#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:41 GMT TreeBASE (cc) 1994-2008 Study reference: Chung K., Hipp A.L., & Roalson E.H. 2012. Chromosome Number Evolves Independently of Genome Size in a Clade with Non-Localized Centromeres (Carex: Cyperaceae). Evolution, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12042] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=92; TAXLABELS Carex_abrupta Carex_adusta Carex_aggregata Carex_alata Carex_albolutescens Carex_alopecoidea Carex_annectens Carex_arcta Carex_athrostachya Carex_baldensis Carex_bebbii Carex_bicknellii Carex_bohemica Carex_brevior Carex_bromoides Carex_brunnescens Carex_canescens Carex_caryophyllea Carex_cephaloidea Carex_cephalophora Carex_conjuncta Carex_cristatella 'Carex crus-corvi' Carex_cumulata Carex_davyi Carex_deweyana Carex_diandra Carex_disperma Carex_disticha Carex_divulsa Carex_ebenea Carex_echinata Carex_elongata Carex_exilis Carex_festucacea Carex_feta Carex_foenea Carex_gibba Carex_glareosa Carex_gravida Carex_harfordii Carex_haydeniana Carex_hoodii Carex_humilis Carex_illota Carex_infirminervia Carex_integra Carex_interior Carex_lachenalii Carex_laeviculmis Carex_laevivaginata Carex_leavenworthii Carex_leptopoda Carex_longii Carex_macloviana Carex_microptera Carex_missouriensis Carex_molesta Carex_molestiformis Carex_muehlenbergii Carex_multicostata Carex_muskingumensis Carex_nubigena Carex_oronensis Carex_ovalis Carex_pachystachya Carex_panicea Carex_phaeocephala Carex_praticola Carex_preslii Carex_projecta Carex_radiata Carex_rochebrunii Carex_rosea Carex_sartwellii Carex_scoparia_var._scoparia Carex_scoparia_var._tessellata Carex_seorsa Carex_shinnersii Carex_siccata Carex_siderosticta Carex_stipata Carex_straminea Carex_suberecta Carex_subfusca Carex_tenera Carex_tenuiflora Carex_tincta Carex_tribuloides Carex_trisperma Carex_vulpina Carex_vulpinoidea ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=92; TAXLABELS Carex_abrupta Carex_adusta Carex_aggregata Carex_alata Carex_albolutescens Carex_alopecoidea Carex_annectens Carex_arcta Carex_athrostachya Carex_baldensis Carex_bebbii Carex_bicknellii Carex_bohemica Carex_brevior Carex_bromoides Carex_brunnescens Carex_canescens Carex_caryophyllea Carex_cephaloidea Carex_cephalophora Carex_conjuncta Carex_cristatella 'Carex crus-corvi' Carex_cumulata Carex_davyi Carex_deweyana Carex_diandra Carex_disperma Carex_disticha Carex_divulsa Carex_ebenea Carex_echinata Carex_elongata Carex_exilis Carex_festucacea Carex_feta Carex_foenea Carex_gibba Carex_glareosa Carex_gravida Carex_harfordii Carex_haydeniana Carex_hoodii Carex_humilis Carex_illota Carex_infirminervia Carex_integra Carex_interior Carex_lachenalii Carex_laeviculmis Carex_laevivaginata Carex_leavenworthii Carex_leptopoda Carex_longii Carex_macloviana Carex_microptera Carex_missouriensis Carex_molesta Carex_molestiformis Carex_muehlenbergii Carex_multicostata Carex_muskingumensis Carex_nubigena Carex_oronensis Carex_ovalis Carex_pachystachya Carex_panicea Carex_phaeocephala Carex_praticola Carex_preslii Carex_projecta Carex_radiata Carex_rochebrunii Carex_rosea Carex_sartwellii Carex_scoparia_var._scoparia Carex_scoparia_var._tessellata Carex_seorsa Carex_shinnersii Carex_siccata Carex_siderosticta Carex_stipata Carex_straminea Carex_suberecta Carex_subfusca Carex_tenera Carex_tenuiflora Carex_tincta Carex_tribuloides Carex_trisperma Carex_vulpina Carex_vulpinoidea ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M10645] TITLE Carex_ETS_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1363; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Carex_abrupta TTGCCTCTCGAAAAACATGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTT----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCTGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGATGAGCTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATTGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGATGTTGTCCCTCGATTGATA-TTTGCTTGCCTTCC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGTCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTG-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGTCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_adusta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGTCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTT{AG}TGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGATGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_aggregata TTGCCTCTCGAAAAACACGACCGTCGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCCGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATCAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGG-CCTGTGTCGGGTGCCAAGGCCAATG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACAG--CGCAC?TCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCCGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACACAAAAAA-C-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGCAAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCAGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_alata TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGATGCTGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCTGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTC{CG}GGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAAATTG-T----C--GGGGCTGGGATGCTTGTGTTCGGTTGCCTGTGTAGTTCTACCCTATT-TGGGTAGCAAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTTCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGTTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAACACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_albolutescens TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-ATAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTTA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAAATTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATT-TGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTTCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAACACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_alopecoidea TTGCCTCTCGAAAAACACGACCGTCGCAC?CGTGACAGA--ATGCTG?CGGAGA---GGTGCT?GCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCCTGTGCCGGGTGCCAAGGCCAACG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTCGCCGTCGCGGCTC-GCGCTGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGTGAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCAGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGTGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCTGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_annectens TTGCCTCTCGAAAAACACGACCGTCGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCCGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCTTGTGTCGGGTGCCAAGGCCAACG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAG?GGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCACGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGTTC-GCGCTGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGCGAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_arcta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCCTGCGTCGGGTGCCGAGGCCAATG-AAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCTTACCGACGCAGGGCCTTTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAAAACAC-CCACC-ACAAACCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCCGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGTGAGATCCTTGTGTAGGTGCGTGTGGTCGAATGGCCTTGCTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGTGACGTGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTGGTTGCGTA-CATGGGGAATGC--CTCTCGGATTGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CCGCCCGTTTGGGTTAGTGCCGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACCCAACAAACACACCCAAACAACAAACAAA Carex_athrostachya TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCAA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTCGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGT{GT}CCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CA?GGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_baldensis TTGCCTTTCGGAAAACACGACCGTTGCACATGTGACAGA--ATGCTGCCGGGGA---GGTGCCTGCTGCCTCCTCGG-CCCCA-CCGGCCTCTTCCCTCTCG-CCCTTC----G--GGCGCGTTGGTCGCCGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGA-GAAAGCTGAGGCG-CCGGCGA--GCTGCTCAATGG-TTGCGCCGGTTGCCAAGGCCAACG--AAAAAAGTACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CCCTTGGC-AAAGATGCGTAAATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCCAAGTGTGCGGTCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCG-CCCCGAGCTCCGTACCGGCACAGGGCC-TTGTTTGACCCCCTAACGAGGAGCATGCCGCCGCGGCCT-GTGCTGCGCGGCACCTTCGGACCAAACACACCAACC-CACACACAACAAAAACA-AC-CCACC-ACAACACATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCGAACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATGTAAAATG-T----G--GTGGTTGGGATGCTCGGGATCGGTTGCCTGTGCGGTTCTACCCTCTTGGGGGTAGCGAAGTCGTCCCCGGATGGATA-TTTGCTTGCCCTTC-TGACA-TTTTGTGGTCGTTTGGGCAGCCGAAATGTTGGCGGAATCCATGTGTTGGTGCA--TGGTCGAATG-CCCTGTTGCCATCACTTGTATTTTTGCCGGCTCTCACGGATGCGGTGCCTAGTGCTAGCTCTGCGGGACTTTGCCCTGCAGAC-TTCGGGAGGTCCC-CTGTAC-GAACCACTGCTCTTTATACGCCGTTTGTCGTGTTGTCGGTGACGACACGCAGATCG---TGTTTTGTCGTGCTGTTGT--TAACGGCACGGC-A--GAAC-AAAGCGTCCGGAGCGTGCTCGCGTG-CATGGGGAAGGC--CTCTC-GTTCGTATGAGCAGCGACTT--CCGGTTTGCGTCATGCGAAGGC-CCGCCCGTCCGGGTCGGTGCCGGAGCTGACGTGCCGGCTCTCGTTTAAGACGTGCAAAAAACCCAAAAACCACAACCCCCAAACAAACACCCCAAACCACAAACAAA Carex_bebbii TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTATGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_bicknellii TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCTCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGATCCAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--{CT}CGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACCCCCAAACAACAAACAAA Carex_bohemica TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCTTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCTGAGGCCAATG--AAAATAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACATTTTTGTTGTTGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGTGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGTGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCAAAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_brevior TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCAGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAATGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGTGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTT-T----C--GGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGTGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCTGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_bromoides TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGCCGGAGA---GGCGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCCCGTCCATCTAG-CCCTCC----G--GGCGAGTCGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCG-CCGGCCG--GCCGCTAAAGGGCATGTGCCGGGCGCCGAGGCCAAAG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGATTGC----CTAACGGC-AGAGATGCGGACAATGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGGGCCCTGTACCGACACAGGGCC-TTTTATGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTC-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCGGTCTCTTCACTCTCCCTCCCATCATCTAATTTG-T----T--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGCTGTCCCCCGATTGATA-TTTGCTTGCCTTTC-TGACATTTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCGCGGATGCAGTGCCTAGTGCTAGCTCTGTGTGACTATGCCCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGTGATTCAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGCGTGCTTTCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCT?GCGTCCTGCGAAGGCCCCTCCCGTTTGGGTCGGTGCCGGAGCTGACGCGCCGGCTCTCGTTTAAGACGTGCAAACAACCCAAAAACCAAAACACCCAACAAACACCCCCAAACAACAAAAAAA Carex_brunnescens TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGCCGGGGA---GGTGCTAGCTGCCTCCTCGG-CCCTA-CCGTCCTCGTCCCTCTAG-CCCTTC----G--GGCGTGTTGGATGTTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTTCTGCGTCGGGTGCCGAGGCAAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTACCGACACAGGGCC-TTTTTGGA-CCCCTAACGAGGAGCTTGTCGTTGCGGCTT-GCGCCGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCTCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGTGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCGTGTGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTATTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGATTGCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCATCGATTT--CCGGCTTGCGTCGTGCGAAGGC-CCGCCCGTTCGGGTTGGTGCCGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACCCAACAAACACACCCAAACAACAAACAAA Carex_canescens TTGCCTCTCGAAAAACACGACCGTTGCACAAGTGACAGA--ATGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCTTTC----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGCTAAAGGGCTGGCGTCGGGTGCCCAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGT-GGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTATCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCTGTTGCGGCTT-GCGCTGTGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCCCC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--GGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGGTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCGTTTGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATACAGTGCCTATTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCGACGTGGGCGCC?TTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGATTGCGTA-CATGGGAAA-GC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGCGCCGCCCGTTCGGGTTGGTGCCGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACCCAACAAACACACCCACACAACAAAAAAA Carex_caryophyllea TTGCCTTTCCGAAA?CACGACCGTCGAACACGTG?CAGA--ATGCTGCCGCGGA---GGCGCCCGCCGCCTCCTCGG-CCCCG-CCGGCCTCCTCCCTCTCG-CCCTCC---GG--GGCGCGTCGGTTGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGGT-AAAGCTAAGGCA-CCGGCGA--GCCTTTCGAGGGCTC-CGTCGGCTGCCGAGG---------------TATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGTTTGCCTGACTAACGGC-AGCGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTGCGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACGCAGGGCC-TTGTTGGAACCCCTAACGAGGAGCACGCCGCTGCGGCTT-ATGCTGCGCGGTGCCTTCGGACCAAACACACCAACACCAACCACAAAACC-A---AC-ACACC-ACAACACA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_cephaloidea TTGCCTCTCGAAAAACACGACCGTCGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCCGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAA-GGCCTGTGTCGGGTGCCAAGGCCAACG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AGAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCCGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACCAAAAAAA-C-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGC?AAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCAGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_cephalophora TTGCCTCTCAAAAAACATGACCGTCGCACACGTGATAGA--ATGCTGTCGGAGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCCTGTGTCGGGTGCCAAGGCCAACA--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CAGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GTGCTGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGT?CCTCGATTGATA-TTTGCTTGCCTTGC-TGACA-TTTTTTTGTC?TTTGGGCAGCCGAAATGATGGCGAAATTCTTGTGTAGGTGCG--TGGTCAAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCACGGATGCATTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-?TCGGGAGGTCCC-TTGTA?