#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:16 GMT TreeBASE (cc) 1994-2008 Study reference: Cui B., & Zhao C.L. 2012. Morphological and molecular evidence for a new species of Perenniporia (Basidiomycota) from Tibet, southwestern China. Mycoscience, 53(5): 365-372. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12012] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=43; TAXLABELS Perenniporia_corticol_Cui_1248 Perenniporia_corticol_Cui2655 Perenniporia_corticol_Dai_7330 Perenniporia_detrita_MUCL_42649 Perenniporia_fraxinea_Cui_7154 Perenniporia_fraxinea_Cui_8871 Perenniporia_fraxinea_Cui_8885 Perenniporia_fraxinea_DP_83 Perenniporia_japonica_Cui_7047 Perenniporia_latissima_Cui_6625 Perenniporia_maackiae_Cui_5605 Perenniporia_maackiae_Cui_8929 Perenniporia_martia_Cui_7992 Perenniporia_martia_MUCL_41677 Perenniporia_martia_MUCL_41678 'Perenniporia medulla-panis Dai 10780' 'Perenniporia medulla-panis MUCL 49581' Perenniporia_minor_Cui_5738 Perenniporia_narymica_Dai_10510 Perenniporia_narymica_Dai_7016 Perenniporia_ochroleuca_Dai_11486 Perenniporia_ochroleuca_MUCL_39563 Perenniporia_ochroleuca_MUCL_39726 Perenniporia_ohiensis_Cui5714 Perenniporia_ohiensis_MUCL_4103 Perenniporia_piceicola_Dai_4184 Perenniporia_pyricola_Cui_9149 Perenniporia_pyricola_Dai_10265 Perenniporia_robiniophila_Cui_5644 Perenniporia_robiniophila_Cui_7144 Perenniporia_robiniophila_Cui_9144 Perenniporia_straminea_Cui_8718 Perenniporia_straminea_Cui_8858 Perenniporia_subacida_Cui_3643 Perenniporia_subacida_Dai_8224 Perenniporia_subacida_MUCL_31402 Perenniporia_tenuis_Cui_5523 Perenniporia_tephropora_Cui_6331 Perenniporia_tephropora_Cui_9029 Perenniporia_tibetica_Cui_9457 Perenniporia_tibetica_Cui_9459 Perenniporia_truncatospora_Dai_5125 Trametes_versicolor_M_126 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=44; TAXLABELS Perenniporia_corticol_Cui_1248 Perenniporia_corticol_Cui2655 Perenniporia_corticol_Dai_7330 Perenniporia_detrita_MUCL_42649 Perenniporia_fergusii_Gilbertson16116 Perenniporia_fraxinea_Cui_7154 Perenniporia_fraxinea_Cui_8871 Perenniporia_fraxinea_Cui_8885 Perenniporia_fraxinea_DP_83 Perenniporia_japonica_Cui_7047 Perenniporia_latissima_Cui_6625 Perenniporia_maackiae_Cui_8929 Perenniporia_martia_Cui_7992 Perenniporia_martia_MUCL_41677 Perenniporia_martia_MUCL_41678 'Perenniporia medulla-panis Dai 10780' 'Perenniporia medulla-panis MUCL 49581' Perenniporia_minor_Cui_5738 Perenniporia_minor_Cui_5782 Perenniporia_narymica_Dai_10510 Perenniporia_narymica_Dai_7016 Perenniporia_ochroleuca_Dai_11486 Perenniporia_ochroleuca_MUCL_39563 Perenniporia_ochroleuca_MUCL_39726 Perenniporia_ohiensis_Cui5714 Perenniporia_ohiensis_MUCL_4103 Perenniporia_piceicola_Dai_4184 Perenniporia_rhizomorph_Cui_7507 Perenniporia_rhizomorph_Dai_7248 Perenniporia_robiniophila_Cui_5644 Perenniporia_robiniophila_Cui_7144 Perenniporia_robiniophila_Cui_9144 Perenniporia_straminea_Cui_8718 Perenniporia_straminea_Cui_8858 Perenniporia_subacida_Cui_3643 Perenniporia_subacida_Dai_8224 Perenniporia_subacida_MUCL_31402 Perenniporia_tenuis_Cui_5523 Perenniporia_tephropora_Cui_6331 Perenniporia_tephropora_Cui_9029 Perenniporia_tibetica_Cui_9457 Perenniporia_tibetica_Cui_9459 Perenniporia_truncatospora_Dai_5125 Trametes_versicolor_M_126 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17900] TITLE Perenniporia__ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=579; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Perenniporia_corticol_Cui_1248 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGATGTTATTAGCGAGGCCTTT---ACG---GGTCTTGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTAACA-GAATGTGT--ATTGCG--ATATAA-CGCATT--TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAG--CCTTTGCGGG--TTTATTAGGCTTGGACTT-GGAGGCTT---GTCGGCCC--AG-----CGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_corticol_Cui2655 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGATGTTATTAGCGAGGCCTTT---ACG---GGTCTTGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTAACA-GAATGTGT--ATTGCG--ATATAA-CGCATT--TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAG--CCTTTGCGGG--TTTATTAGGCTTGGACTT-GGAGGCTT---GTCGGCCC--AG-----CGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_corticol_Dai_7330 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGATGTTATTAGCGAGGCCTTT---ACG---GGTCTTGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTAACA-GAATGTGT--ATTGCG--ATATAA-CGCATT--TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAG--CCTTTGCGGG--TTTATTAGGCTTGGACTT-GGAGGCTT---GTCGGCCC--AG-----CGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_detrita_MUCL_42649 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCAAT-----TGTGCACGCCCAGTTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCGGGTTG-TGGACTG-AGTCTTT---ACT----GGCTTGTGAAGC---A-TCCGGGCTTACGTTTA--TTACA--AACTAC--AAGTATAA-GAATGT----TTTGCG--ATATAA-CGCATC--TATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACTT-ATACG--CTTTTGT-GG--CGTAT-AGGCTTGGACTT-GGAGGCTT---GTTGGT-TTAGT------ACC-GACTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATTAGCTCTTGGTGTGATAATTAT--TTACGCCGTGACTATGAAGCGTTT---GGCA-GGCTGCT-AATCGTCT Perenniporia_fergusii_Gilbertson16116 TTGAAGGGGTTGTAGCTGGCCTTGC-GAGGCA-------TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTAGGCT-TC-GGAGGCG---AAGCGGGCTTCA--------TCGCTCGCGGAC----CCGACGGGCTTACGTTTT-ATTACAA-AC--CCTTCAGT-ATCAGAACGTG--TATCGCG--GATTAA-CGCAT---TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTCGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCTTACGAG--CCTTTGCGGGT-TCAGTAG-GGTTGGACTTTGGAGGCTT---GTCGGCCTTGTC------GGTCGGCTCCTCTCAAACGCATTAGCTT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AACGGTCT Perenniporia_fraxinea_Cui_7154 TGAA-GGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGTGCTTTC----------GCTCGCGGAT----CTAACGGGCCCGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TATCGCG--ATGTAA-CGCATC--TATACACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGG--TCTTTGCAGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCGT------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_fraxinea_Cui_8871 TGAA-GGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGTGCTTTC----------GCTCGCGGAT----CTAACGGGCCCGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGG--TCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCGT------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_fraxinea_Cui_8885 TGAAAGGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGTGCTTTC----------GCTCGCGGAT----CTAACGGGCCCGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGG--TCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCGT------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_fraxinea_DP_83 TGAAAGGGGTTGTAGCTGGCCTTCA-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGTGCTTTC----------GCTCGCGGAT----CTAACGGGCCCGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TGTCGCG--ACGTAA-CGCGTC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCTTACCGG--TCTTTGCAGA--TCGGGTAAGGCTTGGACTTGGAGGCTT---GTCGGCCT-T------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_japonica_Cui_7047 TG-ACCGGGTTGTCGCTGGCCTCAC-GAGGCAA------CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTCACTGTGGGTT-TCGGATCGCAA-AGCG-GGCCTTC---GCG---GGTCTTGTGGAGC---G-TCTGGGCCTGCGTTTA--TCACAA-ACTCTTACA-GTATCA-GAATGTGT--ATTGCG--ACGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAG--C-CTT-TGC---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT--GG-----CGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATCGT--CTACGCCGCGACCGTGAAGCGTCT---GGCG-AGCTTCT-AACCGTCT Perenniporia_latissima_Cui_6625 TTGAAGGGGTTGTAGCTGGCCTTCC-GAGGCATATAATATGTGCACACCCTGCTCAATCCCACTCTCTACACCTGTGCACTTACTGTGGGTTTCTCCGAGGTGGCAGAGCGGGCCTTTTTTCT---TGGCCTGCGAAG--CCCTTCTGGGCCTGCGTTTTTATTATAA-AC--TCTAAAGTGATCAGAATGTGTGCAATGCGCGATGTAAACGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAC-TCCTCAACTCCACGGG--CCCTTGTGGGGGTTTGTAG-GGTTGGACTTTGGAGGTGTGTTGTCGGCCTGGT-----GGGGTCGGCTCCTCTTAAATGCATTAGTTCTGGTTCCTTGTGGATCGGCTCTCGGTGTGATAAATGTGTCTATGCTGCGGCCGTGAAGCGTTT---GGCGGAGCTTCTTAACTGTCC