGGAGAAAAG---------------ATGCAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGTTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGGGTTTCATTTAAAACTGATTGTTCCAAGAGAACTTACCCAGTGCATGGGCCAGTGGACGATGAAACCCTTTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCCAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGACACTATCCATCCCACTCAATTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTGATGTCTGCCATACTACTAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTCTGCAACGTGGCAAACGTGTCAAAACCACTGGAGAACGTGCTCAGCTAAACAGAGGTGTAAAGAA{CT}CAACATCTCAAACAAGCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGTAGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTATTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAAACCTTCCTGAACATCCTTGATAATCTGAATATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTCACACGGAAAATATGGCCAACACCTTTCTGGCCACAGGGAGATGAAAGAAGGAGAGCTCTATAGCTACATCAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGC{CT}CAGAAACATCGTCTGAGGGAGCTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTCCTAGCTTTGAGAGCAAAAAATGAGCACAAACAAGCGGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTATGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAACCTTTGCATGCTCTTCGCACTGC{CT}GAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGATTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGTTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGTACAGGATATGATGAGAAACTCTTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCCAGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCGGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTAACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGCTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATTAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCCGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTTCAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGGGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAGGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTTCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGTCTTCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGTTTGCTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGCGGAGATGTGCCTGAAGCTAGGTATGGACATACAATTAACGTAGTTCACAGCCGGGGAAGAAGCATGAGTGTTCTGTTTGGAGGGAGGTCATATACTCCTCTTACACAGAGAACCACTGAAACATGGAACAGTGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAATTTGGATGCTGTACATCATATATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGCCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGTCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTTGTCGGTGGCTACCTCTCAGACAACCAGAAACGGCTGGCATGTCACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAATGTGGGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAACTGACAACACAAACTTGCAGTCAGACATCAAGTGAAGAGCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAGTCAGAAACAGGTTACTGGATCACCTGCTGTGCC Tityra_semifasciata TAAAGTGCGATCATTTGAAAAAACACCCTCTGATGACAGGCAGCACATAAACAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATAGTGCATAAAGATAAAGCAGTGTCAAGAGAAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGCACTTGAGAAAGAGGCCCCT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCTACAAGAGAACTCATCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAAAAAAAAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAGTACAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAACCTCACTCCCCAAACTGTGATGTATGCCATAC{CT}ACCAGTCGAGGGGTCAAGAGAAAAAGCCAGCCACCA{AG}CTGTACAACAAGGCAAACGTGTGAAGACCATTGTGGAACGTGCTCGACTAAATAAAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAACTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAACCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATTCTTGATAGCCTGGGTATAAGATGCCCC{AG}TCAAAGAATGTGATGAAGAGATTTTGCATGGAAAATACGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAAAGAG{CG}TCTATAGCTACATAAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTTAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAATGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTCAACACGTTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAAC{CT}GTAAAAGCTGTCAGTGGGAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTCTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTTGACGACTATTTGAATGGTCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTTATGAACATTGCTATAACACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCAAATTC{AG}GAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCGGATCATGAAACTCTAACGGCAATCCTGAGTCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCGGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTAGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCTAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAATTTGAAACCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAATTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGACAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTTTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACTCAGAAGCAATGCGAAGTCTGATGAGTACCAGTATGTCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAATAGCAAGAAAATGACGGTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTATATTTGGAGGGAGATCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCATAGTCGACTGTTTGCCATCTGTGTTTCTTGTGGATTTTGAATTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACGATCTACATTTTGGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACTTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGC{AT}ATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTG{GT}T{AG}TGTAACACCATAGTTCTGAAGGAGAGTAAGATAGAGGTTGTTGAAAGGGAGAGCCCTGAGTGGACACCAGATATTAAACACTGCAGAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTC{AC}ACTTGAAGATTC{AG}GAGGAGTTTTGTTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTACAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Toxorhamphus_novaeguineae TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATCAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAA---GATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACAGTGGGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAAGATCGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATCATACATAGAAAATTCAGCAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGGGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAG------------GCACAGATAAACAACAAAAATCTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACTAAGCTGCTTGCAGTTGATTACCCAGTAGATTTCATTAAATCCCTTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCTGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTTGTATCCTTGCTTTCCTACTGATCTGGTCACCCCAGTGAAATCCTTCCTGAATATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGACAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGCGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAGCTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGTGCTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACCAACACAGAAGTGGGAATTATAGATGGGCTATCCGGACTACCACTCTCAATCGATGACTACCCAGTGGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAAGAGATCTTGGAAGGCATGAAAGCACAAAACCTGGACGATTATTTGAACGGCCCCTTCACTGTGGTACTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTGTAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATACGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGA{AG}GCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCACGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGACGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTGTGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCACTAAAAGAACTAATGGACCTTTATCTGAAGATGAAACCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAAGATGTCTTGAGATCCTGCCCCAATGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGTGATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATAAGCCTGGTAAGCAAAACTAGCAAGAAAATTAC{AG}TTCCAATGCATTGAGAAGGACTTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGGAAAAGTGTGAGTGTTCTATTTGGAGGGAGGTCGTACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTTGTTGACTGTTTGCCATCTGTGTTCCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCCGTGACCTGCACCATCCTGCCAGGGGGGAAATCGGTGTCAAGTGCTATAGTGACCCAGGTCAGTGATACTGAATTCGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGCTTGGTGTGTAACACCATCATTCTGGAAGATGGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGGTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCTGGGGCCAGCAAACAATTAATCCCAGATGCAAACTACTTCTACATCTTGAGATGCAAAGGAGCAGAGGACGACAAGGAAGAAGAATTGATAACACAAATTTGCA{GT}TCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAGCAGCTTTGACGTTGATGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Tregellasia_leucops TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGTACATTAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCGTCCTGCATAAAGATGAGGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAATGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAATAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTCAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACCCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAGTTCAGTAATACTCTGTGTGAAGTGTATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCACTCCCCAAACTGTGAGGTGTGCAACACTACCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTCCAACATGGCAAACGTGTCAAAACCACCGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACAAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGACATACATCTCAGCACCAAGCTGCTTGCAGTTGACTACCCAGTAGACTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACCTGCATCTTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACACCAGTGAAATCCTTCCTGAACATCCTTGATAACTTGACTATAAGATGTCCTGTAAAGGAATGTGATGAAGAGATCCTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATGGAGAGGTCTACAGTTACATAAATAAAGGTGGCCGACCAAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCTCAGAAGCATCGCCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTTCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAAGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAACGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGATATGGAAGAGGAAATCTTGGAAGGCATGAAATTAAGAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAATTGCTGCTTGAAATGGGAGGCATCCTGAGAACGTTCAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTCTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGAAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTCATTGAGACTGTTCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAAGATCTTCCAGATGGAGATTGGTGAACTCTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAG{AG}TGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGACATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAAC{AG}CTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTGAAAATGAAACCTGCTTGCTTCTCCAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGCCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTTCCTGAAGCTAGGTATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTTTATTTGGAGGGAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTTTTTCTTATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGACTTTCGTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCCTGGGAGGCCACTCACTTCAAAATAACACCAGATGCCCCAGCTTGTACAAGCTGAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGCGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCAGGAGCCAACAAACAAATAACCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATAACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCAGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC Troglodytes_aedon TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCACACAAGGAATTCATCCTGCAA---GATGAAGCAGTGCCAAGAGGAGAAAAG---------------{AG}TG{AG}AGTTAACAGGCAACAGG---CAGGGGCTAGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGGACAATCTGAAGCAACTCTGTCGCATCTGTGGAGTTTCATTTAAAACTGATTGCCACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAAC{CT}TCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATTGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAATTTTGTCACAATTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCTATGTGAAGTATATTTTCCCAGGAACAGCACAATGGAGTGGCAACCCCATTCCCCAAACTGTAATGTGTGCCATACTACTAGACGAGGAGTCAAGAGAAAAAGCCAGCCTGCAA{AG}TGTTCAACGTGGCAAACGTGTCAAAACCACTGTG------------TTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAA{CT}AAA{AC}ATTTAATGAAAGAGATTGTCAGTTGCAAGGATGTACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACGGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGCGATGAAGAGATTTTGCATGGAAAATATGGTCAACACCTCTCTGGTCACAAGGAGA{CG}AAAAGATGGAGAGCTCTATAGCTACATAAACAAAGGTGGCCGACCGAGGCTGCACCTCTTGTCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAA{AG}GCTTTTGCTGAGAAAGAAGAGGG{CT}GGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAAGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCGGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTA{CT}AGGACAGTAAAAGCTGTCACGGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACC{AG}GGTTATCACCCGTTTGAATGGAAACCTCCCCTGAAAAATGTATCCACTAACAC{CT}GAAGTGGGAATTATAGATGGACTATCAGGACTGCCGCACTCAATCGATGATTACCCAGTAGAAACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAA{CT}CTGGATGACTATTTGAATGGTCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCCGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAGCACGAGGATCTTTGAGGAGGTAAAGCCCAATTCAGAGTTGTGCTGTAAACCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCC{CT}CTCATAGCAGAAAGAGAGGCTATGAAAAGCAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCGTCTTTAGGGGCACAGGATATGATGAGAAACTTCTGCGGGAAGTGGAAGGGCTGGAGGCCGCAGGTTCCACCTACATTTGTACCTTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATACCACGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTTTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACACTTGCTCATGTCCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAACTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTGAGCAAAAGCAGCAAGAAAATGACATTCCAATGCATTGAGAAAGACCTTGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACGATTAATGTAGTTCATAGCCGAGGAAAAAGCATGAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAGAAATGGAACAGCGTAGTCGACTGTTTGCCATCTGTGTTTCTCATTGATGTTGAGTTTGGGTGCTGTACATCGTATATACTTCCAGAGCTTCAAGACGGACTTTCTTTCCATGTTTCAATTGCCAGAGGTGATACAATCTACATCTTGGGAGGCCACTCACTTCAGAATAACACCAGGTCCCCCAACTTGTACAAACTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTTGTCCTTGTTGGTGGCTACCACTCAGACAACCAGAAACGGCTG{AG}CATGCAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTCGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGAAAAGG{GT}TCTGTTTTGCTGGGCATTCCAGGGGCCACCAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATTGATTACACAAACTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGAT{GT}ATGCTGATACTTACAATGAAGATGACGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Turdus_falklandii TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATTCTGCATGAAGATGAAGCAGTGCCAAGTGGAGAAAAG---------------ATGGAGTTAACAGGCAATAGG---CAGGCACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACAGATTGTTACAAGAAAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGAGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAGGTTTTCAGGATTGATGTGCGAGGGGATGTCGACACTATCCA{CT}CCCACCCACTTTTGTCACAACTGTTGGAGTATTATACATAGCAAATTCAGTAATACTCTGTGTGAAGTGTATTTTCCTAGGAACAGCACAATGCAGTGGCAACCCCATTCCCCAAACTGTGATGTGTGCCATACTACCAGAAGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACCGGGGAACATGCTCAGCTAAACAGAGGTGCAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACACCTCAGCACCAAGCTGCTTGCAGTTGATTACCCACCGGATTTCATTAAATCCATGTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGACCTGGTAACCCCAGTAAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGCAAAGTATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGACAGAGAGCTCCACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTTCTGTCCCTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGCCAGGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGACATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAGGGGAAGGGATCTGGACTTCACCCCGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTATCACAAAATGTACAGAACGGTAAAAGCTGTCACAGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTACCACCCATTTGAGTGGAATCCTCCCCTGAAA{AT}ATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACTTGGATGACTATTTGACTGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACATGGGAATGAAAACAAGAGAATCTTTGAGGAATTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGACCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGA{AG}ATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTCGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGGTCCACTTACATTTGTACCCTGTGTGATGCCACCCGCTTGGAGGCATCCCAGAACCTGGTCCTGCACTCCATAACCCGGAGCCATGCTGAAAACCTGGCGCGATATGAAATATGGAGGTCCAACCCATACCACGAGTCCGTCGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATCGAGACTGTCCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTA{CT}AGGATCTTCCAGATGGAGATCGGTGAGCTTTACAAGAATCCTGACGTGTCTAAGGAAGAGAGGAAGAGGTGGCAGCTGACTCTGGACAAACATCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAACGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGCTTTGCAGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAGGGCAAGATTACCAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGCGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCTGCTCTCTGCACGCTCAGAAGCGATGCCAGGGCTGATGAGTACCAGTACATCATCCATGGGGGTAAAACACCTAACAATGACCTTTCTGACAAGATTTACTTTATGAGTCTGGTAAACAAAACTAGCAAGAAAACAACATTCCGATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTTTGTTTGGAGGGAGGTCATACACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGTCACTCCCTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAGTTTGTCCTGGTGGGTGGCTACCACTCAGACAGCCAGAAACGGCTGGCGTGTAACACCATAGTTCTGGAAGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATCAAACACTGCAGAACATGGTTCGGCTGTGATATGGGTAAAGGGTCTGTTTTGCTAGGCATTCCAGGGGCCAACAAACAAATAAGCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGGGCAGAAGAAGACAAGGCAGAAGAATTGATAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGATTCGGAGGAGTTTTGCTTTAGTGCTGAAGCCAACAGCTTTGATGCTGACGATGCTGATACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Tyrannus_tyrannus