-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGT?TCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGAT??TATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCACTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_conjuncta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCCGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGG-CCTGTGTCGGGTGCCAAGGCCAATG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGCTC-GCGCCGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACACAAAAAA-C-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--ATTGCTGGGATGCTTTTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTAATTTGGGCAGCCGAAATGATGGCAAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCAGCTCTCACGGATGTAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTACAGAC-CTCGGGAGGTCCC-TTGTAC-AAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_cristatella TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG-AAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAAAACAC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTATGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGC{CT}CTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA 'Carex crus-corvi' TTGCCTCTCAAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCGCGTCCCTCAAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGTTAAAGGGCCTGTGTAGGGTGCCGAGGCCAACA---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACAATGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTACGTGGCCGGAAGTGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCCTTTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGTGGCTT-TCGTCGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAAACCATTCTAGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GAGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGTGAAGTTGTCCCTTGAATGATA-TTTGCTTGCCTTTC-TGACA-TTCTTTTGTCGTTTGGGCAACCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TAGTCGAATGGCCTTGTTGCTATCACATGGATTTTTGCCGGCTCTTGCGGATACAGTGCCTAGTGCTAGCTCTGCGTGACTATGTCCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGCGTGCTTTCGTA-CATGGGGAATGC--CTCTTCGATCGTATGAGTA?C?A??AC?????CTC?CGTCATTTGAAGTC-CTGCCCGTTTGGGTTGGTGCGGAAGTTGATGCGCCGGGTCTCGTTTAAGACTTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAAAAAACAAA Carex_cumulata TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCAGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCAAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCT?TGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACTGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_davyi TTGCCTCTCGAAAAACATGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAGCCCCTTC----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGAGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GTCGTCAAAGGGCTTGCATCGGGTGCTGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACTGCAAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAAAC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTG-GTAGCGAAGTCGTCCCTTGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGAAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--TCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAACCCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_deweyana TTGCCTCTCGAAAAACACGACCGTTGAACACGTGACAGA--ACGCTGCCGGAGA---GGCGCTCGCCGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTCC----G--GGCGAGTTGGATGCTGGCCGGAACACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTGAGGCA-CCGGCCG--GCCGCTTAAGGGCCTGCGCCGGGCGCCGAGGCCAACG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AGAGATGCGGACAATGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGT-GGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TCTTATGA-CCCCTCACGAGGAGCTTGCTGTCGCGGCTC-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCCCC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGCGGGTAGCGAAGCTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTGGGCGCGTGTGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-CTGTAC-GAATCACTGTGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGGC-CGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGGCCGTGGCATGATCGCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGCCCCGCCCGTCCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGCGGAAGACGTGCAAACAACCCAAAAACCACAAAACCCCACAAACACCCCCAAACAACAAAAAAA Carex_diandra