Perenniporia_maackiae_Cui_8929 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGATGTTATTAACGGGGCCTTT---ACG---GGTCTCGTGAAAG---CCTCTGTGCCTGCGTTTA--TTACAA-ACTCTTAAAAGTAACA-GAATGTGT--ATTGCG--ATGTAA-CGCATT--TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAG--CCTTTGCGGG--TTTATTAGGCTTGGATTT-GGAGGCTT---GTCGGCCT--AG-----CGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_martia_Cui_7992 TG-AAGGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTA--TCGGAGGTG---AAGCGTGCTTTC----------GCTCGCGGA----TCTAACGGGCCCGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAATGTG--TATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAT-CCCTCAACTT-ACAGG--CCTTTGTGG---TTTGTAG-GGTTGGACTTTGGAGGTGT--TGTCGGCCAGGC-----GGT-CCGGCTCCTCCTAAATGCATTAGTTC-GGTTCCTTGTGAATCGGCTCTCGGCGTGATAATTGT--CTGCGCTGTGGCCGTGAAGCGTTT---GACG-AGCTTCTTAGCTGTCT Perenniporia_martia_MUCL_41677 TGAAAGGGGTTGTAGCTGGCCTTCC-GGGGCA------ATGTGCACGCCCTGCTCAATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTC-CTCTGGGGCG-CTGAGCGGGCCTTT---CT---TGGCCTGTGAAGCCCCCCTCCGGGCCTGCGTTTTTATTATAA-AC--TCCAAAGTCGTCGGAATGTG--CAATGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAT-CCCTCAACTT-ACAGG--CCTTTGTGG---TTTGTAG-GGTTGGACTTTGGAGGTGT--TGTCGGCCAGGC-----GGT-CCGGCTCCTCCTAAATGCATTAGTTC-GGTTCCTTGTGAATCGGCTCTCGGCGTGATAATTGT--CTGCGCTGTGGCCGTGAAGCGTTT---GACG-AGCTTCTTAGCTGTCT Perenniporia_martia_MUCL_41678 TGAAAGGGGTTGTAGCTGGCCTTCC-GGGGCA------ATGTGCACGCCCTGCTCAATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTC-CTCTGGGGCG-CCGAGCGGGCCTTT---CT---TGGCCTGTGAAAGCCCCCTCCGGGCCTGCGTTTTTATTATAA-AC--TCCAAAGTCGTCGGAATGTG--CAATGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAT-CCCTCAACTT-ACAGG--CCTTTGTGG---TTTGTAG-GGTTGGACTTTGGAGGTGT--TGTCGGCCAGGC-----GGT-CCGGCTCCTCCTAAATGCATTAGTTC-GGTTCCTTGTGAATCGGCTCTCGGCGTGATAATTGT--CTGCGCTGTGGCCGTGAAGCGTTT---GACG-AGCTTCTTAGCTGTCT 'Perenniporia medulla-panis Dai 10780' TG-ACAGGGTTGTAGCTGGCCTTCC-GAGGCAA------TGTGCACGCCCTTGTTCATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTT-TCAGTTGAATGAAGCG-AGCCTTTTAAATTAAAGGGCTTGTGGAATT-TATTCTGTGCCTGCGTTTA--TCACATTAAACTCCATTGTATCA-GAATGTGTATATTGCG--ATGTAA-CGCATC--TATGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TATTCAATCT-ACAAG--TCTTTGC-----TTTGT-AGTTTTGGATTT-GGAGGCTT---GCCGGTTTGTATTTGACAAACTGGCTCCTCTTAAATGCATTAGCTT-GATTTCTTGCAGATCAGCTCCTGGCGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGCTT---GGCG-AGCTTCT-AGTTGTCT 'Perenniporia medulla-panis MUCL 49581' TG-ACAGGGTTGTAGCTGGCCTTCC-GAGGCAA------TGTGCACGCCCTTGTTCATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTT-TCAGTTGAATGAAGCG-AGCCTTTTAAATTAAAGGGCTTGTGGAATT-TATTCTGTGCCTGCGTTTA--CAACAT-AAACTCTATTGTATCA-GAATGTGTATATTGCG--ATGTAA-CGCATC--TATGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAATCTTCAACCT-ACAAA--CCTTTGC-----TTTGT-AGTTTTGGATTT-GGAGGCTT---GCCGGTTTGTATTTGACAAACTGGCTCCTCTTAAATGCATTAGCTT-GATTTCTTGCAGATCAGCTCCTGGCGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGCTT---GGCG-AGCTTCT-AGTTGTCT Perenniporia_minor_Cui_5738 TG-ACTAGGTTGTAGCTGGCCTTAC-GAGGCA-------TGTGCTCGCCTTGCTC-ATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAAATGT-GAAAGTG-AGCCCTT---GTG----GGTTTGTTGAAG---CATTTGTGCCTGCGTTTC--TTACA--CACTCT--AAGTCAAT-GAATGT----ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAG--CCTTTGC-----TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCTTAGGT---------CGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGTGTTT---GGCA-AGCTTCA-AACCGTCT Perenniporia_minor_Cui_5782 TG-ACTAGGTTGTAGCTGGCCTTAC-GAGGCA-------TGTGCTCGCCTTGCTC-ATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAAATGT-GAAAGTG-AGCCCTT---GTG----GGTTTGTTGAAG---CATTTGTGCCTGCGTTTC--TTACA--CACTCT--AAGTCAAT-GAATGT----ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAG--CCTTTGC-----TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCTTAGGT---------CGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGTGTTT---GGCA-AGCTTCA-AACCGTCT Perenniporia_narymica_Dai_10510 GA-A-CGGGTTGTAGCTGGCCTTCT-TTGGCAC------CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTAGGTT-TCAGA-CGCGA---TGCGAGTTTA----------GGCTCGCGGAGC---TTATGGGGCTTACGTTTC--AACCAC-AAACGCTTCAGTATCA-GAATGTGT--ATCGCG--ATGTAA-CGCATC--TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAA-CCTATAAG--CCTTTGCGGG--TTTTGTAGGATTGGACTTGGAGGTTTT---GTCGGC--TCACG-------TCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AACCGTCT Perenniporia_narymica_Dai_7016 GA-A-CGGGTTGTAGCTGGCCTTCT-TTGGCAC------CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTAGGTT-TCAGA-CGCGA---TGCGAGTTTA----------GGCTCGCGGAGC---TTATGGGGCTTACGTTTC--AACCAC-AAACGCTTCAGTATCA-GAATGTGT--ATCGCG--ATGTAA-CGCATC--TAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAA-CCTATAAG--CCTTTGCGGG--TTTTGTAGGATTGGACTTGGAGGTTTT---GTCGGC--TCACG-------TCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AACCGTCT Perenniporia_ochroleuca_Dai_11486 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT-TCGGATGG-TGGAGCA-AGTCTTT---ATT----GGCTTGTGAAGC---AGTCCGGGCTTACGTTTA--TTACA--AACCACACAAGTATTG-GAATGT----ATTGCA--ATATAA-TGCATT--TATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAATCTTATAGG--TCTTTGCGGG--TCTAT-AGGCTTGGACTT-GGAGGCTT---GTCGGTATTAAT------GCCCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGCGTTTT--GGCA-AGCTTCT-AACTGTCT Perenniporia_ochroleuca_MUCL_39563 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT-TCGGATGG-TGGAACA-AGTCTTT---ATT----GGCTTGTGAAGC---AGTCCGGGCTTACGTTTA--TTACA--AACCACACAAGTATTA-GAATGT----ATTGCA--GTATAA-TGCATT--TATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAATCT-ATAGG--CCTTTGCAGG--TCTAT-AGGCTTGGACTT-GGGGGCTT---GTCGGTATTTAT------GCC-GGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTTT--GGCA-AGCTTCT-AACTGTCT Perenniporia_ochroleuca_MUCL_39726 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT-TCGGATGG-TGGAACA-AGTCTTT---ATT----GGCTTGTGAAGC---AGTCCGGGCTTACGTTTA--TTACA--AACCACACAAGTATTA-GAATGT----ATTGCA--GTATAA-TGCATT--TATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAATCT-ATAGG--CCTTTGCAGG--TCTAT-AGGCTTGGACTT-GGGGGCTT---GTCGGTATTTAT------GCC-GGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTTT--GGCA-AGCTTCT-AACTGTCT Perenniporia_ohiensis_Cui5714 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT-TCGGATTG-TGGACCG-AGCCTTT---ACT----GGCTTGGGAAGC---GTCCGGGTCCTACCTTTA--TTACA--AACCAC--AAGTATAA-GAATGT----ATTGCG--ATATAA-CGCATC--TATAGACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATTGT--CCTTTGT-GA--TCTAT-AGGCTTGGACTT-GGAGGCTT---GTCGGC-GTAGT------GCT-GGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTGTCGGTGTGATAATTGT--CTACGCCGCAACCGTGAAGCGTTT---GGCG-AGCTTCT-AACCGTCT Perenniporia_ohiensis_MUCL_4103 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACACCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT-TCGGATTG-TGGACCG-AGCCTTT---ACT----GGCTTGGGAAGC---GTCCGGGTCCTACCTTTA--TTACA--AACCAC--AAGTATGA-GAATGT----ATTGCG--ATATAA-CGCATC--TATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-GTAGT--CCTTTGC-GA--TCTAT-AGGCTTGGACTT-GGAGGCTT---GTCGGT-GTAGT------GCC-GGCTCCTCTTAAATACATTAGCTT-GATTCCTTGCGGATCGGCTGTCGGTGTGATAATTGT--CTACGCCGCAACCGTGAAGCGTTT---GAGA-CACTGCT-AATCGTCT Perenniporia_piceicola_Dai_4184 TG-ACTGGGTTGTCGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAAATCGTGA-AGCG-TGCCTTT---GTG---GGT-TCGCAAAGC---GGTCTGAGCCTGCGTTTA--TTACAA-ACCCTTACAAGTAACA-GAATGTGT--ATCGCG--ATGTAA-TGCATC--ATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCATCAACCT-ACAAG--C-TTTGCGG---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT--AA-----CGGTCGGCTTCTCTTAAATGCATTAGCTC-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTT---GGTG-AGCTTCT-AACCGTCT Perenniporia_rhizomorph_Cui_7507 TGAAACGGGTTGTAGCTGGCCTTTCCAAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCTC-ACACCTGTGCACTCATTGTGGGTT-TCTGGAGGTG---ATGTGGGGTTTC--------GGCTCTGCGGAGG---TTCTGGGGCCTACGTTTT-ATTACAA-AC--TCTTCAGT-GTCAGAATGTT--TATTGCG--ACGTAA-CGCATCCATATATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTATCAACCTTACGAAGTCTTTTGCGAGA-CTTGTGGAGGCTTGGACTTGGAGGCTT---GTCGGCCCGGCTC---GTGGTCGGCTCCTTTTAAATGCATTAGCTC-GTTCCCTTGCGGATCGGCCGTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTTTTGGGCG-AGCTTCG-AATCGTCT