TAAAGTGCGATCATTTGAAAAAACA---TCTGATGACAGGCAGCACATAAGCAAAGATCAGGCAGAAGGGGTTGCTTCT------------------------------------------------------------TCAAACAAAGAAATCATACTGCATAAAGATGAAGCAGTGTCAAGAGGAGAAAAG---------------ATGGACTTAATGGGCAATAGG---CAGGCACTTGAGAAAGATGCCCAT---------GACATGAAAACACGAGACAAT---AGAGCTCATCAGAACAATCTGAAGCAACTTTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGCCACAAGAGAACTCATCCAGTGCATGGGCCTGTGGATGATGAAACTCTGTGTCTTCTGAGAAAGAAAGAGAAAAAAGCAACCTCTTGGCCAGATCTTAT{AC}GCTAAGGTGTTCAAGATTGATGTGCGAGGGGATGTTGATACTGTCCATCCCACTCGGTTTTGTCACAACTGTTGGAGTATTATCCATAGAAAATACAGTAATACTCTATGTGAGGTATATTTTCCTAGGAACAGCACCATGGAGTGGCAGCCTCACTCCCCAAACTGTGA{CT}GTATGCCATACTACCAGTCGAGGGGTCAAGAGAAAAAGCCAGACACCAAGTGTACAGCATGGCAAACGTGTGAAGACCACTGTGGAACGTGCTCGACTAAACAGAGGAGTAAAGAACCAG------------GCAAAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGAATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCAGTAGATTTCATTAAATCAATTTCTTGCCAGATTTGTGAGCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAAGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTCCCGACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAGCCTGGGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCCAACCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTATGTGAATAAAGGTGGCCGACCAAGGCAGCATCTCCTATCTTTGACAAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCCGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTTCTAGCTTTAAGAGCAAAAAACGAACACAGACAAGCAGATGAATTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCAATCCGAGTTAACACATTTCTCAGCTGTAGCCAGTACCATAAAATGTATAGAACTGTAAAAGCTGTCACTGGCAGGCAGATCTTCCAGCCCTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTTCCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAACGTATCCACTAATACAGAAGTAGGAATTATAGATGGTCTATCAGGATTGCCACTTTCAGTTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCAGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAATCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAATAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCAC{AG}ATTATGAACATTGCTATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAATAAAGCCAAATTCAGAGTTGTGTTGCAAGCCCTTGTGCCTTATGCTGGCTGATGAATCAGATCATGAAACTCTAACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGTTGCTTGAAATGGGAGGCATCCTGAGAACATTCAGATTTGTCTTTAGGGGTACAGGGTATGATGAGAAACTTGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACTCGCTTGGAGGCATCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCAT{AG}CTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCATGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCGTTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAACCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGATGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGGCAGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAAAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGTCCTGCCAAGGAGTGCCCGGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCTGAGCTCTTATCTACAAAGTTCAAGTACAGATACGAAGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGATCTATAGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGATTCCGAAAAATGAATGCCAGGCAGTCCAAATTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCGCCTTCTCCAAAGACTCATGTTACCTTCCCCCTCTCCGCTACCCTGCTCTTTGCACACACAGAAGCAATGCAAAGTCTGATGAGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTCTCTGATAAGATTTACTTTATAAGTCTGGTAAGCAAAAGTAGCAAGAAAATGACATTCCA{AG}TGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCGTGAGTGTTATATTTGGAGGGAGATCGTATACTCCTCTTGAACAAAGAACCACTGAAAAGTGGAACAGCGTAGTGGACTGTTTGCCATCTGTGTTTCTTGTTGATTTTGAGTTTGGATGCTGTACATCATACATGCTTCCAGAGCTTCAAGATGGACTTTCTTTCCATGTTTCAATTGCCAGAGATGATACGATCTACATTTTAGGAGGCCATTCACTTCAAAATAACACCAGGTGCCCCAACCTGTACAAGCTAAAAGTTGATCTCCCACTGGGCAGCCCAGCTGTGACCTGCACCATCTTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACTCAAATCAGTGATACTGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTAGAGGATAGTAAGATAGAGATTGTTGAAAGGGAGAGCCCAGAGTGGACACCAGATATTAAACACTGCAAAATATGGTTTGGCTGTGATATGGGCAAAGGGTCTGTATTGCTGGGCATTCCAGGAGCCAACAAACAGTTAATCTCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGAAGAAGAGGACAAGGAAGAAGAATTGACAACACAGATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGATTCCACTCCATTTGAAGATTCAGAGGAGTTTTGCTTTAGTGCTGAAGCCAGTAGCTTTGACATTGATGATACTGACACTTATAATGAGGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Vanga_curvirostris TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCGGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCAGAAGGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGGGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGCAAACACAAGACAGT---AGAGCTCATCAGAACAATTTGAAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGGACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTTGGAGTATTATACATAGAAAATTCAGTAATACTTTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCGCACTCCCCAAATTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAAAGACAGCCCCCAAGTGTACAACATGGCAAACGTGTCAAAACCACTGGGGAACATGCTCGGCTAAACAGGGGTGTAAAGAACAAA------------------------------AATTTAATGAAAGAGTTTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCAGTTGATTACCCAGTGGATTTCATTAAATCCATTTCTTGTCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTACCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGCATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCCAGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGTCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGCCAGTATCATAAAATGTACAGAACAGTAAAAGCTGTCACTGGAAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCCAAA{AG}GCCTGGACGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCAATAGCACATGGGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCGTCCCAGAATTTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACCGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACCGTCCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGCGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACTGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAAGAACTCATGGACCTTTATCTGAAGATGAAGCCAGTATGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTGTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTCGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTTTCTAAAAACTCTTGTTACCTTCCCCCTCTCCGCTACCCTGCGGTTTGCACGCTCAGAAGCCATGCAAGGGCTGATGAGTACCAGTATATCATCCACGGTGGTAAAACACCTAACAATGACCTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCAAGGGAAAAAGCATCAGTGTTCTGTTTGGAGGGAGGTCGTATACTCCTCTTGTACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGATTGTTTGCCATCTGTATATCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTCTCAGTTGCCAGAGATGATACAGTCTACATCTTGGGAGGCCACTCACTTCAAAATAACACCAGGTCCCCCAACTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGGTATCGGTGTCAAGTGCTATAGTGACGCAGATCACTGATACCGAATTTGTCCTTGTCGGTGGCTACCACTCTGACAACCAGAAACGGTTGGTGTGTAACACCATAGTTCTGGAAGACAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGCTGTGATATGGGTAACGGGTCTGTTTTGCTGGGCATTCCAGGGGCCAACAAACAGTTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGCAGAAGAGGACAAGGAAGAAGAATCGATAACACAAATTTGCAGCCAGACGTCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCCAATAGCTTTGACGTTGACGATGCTGACACTTACAATGAAGATGATGAAGATGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Vireo_philadelphia TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACACAAACAAAGACCAGGCAGAAGAGGCTGCTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAAAGGGCAATAGG---C{AG}GGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCAGAACAATTTGAAACAACTCTGCCGTATCTGTGGAATTTCATTTAAAACTGATTGTTACAAGAGAACTTATCCAGTGCA{CT}GGGCCAGTGGATGATGAAACTCTGTGGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATTGATGTGCGAGGGGATGTCGATAC{GT}ATCCATCCCACTCAATTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCTGTACTACCAGAAGAGGAGTCAAGAGAAAAAGCCAACCCCCAAGTGTGCAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTG{CT}GATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTATAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCACCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTGTCAGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTTCGATATGATGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTGAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCAGTCCCAGAGAAGGCTGTTCGCTTTTCTTTCACAGTCATGAACATTTCTATAGCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAATTGTGTTGTAAGCCCTTGTGCCTTATGCTGGCTGACGAATCAGATCACGAAACTCTGACAGCAATCCTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTCCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATACGATGAGAAACTTGTGCGGCAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTT{AG}GAGGCATCCCAGAATCTGGTCTTCCACTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATACCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCA{GT}TGCGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGAGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTAAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCCTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTCGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCAT{AT}GGGGCCTGGGCAAGTGAAGGGAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGTCCCACTGGTGTTTTCCTCCTCGATGTGAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCCCTTTGCACACTCAGAAGCGAT---------GATGTGTACCAGTATATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAACAAGAAAATGACGTTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTCTTTGGAGGGAGGTCGTATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAGAGATGATACAATCTACATCTTGGGAGGCTACTCACTTCAAAATAACACCAGGTC{CG}CCCAACTTATACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGG{CT}TGGTGTGTAACACCATAGTTCTGGATGATAGTAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAACATGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCGCTAATGCAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCAGAGGAGTTTTGTTTTAGTGCTGAAGC{AC}AATCACTTTGATGTTGACGATGCTGACATTTACAATGAAGATGATGAAGAAGATGAATCAGAAACAGGCTACTGGATCACCTGCTGTGCC Yuhina_zantholeuca TAAATTGCGATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGATCAGGCAGAAGAAGCTGTTTCT------------------------------------------------------------TCAAACAAAGAACTAATCCCGCATAAAGATGAAGCAGTGCCAAGAGGAGAAAAG---------------ACGGAGTTAAACAGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAC---AGAGCTCATCAGAACCATCTGAAACAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTGGCTTCTCAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGACCTTATTGCTAAAGTTTTCAAGATCGATGTGCGAGGGGATGTCGATACTATCCATCCCACTCAGTTTTGTCACAACTGTCGGAGTATTATACATAGAAAATTCAGTAATACTCTATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCACACTCCCCAAACTGTGATGTGTGCCATACTAGCAGACGAGGAGTCAAGAGAAAAAGCCAGCCCCCAAGTGTACAACGTGGCAAACGTGTCAAAACCACTGGGGAACGTGCTCGGCTAAACAGAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATGAAAGAGATTGTCAATTGCAAGGATATACATCTCAGCACCAAGCTGCTTGCTGTTGATTACCCGGCAGATTTCATTAAATCCATTTCTTGCCAGATTTGCGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAACTTGCATCCTTAAATGCATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACTGATCTGGTAACTCCAGTGAAATCCTTCCTGAACATCCTTGATAACCTGAGTATAAGATGCCCTGTAAAGGAATGTGATGAAGAGATTTTGCATGGAAAATATGGCCAACACCTCTCTGGCCACAAGGAGATGAAAGATAGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCACCTCCTGTCTTTGACAAGGAGAGCCCAGAAACATCGTCTGAGGGAACTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGCGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTCCTGGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGGGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGTAGTCAGTATCATAAAATGTATAGAACAGTAAAAGCTGTCACTGGGAGGCAGATTTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTACCAGGTTATCATCCATTTGAGTGGAAACCTCCCTTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGATGGACTATCGGGACTGCCACTCTCAATTGATGACTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGACGCGGCCTTGGTTTGTGCCTTAAAGGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGATGACTATTTGAATGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGATGGAATGGGAGATGTCAGTGAGAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATAGCACACGGCAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAACTGTGTTGTAAGCCTTTGTGCCTTATGCTGGCTGACGAATCAGATCATGAAACTCTGACGGCAATCCTGAGCCCCCTGATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTTCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTCATCTTTAGGGGTACAGGATATGATGAGAAACTTGTGAGGGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTATATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCACTCCATCACCAGGAGCCATGCTGAAAATCTGGAGCGATACGAAATATGGAGGTCCAACCCATATCACGAATCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTTCCCTCCATAGATGCATTGCACTGTGACATTGGCAATGCAACAGAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGTGTCTAAAGAGGAGAGGAAGAGGTGGCAGTTGACTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCAATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTCATGTCCAAAGAGACCGTAGAGGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAGAGAACTAATGGACCTTTATCTGAAGATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTACAATTCACAGCGTTTTGCGGAGCTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCACAAAACACTTGCTCATGTTCCTGAAATAATTGAAAGAGATGGATCCATTGGGGCCTGGGCAAGTGAAGGGAATGAGTCCGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCCTTCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTCTTTGCACGCTCAGAAGCGATGCAAGGGCTGATGTGTACCAGTACATCATCCATGGTGGTAAAACACCTAACAATGACCTTTCCGATAAGATCTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAGATGACATTCCAATGCATTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTATTTGGAGGAAGGTCATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGCGTAGTTGACTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATATGTCCTTCCAGAGCTTCAAGATGGACTTTCTTTCCACGTTTCAATTGCCAAAGATGATACAATCTACATCTTGGGAGGCTACTCACTTCAAAATAACACCAGGTCCCCCAACTTATACAAGCTAAAAATTGATCTGCCTCTGGGCAGCCCAGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGATGCTGAATTTGTCCTTGTCGGTGGCTACCACTCTGAGAACCAGAAACGGCTGGTGTGTAACACCATAGTTCTGGAGGATAGTAAGATAGAGATTGTTGAAAGTGTAGGCCCAGAGTGGACGCCAGATATTAAACACTGCAGAACGTGGTTTGGCTGTGATATGGGTAAAGGGTCTGTATTACTGGGCATTCCAGGGGCCAACAAACAATTAATCCCAGATGCAAACTACTTTTACATTTTGAGATGCAAAGGAGGAGAAGAGGACAAGGAAGAAGAATCGCTAACACAAATTTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCCACTCCATTTGAAGACTCGGAGGAGTTTTGTTTTAGTGCTGAAGCTAATAGCTTTGATGTTGACGATGCTGACACTTACAATGAAGATGATGAAGAAGATGAATCAGAAACGGGCTACTGGATCACCTGCTGTGCC Zosterops_senegalensis TAAATTGCCATCATTTGAAAAAACACCCTCTGATGACAGCCAGCACATAAACAAAGACCAGGCAGAAGAGGCTGTTTCT------------------------------------------------------------TCAAACAAAGAATTCATCCTGCATAAAGATGAAACAGTGCCAAGAGGAGAAAAG---------------ATGGAGTTAACGGGCAATAGG---CAGGGACTTGAGGAAGATGCCCAT---------GCCATGAAAACACAAGACAAT---AGAGCTCATCA{AG}AACAATCTGGAGCAACTCTGCCGCATCTGTGGAGTTTCATTTAAAACTGATTGTTACAAGAGAACTTACCCAGTGCATGGGCCAGTGGATGATGAAACTCTGTTGCTTCTGAGAAAGAAAGAAAAAACAGCAACCTCTTGGCCAGATCTTATTGCTAAGGTTTTCAAGATAGATGTGCGAGGGGATGTTGATACTATCCATCCCACTCGATTTTGTCACAACTGTTGGAGTATTATACACAGAAAATTCAGTAATACTCCATGTGAAGTATATTTTCCTAGGAACAGCACAATGGAGTGGCAACCCCATTCCTCCAACTGTGATGTGTGCCATACTACCAGACGAGGAGTCAAGAGAAAGAAACAGCCTGCAAGTGTACAATCTGGCAAACGTGTCAAAACCACTGGGCAACGTGTTCAGCTAAACAAAGGTGTAAAGAACCAA------------GCACAGATAAACAACAAAAATTTAATTAAAGAGATTATCAATTGCAAGGATATACATCTCAGCATCAAGCTGCTTGCAATTGATTACCCAGTAGATTTCATTAAATCCATTTCTTGCCAGATTTGTGATCATATTTTGGCAGATCCAGTGGAAACAACATGCAGACACTTGTTTTGCAGAA{CT}TTGCATCCTTAAATGTATCAGGGTTATGGGCAGCTATTGCCCCTCCTGCTGGTATCCTTGCTTTCCTACAGATCTGGTTACCCCAGTGAAATCCTTCCTGAACATCCTTGATAACTTAAGTATAAGATGCCCCGTAAAGGAATGTGATGAAGAGATCTTGCATGGAAAATACAGCCAACACCTCTCTAGTCACAAGGAGACGAAAGAGGGAGAGCTCTACAGCTACATAAATAAAGGTGGCCGACCGAGGCAGCA{CT}CTCCTGTCTTTGACGAGGAGAGCTCAGAAACATCGTCTGAGGGAATTGAAACGTCAAGTCAAGGCTTTTGCTGAGAAAGAAGAGGGTGGTGATATAAAGGCTGTATGCATGACTTTGTTCCTGCTAGCTTTGAGAGCAAAAAATGAACACAAACAAGCAGATGAACTGGAGGCTATAATGCAAGGGAGAGGATCTGGACTTCATCCTGCTGTCTGTCTGGCCATCCGAATCAACACGTTTCTCAGCTGCAGTCAGTACCATAAAATGTATAGAACAGTAAAAGCTGTCTCTGGGAGGCAGATCTTCCAGCCTTTGCATGCTCTTCGCACTGCTGAGAAAGCCCTCCTGCCAGGTTATCACCCATTTGAGTGGAAACCTCCCCTGAAAAATGTATCCACTAACACAGAAGTGGGAATTATAGACGGACTATCAGGACTGCCACTCTCAATTGATGATTACCCAGTAGACACAATTGCAAAGAGATTCCGATATGACGCAGCCTTGGTTTGTGCCTTAAAAGACATGGAGGAGGAGATCTTGGAAGGCATGAAAGCAAAAAACCTGGACGACTATTTGAGTGGCCCCTTCACTGTGGTAGTAAAAGAGTCCTGTGACGGAATGGGAGATGTCAGTGAAAAGCATGGAAGTGGGCCTGCTGTCCCAGAGAAGGCTGTTCGCTTTTCCTTCACAGTCATGAACATTTCTATATCACATGAGAATGAAAGCAAGAGGATCTTTGAGGAAGTAAAGCCCAATTCAGAGTTGTGCTGTAAGCCCTTATGCCTAATGCTGGCTGATGAATCAGATCATGAAACTCTGACAGCAATCCTGAGCCCCCTCATAGCAGAAAGAGAGGCTATGAAAAACAGTGAACTGCTGCTTGAAATGGGAGGCATCCTGAGAACATTTAGATTTGTCTTTAGGGGTACAGGATATGATGAGAAACTCGTGCGAGAAGTGGAAGGGCTGGAGGCCTCAGGTTCCACTTACATTTGTACCCTGTGTGATGCAACCCGCTTGGAGGCATCCCAGAATCTGGTCTTCCATTCCATAACCAGGAGCCATGCTGAAAATCTGGAGCGATATGAAATATGGAGGTCCAACCCATTTCATGAGTCTGTTGATGAGCTCCGTGACAGAGTGAAGGGTGTTTCAGCCAAACCTTTTATTGAGACTGTCCCCTCCATAGATGCATTGCACTGCGACATTGGCAATGCAAC{AG}GAATTCTACAGGATTTTCCAGATGGAGATTGGTGAACTTTACAAGAATCCTGATGT{AG}TCTAAAGAGGAGAAGAAGAGGTGGCAGTTGGCTCTTGACAAACACCTCAGGAAGAAGATGAACTTGAAGCCTATGTTGAAGATGAGTGGAAATTTTGCTAGAAAGCTTATGTCCAAGGAGACTGTAGAAGCAGTATGTGAATTAATAAAGTGTGAGGAAAGGCATGAAGCCCTGAAGGAACTAATGGACCTTTATCTGAAAATGAAGCCAGTGTGGCGATCCTCATGCCCTGCCAAGGAGTGCCCAGAACTGCTGTGCCAGTATAGCTATAATTCACAGCGTTTTGCAGAACTCTTATCTACAAAGTTCAAGTACAGATATGAGGGCAAGATTACAAATTATTTCCATAAAACGCTTGCTCATGTTCCTGAAATCATTGAAAGAGATGGGTCCATTGGGGCCTGGGCAAGTGAAGGAAATGAGTCTGGAAACAAACTGTTTAGGAGGTTCCGAAAAATGAATGCCAGGCAGTCCAAAGTCTATGAGATGGAGGATGTCTTGAGATCCTGCCCCACTGGTGTTTTCCTCCTTGATATAAAGCAGAATGAGCTCAAAATGAAACCTGCTGCCTTCTCTAAAGACTCGTGTTACCTTCCCCCTCTCCGCTACCCCGCTATTTGCACGCTCAGGAGCGATGCAGGGGCTGATGAGTACCAGTATGTCATCCACGGGGGTAAAACACCTAACAATGAACTTTCTGATAAGATTTACTTTATGAGTCTGGTAAGCAAAACTAGCAAGAAAATAACATTCCAGTGCCTTGAGAAAGACCTGGGTGGAGATGTCCCTGAAGCTAGATATGGGCATACAATTAATGTAGTTCATAGCCGGGGAAAAAGCATGAGTGTTCTGTTTGGAGGCAGGACATATACTCCTCTTGCACAAAGAACCACTGAAAAATGGAACAGTGTAGTCGATTGTTTGCCATCTGTGTTTCTCATTGATTTTGAGTTTGGATGCTGTACATCATACATACTTCCAGAGCTTCAAGATGGGCTTTCTTTCCACGTGTCACTTGCCAGAGATGATACAATCTACATCTTGGGAGGCCATTCACTTCAAAATAACACCAGGTCCCCCAGCTTGTACAAGCTAAAAATTGATCTGCCCCTGGGCAGCCCGGCTGTGACCTGCACCATCCTGCCAGGGGGGATATCAGTGTCAAGTGCTATAGTGACCCAGATCAGTGACACTGAATTCGTCCTTGTTGGTGGCTACCACTCAGACAGCCAGAAACG{CG}CTGGCATGTCACACCATAGTTCTGGAAGATAATAAGATAGAGATTGTTGAAAGTGTGAGCCCAGAGTGGACACCAGATATTAAACACTGCAGAATGTGGTTTGGTTGTGATATGGGTAAAGGGTCTGTTTTGCTGGGCATTCCGGGGGCCAACAAACAAATAATCCCAGATGCAAACTACTTCTACATTTTGAGATGCAAAGGAGCAGATGAGGACAAGGAAGAAGAATTGATAACACAAAATTGCAGTCAGACATCAAGTGAAGACCCTGGAGACTCTGCTCC{AG}TTTGAAGATTCAGAGGAATTTTGTTTTAGTGCTGAAGCCAATAGCTTTGATGCTGATGATGCTGATACTTACAATGAAGATGATGAAGAGGATGAATCAGAAACAGGCTACTGGATCACTTGCTGTGCC ; END; BEGIN SETS; CHARSET rag1_1st (CHARACTERS = Passerine_RAG) = 626 2 5 71 74 77 8 629 11 14 17 20 23 26 80 83 86 89 92 29 32 35 632 38 41 635 44 47 638 50 53 641 56 59 644 62 65 647 68 650 653 656 659 662 665 668 671 674 677 680 683 686 689 692 695 698 701 704 707 710 713 716 719 722 725 728 731 734 737 740 743 746 95 749 752 98 755 101 104 758 107 110 761 113 116 764 119 122 767 125 770 128 131 773 134 137 1181 140 776 143 146 1184 779 1187 1190 149 152 155 1193 782 1196 1199 158 161 164 1202 785 1205 1208 167 170 173 1211 788 1214 1217 176 179 182 1220 185 1223 791 1226 1229 188 191 194 197 200 203 206 209 212 215 218 221 224 227 230 233 236 239 242 245 248 251 254 257 260 263 266 269 272 275 278 281 284 287 290 293 296 1232 1235 1238 1241 1244 1247 1250 1253 1256 1259 1262 1265 1268 1271 1274 1277 1280 1283 1286 1289 1292 1295 1298 1301 1304 1307 1310 1313 1316 1319 1322 1325 1328 1331 1334 1337 1340 1343 1346 1349 1352 1355 1358 1361 1364 1367 1370 1373 299 302 305 308 311 314 317 320 323 326 329 332 335 338 341 344 347 350 353 356 359 362 365 368 794 371 374 377 380 797 383 386 800 389 392 803 395 398 806 401 404 407 809 410 413 812 416 815 419 422 818 425 428 431 434 437 440 443 446 449 452 455 458 461 464 467 1376 1379 1382 1385 1388 1391 470 473 476 479 1394 1397 482 821 485 488 491 1400 1403 1406 1409 494 497 1412 500 1415 824 1418 1421 503 506 509 1424 1427 512 827 515 518 1430 1433 521 830 524 1436 1439 1442 527 530 533 1445 1448 536 833 539 542 1451 1454 1457 545 548 1460 1463 551 836 554 557 1466 1469 1472 560 1475 839 1478 1481 563 566 569 572 1484 1487 1490 575 1493 578 1496 581 842 584 587 1499 1502 1505 590 593 845 596 599 848 602 605 851 608 1508 611 854 614 1511 1514 617 857 620 623 1517 1520 1523 860 1526 1529 863 1532 1535 866 1538 1541 1544 1547 1550 1553 1556 1559 1562 1565 1568 1571 1574 1709 1712 1715 1718 1721 1724 1727 1730 1733 1736 1739 1742 1577 1580 1583 1586 1589 1745 1748 1592 1751 1595 869 1598 1601 1754 1757 1760 1763 1766 1604 1607 1610 1769 1772 1613 1775 1616 872 1619 1622 1778 1781 1784 1625 1787 1628 875 1631 1790 1793 1634 1796 1637 878 1640 1799 1802 1643 1805 1646 881 1649 1808 1811 1652 1814 1655 884 1658 1817 1820 1661 1664 1823 1667 887 1670 1673 1826 1829 1832 1676 890 1679 1682 1835 1838 1841 1685 893 1688 1844 1847 1850 1691 1694 896 1697 1853 1856 1700 899 1703 1706 1859 1862 1865 902 1868 1871 905 1874 1877 908 1880 911 1883 1886 914 1889 1892 917 1895 1898 1901 1904 1907 1910 1913 1916 1919 1922 1925 1928 1931 2264 2267 2270 2273 2276 2279 2282 2285 2288 2291 2294 2297 2300 2303 2306 2309 2312 2315 2318 1934 1937 1940 1943 1946 1949 1952 1955 1958 2321 2324 2327 1961 1964 2330 2333 1967 1970 2336 920 2339 2342 2345 1973 1976 1979 1982 2348 2351 1985 923 1988 2354 2357 2360 1991 926 1994 1997 2363 2366 2369 2000 2372 2003 929 2006 2009 2375 2378 2381 2012 2384 2015 932 2018 2021 2387 2390 2393 2024 2396 2027 2399 935 2402 2030 2033 2405 2036 2408 938 2411 2039 2042 2414 2045 2417 941 2420 2048 2051 2054 2423 2426 2057 944 2060 2429 2432 2435 2063 2066 2438 947 2441 2069 2072 2444 2075 2447 2078 950 2081 2084 2087 2090 2093 2096 2099 2102 2105 2108 2111 2114 2117 2120 953 2123 2126 2129 2132 956 2135 2138 959 2141 2144 2450 962 2453 2147 2150 2456 965 2459 2462 2153 2156 2465 968 2468 2471 2159 2162 2165 2168 2171 971 2174 2177 974 2180 2183 977 2186 2189 2474 2477 2480 2192 980 2195 2198 2483 2486 2489 2201 2492 2204 983 2207 2210 2495 2498 2213 986 2216 2219 2501 2504 2507 2222 2225 989 2228 2231 992 2234 2237 2510 2513 2516 2240 2243 2519 995 2522 2525 2246 2249 2252 2528 2255 2531 2258 2534 998 2537 2540 2261 1001 2543 2546 1004 2549 2552 1007 2555 2558 1010 2561 2564 1013 2567 2570 1016 2573 2819 2576 1019 2579 2822 2582 2825 1022 2828 2831 2834 2837 2840 2843 2846 2849 2852 2855 2858 2585 2588 2591 2594 2597 2600 2603 2606 2609 2612 2615 2618 2621 2624 2627 2630 2633 2861 2864 2867 2870 2873 2876 2879 2882 2636 2639 2642 1025 2645 2648 2651 2885 2888 2891 2894 2897 2654 2657 2660 2663 2900 2903 2666 2906 1028 2909 2912 2669 2672 2675 2915 2918 2678 1031 2681 1034 2684 2687 1037 2690 2693 2696 2699 2702 1040 2705 2708 1043 2711 2714 1046 2717 2720 1049 2723 2726 1052 2729 2732 1055 2735 2738 1058 2741 2744 1061 2747 2750 1064 2753 2756 1067 2759 2762 2921 1070 2924 2765 2768 2927 2771 2930 2774 1073 2777 2780 2933 2936 2939 2783 2942 2786 1076 2789 2792 2945 2948 2951 2795 1079 2798 2954 2957 2801 1082 2804 2807 2810 2813 2816 2960 2963 2966 2969 2972 1085 1088 1091 1094 1097 1100 1103 1106 1109 1112 1115 1118 1121 1124 1127 1130 1133 1136 1139 1142 1145 1148 1151 1154 1157 1160 1163 1166 1169 1172 1175 1178; CHARSET rag2_2nd (CHARACTERS = Passerine_RAG) = 3333 3336 2976 2979 2982 2985 2988 2991 2994 2997 3339 3000 3003 3006 3342 3009 3012 3345 3015 3018 3348 3021 3024 3351 3027 3030 3354 3033 3036 3357 3039 3042 3360 3045 3048 3363 3051 3054 3366 3057 3060 3369 3063 3066 3372 3069 3072 3375 3075 3078 3378 3081 3084 3381 3087 3090 3384 3093 3096 3387 3099 3102 3390 3105 3108 3393 3111 3114 3396 3117 3399 3120 3123 3126 3402 3129 3132 3405 3135 3138 3408 3411 3141 3144 3147 3414 3150 3153 3417 3156 3159 3420 3162 3165 3423 3168 3171 3426 3174 3177 3429 3180 3183 3432 3186 3189 3435 3192 3195 3438 3198 3201 3204 3207 3210 3213 3216 3219 3222 3225 3228 3231 3234 3237 3240 3441 3243 3246 3249 3444 3252 3255 3447 3258 3261 3450 3264 3267 3453 3270 3273 3456 3276 3279 3459 3282 3285 3462 3288 3291 3465 3294 3297 3468 3300 3303 3471 3306 3309 3474 3312 3315 3477 3318 3321 3480 3324 3327 3483 3330 3486 3489 3492 3495 3498 3501 3504 3507 3510 3513 3516 3519 3522 3888 3525 3891 3894 3897 3528 3900 3903 3906 3909 3531 3912 3915 3918 3921 3534 3924 3927 3930 3933 3537 3936 3939 3942 3945 3540 3948 3951 3954 3957 3543 3960 3963 3966 3969 3972 3975 3978 3981 3984 3987 3990 3993 3996 3999 4002 4005 4008 4011 4014 4017 4020 4023 4026 4029 4032 4035 3546 4038 4041 4044 4047 3549 4050 4053 4056 4059 3552 4062 4065 4068 3555 4071 4074 3558 4077 4080 3561 4083 3564 4086 4089 3567 4092 4095 4098 3570 4101 4104 4107 4110 3573 4113 4116 4119 4122 3576 4125 3579 3582 3585 3588 3591 3594 3597 3600 3603 3606 3609 3612 3615 3618 3621 3624 3627 3630 3633 3636 3639 3642 3645 3648 3651 3654 3657 3660 3663 3666 3669 3672 3675 3678 3681 3684 3687 3690 3693 3696 3699 3702 3705 3708 3711 3714 3717 3720 3723 3726 3729 3732 3735 3738 3741 3744 3747 3750 3753 3756 3759 3762 3765 3768 3771 3774 3777 3780 3783 3786 3789 3792 3795 3798 3801 3804 3807 3810 3813 3816 3819 3822 3825 3828 3831 3834 3837 3840 3843 3846 3849 3852 3855 3858 3861 3864 3867 3870 3873 3876 3879 3882 3885; CHARSET rag2_1st (CHARACTERS = Passerine_RAG) = 2975 2978 2981 2984 2987 2990 2993 2996 2999 3002 3374 3377 3380 3005 3383 3008 3011 3014 3386 3389 3017 3020 3023 3026 3029 3032 3392 3395 3035 3038 3041 3044 3047 3398 3401 3404 3407 3410 3413 3050 3053 3416 3419 3056 3059 3422 3425 3062 3065 3068 3428 3431 3434 3071 3437 3074 3077 3080 3440 3443 3446 3083 3086 3449 3452 3089 3092 3095 3455 3458 3461 3098 3464 3101 3104 3107 3467 3470 3473 3476 3110 3113 3116 3479 3482 3485 3488 3119 3122 3491 3494 3497 3125 