TTGCCTCTCGGAAAACACGACCGTTGCACAAGTGACAGA--ACGCTGCCGGAGG---GGTGCCTGCTGCCTCCTCGG-CCACA-CCGGCCACGTCCCTCTGG-CCCTCC----G--GGCGAGCTGGATGCTGGCAGGAATACGGCGCGGGATGACGCCAAGGAACACGGTAAGAGCTGAGGCA-CCGGCAA--GCCGCCAAAGGGCCTGTGTCGGGTGCCAAGGCCAATGAAAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATTCACGCT--CGGTTGC----CTGCTGGC-AAGGATGCGGACACTGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGC-CGTCA-CCCCGGGCCCCGTACCGACACAGGGCC-TTTCCTGA-CCCCTAACGAGGAGCTTGCCGTTGCGGCAT-GCGCCGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAAAAAAC-CCACC-CCAACCCATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGTAAATTTGTCCCTCGGTTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAA--ATGGCGAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGACTTTTGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTGCTTGCGTA-CATGGGGAATGC--CTCTCCGATCGTGTGAGCAGCGATTT--CCGGCTTGCGTCCTGCGATGGC-CTGCCCGTTCGGGTTGGTGCCGGAGCTGACGCGT?????????????????????AAACAACCCAAAAACCACACCAACCCACAAACACACCCAAACAACAAACAAA Carex_disperma TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGTCGGGGA---GGTGCTTGTTGCCTCTTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGATGGCCGGAAAACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCAAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GTGCTGCGTGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCCGCATTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGCGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATACTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACAGATACAGTGCCTATTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGTGGCGTGGTTGCGTA-CATGGGGATTGC--CTCTCGGATTGTATGAGCAGCGATTT--CTGGCTTGCGTCCTGCGAAGGC-CCGCCTGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_disticha TTGCCTCTC-AAAAACACGACCGTTGCACACGTCACAGA--ACGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CCTTTC----G--GGCGCGTTGGTCAGTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGTGA--GTCGCCCGAGGGCTTGCGTCGGGTGCCGAGGCCAATG--ATAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTCGAGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTACAGACACAAGGCC-TTTCTGGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCCT-GCGCCGCGCGGCGCCTTCGGACCACACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCATCACTCTCCCTCCCGTCATTGAATTTG-T----C--GGGGCTGGGATGCTGTTGATTGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGCCCCTCGATAGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCATTTGGGTAGCCGAAATGTTGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTGTCACTTGGATTTTCGCCGGCTCTCACGGATGCGGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATCGCGATTTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTTGTTGCGTA-CACGGGGAATGC--CTCTCGGATTGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CCGCCTGTTCGGGTTGGTGCCGGAGCTGACGTGCCGGCTCTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_divulsa TTGCCCCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGTCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTTCCTCTAG-CCCTTC----G--GGCGAGTTGGACGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCGTAGCCGCTTAAGGGCTTGCGTCGGATGCCAAGGCCAACG--AAAATAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AGAGATGCGGACATTGGCCCTCCGAACCGCGAGGTACGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACGCAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCCTGCCGTTGCAGCTG-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACAAAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCATCATT-AATTTG-T----C--GGGGCTGGCATGCTTGTGATCGGTAGCCTGTGTAGTTGTACCCTGTTGTGGGTAGCCAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGCAATGATGGCAAAATCCTTGTGTAAGTGCG--CGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACAGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTTGGGAGGTCCC-TTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTGGTTGC?TA-CATGGGGAATGC--CTCTCAGATTGTATGAGCAGCGAT??--??TTCTTGCGTCCTGCGAAGGC-CCGCCTGTTTGGGTTGGTGCCGGAGCTGACGCACTGGCACTCGT-TAAGACGGCAAAACACCCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACACA Carex_ebenea TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTT-TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AACCCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGACCTTGTTGCTATCACTTGGATTTTAGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CTGGCTTGCGTCATGCGAAGGC-CCGCCCTTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_echinata TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAACATGCTGTCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTTCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCG-CCGGCTATAGCCGCTAAAGGGCTTGCGCCGGATGCCAAGGCCAATG--AAAAGAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGCACGGTGGGCCTAAGTGTGCGGCCGTCGTATAGGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACGCAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCCTGCCGTTGCAGCCT-GCGCTGCGCGGCGCCTTCGGACCAAAAACACCAACC-CAAACAAAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCCTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTACTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA--TTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCG--TGGTCGAATTGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCCAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGACACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGTCCGGGGCGTGATCGCGTA-CATGGGGAATGC--CTCTCGGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCCGCGAAGGC-CCGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCA-CACACCCCACAAACACCCCCAAACAACAAACAAA Carex_elongata TTGCCTCTCGAAAAACACGACCGTTG?