Perenniporia_rhizomorph_Dai_7248 TGAAACGGGTTGTAGCTGGCCTTTCCAAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCTC-ACACCTGTGCACTCATTGTGGGTT-TCTGGAGGTG---ATGTGGGGTTTC--------GGCTCCGCGGAGG---TTCTGGGGCCTACGTTTT-ATTACAA-AC--TCTTCAGT-GTCAGAATGTT--TATTGCG--ACGTAA-CGCATCCATATATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTATCAACCTTACGAAGTCTTTTGCGAGA-CTTGTGGAGGCTTGGACTTGGAGGCTT---GTCGGCCCGGCTC---GTGGTCGGCTCCTTTTAAATGCATTAGCTC-GTTCCCTTGCGGATCGGCCGTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTTTTGGGCG-AGCTTCG-AATCGTCT Perenniporia_robiniophila_Cui_5644 TGAAAGGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGCGCTTTC----------GCTCGCGGAT----CTAACGGGCCTGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGG--TCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCGT------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_robiniophila_Cui_7144 TGAA-GGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGCGCTTTC----------GCTCGCGGAT----CTAACGGGCCTGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGG--TCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCGT------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_robiniophila_Cui_9144 TGAAAGGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCCGCTCAATCC---ACTCTACACCTGTGCACTTACTGTGGGTT--TCGGAGGTG---AAGCGCGCTTTC----------GCTCGCGGAT----CTAACGGGCCTGCGTTTT-ACTACAA-ACACTTTAAAGTAAAC-GAACGTG--TATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGG--TCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCGT------GTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCT-GGCTTCT-AACCGTCT Perenniporia_straminea_Cui_8718 TG-ACTGGGTTGTAGCTGGCCTTAC-GAGGCA-------TGTGCACACCCTGTTAA-TCC-ACTCT--ACACCTGTGCACTTACTGTGAGCT-TCAGAGCATGA-A-TG-GGCCTTT---GCG---GGC-TCTTGAAGT---GCTTTGGGCTTGCGTTCC--TTACAA-ACTC--GAATGTAACA-GAATGTCT--ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCATCAACTT-ACAAG--CCTTTGTGG---TTTGT-ACGCTTGGACTTTGAAGGCTT---GTCGGCTTCTAT-----AAGTTGGCTCCTTTTAAATGCATTAGCTT-GATTCCTTGCGGAGCGGTTCTCGGTGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGTTT---GGCG-AGCTTCT-AATTGTCT Perenniporia_straminea_Cui_8858 TG-ACTGGGTTGTAGCTGGCCTTAC-GAGGCA-------TGTGCACACCCTGTTAA-TCC-ACTCT--ACACCTGTGCACTTACTGTGAGCT-TCAGAGCATGA-A-TG-GGCCTTT---GCG---GGC-TCTTGAAGT---GCTTTGGGCTTGCGTTCC--TTACAA-ACTC--GAATGTAACA-GAATGTCT--ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCATCAACTT-ACAAG--CCTTTGTGG---TTTGT-ACGCTTGGACTTTGAAGGCTT---GTCGGCTTCTAT-----AAGTTGGCTCCTTTTAAATGCATTAGCTT-GATTCCTTGCGGAGCGGTTCTCGGTGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGTTT---GGCG-AGCTTCT-AATTGTCT Perenniporia_subacida_Cui_3643 GA-AAGGGGTTGTAGCTGGCCTTCT-TTGGCAC------CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTCACTGTAGGTT-TCAAA-GGTGA---CGCGAGTTTC----------GGCTCGTGGAGC---TTTTGGG-CTTACGTTTC--A-CTAT-AAACGCTTTAGTATCA-GAATGTGT--ATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAA-CCTATGAG--CCTTTGCGGG--TTT-GTAGGATTGGACTTGGAGGTCT----GTTGGC--TTGCG-------TCGGCTCCTCTCAAATGCATTAGCTC-GATTCCTTGTGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATGGTCT Perenniporia_subacida_Dai_8224 GA-A-GGGGTTGTAGCTGGCCTTCT-TTGGCAC------CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTCACTGTAGGTT-TCAAA-GGTGA---CGCGAGTTTC----------GGCTCGTGGAGC---TTTTGGG-CTTACGTTTC--A-CTAT-AAACGCTTTAGTATCA-GAATGTGT--ATCGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAA-CCTATGAG--CCTTTGCGGG--TTT-GTAGGATTGGACTTGGAGGTCT----GTCGGC--TTGCG-------TCGGCTCCTCTCAAATGCATTAGCTC-GATTCCTTGTGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATGGTCT Perenniporia_subacida_MUCL_31402 GA-AAGGGGTTGTAGCTGGCCTTCT-TTGGCAC------CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTAGGTT-TCAAA-GGTGA---CGCGAGTTTC----------GGCTCGTGGAGC---TTTTGGG-CTTACGTTTC--A-CTAT-AAACGCTTTAGTATCATGAATGTGT--ATCGCG--ATG-AA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAA-CCTATGAG--CCTTTGCGGG--TTT-GTAGGATTTGGACTGGAGGTCT----GTCGGC--TTGCG-------TCGGCTCCTCTCAAATGCATTAGCTC-GATTCCTTGCGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AACGGTCT Perenniporia_tenuis_Cui_5523 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGACGGTGT-AGCG-GGTCTTT---ACC---GGC-TCGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTATTA-GAATGTGT--ATTGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAA--CCTTTGCGGG--CTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT--AA-----TGGTCGGCTCCTCTTAAATGTATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_tephropora_Cui_6331 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGACGGTGT-AGCG-AGCCTTT---ACG---GGT-TCGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTAAAT-GAATGTGT--ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAA--CCTTTGCGGG--TTTGT-AGGCTTGGATTT-GGAGGCTT---GTCGGCCT--AA-----CGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_tephropora_Cui_9029 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGACGGCGT-AGCG-AGCCTTT---ACG---GGT-TCGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTAAAT-GAATGTGT--ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAA--CCTTTGCGGG--TTTGT-AGGCTTGGATTT-GGAGGCTT---GTCGGCCT--AA-----CGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Perenniporia_tibetica_Cui_9457 TG-ACTGGGTTGTAGCTGGCCTTAC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGCT-TCGGATCGTGA-AGCG-GGCCTTT---GCG---GGT-TCGTGAAGC---G-TCCGGGCCTGCGTTTA--TCACAA-ACCC--GATAGTAACA-GAATGT----ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAG--CCTTTGCGT---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCTC---------AGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AACCGTCT Perenniporia_tibetica_Cui_9459 TG-ACTGGGTTGTAGCTGGCCTTGC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGCT-TCGGATCGTGA-AGCG-GGCCTTT---GCG---GGT-TCGTGAAGC---G-TCCGGGCCTGCGTTTA--TCACAA-ACCC--GATAGTAACA-GAATGT----ATTGCG--ATATAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAG--CCTTTGCGT---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCTC---------AGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AACCGTCT Perenniporia_truncatospora_Dai_5125 TG-ACTGGGTTGTAGCTGGCCTTCC-GAGGCA-------TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT-TCAGACGGTGT-AGCG-GGTCTTT---ACT---GGC-TCGTGAAAG---CGTCTGTGCCTGCGTTTA--TTACAA-ACTCTTACAAGTATTA-GAATGTGT--ATTGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAA--CCTTTGCGGG--TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT--AA-----TGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT---GGCG-AGCTTCT-AATCGTCT Trametes_versicolor_M_126 GA-AACGGGTTGTAGCTGGCCTCTC-CGGAGGCA-----TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTA-TCGGAAGGCGT---CGCGTCGTTT----------ACGGCGAGGCGT---TAACCGTGCCTACGTCTT--A-CTAC-AAACGCTTCAGTATCA-GAATGTGT--ATTGCG--ATGTAA-CGCATC--TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAAACCCATAAG--TCTTTGCGGG--CTTACGGGCTTTGGACTTGGAGGCTTT---GTCGGCGACCGCGAGGTCTGTCGACTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGCGTTTT--GGCG-AGCTTCT-AATCGTCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17901] TITLE 'Perenniporia ITS+LSU'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2054; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Perenniporia_corticol_Cui_1248 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGATGTTATT--AGCGAGGCCTTTACG-----GGTCTTGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAA-CAGAATGTGTA----TTGCGATATAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAGCCTTTGCGGG--TTTATTAGGCTTGGACTT-GGAGGCTT---GTCGGCCC-------AGCGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAATTCAT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCCGAAAGGAAC-----------AGCAGACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_corticol_Cui2655 