3128 3131 3500 3134 3503 3506 3137 3140 3509 3143 3512 3515 3146 3149 3518 3152 3521 3524 3527 3530 3533 3536 3539 3542 3545 3548 3551 3554 3557 3560 3155 3158 3161 3164 3167 3170 3173 3176 3179 3182 3185 3188 3191 3194 3197 3200 3203 3206 3209 3563 3566 3569 3212 3215 3218 3221 3224 3227 3230 3233 3236 3239 3242 3245 3248 3572 3251 3254 3257 3575 3578 3581 3260 3263 3266 3584 3587 3590 3593 3269 3272 3596 3275 3278 3281 3599 3602 3605 3284 3287 3608 3611 3290 3293 3614 3617 3620 3296 3299 3623 3626 3629 3302 3305 3308 3632 3635 3311 3314 3317 3320 3323 3638 3326 3641 3644 3647 3329 3332 3335 3650 3338 3653 3656 3659 3341 3344 3347 3662 3665 3350 3353 3668 3671 3674 3356 3359 3362 3365 3368 3371 3677 3680 3683 3686 3689 3692 3695 3698 3701 3704 3707 3710 3713 3716 3719 3722 3725 3728 3731 3734 3737 3929 3932 3935 3938 3740 3743 3746 3749 3941 3944 3947 3950 3752 3755 3758 3761 3953 3956 3959 3764 3767 3770 3962 3965 3968 3971 3974 3977 3980 3983 3986 3989 3992 3995 3998 4001 4004 4007 4010 4013 4016 4019 4022 4025 3773 3776 3779 3782 3785 3788 3791 3794 3797 3800 3803 3806 3809 3812 3815 3818 3821 3824 3827 3830 3833 3836 3839 3842 3845 3848 3851 3854 3857 3860 4028 4031 4034 4037 4040 4043 4046 4049 4052 4055 4058 4061 4064 4067 3863 3866 3869 3872 3875 4070 4073 3878 4076 4079 4082 3881 3884 3887 3890 4085 4088 4091 4094 4097 4100 4103 4106 4109 4112 4115 4118 4121 3893 3896 3899 3902 3905 3908 3911 3914 3917 3920 3923 3926 4124; CHARSET rag1_3rd (CHARACTERS = Passerine_RAG) = 52 55 58 61 64 67 70 73 76 79 82 85 88 91 94 97 100 103 106 109 112 115 118 121 124 127 130 133 136 139 142 145 148 151 154 157 160 163 1 166 4 7 169 172 175 10 13 178 181 184 16 19 22 187 25 190 193 196 28 31 34 199 202 37 40 43 46 205 208 211 49 214 217 220 223 226 229 232 235 238 241 244 247 250 253 256 280 259 262 283 286 265 289 268 292 271 274 277 295 298 301 304 307 310 313 316 319 322 325 328 331 358 361 334 337 364 367 370 340 343 346 349 373 376 352 379 382 355 385 388 391 394 397 400 403 406 409 412 415 418 421 424 427 430 433 436 913 916 439 442 919 922 445 448 451 925 928 454 931 934 937 457 460 463 940 466 943 469 472 475 946 949 952 955 478 481 958 484 487 961 964 967 490 493 970 496 499 502 973 976 979 982 505 508 985 511 514 517 988 991 994 520 997 523 1000 1003 1006 526 529 532 1009 535 1012 538 1015 541 544 547 550 553 556 559 562 565 568 571 1018 1021 1024 1027 1030 1033 1036 1039 1042 1045 574 577 580 1048 1051 583 586 1054 589 1057 1060 1063 592 595 598 1066 601 1069 1072 1075 604 607 610 1078 1081 613 616 1084 1087 1090 619 622 625 1093 628 1096 631 1099 1102 1105 634 637 640 1108 643 1111 646 1114 1117 649 652 655 1120 1123 658 1126 661 1129 1132 664 667 670 1135 1138 673 1141 676 1144 1147 679 682 685 1150 1153 688 1156 691 694 697 1159 1162 1165 700 703 1168 1171 706 709 1174 1177 712 715 1180 718 1183 721 1186 1189 1192 724 727 730 1195 1198 1201 1204 1207 1210 1213 1216 1219 1222 733 736 739 742 745 748 751 754 757 760 763 766 1225 1228 1231 1234 1237 769 772 775 1240 1243 1246 778 781 784 1249 787 1252 1255 790 793 1258 796 1261 1264 1267 799 802 805 1270 1273 1276 808 811 814 1279 817 1282 820 1285 823 826 829 1288 1291 1294 832 1297 835 838 841 1300 1303 1306 844 1309 847 850 853 1312 1315 1318 856 1321 859 862 865 1324 1327 1330 868 1333 871 874 877 1336 1339 1342 880 883 886 1345 1348 1351 889 892 895 1354 1357 1360 1363 898 901 904 1366 1369 907 910 1372 1375 1378 1381 1384 1387 1390 1393 1396 1399 1402 1405 1408 1411 1468 1471 1474 1477 1480 1483 1414 1417 1420 1486 1489 1492 1495 1423 1426 1429 1432 1435 1498 1501 1438 1504 1507 1441 1444 1510 1513 1447 1450 1453 1516 1456 1459 1462 1465 1519 1522 1525 1528 1531 1534 1537 1540 1543 1546 1549 1552 1555 1558 1561 1564 1567 1570 1573 1576 1579 1582 1585 1588 1591 1594 1597 1600 1603 1606 1609 1612 1615 1618 1621 1624 1627 1630 1633 1636 1639 1642 1645 1648 1651 1654 1657 1660 1663 1666 1669 1672 1675 1678 1681 1684 1687 1690 1693 1696 1699 1702 1705 1708 1711 1714 1717 1720 1723 1726 1729 1732 1735 1738 1741 1744 1747 1750 1753 1756 1759 1762 1765 1768 1771 1774 1777 1780 1783 1804 1807 1786 1810 1813 1789 1816 1819 1792 1822 1825 1795 1828 1831 1798 1834 1837 1840 1801 1843 1846 2449 1849 1852 1855 1858 1894 1897 1900 1903 1861 2452 1864 1867 1906 1909 1912 1870 2455 1873 1915 1918 1876 1921 1879 2458 1882 1885 1924 1927 1930 1888 1933 1891 2461 1936 1939 1942 1945 1948 1951 1954 1957 1960 1963 1966 1969 1972 1975 1978 1981 1984 1987 1990 1993 1996 1999 2002 2005 2008 2011 2014 2464 2017 2020 2023 2467 2026 2029 2470 2032 2035 2473 2038 2041 2476 2044 2047 2479 2050 2053 2482 2056 2059 2062 2065 2068 2071 2074 2077 2080 2083 2086 2089 2092 2095 2098 2101 2104 2107 2485 2110 2113 2488 2116 2119 2491 2122 2125 2494 2128 2131 2497 2134 2137 2500 2140 2143 2503 2146 2149 2506 2152 2155 2509 2158 2161 2512 2164 2167 2515 2170 2173 2518 2176 2179 2521 2182 2185 2524 2188 2191 2527 2194 2197 2530 2200 2203 2533 2206 2209 2536 2212 2215 2539 2218 2221 2542 2224 2227 2545 2230 2233 2548 2236 2239 2551 2242 2245 2554 2248 2251 2557 2254 2257 2560 2260 2263 2266 2269 2272 2275 2278 2281 2284 2287 2290 2293 2296 2299 2302 2305 2308 2311 2314 2563 2317 2320 2323 2326 2566 2329 2332 2569 2335 2338 2572 2341 2344 2575 2347 2350 2578 2353 2356 2581 2359 2362 2584 2365 2368 2587 2371 2374 2590 2377 2380 2593 2383 2386 2596 2389 2392 2599 2395 2398 2602 2401 2404 2605 2407 2410 2608 2413 2416 2611 2419 2422 2614 2425 2617 2428 2431 2434 2620 2437 2440 2623 2443 2446 2626 2629 2632 2635 2638 2641 2644 2647 2650 2653 2656 2659 2662 2665 2668 2671 2674 2677 2680 2683 2686 2689 2692 2695 2698 2701 2704 2707 2710 2713 2716 2719 2722 2725 2728 2731 2734 2737 2740 2743 2746 2749 2752 2755 2758 2761 2764 2767 2770 2773 2776 2779 2782 2785 2788 2791 2794 2797 2800 2803 2806 2809 2812 2815 2818 2821 2824 2827 2830 2833 2836 2839 2842 2845 2848 2851 2854 2857 2860 2863 2866 2869 2872 2875 2878 2881 2884 2887 2890 2893 2896 2899 2902 2905 2908 2911 2914 2917 2920 2923 2926 2929 2932 2935 2938 2941 2944 2947 2950 2953 2956 2959 2962 2965 2968 2971 2974; CHARSET rag2_3rd (CHARACTERS = Passerine_RAG) = 3136 3139 3142 3145 3148 3151 3154 3157 3160 3163 3166 3169 3172 3175 3178 3181 3184 3187 3190 3193 3196 3199 3202 3205 3208 3211 3214 3217 3220 3223 3226 3229 3232 3235 3238 3241 3244 3247 3250 3253 3256 3259 3262 3265 3268 3271 3274 3277 3280 3283 3286 3289 3292 3295 3298 3301 3304 3307 3310 3313 3316 3319 3322 3325 3328 3331 3334 3337 3340 3343 3346 3349 3352 3355 3358 3361 3364 3367 3370 3685 3688 3691 3694 3697 3700 3703 3706 3709 3712 3715 3373 3376 3379 3382 3385 3718 3721 3388 3724 3727 3730 3391 3394 3397 3400 3733 3736 3403 3739 3742 3406 3409 3745 3412 3748 3751 3754 3415 3418 3421 3757 3424 3760 3427 3430 3763 3766 3433 3436 3439 3442 3445 3448 3451 3454 3457 3769 3460 3772 3775 3778 3463 3466 3469 3781 3472 3784 3475 3478 3481 3484 3487 3490 3493 3496 3787 3790 3499 3793 3502 3505 3796 3799 3802 3508 3511 3805 3514 3517 3520 3808 3811 3814 3523 3817 3526 3820 3823 3826 3529 3532 3535 3538 3829 3832 3541 3544 3547 3550 3553 3556 3559 3562 3565 3568 3571 3574 3577 3580 3583 3586 3589 3835 3838 3841 3844 3847 3850 3853 3856 3859 3862 3865 3868 3871 3874 3877 3880 3883 3886 3889 3892 3895 3898 3901 3592 3595 3598 3601 3604 3607 3610 3613 3616 3619 3622 3904 3907 3910 3913 3916 3919 3625 3628 3631 3634 3922 3925 3637 3640 3643 3646 3928 3931 3934 3937 3940 3943 3649 3652 3655 3946 3949 3952 3658 3661 3664 3955 3958 3961 3667 3670 3673 3964 3967 3970 3676 3679 3682 3973 3976 3979 3982 3985 3988 3991 3994 3997 4000 4003 4006 4009 4012 4015 4018 4021 4024 4027 4030 4033 4036 4039 4042 4045 4048 4051 4054 4057 4060 4063 4066 4069 4072 4075 4078 4081 4084 4087 4090 4093 4096 4099 4102 4105 4108 4111 4114 4117 4120 4123 4126 2977 2980 2983 2986 2989 2992 2995 2998 3001 3004 3007 3010 3013 3016 3019 3022 3025 3028 3031 3034 3037 3040 3043 3046 3049 3052 3055 3058 3061 3064 3067 3070 3073 3076 3079 3082 3085 3088 3091 3094 3097 3100 3103 3106 3109 3112 3115 3118 3121 3124 3127 3130 3133; CHARSET rag1_2nd (CHARACTERS = Passerine_RAG) = 318 321 324 327 330 333 336 339 342 345 348 351 354 357 360 363 366 369 372 375 378 381 384 387 390 393 396 399 402 405 408 411 414 417 420 423 426 429 432 435 438 441 444 447 450 453 456 459 462 465 468 471 474 477 480 483 486 489 492 495 498 501 504 507 510 513 516 519 522 525 3 6 528 9 531 534 537 12 15 18 540 21 543 546 549 24 27 30 552 555 558 33 36 39 561 564 567 42 45 48 51 54 57 60 63 66 69 72 75 