{AT}-??G??ACAGA--ATG?TGTCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCTA-CCGTCCTCGTCCCTCTAG-?CCTTC----G--GGCGAGTTGGATGTTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTT?TG??TCGGAT?CC?AGGCAAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGA??ATCCACGCT--CAGTTGC----CTATCGGC-ACAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG-C?ACACGTCA-CCCCGAGCCCTGTATCGACACAT??CC-TTTTTTTA-CCCCTAACGAGGAGCTTGTCGTCGTGGCTT-GTGCTGCGCGGCGCCTTCGGACCAACCACACCAACC-CAAACACAAAAAAAACA-AC-CCACACACAACCCA??????????????????????????????TGCACTTTTGGTGCGGCC-ACCG-ACATGGGGCTGTCTCTCCACTCTCCCTCCTGT-A??????T??-T----?--CGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTTTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTACCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTCGTGTAGATGCGTGTGGTCGAATGGCCTTATTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATACAGTGCCTATTGCTA{CGT}CTCTGCGTGACTTTACTCCGCA?AC-TTCGGGAGGTTCCTTTGTAC-GAATCATTGCGAGGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGATTGCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGTAGC??TTT--CT??CTTGCGTCATGCGAAGGC-CCGCCTGTACGGGTTGGCGCCGGAGCTGACGCGCTGGCTCTCGTGTAAGAC????AACCCACCCAAAAACCACAAAACACAACAAACACACCCAAACAACAAACAAA Carex_exilis TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAACACGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTTCCCCTAG-CCCTTC----G--GGCGAGTTGGATGCAGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTATTGCCGCTAAAGGGCTTGCGCCGGATGCCAAGGCCGATG--AAAAGAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGCACGGTGGGCCTAAGTGTGCGGCCGTCGTATGCGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACGCAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCCTGCCGTTGCAGCCT-GCGCTGCGCGGCGCCCTCGGACCAAAAACACCAACC-CAAACAAAAAAAAAACA-AC-CCACC-ACAACCCATTATGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCCTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGCACTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA--TTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGCGCG--TGGTCGAATTGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTGC-GAATCATTGCGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGTCCGGGGCGTGATCGCGTA-CATGGGGAATGC--CTCTCGGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCCGCGAAGGC-CCGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCA-CACACCCCACAAACACCCCCAAACAACAAACAAA Carex_festucacea TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--A{CT}GCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAA{CT}G---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGTCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGA{CT}GCGCTGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_feta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGATGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGTGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTTTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-A----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTGGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCTGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_foenea TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTTCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTATGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGCTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTATTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_gibba TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGCCGGGGA---GGCGCCCGCCGCCTCCTCGG-CCCCA-CCGGCCCCGTCCCTCTCG-GCCTCC----G--GGCGCGTCGGTCGACGGCCGGAATACGGCGCG-GATGACGCCAAGGAACACGGAAAGAGCTGAGGCACCCGGCGA--GCCGCTGCTGCTGTTC????????????AGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-ACGGATGCGGACATTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCTAAGTGGGCGGCCGTCGTATGCGGCCGGGAGCGGCGAGTGGTGGGC--TACT?