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGATGTTATT--AGCGAGGCCTTTACG-----GGTCTTGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAA-CAGAATGTGTA----TTGCGATATAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAGCCTTTGCGGG--TTTATTAGGCTTGGACTT-GGAGGCTT---GTCGGCCC-------AGCGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAATTTAT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAAGGGGGAAGGAATC--TCACGGGGAGTAGACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_corticol_Dai_7330 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGATGTTATT--AGCGAGGCCTTTACG-----GGTCTTGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAA-CAGAATGTGTA----TTGCGATATAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAGCCTTTGCGGG--TTTATTAGGCTTGGACTT-GGAGGCTT---GTCGGCCC-------AGCGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAATTCAT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGA-GGAAT-----------AGTAGACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_detrita_MUCL_42649 TGAGTCTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCAATTGTGCACGCCCAGTTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGGTTGTGG---ACTGAGTCTTTACTG------GC-TTGTGAAG---CA-TCCGGGCTTACGTTTA--TTAC-AAAC-TACA--AGTAT---AAGAATGTT----TTGCGATATAA-CGCATCTATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACTT-ATACGCTTTTGT-GG--CGTA-TAGGCTTGGACTT-GGAGGCTT---GTTGGT-TT------AGTACC-GACTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATTAGCTCTTGGTGTGATAATTAT--TTACGCCGTGACTATGAAGCGTTT-GGCA-GGCTGCT-AATCGTCTT-TTAT-AAGACACTGTAAG------CATAT----------------------CAATAAGCGGAG------------------GAAAAG-------------AAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCAG-CTTTGGCTGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCATGCT-TTTGCTTGGTGCATTTTCTGGATA-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTTC--GGGTGTGTT-ATAGACTTTAGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGTAAGGCAGGGGTTTACCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGTAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCCCCTGCCGAATGACCTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGCCAGTGAAGAAGCCTAGG Perenniporia_fraxinea_Cui_7154 -GAGTTTTGAA-GGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGTGCTTTC----------GC-TCGCGGA----TCTAACGGGCCCGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTA----TCGCGATGTAA-CGCATCTATACACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGGTCTTTGCAGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCG------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAACTTT------------------------------------------------------------------------------------GAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_fraxinea_Cui_8871 CGAGTTTTGAA-GGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGTGCTTTC----------GC-TCGCGGA----TCTAACGGGCCCGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGGTCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCG------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAACTTT-C-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAG---------GAAGAAGAACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_fraxinea_Cui_8885 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGTGCTTTC----------GC-TCGCGGA----TCTAACGGGCCCGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGGTCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCG------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAACTTT-C-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCCGGAAGGAAA--CATCGACGGGAGAGACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAACCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_fraxinea_DP_83 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCA--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGTGCTTTC----------GC-TCGCGGA----TCTAACGGGCCCGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTG----TCGCGACGTAA-CGCGTCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCTTACCGGTCTTTGCAGA--TCGGGTAAGGCTTGGACTTGGAGGCTT---GTCGGCCT-------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAGCTTT-C-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTATGCATATCAATAAGCGGAGGAAA-------------AGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTCGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAACCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_japonica_Cui_7047 CGAGTCTTGAC-CGGGTTGTCGCTGGCCTCAC--GAGGCAA-CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTCACTGTGGGTT--TCGGATCGCAA---AGCGGG-CCTTCGCG-----GGTCTTGTGGAG---CG-TCTGGGCCTGCGTTTA--TCAC-AAACTCTTACA-GTAT-CAGAATGTGTA----TTGCGACGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAGCCTT--TGC---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT-------GGCGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATCGT--CTACGCCGCGACCGTGAAGCGTCT-GGCG-AGCTTCT-AACCGTCTC-GTGT-GAGACAGCTCTT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAAT-------------ATGACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTCGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTTTACCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTAAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_latissima_Cui_6625 CGAGTTTTTGAAGGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACACCCTGCTCAATCCCACTCTCTACACCTGTGCACTTACTGTGGGTTTCTCCGA-GGTGGCAGAGCGGGCCTTTTTTCTT---GGC-CTGCGAAG--CCCTTCTGGGCCTGCGTTTTTATTAT-AAAC--TCTAAAGTGATCAGAATGTGTGCAATGCGCGATGTAAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGGACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAC-TCCTCAACTCCACGGGCCCTTGTGGGGGTTTG-TAGGGTTGGACTTTGGAGGTGTGTTGTCGGCCTGG-----TGGGGTCGGCTCCTCTTAAATGCATTAGTTCTGGTTCCTTGTGGATCGGCTCTCGGTGTGATAAATGTGTCTATGCTGCGGCCGTGAAGCGTTT-GGCGGAGCTTCTTAACTGTCCCCTTGTCCGGACGATTTA-T-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA---------------------------------TAACGAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTGTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGGACTCAGCCTTGCT-TACGCTTGGTGCACTTTCCGGATGGACGGGCCAGCATCGATTCTGACCGTTGGAAAAGGGCTGGGGTAATGTGGCACCCTCTGGGGTGTGTT-ATAGACCTTGGTCGCATACGGCGGTCGGGATCGAGGAACCGCAGCGTGCCGCAAGGCAGGGGTTCGCCCACTTT-CACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCACAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGACTGGACCGCTCGGTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGGTGAAGAAGCCTAGG Perenniporia_maackiae_Cui_5605 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGATGTTATT--AACGGGGCCTTTACG-----GGTCTCGTGAAA---GCCTCTGTGCCTGCGTTTA--TTAC-AAACTCTTAAAAGTAA-CAGAATGTGTA----TTGCGATGTAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAGCCTTTGCGGG--TTTATTAGGCTTGGATTT-GGAGGCTT---GTCGGCCT-------AGCGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAATTCAT--TGACCTCTGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGC-GGAGGAAT------------AAGAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCCGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGAT-CTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_maackiae_Cui_8929 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGATGTTATT--AACGGGGCCTTTACG-----GGTCTCGTGAAA---GCCTCTGTGCCTGCGTTTA--TTAC-AAACTCTTAAAAGTAA-CAGAATGTGTA----TTGCGATGTAA-CGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAGCCTTTGCGGG--TTTATTAGGCTTGGATTT-GGAGGCTT---GTCGGCCT-------AGCGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAATTCAT--TGACCTCTGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAAT------------AAGAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCCGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCCCCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_martia_Cui_7992 CGAGTTTTGAA-GGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTA--TCGGA-GGTG---AAGCGTGCTTTC----------GC-TCGCGGA----TCTAACGGGCCCGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AATGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAT-CCCTCAACTT-ACAGGCCTTTGTGG---TTTG-TAGGGTTGGACTTTGGAGGTGT--TGTCGGCCAGG-----CGGT-CCGGCTCCTCCTAAATGCATTAGTTC-GGTTCCTTGTGAATCGGCTCTCGGCGTGATAATTGT--CTGCGCTGTGGCCGTGAAGCGTTT-GACG-AGCTTCTTAGCTGTCTC-TTATCAGGACTAATT----------------------------AGGGAGAC-----------------------------------------------------TAACGAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGCCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----CGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGGACTCAGCCTTGCT-TATGCTTGGTGCACTTTCTGGATG-ACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACCTCGGTCGCATACGGCGGTTGGGATTGAGGAAC-GCAGCGTGCCGCAAGGCAGGG-TTCGCCCACTTTTCACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTCGACTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTCAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGGTGAAGAAGCCTAGG Perenniporia_martia_MUCL_41677 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCC--GGGGCAA-TGTGCACGCCCTGCTCAATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTCC-TCTGG-GGCGCT-GAGCGGGCCTTTCTT------GGC-CTGTGAAGCCCCCCTCCGGGCCTGCGTTTTTATTAT-AAAC--TCCAAAGTCGTCGGAATGTGCA----ATGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAT-CCCTCAACTT-ACAGGCCTTTGTGG---TTTG-TAGGGTTGGACTTTGGAGGTGT--TGTCGGCCAGG-----CGGT-CCGGCTCCTCCTAAATGCATTAGTTC-GGTTCCTTGTGAATCGGCTCTCGGCGTGATAATTGT--CTGCGCTGTGGCCGTGAAGCGTTT-GACG-AGCTTCTTAGCTGTCTC-TTATCAGGACTAATTA-C-TTAAGCATATCAATAAGCGGAGGAAAAGAAAC-----------------------------------------------------TAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGGACTCAGCCTTGCT-TATGCTTGGTGCACTTTCTGGATG-ACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACCTCGGTCGCATACGGCGGTTGGGATTGAGGAAC-GCAGCGTGCCGCAAGGCAGGG-TTCGCCCACTTTTCACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTCGACTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTCAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGGTGAAGAAGCCTAGG Perenniporia_martia_MUCL_41678 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCC--GGGGCAA-TGTGCACGCCCTGCTCAATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTCC-TCTGG-GGCGCC-GAGCGGGCCTTTCTT------GGC-CTGTGAAAGCCCCCTCCGGGCCTGCGTTTTTATTAT-AAAC--TCCAAAGTCGTCGGAATGTGCA----ATGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAT-CCCTCAACTT-ACAGGCCTTTGTGG---TTTG-TAGGGTTGGACTTTGGAGGTGT--TGTCGGCCAGG-----CGGT-CCGGCTCCTCCTAAATGCATTAGTTC-GGTTCCTTGTGAATCGGCTCTCGGCGTGATAATTGT--CTGCGCTGTGGCCGTGAAGCGTTT-GACG-AGCTTCTTAGCTGTCTC-TTATCAGGACTAATTA-C-TTAAGCATATCAATAAGCGGAGGAAAAGAAAC-----------------------------------------------------TAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGCTTTCCGTGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGGACTCAGCCTTGCT-TATGCTTGGTGCACTTTCTGGATG-ACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACCTCGGTCGCATACGGCGGTTGGGATTGAGGAAC-GCAGCGTGCCGCAAGGCAGGG-TTCGCCCACTTTTCACGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACAAACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGCAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTTTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTCGACTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTCAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGGTGAAGAAGCCTAGG 'Perenniporia medulla-panis Dai 10780' CGAGTTATTGACAGGGTTGTAGCTGGCCTTCC--GAGGCAA-TGTGCACGCCCTTGTTCATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTT--TCAGTTGAATGA--AGCGAGCCTTTTAAATTAAAGGGCTTGTGGAA-TTTATTCTGTGCCTGCGTTTATCACATTAAACTCCATTGTATCA---GAATGTGTATA--TTGCGATGTAA-CGCATCTATGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TATTCAATCT-ACAAGTCTTTGC-----TTTG--TAGTTTTGGATTTGGAGGCTT---GCCGGTTTGTATTTGACAAACTGGCTCCTCTTAAATGCATTAGCTT-GATTTCTTGCAGATCAGCTCCTGGCGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGCTT-GGCG-AGCTTCT-AGTTGTCTT-GCAT-AAGACACTTATAG-AGCCCTCACACCTCAACTCATGTAACAACACCCGCAGA--TCAAACACATAA----------TC----------GGGAGTAAGACTAC--AGGATTCCCCTAGTAACTGCGAGTGAAGCGGGATAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCATCCGAATTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGATCAGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGACTA-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCCAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTTTGGTCACATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGTAAGGCAGGGGTTTACCCACTTT-CGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG 'Perenniporia medulla-panis MUCL 49581' CGAGTTATTGACAGGGTTGTAGCTGGCCTTCC--GAGGCAA-TGTGCACGCCCTTGTTCATCC-ACTCTCTACACCTGTGCACTTACTGTGGGTT--TCAGTTGAATGA--AGCGAGCCTTTTAAATTAAAGGGCTTGTGGAA-TTTATTCTGTGCCTGCGTTTACAACAT-AAACTCTATTGTATCA---GAATGTGTATA--TTGCGATGTAA-CGCATCTATGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAAATCTTCAACCT-ACAAACCTTTGC-----TTTG--TAGTTTTGGATTTGGAGGCTT---GCCGGTTTGTATTTGACAAACTGGCTCCTCTTAAATGCATTAGCTT-GATTTCTTGCAGATCAGCTCCTGGCGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGCTT-GGCG-AGCTTCT-AGTTGTCTT-GCAT-AAGACACTTATAG-AGCCCTCACACCTCAACTCATGTAACAACACCCGCAGA--TCAAACACATAAAATAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGATAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCGCCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCAGCCTTGCT-TCTGCTTGGTGCATTTTCTGACTA-ACGGGCCAGCATCGATTCTGACCGCCGGAAAAGGGCCAGAGTAATGTGGCACCTCC--GGGTGTGTTTATAGACTTTGGTCACATACGGCGGTCGGGATCGAGGAAT-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_minor_Cui_5738 CGAGTTCTGAC-TAGGTTGTAGCTGGCCTTAC--GAGGCA--TGTGCTCGCCTTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAAATGTGAA---AGTGAGCCCTTGT-------GGGTTTGTTGAA---GCATTTGTGCCTGCGTTTC--TTAC-ACACTCT---AAGTCA---ATGAATGTA----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAA-CCTACAAGCCTTTGC-----TTTG-TAGGCTT-GGACTTGGAGGCTT---GTCGGCT---------TAGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGTGTTT-GGCA-AGCTTCA-AACCGTCTC-GCAT-GAGACAGCTTTA--TGACCTCTGACCTCAAATCAGGTAGA------CGTCGGGATTCCCC----TAGTAACTGCGAGTGAAG--------------------CGGGAA------------------------------AAGCTCAAATTTAAAATCTGGTGGTCTATGGCCATCCGAGTTGTAGTCTGGAGAGGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTTTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGATG-ACGGGCCAGCATCAATTTTGACCGTTGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_narymica_Dai_10510 CGAGTTTTGAA-CGGGTTGTAGCTGGCCTTCT--TTGGCAC-CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTAGGTT--TCAGA-CGCG---ATGCGAGTTTAG----------GC-TCGCGGAG---CTTATGGGGCTTACGTTTCAACCAC-AAACGCTTCAGTATCA---GAATGTGTA----TCGCGATGTAA-CGCATCTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ATAAGCCTTTGCGGG--TTTTGTAGGATTGGA-CTTGGAGGTTTT--GTCGGCTCA---------CGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AACCGTCTCTCTTTCGAGACAATCGA-C-TGAACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA-TAAGCCCGGGAAAAGAAAAGGGCGGGGAGAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGAATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCCTC--GGGTGTGTT-ATAGACTCTGGTCGCATACGACGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCCGTGAAGAAGCCTAGG Perenniporia_narymica_Dai_7016 CGAGTTTTGAA-CGGGTTGTAGCTGGCCTTCT--TTGGCAC-CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTAGGTT--TCAGA-CGCG---ATGCGAGTTTAG----------GC-TCGCGGAG---CTTATGGGGCTTACGTTTCAACCAC-AAACGCTTCAGTATCA---GAATGTGTA----TCGCGATGTAA-CGCATCTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ATAAGCCTTTGCGGG--TTTTGTAGGATTGGA-CTTGGAGGTTTT--GTCGGCTCA---------CGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AACCGTCTCTCTTTCGAGACAATCGA-C-TGAACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGC--GGAGGAAGAAACCGG--AAGATCACTAACAGGTATTCCC-TAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTTTGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGAATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCCTC--GGGTGTGTT-ATAGACTCTGGTCGCATACGACGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAAGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCCGTGAAGAAGCCTAGG Perenniporia_ochroleuca_Dai_11486 CGAGTCTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT--TCGGATGGTGG---AGCAAGTCTTTATTG------GC-TTGTGAAG---CAGTCCGGGCTTACGTTTA--TTAC-AAAC-CACACAAGTAT---TGGAATGTA----TTGCAATATAA-TGCATTTATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAATCTTATAGGTCTTTGCGGG--TCTA-TAGGCTTGGACTT-GGAGGCTT---GTCGGTATT------AATGCCCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGCGTTTTGGCA-AGCTTCT-AACTGTCTT-GTAA-GAGACACTATTTA------TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAACGGGAGC-------------AGACTAACAGGA-TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGATA-ACGGGCCAGCATCAATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTTT--TGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATTGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCCCCTGCCGAATGACCTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGCCAGTGAAGAAGCCTAGG Perenniporia_ochroleuca_MUCL_39563 CGAGTCTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT--TCGGATGGTGG---AACAAGTCTTTATTG------GC-TTGTGAAG---CAGTCCGGGCTTACGTTTA--TTAC-AAAC-CACACAAGTAT---TAGAATGTA----TTGCAGTATAA-TGCATTTATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAATCT-ATAGGCCTTTGCAGG--TCTA-TAGGCTTGGACTT-GGGGGCTT---GTCGGTATT------TATGCC-GGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTTTGGCA-AGCTTCT-AACTGTCTT-GTAA-GAGACGCTAT------------------------------------------GCGGA--------------------GAAA--------------GAACTAACAAGA--TTCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTTT--TGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGTAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCCCCTGCCGAATGACCTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGCCAGTGAAGAAGCCTAGG Perenniporia_ochroleuca_MUCL_39726 CGAGTCTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT--TCGGATGGTGG---AACAAGTCTTTATTG------GC-TTGTGAAG---CAGTCCGGGCTTACGTTTA--TTAC-AAAC-CACACAAGTAT---TAGAATGTA----TTGCAGTATAA-TGCATTTATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAATCT-ATAGGCCTTTGCAGG--TCTA-TAGGCTTGGACTT-GGGGGCTT---GTCGGTATT------TATGCC-GGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTTTGGCA-AGCTTCT-AACTGTCTT-GTAA-GAGACGCTATCAA------TAA------------------------------GCGGA--------------------GAAAA-------------GAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCAGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGATA-ACGGGCCAGCATCAATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTTT--TGGTGTGTT-ATAGACT{CT}TAGTCGCATACGGCGGTTGGGATTGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCCCCTGCCGAATGACCTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGCCAGTGAAGAAGCCTAGG Perenniporia_ohiensis_Cui5714 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT--TCGGATTGTGG---ACCGAGCCTTTACTG------GC-TTGGGAAG---CGTCCGGGTCCTACCTTTA--TTAC-AAAC-CACA--AGTAT---AAGAATGTA----TTGCGATATAA-CGCATCTATAGACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATTGTCCTTTGT-GA--TCTA-TAGGCTTGGACTT-GGAGGCTT---GTCGGC-GT------AGTGCT-GGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTGTCGGTGTGATAATTGT--CTACGCCGCAACCGTGAAGCGTTT-GGCG-AGCTTCT-AACCGTCTT-GTAA-GAGACACT-----------------------------------------------------------------------------------------GCTAACAGGA-TTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----CGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAACTCAGCCTTGCA-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTTC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTAAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_ohiensis_MUCL_4103 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACACCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTATTGTGGGTT--TCGGATTGTGG---ACCGAGCCTTTACTG------GC-TTGGGAAG---CGTCCGGGTCCTACCTTTA--TTAC-AAAC-CACA--AGTAT---GAGAATGTA----TTGCGATATAA-CGCATCTATAAACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-GTAGTCCTTTGC-GA--TCTA-TAGGCTTGGACTT-GGAGGCTT---GTCGGT-GT------AGTGCC-GGCTCCTCTTAAATACATTAGCTT-GATTCCTTGCGGATCGGCTGTCGGTGTGATAATTGT--CTACGCCGCAACCGTGAAGCGTTT-GAGA-CACTGCT-AATCGTCTC-TTAT-GAGACA------------------------------------------------AGA---------------------AAAG-------------AAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGAACTCAGCCTTGCA-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGGTTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTTC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTAAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_piceicola_Dai_4184 CGAGTCTTGAC-TGGGTTGTCGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAAATCGTGA---AGCGTG-CCTTTGTG-----GGT-TCGCAAAG---CGGTCTGAGCCTGCGTTTA--TTAC-AAACCCTTACAAGTAA-CAGAATGTGTA----TCGCGATGTAA-TGCATCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCATCAACCT-ACAAGCTTT-GCGG---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT-------AACGGTCGGCTTCTCTTAAATGCATTAGCTC-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGTGTTT-GGTG-AGCTTCT-AACCGTCTC-GCGA-GAGATAACACTT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAACCGGAGGAA--------------GTAACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGT-TTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTCGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACTGTCGGAAAAGGGCTGGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTTCAGTCGCATACGGCGGTCGGGATCGAGGAAC-GCAGCGCGCCGTAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGTGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTAAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_pyricola_Cui_9149 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGACGGTGT---AGCGGG-TCTTTACC-----GGC-TCGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAT-TAGAATGTGTA----TTGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAACCTTTGCGGG--CTTTT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT-------AATGGTCGGCTCCTCTTAAATGTATTAGCTT-GATTCCTTGCGGATCGGCTGTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-GCAT-GAGACAATCCAT--TGACCTCTGACCTCAAATCAGGTAG-ACT--CCAGTGGACC---GGGAAGAGAA------------------------------CTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTGGCT-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_pyricola_Dai_10265 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGACGGTGT---AGCGGG-TCTTTACC-----GGC-TCGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAT-TAGAATGTGTA----TTGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAACCTTTGCGGG--CTTTT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT-------AATGGTCGGCTCCTCTTAAATGTATTAGCTT-GATTCCTTGCGGATCGGCTGTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-GCAT-GAGACAATCCAT--TGACCTCTGACCTCAAATCAGGTAG-ACT--CCAGTG-------------AGAA------------------------------CTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTGGCT-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_robiniophila_Cui_5644 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGCGCTTTC----------GC-TCGCGGA----TCTAACGGGCCTGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGGTCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCG------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAACTTT-C-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCCCGAAGGAA------------------CTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGAACTCAGCCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_robiniophila_Cui_7144 CGAGTTTTGAA-GGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGCGCTTTC----------GC-TCGCGGA----TCTAACGGGCCTGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGGTCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCG------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAACTTT-C-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA---------------TAGCAGGGAGGAAGAACTA-CA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGAACTCAGCCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_robiniophila_Cui_9144 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCCGCTCAATCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCGGA-GGTG---AAGCGCGCTTTC----------GC-TCGCGGA----TCTAACGGGCCTGCGTTTT-ACTAC-AAACACTTTAAAGTAAACG-AACGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ACCGGTCTTTGCGGA--TCGG-TAAGGCTTGGACTTGGAGGCTT---GTCGGCCCG------TGTGGTCGACTCCTCTCAAATGCATTAGCCT-GGTTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCT-GGCTTCT-AACCGTCTC--GATGGAGACAACTTT-C-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAACGGGAAAGGAAATGTGAATGGGAGTAAGAACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCACCAGTGCTTTGCGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCAGAACTCAGCCTTGCT-CTCGCTTGGTGCATTTTCTGGATG-ACGGGCCAGCATCGATTTTGATCGTCGGAAAAGGGTTGGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCCAGTCGCATACGACGGTCGGGATCGAGGTTC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGGGACCTCTGTCGTGGAGGGCACCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_straminea_Cui_8718 