78 570 573 576 579 582 585 588 591 594 597 600 603 606 609 612 615 81 84 87 90 93 96 99 618 621 624 627 102 105 630 633 636 108 111 114 117 120 639 642 645 123 126 648 129 651 132 135 138 654 657 660 141 663 144 147 150 666 669 672 153 675 156 159 162 678 681 684 165 687 168 171 174 690 693 696 177 699 180 183 186 702 705 708 189 711 714 717 192 195 198 720 723 726 201 204 729 732 735 207 210 213 738 741 216 219 222 744 747 750 225 753 228 231 234 756 759 762 765 768 771 774 777 780 783 786 789 792 237 240 243 246 249 252 255 258 261 264 267 270 273 276 279 282 795 798 801 804 807 810 813 816 285 288 291 294 819 822 297 825 300 828 303 831 306 309 312 315 834 837 840 843 846 849 852 855 858 861 864 867 873 876 870 879 882 885 888 891 894 897 900 903 906 909 912 1404 1407 1410 915 918 921 924 927 930 933 936 939 942 945 948 951 954 957 960 963 966 969 972 975 978 1413 981 984 987 1416 1419 1422 1425 1428 1431 1434 1437 1440 1443 1446 1449 1452 1455 990 993 996 999 1002 1005 1008 1011 1014 1017 1020 1023 1026 1029 1032 1035 1038 1041 1458 1461 1464 1467 1470 1473 1476 1479 1482 1044 1047 1050 1053 1485 1488 1056 1059 1062 1065 1491 1494 1497 1500 1503 1506 1068 1071 1074 1077 1509 1080 1512 1515 1083 1086 1518 1521 1524 1089 1092 1095 1527 1530 1533 1098 1101 1536 1104 1107 1110 1539 1542 1545 1113 1116 1119 1548 1551 1554 1122 1557 1125 1128 1131 1560 1563 1566 1134 1569 1137 1140 1572 1575 1143 1578 1146 1149 1581 1584 1587 1152 1155 1158 1161 1164 1167 1170 1173 1176 1179 1182 1185 1188 1191 1194 1197 1200 1203 1206 1209 1590 1593 1596 1599 1602 1605 1608 1611 1614 1617 1620 1623 1626 1212 1215 1218 1221 1224 1227 1230 1233 1629 1632 1635 1638 1236 1239 1242 1641 1644 1647 1245 1248 1251 1650 1653 1656 1254 1257 1659 1662 1665 1260 1263 1266 1668 1671 1674 1269 1272 1275 1677 1680 1278 1281 1284 1683 1686 1689 1287 1290 1293 1692 1695 1698 1701 1296 1299 1302 1704 1707 1710 1305 1308 1311 1713 1716 1719 1314 1317 1320 1722 1725 1728 1323 1326 1329 1731 1734 1737 1332 1335 1338 1341 1740 1743 1746 1749 1344 1347 1350 1752 1755 1758 1353 1356 1761 1359 1362 1365 1764 1767 1770 1773 1776 1779 1782 1785 1368 1371 1374 1377 1380 1383 1386 1389 1392 1395 1398 1401 1806 1809 1812 1788 1791 1794 1815 1818 1821 1797 1824 1800 1827 1830 1803 1833 1836 1839 1842 1845 1848 1851 1854 1857 1860 1863 1866 1869 1872 1875 1878 1881 1884 1887 1890 1893 1896 1899 1902 1905 1908 1911 1914 1917 1920 2019 1923 1926 1929 1932 1935 1938 1941 1944 1947 1950 1953 1956 1959 1962 1965 1968 1971 1974 1977 1980 1983 1986 1989 1992 1995 1998 2001 2235 2238 2241 2244 2247 2250 2253 2256 2259 2262 2265 2268 2271 2274 2277 2280 2283 2286 2289 2292 2295 2298 2004 2007 2010 2013 2016 2301 2304 2307 2022 2310 2313 2316 2025 2319 2322 2028 2325 2031 2034 2037 2040 2043 2046 2049 2052 2055 2058 2061 2064 2067 2070 2073 2076 2079 2082 2085 2088 2091 2094 2097 2100 2103 2106 2109 2112 2115 2118 2121 2124 2127 2130 2133 2136 2139 2142 2145 2148 2151 2154 2157 2160 2163 2166 2169 2172 2175 2178 2181 2184 2187 2190 2193 2196 2199 2202 2205 2208 2211 2214 2217 2220 2223 2226 2229 2232 2580 2328 2331 2334 2337 2340 2343 2346 2349 2352 2583 2355 2358 2586 2361 2364 2589 2367 2370 2592 2373 2376 2379 2595 2382 2385 2388 2391 2394 2598 2397 2400 2403 2406 2409 2412 2415 2418 2421 2424 2427 2430 2433 2436 2439 2442 2445 2448 2451 2454 2457 2460 2463 2466 2469 2472 2475 2478 2481 2484 2487 2601 2490 2493 2496 2499 2502 2505 2508 2604 2511 2514 2517 2520 2607 2523 2526 2529 2532 2610 2535 2538 2541 2613 2544 2616 2547 2550 2619 2553 2556 2559 2622 2562 2565 2568 2625 2571 2574 2577 2628 2631 2634 2637 2640 2643 2646 2649 2652 2655 2658 2661 2664 2667 2670 2673 2676 2679 2682 2685 2688 2691 2694 2697 2700 2703 2706 2709 2712 2715 2718 2721 2724 2727 2730 2733 2736 2739 2742 2745 2748 2751 2754 2757 2760 2763 2766 2769 2772 2775 2778 2781 2784 2787 2790 2793 2796 2799 2802 2805 2808 2811 2814 2817 2820 2823 2826 2829 2832 2835 2838 2841 2844 2847 2850 2853 2856 2859 2862 2865 2868 2871 2874 2877 2880 2883 2886 2889 2892 2895 2898 2901 2904 2907 2910 2913 2916 2919 2922 2925 2928 2931 2934 2937 2940 2943 2946 2949 2952 2955 2958 2961 2964 2967 2970 2973; CHARSET rag2 (CHARACTERS = Passerine_RAG) = 2975-4126; CHARSET rag1 (CHARACTERS = Passerine_RAG) = 1-2974; END; BEGIN TREES; TITLE Passerine_Taxonomy; LINK TAXA = Taxa2; TRANSLATE 1 Acanthisitta_chloris, 2 Aegithalos_iouschensis, 3 Aegithina_tiphia, 4 Ailuroedus_melanotis, 5 Alauda_arvensis, 6 Arcanator_orostruthus, 7 Artamus_cyanopterus, 8 Artamus_leucorhynchus, 9 Batis_mixta, 10 Bombycilla_garrulus, 11 Campylorhamphus_trochilirostris, 12 Cardinalis_cardinalis, 13 Catharus_ustulatus, 14 Certhia_familiaris, 15 Chaetops_frenatus, 16 Chaetorhynchus_papuensis, 17 Chloropsis_cochinchinensis, 18 Cinclus_cinclus, 19 Cisticola_anonyma, 20 Climacteris_erythrops, 21 Climacteris_picumnus, 22 Cnemophilus_loriae, 23 Colluricincla_harmonica, 24 Conopophaga_ardesiaca, 25 Coracias_caudata, 26 Coracina_lineata, 27 Coracina_novaehollandiae, 28 Corcorax_melanorhamphos, 29 Cormobates_leucophaea, 30 Corvinella_corvina, 31 Corvus_corone, 32 Corvus_coronoides, 33 Corvus_orru, 34 Cracticus_quoyi, 35 Culicicapa_ceylonensis, 36 Cyanocitta_cristata, 37 Daphoenositta_chrysoptera, 38 Dicaeum_aeneum, 39 Dicrurus_adsimilis, 40 Dicrurus_hottentottus, 41 Dryoscopus_cubla, 42 Elminia_nigromitrata, 43 Emberiza_schoeniclus, 44 Ephthianura_tricolor, 45 Eugerygone_rubra, 46 Falcunculus_frontatus, 47 Formicarius_colma, 48 Fringilla_montifringilla, 49 Furnarius_rufus, 50 Gallus_gallus, 51 Garrulax_milleti, 52 Grallina_cyanoleuca, 53 Gymnorhina_tibicen, 54 Hirundo_pyrrhonota, 55 Hirundo_rustica, 56 Hylophilus_poicilotis, 57 Icterus_parisorum, 58 Irena_cyanogaster, 59 Lalage_leucomela, 60 Lanius_excubitor, 61 Loboparadisaea_sericea, 62 Malurus_melanocephalus, 63 Manucodia_atra, 64 Manucodia_chalybata, 65 Melampitta_gigantea, 66 Melampitta_lugubris, 67 Melanocharis_nigra, 68 Melanocharis_versteri, 69 Melanodryas_cucullata, 70 Meliphaga_analoga, 71 Menura_novaehollandiae, 72 Microeca_papuana, 73 Mimus_patagonicus, 74 Mionectes_macconnellii, 75 Modulatrix_stictigula, 76 Monarcha_axillaris, 77 Monarcha_chrysomela, 78 Motacilla_cinerea, 79 Muscicapa_ferruginea, 80 Nectarinia_olivacea, 81 Neodrepanis_coruscans, 82 Oedistoma_iliolophum, 83 Oreoica_gutturalis, 84 Oriolus_larvatus, 85 Oriolus_xanthonotus, 86 Orthonyx_spaldingii, 87 Orthonyx_teminckii, 88 Pachycephala_soror, 89 Pachycephala_hyperthra, 90 Pachycephalopsis_poliosoma, 91 Paradisaea_raggiana, 92 Paramythia_montium, 93 Pardalotus_punctatus, 94 Pardalotus_striatus, 95 Parula_americana, 96 Parus_inornatus, 97 Parus_major, 98 Passer_montanus, 99 Peneothello_bimaculatus, 100 Pericrocotus_ethologus, 101 Philepitta_castanea, 102 Philesturnus_carunculatus, 103 Picathartes_gymnocephalus, 104 Pipra_coronata, 105 Pitohui_cristatus, 106 Pitta_sordida, 107 Ploceus_cucullatus, 108 Polioptila_caerulea, 109 Pomatostomus_halli, 110 Pomatostomus_isidorei, 111 Prionops_plumatus, 112 Promerops_cafer, 113 Prunella_collaris, 114 Psarisomus_dalhousiae, 115 Ptilogonys_cinereus, 116 Ptilonorhynchus_violaceus, 117 Ptiloris_magnificus, 118 Ptilorrhoa_caerulescens, 119 Pycnonotus_barbatus, 120 Regulus_calendula, 121 Regulus_satrapa, 122 Remiz_pendulinus, 123 Rhipidura_hyperthra, 124 Rupicola_rupicola, 125 Schiffornis_turdinus, 126 Scytalopus_magellanicus, 127 Sitta_carolinensis, 128 Smithornis_rufolateralis, 129 Sphecotheres_viridis, 130 Strepera_graculina, 131 Struthidea_cinerea, 132 Sturnus_vulgaris, 133 Sylvia_nana, 134 Telophorus_dohertyi, 135 Thamnophilus_nigrocinereus, 136 Thraupis_cyanocephala, 137 Tityra_semifasciata, 138 Toxorhamphus_novaeguineae, 139 Tregellasia_leucops, 140 Troglodytes_aedon, 141 Turdus_falklandii, 142 Tyrannus_tyrannus, 143 Vanga_curvirostris, 144 Vireo_philadelphia, 145 Yuhina_zantholeuca, 146 Zosterops_senegalensis; TREE SA_Alltax = [&R] (50,(25,(((((((((((((51,((145,6,75),133)),146),19),119),(120,121)),(54,55)),2),((96,97),122)),(127,(14,(108,140)))),(5,((98,(78,(107,113))),(((((136,(12,57)),95),43),48),((112,(38,80)),(92,((67,68),(82,138)))))))),((10,115),(18,(((13,141),(35,79)),(73,132))))),(15,103),((((4,116),71),((20,21),29)),((((44,70),(93,94)),62),(102,((45,90,69,99,139,72),((17,58),((86,87),((109,110),((30,60),((56,144),(118,((28,131),(((83,46,(105,23,(89,88))),37),(((3,((41,134),(9,(111,143)))),(123,((39,40),16,(52,(42,(76,77)))))),(((31,32,33),36),(((65,66),((63,64),(22,61,91,117))),(((((26,27),59),100),((84,85),129)),((7,8),((34,53),130))))))))))))))))))),(1,(((((11,49),47,126),(24,135)),((((74,124),(125,137)),104),142)),((((81,101),114),128),106)))))); TREE