#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 11:14 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., Hidayat I.-., Kramadibrata K., Nurcahyanto D., Siahaan S.A., & Takamatsu S. 2011. Cystotheca tjibodensis (Erysiphaceae, Ascomycota): Ninety years rediscovery in Java and first finding of anamorph. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S11971] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=8; TAXLABELS Cystotheca_lanestris_ex_Myrica_californica_AF011288_USA Cystotheca_lanestris_ex_Quercus_agrifolia_AB000933_USA Cystotheca_lanestris_ex_Quercus_agrifolia_AF011289_USA Cystotheca_lanestris_ex_Quercus_sp._AF073354_KOR Cystotheca_tjibodensis_ex_Castanopsis_argentea_A Cystotheca_tjibodensis_ex_Castanopsis_argentea_T Cystotheca_wrightii_ex_Quercus_glauca_AB000932_JPN Sawadaea_nankinensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10430] TITLE Cystotheca_tjibodensis; LINK TAXA = Taxa1; DIMENSIONS NCHAR=488; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cystotheca_lanestris_ex_Myrica_californica_AF011288_USA ---------------CGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG Cystotheca_lanestris_ex_Quercus_agrifolia_AB000933_USA CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG Cystotheca_lanestris_ex_Quercus_agrifolia_AF011289_USA ------------GCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG Cystotheca_lanestris_ex_Quercus_sp._AF073354_KOR CTGAGCGTGAAGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTTGCGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTATGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAACACCCATTCTAACAGG Cystotheca_tjibodensis_ex_Castanopsis_argentea_A -------------------------------------------------CCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCCGGCGTCGGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCGTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCGGCCCTTAAATGCAGTGGCGGTGCCGTTGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACTTGCCAAAAGGCTCATCTCATTCGG Cystotheca_tjibodensis_ex_Castanopsis_argentea_T ---GACGTGAGGCCACGCTGGGCGCCTGGCGCCTGGCGGGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCCGGCGTCGGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCGTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCGGCCCTTAAATGCAGTGGCGGTGCCGTTGGGCTCTACGCGTAGTTATTTCTCTCGCG------------------------------------------- Cystotheca_wrightii_ex_Quercus_glauca_AB000932_JPN CTGAGCGTGAGGCCACGCTGGGCGCCTGGCGCCAGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCATCATACTAGG Sawadaea_nankinensis CTGAGCGTGA-GCCACGCAGGGCGC---AAGCCCCGCGCGGCCGACCCTCCACCCGTGCCGACTCATATCCGGTTGCCCTGGCGG--------------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAA--TAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCG-CCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG ; END; BEGIN TREES; TITLE Cystotheca_tjibodensis; LINK TAXA = Taxa1; TRANSLATE 1 Sawadaea_nankinensis, 2 Cystotheca_lanestris_ex_Myrica_californica_AF011288_USA, 3 Cystotheca_lanestris_ex_Quercus_agrifolia_AB000933_USA, 4 Cystotheca_lanestris_ex_Quercus_agrifolia_AF011289_USA, 5 Cystotheca_lanestris_ex_Quercus_sp._AF073354_KOR, 6 Cystotheca_wrightii_ex_Quercus_glauca_AB000932_JPN, 7 Cystotheca_tjibodensis_ex_Castanopsis_argentea_T, 8 Cystotheca_tjibodensis_ex_Castanopsis_argentea_A; TREE PAUP_1 = [&R] (1,(((((2,4),3),5),6),(7,8))); TREE PAUP_2 = [&R] (1,((((2,3,4),5),6),(7,8))); END;