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTAC--GAGGCA--TGTGCACACCCTGTTAA-TCC-ACTCT--ACACCTGTGCACTTACTGTGAGCT--TCAGAGCATGA---A-TGGG-CCTTTGCG-----GGC-TCTTGAAG---TGCTTTGGGCTTGCGTTCC--TTAC-AAACTC--GAATGTAA-CAGAATGTCTA----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCATCAACTT-ACAAGCCTTTGTGG---TTTGT-ACGCTTGGACTTTGAAGGCTT---GTCGGCTTCT-----ATAAGTTGGCTCCTTTTAAATGCATTAGCTT-GATTCCTTGCGGAGCGGTTCTCGGTGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGTTT-GGCG-AGCTTCT-AATTGTCTT-GCAT-GAGACAACACTC--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGC-GGAGGAA-------AGGGAAGAGAACTAACA-GGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAAT-------CTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACTGTCGGAAAAGGGCTGGAGGAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGTAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTAAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_straminea_Cui_8858 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTAC--GAGGCA--TGTGCACACCCTGTTAA-TCC-ACTCT--ACACCTGTGCACTTACTGTGAGCT--TCAGAGCATGA---A-TGGG-CCTTTGCG-----GGC-TCTTGAAG---TGCTTTGGGCTTGCGTTCC--TTAC-AAACTC--GAATGTAA-CAGAATGTCTA----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCATCAACTT-ACAAGCCTTTGTGG---TTTGT-ACGCTTGGACTTTGAAGGCTT---GTCGGCTTCT-----ATAAGTTGGCTCCTTTTAAATGCATTAGCTT-GATTCCTTGCGGAGCGGTTCTCGGTGTGATAATTGT--CTACGCCGTGGCTGTGAAGTGTTT-GGCG-AGCTTCT-AATTGTCTT-GCAT-GAGACAACACTC--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAAGC-GGAGGAA-------AG-------AACTAACA-GGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGGCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACTGTCGGAAAAGGGCTGGAGGAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGTAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTAAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_subacida_Cui_3643 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCT--TTGGCAC-CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTCACTGTAGGTT--TCAAA-GGTG---ACGCGAGTTTCG----------GC-TCGTGGAG---CTTTTGGG-CTTACGTTTCA-CTAT-AAACGCTTTAGTATCA---GAATGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ATGAGCCTTTGCGGG--TTT-GTAGGATTGGA-CTTGGAGGTCT---GTTGGCTTG---------CGTCGGCTCCTCTCAAATGCATTAGCTC-GATTCCTTGTGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATGGTCTCT--TAGGAGACAATGAAAC-----------------------------------------------------------------------AATGGTGAGGAGAACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCGGCCTTGCTCTTTGCTTGGTGCATTTTCTGGATG-ATGGGCCAGCATCGATTTTGACCGTCAGAAAAGGGCTAGAGTAATGTGGCACCCTC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGGTGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_subacida_Dai_8224 CGAGTTTTGAA-GGGGTTGTAGCTGGCCTTCT--TTGGCAC-CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTCACTGTAGGTT--TCAAA-GGTG---ACGCGAGTTTCG----------GC-TCGTGGAG---CTTTTGGG-CTTACGTTTCA-CTAT-AAACGCTTTAGTATCA---GAATGTGTA----TCGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ATGAGCCTTTGCGGG--TTT-GTAGGATTGGA-CTTGGAGGTCT---GTCGGCTTG---------CGTCGGCTCCTCTCAAATGCATTAGCTC-GATTCCTTGTGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATGGTCTCT--TAGGAGACAATGAAAC-TGAACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCC-----GGGAGGAAATGGTGAGGAGAACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCAGCCTTGCTCTTTGCTTGGTGCATTTTCTGGATG-ATGGGCCAGCATCGATTTTGACCGTCAGAAAAGGGCTAGAGTAATGTGGCACCCTC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_subacida_MUCL_31402 CGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCT--TTGGCAC-CGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTAGGTT--TCAAA-GGTG---ACGCGAGTTTCG----------GC-TCGTGGAG---CTTTTGGG-CTTACGTTTCA-CTAT-AAACGCTTTAGTATCAT--GAATGTGTA----TCGCGATG-AA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAACCT-ATGAGCCTTTGCGGG--TTT-GTAGGATTTGG-ACTGGAGGTCT---GTCGGCTTG---------CGTCGGCTCCTCTCAAATGCATTAGCTC-GATTCCTTGCGGATCGGCTCTCGGTGTGATAGTTTT--TTGCGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AACGGTCTCT--TAGGAGACAATGAAAC-TGAACTAT-------------------------------------------------C-----AATAAGCGGAGGAAAAGA-AACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTTCAGAACTCGGCCTTGCTCTTTGCTTGGTGCATTTTCTGGATG-ATGGGCCAGCATCGATTTTGACCGTCAGAAAAGGGCTAGAGTAATGTGGCACCCTC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGACC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCGTAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGGTGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_tenuis_Cui_5523 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGACGGTGT---AGCGGG-TCTTTACC-----GGC-TCGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAT-TAGAATGTGTA----TTGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAACCTTTGCGGG--CTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT-------AATGGTCGGCTCCTCTTAAATGTATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-GCAT-GAGACAATCTAT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAAACCGGGGGGAA---------------GACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTGGCT-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCTCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_tephropora_Cui_6331 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGACGGTGT---AGCGAG-CCTTTACG-----GGT-TCGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAA-ATGAATGTGTA----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAACCTTTGCGGG--TTTGT-AGGCTTGGATTT-GGAGGCTT---GTCGGCCT-------AACGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAACACA--------------------------------------------------------------------------------------GACTACA-GGATTCCC-TAGTA-CTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTATTCTGGAGAAGTGCTTTCCGCGCTGGACCGGGTATAAGTCTCTTGGAACAGAGCGTCATAAAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCCGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCACGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGGGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_tephropora_Cui_9029 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGACGGCGT---AGCGAG-CCTTTACG-----GGT-TCGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAA-ATGAATGTGTA----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAACCTTTGCGGG--TTTGT-AGGCTTGGATTT-GGAGGCTT---GTCGGCCT-------AACGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-TTAT-GAGACAACACAT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAAGCCCGGAGGAAA---------T----GAGACTACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCCGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGGGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTAGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGATGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_tibetica_Cui_9457 CGAGTTCTGAC-TGGGTTGTAGCTGGCCTTGC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGCT--TCGGATCGTGA---AGCGGG-CCTTTGCG-----GGT-TCGTGAAG---CG-TCCGGGCCTGCGTTTA--TCAC-AAACCC--GATAGTAA-CAGAATGT--A----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAGCCTTTGCGT---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCTC---------AGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AACCGTCTT-GTATCGAGACAGCGCTTA-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACATAAGCATATCAAAGGGG-GGGGGAA---------AAAGTAGCACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_tibetica_Cui_9459 CGAGTTCTGAC-TGGGTTGTAGCTGGCCTTAC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGCT--TCGGATCGTGA---AGCGGG-CCTTTGCG-----GGT-TCGTGAAG---CG-TCCGGGCCTGCGTTTA--TCAC-AAACCC--GATAGTAA-CAGAATGT--A----TTGCGATATAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ACAAGCCTTTGCGT---TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCTC---------AGGTCGGCTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AACCGTCTT-GTATCGAGACAGCGCTTA-TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAAGCCG-GGAGGAAGC----TATAGTGTAGCACTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCTGGTTG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTGGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Perenniporia_truncatospora_Dai_5125 