SA_Pruned = [&R] (50,(25,(((((((((((((51,133),146),19),119),(120,121)),(54,55)),2),((96,97),122)),(127,(14,(108,140)))),(5,((98,(78,(107,113))),(((((136,(12,57)),95),43),48),((112,(38,80)),(92,((67,68),(82,138)))))))),((10,115),(18,(((13,141),79),(73,132))))),(15,103),((((4,116),71),((20,21),29)),((((44,70),(93,94)),62),((139,72),((17,58),((86,87),((109,110),((30,60),((56,144),(118,((28,131),(((83,46,(105,23,(89,88))),37),(((3,((41,134),(9,111))),(123,((39,40),16,(52,(76,77))))),(((31,32,33),36),(((65,66),((63,64),(91,117))),(((((26,27),59),100),((84,85),129)),((7,8),((34,53),130)))))))))))))))))),(1,(((((11,49),(47,(24,126))),135),(74,((124,104),(142,(125,137))))),((114,128),106)))))); TREE ML = [&R] (((1,((((((((((((((2,(54,55)),((19,((51,146),133)),119)),5),((35,42),((96,97),122))),((((6,75),112),((((((((((12,136),43),(57,95)),48),78),98),107),113),(17,58)),(38,80))),((((10,115),((((13,141),79),18),(73,132))),(120,121)),((14,127),(108,140))))),((45,90),(((69,99),139),72))),(15,103)),((((((((((3,(41,134)),9,(111,143)),((7,8),((34,53),130))),(((16,123),((((28,131),((52,(76,77)),(65,66))),((63,64),(91,117))),((30,60),((31,(32,33)),36)))),(39,40))),((83,105),(((84,85),129),92))),((23,(88,89)),(46,118))),(((26,27),59),100)),((56,144),145)),37),(((22,61),102),((67,68),(82,138))))),(86,87)),(109,110)),(((44,70),(93,94)),62)),((4,116),((20,21),29))),71),(((((((11,49),47),126),24),135),(((74,142),(124,(125,137))),104)),((((81,101),114),128),106)))),25),50); END; BEGIN TREES; TITLE Passerine_RAG; LINK TAXA = Taxa1; TRANSLATE 1 Acanthisitta_chloris, 2 Aegithalos_iouschensis, 3 Aegithina_tiphia, 4 Ailuroedus_melanotis, 5 Alauda_arvensis, 6 Arcanator_orostruthus, 7 Artamus_cyanopterus, 8 Artamus_leucorhynchus, 9 Batis_mixta, 10 Bombycilla_garrulus, 11 Campylorhamphus_trochilirostris, 12 Cardinalis_cardinalis, 13 Catharus_ustulatus, 14 Certhia_familiaris, 15 Chaetops_frenatus, 16 Chaetorhynchus_papuensis, 17 Chloropsis_cochinchinensis, 18 Cinclus_cinclus, 19 Cisticola_anonyma, 20 Climacteris_erythrops, 21 Climacteris_picumnus, 22 Cnemophilus_loriae, 23 Colluricincla_harmonica, 24 Conopophaga_ardesiaca, 25 Coracias_caudata, 26 Coracina_lineata, 27 Coracina_novaehollandiae, 28 Corcorax_melanorhamphos, 29 Cormobates_leucophaea, 30 Corvinella_corvina, 31 Corvus_corone, 32 Corvus_coronoides, 33 Corvus_orru, 34 Cracticus_quoyi, 35 Culicicapa_ceylonensis, 36 Cyanocitta_cristata, 37 Daphoenositta_chrysoptera, 38 Dicaeum_aeneum, 39 Dicrurus_adsimilis, 40 Dicrurus_hottentottus, 41 Dryoscopus_cubla, 42 Elminia_nigromitrata, 43 Emberiza_schoeniclus, 44 Ephthianura_tricolor, 45 Eugerygone_rubra, 46 Falcunculus_frontatus, 47 Formicarius_colma, 48 Fringilla_montifringilla, 49 Furnarius_rufus, 50 Gallus_gallus, 51 Garrulax_milleti, 52 Grallina_cyanoleuca, 53 Gymnorhina_tibicen, 54 Hirundo_pyrrhonota, 55 Hirundo_rustica, 56 Hylophilus_poicilotis, 57 Icterus_parisorum, 58 Irena_cyanogaster, 59 Lalage_leucomela, 60 Lanius_excubitor, 61 Loboparadisaea_sericea, 62 Malurus_melanocephalus, 63 Manucodia_atra, 64 Manucodia_chalybata, 65 Melampitta_gigantea, 66 Melampitta_lugubris, 67 Melanocharis_nigra, 68 Melanocharis_versteri, 69 Melanodryas_cucullata, 70 Meliphaga_analoga, 71 Menura_novaehollandiae, 72 Microeca_papuana, 73 Mimus_patagonicus, 74 Mionectes_macconnellii, 75 Modulatrix_stictigula, 76 Monarcha_axillaris, 77 Monarcha_chrysomela, 78 Motacilla_cinerea, 79 Muscicapa_ferruginea, 80 Nectarinia_olivacea, 81 Neodrepanis_coruscans, 82 Oedistoma_iliolophum, 83 Oreoica_gutturalis, 84 Oriolus_larvatus, 85 Oriolus_xanthonotus, 86 Orthonyx_spaldingii, 87 Orthonyx_teminckii, 88 Pachycephala_hyperthra, 89 Pachycephala_soror, 90 Pachycephalopsis_poliosoma, 91 Paradisaea_raggiana, 92 Paramythia_montium, 93 Pardalotus_punctatus, 94 Pardalotus_striatus, 95 Parula_americana, 96 Parus_inornatus, 97 Parus_major, 98 Passer_montanus, 99 Peneothello_bimaculatus, 100 Pericrocotus_ethologus, 101 Philepitta_castanea, 102 Philesturnus_carunculatus, 103 Picathartes_gymnocephalus, 104 Pipra_coronata, 105 Pitohui_cristatus, 106 Pitta_sordida, 107 Ploceus_cucullatus, 108 Polioptila_caerulea, 109 Pomatostomus_halli, 110 Pomatostomus_isidorei, 111 Prionops_plumatus, 112 Promerops_cafer, 113 Prunella_collaris, 114 Psarisomus_dalhousiae, 115 Ptilogonys_cinereus, 116 Ptilonorhynchus_violaceus, 117 Ptiloris_magnificus, 118 Ptilorrhoa_caerulescens, 119 Pycnonotus_barbatus, 120 Regulus_calendula, 121 Regulus_satrapa, 122 Remiz_pendulinus, 123 Rhipidura_hyperthra, 124 Rupicola_rupicola, 125 Schiffornis_turdinus, 126 Scytalopus_magellanicus, 127 Sitta_carolinensis, 128 Smithornis_rufolateralis, 129 Sphecotheres_viridis, 130 Strepera_graculina, 131 Struthidea_cinerea, 132 Sturnus_vulgaris, 133 Sylvia_nana, 134 Telophorus_dohertyi, 135 Thamnophilus_nigrocinereus, 136 Thraupis_cyanocephala, 137 Tityra_semifasciata, 138 Toxorhamphus_novaeguineae, 139 Tregellasia_leucops, 140 Troglodytes_aedon, 141 Turdus_falklandii, 142 Tyrannus_tyrannus, 143 Vanga_curvirostris, 144 Vireo_philadelphia, 145 Yuhina_zantholeuca, 146 Zosterops_senegalensis; TREE Fig._1 = [&R] (50:0.0580975,(25:0.049315,(1:0.052216,(((106:0.033811,(128:0.024894,(114:0.022158,(81:0.019308,101:0.018403):0.006128):0.006898):0.001228):0.008156,((135:0.031731,(24:0.027042,(126:0.026993,(47:0.027415,(11:0.014213,49:0.018414):0.007398):0.001088):0.002844):4.51E-4):0.006518,(104:0.013742,((74:0.027731,142:0.019608):0.002516,(124:0.019665,(125:0.015677,137:0.011959):0.002763):0.001142):8.81E-4):0.011684):0.003533):0.005131,(71:0.031982,(((4:0.013878,116:0.012076):0.014567,(29:0.015177,(20:0.008562,21:0.008847):0.01138):0.015186):0.006162,((62:0.037798,((44:0.015744,70:0.008166):0.012755,(93:0.00538,94:0.004928):0.02004):0.002118):0.007361,((109:0.006957,110:0.004932):0.028409,((86:0.009158,87:0.007584):0.017225,(((15:0.018686,103:0.0174):0.008676,(((45:0.02744,90:0.024245):0.004895,(72:0.022544,(139:0.005551,(69:0.004049,99:0.005588):0.003374):0.01795):0.003457):0.003648,((((35:0.023643,42:0.022131):0.011607,(122:0.044169,(96:0.008785,97:0.007319):0.018279):0.003471):5.0E-4,(5:0.024978,((2:0.01761,(54:0.010447,55:0.006869):0.019701):0.001683,(119:0.029812,(19:0.027797,(133:0.021857,(51:0.01973,146:0.023794):0.003055):0.002984):8.05E-4):0.001578):0.00204):0.003207):0.001628,((((14:0.026182,127:0.051362):0.001743,(108:0.016658,140:0.021246):0.005922):0.004829,((120:0.010101,121:0.011839):0.022571,((10:0.022202,115:0.015861):0.009003,((73:0.018916,132:0.019928):0.007774,(18:0.026251,(79:0.024081,(13:0.013936,141:0.012249):0.014749):0.002928):0.002003):0.008068):0.001389):6.36E-4):2.61E-4,((112:0.020596,(6:0.006384,75:0.007744):0.010244):0.002981,((38:0.019848,80:0.022393):0.004304,((17:0.022605,58:0.02505):0.002364,(113:0.020984,(107:0.018687,(98:0.021786,(78:0.017006,(48:0.017785,((57:0.012412,95:0.010617):0.005732,(43:0.0144,(12:0.011134,136:0.013268):0.002777):0.001408):0.00354):0.002154):9.99E-4):0.001887):0.001589):0.006689):6.11E-4):0.001328):0.00122):4.13E-4):0.003684):0.001242):0.001362,(((102:0.019793,(22:0.003709,61:0.005365):0.018231):8.39E-4,((67:0.00572,68:0.005294):0.007562,(82:0.010555,138:0.018189):0.001417):0.010093):0.001507,(37:0.014002,((145:0.020686,(56:0.009553,144:0.008735):0.004464):0.008652,((100:0.022991,(59:0.012615,(26:0.001303,27:0.003647):0.005011):0.002987):0.004407,(((46:0.018352,118:0.021398):0.001016,(23:0.011332,(88:0.00652,89:0.004951):0.010644):0.002129):3.75E-4,(((83:0.009396,105:0.006281):0.011562,(92:0.022502,(129:0.015521,(84:0.005554,85:0.002822):0.012429):0.003622):0.001014):4.64E-4,((((7:0.001603,8:0.003013):0.019219,(130:0.007662,(34:3.05E-4,53:0.002009):0.004336):0.002539):0.004032,(9:0.013392,(111:0.010682,143:0.015509):0.001756,(3:0.018811,(41:0.011442,134:0.020259):0.00264):7.93E-4):9.22E-4):0.004475,((39:0.00276,40:0.00529):0.010068,((16:0.016504,123:0.019353):0.003774,(((30:0.004908,60:0.00536):0.018491,(36:0.005,(31:0.002146,(32:6.04E-4,33:6.03E-4):0.001809):0.009096):0.005731):0.002619,(((63:7.2E-4,64:0.00174):0.009195,(91:0.003057,117:0.003272):0.003362):0.003872,((28:0.006828,131:0.007724):0.006824,((65:0.005831,66:0.0041):0.007015,(52:0.0124,(76:0.006254,77:0.006178):0.006636):0.011315):0.001039):6.8E-4):0.001072):0.001317):3.54E-4):0.004):9.69E-4):7.88E-4):0.001432):0.001387):5.75E-4):0.004702):9.09E-4):0.001917):9.73E-4):0.002606):0.007337):0.003662):0.014218):0.006092):0.014699):0.0580975); END;