CGAGTTTTGAC-TGGGTTGTAGCTGGCCTTCC--GAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTT--TCAGACGGTGT---AGCGGG-TCTTTACT-----GGC-TCGTGAAA---GCGTCTGTGCCTGCGTTTA--TTAC-AAACTCTTACAAGTAT-TAGAATGTGTA----TTGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TCTTCAACCT-ATAAACCTTTGCGGG--TTTGT-AGGCTTGGACTT-GGAGGCTT---GTCGGCCT-------AATGGTCGGCTCCTCTTAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGCGACCGTGAAGCGTTT-GGCG-AGCTTCT-AATCGTCTC-GCAT-GAGACAATTTAT--TGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAA------------------------------CTAACA-GGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAA----TGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCCTTGCT-TTTGCTTGGTGCACTTTCCGGATG-ACGGGCCAGCATCGATTTTGACCGTCGGAAAAGGGCTAGAGTAATGTGGCACCTCC--GGGTGTGTT-ATAGACTCTGGTCGCATACGGCGGTTGGGATCGAGGAAC-GCAGCGCGCCGCAAGGCAGGGGTTCGCCCACTTT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATACCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTCTCTGACGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCAGTGAAGAAGCCTAGG Trametes_versicolor_M_126 CGAGTTTTGAAACGGGTTGTAGCTGGCCTCTCCGGAGGCA--TGTGCACGCCCTGCTCA-TCC-ACTCT--ACACCTGTGCACTTACTGTGGGTA--TCGGAAGGCGT---CGCGT-CGTTTAC-------GG---CGAGGCG---TTAACCGTGCCTACGTCTTA-CTAC-AAACGCTTCAGTATCA---GAATGTGTA----TTGCGATGTAA-CGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAA-TTCTCAAACCCATAAGTCTTTGCGGG--CTTA-CGGGCTTTGGACTTGGAGGCTTT--GTCGGCGACCGCGAGGTCTGTCGACTCCTCTCAAATGCATTAGCTT-GATTCCTTGCGGATCGGCTCTCGGTGTGATAATTGT--CTACGCCGTGACCGTGAAGCGTTTTGGCG-AGCTTCT-AATCGTCTC-TTAC-GAGACAGTTTACATTGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGA-------------AACTAACAAGGATTCCCCTAGTAACT----------------AAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGCGTCTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATGCGCTCTCAAAGAGTCGCGTTGTTTGGGAATGCAGCGCAAAA----TGGGAGGTGAATTCCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTCGTCCGGAACTCAGCTTTGCT-TCGGCTTAGTGCACTTTCCGGTTG-ACGGGCCAGCATCGATTTTGACCGCTGGAAAAGGGCTGGAGGAATGTGGCACCTTC--GGGTGTGTT-ATAGCCTTCAGTCGCATACAGCGGTTGGGATCGAGGAAC-GCAGCGCGCCTTATGGCTGGGGTTCGCCCACATT-CGCGCTTAGGATGCTGGCATAATGGCTTTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGAAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGACGTTTTCTGAAGGATCCGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCAT-ATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGATTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCTCGCCGTCAGCGTTTAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCCGTGAAGAAGCCTAGG ; END; BEGIN TREES; TITLE Perenniporia__ITS; LINK TAXA = Taxa2; TRANSLATE 1 Perenniporia_tibetica_Cui_9459, 2 Perenniporia_tibetica_Cui_9457, 3 Perenniporia_corticol_Cui2655, 4 Perenniporia_corticol_Dai_7330, 5 Perenniporia_corticol_Cui_1248, 6 Perenniporia_minor_Cui_5782, 7 Perenniporia_minor_Cui_5738, 8 Perenniporia_japonica_Cui_7047, 9 Perenniporia_truncatospora_Dai_5125, 10 Perenniporia_ohiensis_Cui5714, 11 Perenniporia_ohiensis_MUCL_4103, 12 Perenniporia_ochroleuca_MUCL_39726, 13 Perenniporia_ochroleuca_Dai_11486, 14 Perenniporia_ochroleuca_MUCL_39563, 15 Perenniporia_maackiae_Cui_8929, 16 Perenniporia_tephropora_Cui_6331, 17 Perenniporia_tephropora_Cui_9029, 18 Perenniporia_detrita_MUCL_42649, 19 Perenniporia_fergusii_Gilbertson16116, 20 Perenniporia_martia_Cui_7992, 21 Perenniporia_martia_MUCL_41677, 22 Perenniporia_martia_MUCL_41678, 23 Perenniporia_rhizomorph_Cui_7507, 24 Perenniporia_rhizomorph_Dai_7248, 25 Perenniporia_robiniophila_Cui_7144, 26 Perenniporia_robiniophila_Cui_5644, 27 Perenniporia_robiniophila_Cui_9144, 28 Perenniporia_fraxinea_Cui_7154, 29 Perenniporia_fraxinea_Cui_8885, 30 Perenniporia_fraxinea_Cui_8871, 31 Perenniporia_fraxinea_DP_83, 32 'Perenniporia medulla-panis Dai 10780', 33 'Perenniporia medulla-panis MUCL 49581', 34 Perenniporia_straminea_Cui_8718, 35 Perenniporia_straminea_Cui_8858, 36 Perenniporia_subacida_Dai_8224, 37 Perenniporia_subacida_Cui_3643, 38 Perenniporia_subacida_MUCL_31402, 39 Perenniporia_tenuis_Cui_5523, 40 Perenniporia_latissima_Cui_6625, 41 Perenniporia_narymica_Dai_10510, 42 Perenniporia_narymica_Dai_7016, 43 Perenniporia_piceicola_Dai_4184, 44 Trametes_versicolor_M_126; TREE PAUP_1 = [&R] (44:0.068139615,(((41:1.0E-8,42:1.0E-8):0.01745912,(38:0.01094789,(36:1.0E-8,37:0.00251362):0.00727147):0.03379483):0.05540538,(((23:0.00229839,24:1.0E-8):0.14715421,((40:0.03935009,(20:0.05947936,(21:1.0E-8,22:0.00688343):0.02591412):0.04259745):0.08346144,(19:0.07899665,((25:1.0E-8,(26:1.0E-8,27:1.0E-8):1.0E-8):0.0,((28:0.0023736,31:0.01250926):0.00245008,(29:1.0E-8,30:1.0E-8):1.0E-8):0.0048659):0.08420021):0.02453996):0.00710702):0.03830814,(((32:0.00999824,33:0.00594092):0.1703736,((10:0.01479047,11:0.0271538):0.04311805,(18:0.08707128,(13:0.00494239,(12:1.0E-8,14:1.0E-8):0.01491697):0.0297009):0.00384958):0.04608201):0.02875651,((34:1.0E-8,35:1.0E-8):0.13216422,((6:1.0E-8,7:1.0E-8):0.10977878,((8:0.05439256,(1:0.00248844,2:1.0E-8):0.02637126):0.01097747,(43:0.05262426,((15:0.01343542,(5:1.0E-8,(3:1.0E-8,4:1.0E-8):1.0E-8):0.00818743):0.0164177,((9:1.0E-8,39:0.00721902):0.01659315,(16:1.0E-8,17:0.00238375):0.00993965):0.00566749):0.02735737):8.58E-6):0.0077887):6.86E-6):0.00969711):0.05406458):0.11827284):0.068139615); END; BEGIN TREES; TITLE 'Perenniporia ITS+LSU'; LINK TAXA = Taxa1; TRANSLATE 1 Perenniporia_tibetica_Cui_9457, 2 Perenniporia_tibetica_Cui_9459, 3 Perenniporia_corticol_Cui2655, 4 Perenniporia_corticol_Dai_7330, 5 Perenniporia_corticol_Cui_1248, 6 Perenniporia_minor_Cui_5738, 7 Perenniporia_japonica_Cui_7047, 8 Perenniporia_truncatospora_Dai_5125, 9 Perenniporia_ohiensis_Cui5714, 10 Perenniporia_ohiensis_MUCL_4103, 11 Perenniporia_ochroleuca_MUCL_39726, 12 Perenniporia_ochroleuca_Dai_11486, 13 Perenniporia_ochroleuca_MUCL_39563, 14 Perenniporia_maackiae_Cui_8929, 15 Perenniporia_maackiae_Cui_5605, 16 Perenniporia_pyricola_Cui_9149, 17 Perenniporia_pyricola_Dai_10265, 18 Perenniporia_tephropora_Cui_6331, 19 Perenniporia_tephropora_Cui_9029, 20 Perenniporia_detrita_MUCL_42649, 21 Perenniporia_martia_Cui_7992, 22 Perenniporia_martia_MUCL_41677, 23 Perenniporia_martia_MUCL_41678, 24 Perenniporia_robiniophila_Cui_7144, 25 Perenniporia_robiniophila_Cui_5644, 26 Perenniporia_robiniophila_Cui_9144, 27 Perenniporia_fraxinea_Cui_7154, 28 Perenniporia_fraxinea_Cui_8885, 29 Perenniporia_fraxinea_Cui_8871, 30 Perenniporia_fraxinea_DP_83, 31 'Perenniporia medulla-panis Dai 10780', 32 'Perenniporia medulla-panis MUCL 49581', 33 Perenniporia_straminea_Cui_8858, 34 Perenniporia_straminea_Cui_8718, 35 Perenniporia_subacida_Dai_8224, 36 Perenniporia_subacida_Cui_3643, 37 Perenniporia_subacida_MUCL_31402, 38 Perenniporia_tenuis_Cui_5523, 39 Perenniporia_latissima_Cui_6625, 40 Perenniporia_narymica_Dai_10510, 41 Perenniporia_narymica_Dai_7016, 42 Perenniporia_piceicola_Dai_4184, 43 Trametes_versicolor_M_126; TREE PAUP_1 = [&R] ((31:0.01250004,32:0.00739088):0.05394612,(6:0.06190309,(((9:0.00967516,10:0.01536553):0.01464309,(20:0.04594534,(13:0.00191999,(11:2.67E-8,12:0.02126054):0.00629655):0.02896097):0.01237248):0.04729343,((((7:0.02426458,42:0.0285775):0.00515057,((1:0.00293456,2:0.00232705):0.01415017,(33:1.0E-8,34:7.0961E-4):0.03973959):0.00756691):0.00489203,((8:1.0E-8,(38:8.4985E-4,(16:1.0E-8,17:1.0E-8):0.01040434):0.00436029):0.01069219,((18:0.00454572,19:0.001539):0.01268509,((14:6.8513E-4,15:1.0E-8):0.00497487,(5:0.00304713,(3:0.00247324,4:0.00107621):0.0):0.00946412):0.00588861):0.00115146):0.00756067):0.00689956,((43:0.07311931,((40:0.00149246,41:0.00705036):0.01265379,(37:0.01252069,(35:0.00101352,36:0.00166457):0.00386166):0.02250805):0.02826676):0.01615198,((39:0.03091729,(21:0.01851681,(22:0.00207679,23:0.00183355):0.02619508):0.04163702):0.0410171,((24:9.4516E-4,26:0.00604394):0.0,((25:5.4624E-4,28:0.00658969):0.00484281,(30:0.00921413,(27:0.00137442,29:0.00188326):0.0):0.00445988):0.0):0.04482503):0.00428009):0.01698483):0.00919879):0.00930701):0.05394612); END;