--C?C?CGTCA-CCCCGGGCCCCATACCGACACAGGGCC-TTCTACCACC?CTAA?CGAGGAGCCTGCCGCCGCGGCCT-GTGCCGCGCGGCGCCTTCGGACCAAACACACCAACC-CCAAAACAAAAAAAACA-AC-CCACC-ACAACACATTCTGGACTTGCTCTACATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTGAATTTG-T----C--GGGGTTGGGATG-TTGTGATCGGTTGCCTGGGCAGTTCTACCCTCTTGTGGGTAGCGAAGTCGTCCCTCGATTGATA-TTTGCTTGCCTCTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGTTGGCGAAATCCCTGTGTTGGTGCT--TGGTCGAATGCCCTTGTTGCTATCACTTGGATTTTTGCCGGCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTGCCCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCTCT-TATACGCCGTTTGTCGTGTTGCCGGTGGCGGCACGCAGATCG---TGTTCTGCCGTGTAGTCGCGATGACGA-AAGTC-A--GAACAGAAGTGTCCGGAGCGTGATCGCGTG-CATGTGGAATGC--CTCTCCGATCGTACGAACAGCGATTT--CCGGTCTGCGTCCTGCGAAGGC-CCGCCCGTTCGGGTTGGTGCCGGAGCTGACTCGCCGGCTCTCGTTTAAGACGTGCAAACAACCCACAAACCACAACACCCCAACAAAACCCACAAACAACAAACAAA Carex_glareosa TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCTA-CCGTCCTCGTCCCTCGAG-CCCTTC----G--GGCGAGTTGGATGTTGGCCGGAATACGGCGCGGGATGACGCCAAGGAATACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTTCTGTGTCGGGTGCCGAGGCAAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CAGTTGC----CTATTGGC-ACAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCTGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTATCGACACATGGCC-TATTTTTA-CCCCTAACGAGGAGCTTGTCGTCGTGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATATG-T----C--GGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTACCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCGTGTGGTCGAATGGCCTTATTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATACAGTGCCTATTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTTGGGAGGTCCCTTTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGATTGCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGTAGCGATTT--CTGGCTTGCGTCATGC?AAGGC-CCGCCTGTACGGGTTGGCGCCGGAGCTGACGCGCTGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACACAACAAACACACCCAAACAACAAACAAA Carex_gravida TTGCCTCTCGAAAAACACGACCGTAG?A-G?GTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCCGCCTCCT?GG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGAAAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGG?C-T???TTGGGTGCCAAGG?CAACG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCCGCGCGGTGCCTTCGGACCAACCACACCAACC-CAAACACAAACAAAA-C-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGCAAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCAGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_harfordii TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTA{GT}-ACCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGCGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGT-GGC--TACTG--CGCACGTCA-CCCCGCGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCCCC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----T--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGG{CT}GAAATCCTTGTGTAGGTGCG--TGGTTGAA{AT}GGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGA{CT}GA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGAT{CT}GTGTA-CATGGGGAATGC--CTCTCCGA{CT}CGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGA{CT}GCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_haydeniana TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTTCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGACCTTGTTGCTATCACTTGGATTTTAGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CTGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_hoodii TTGCCTCTC-AAAAACACGACCGTTGCACACGTGACAGA--ACGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CCTTTC----G--GGCGCGTTGGTCAGTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGTGA--GTCGCCCGAGGGCTTGCGTCGGGTGCCGAGGCCAATG--ATAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTCGAGGC-AAAGGTGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTACAGACACAGGGCC-TTTTTGGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCCT-GCGCCGCGCGGCGCCTTCGGACCACACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCGTCACTCTCCCTCCCGTCATTGAATTTG-T----C--GGGGTTGGGATGCTCGTGATTGGTTGCCTGTGTAGTTCTACC{CT}TATTGTGGGTAGCGAAGTTGCCCCTCGATAGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCATTTGGGTAGCCGAAATGTTGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTGTCACTTGGATTTTCGCCGGCTCTCATGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATCGCGATTTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTGGTTGCGTA-CATGGGGAATGC--CTCTCGGATTGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CCGCCTGTTTGGGTTGGTGCTGGAGCTGACGTGCCGGCTCTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_humilis TTGCCTTTCCGAAAACACGACCGTCGAACACGTGACAGA--ATGCTGCCGCGGA---GGCGCGTGCCGCCTCCTCGG-CCCCA-CCGGCCTCATCCCTCTCG-TCCTCC----G--GGCGCGTTGGTTGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGA-GAAAGCTGAGGCA-CCGGCGA--GCCGCGCAAGGGC-TGTGTCGGTTGCCAAGGCCAACA--AAAAAAATATGACT{CG}TCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGCCGGACTAACGGCAAAAGATGCGGACATTGGCCCTCCGAGCCGTGAGGCGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGTGCCCCGTACCGACGCAGGGCC-TTGTACGA-CCCCTAACGAGGAGCATGTCGTTGCGGCTT-CTGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CACACACAAACAAAACA-AC-AAACC-ACAACCCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_illota TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGCCGGGAAGGTGGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCATGCGTCGGGTGCCGAGGCCAATGAAAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCTTACTGACGCAGGGCCTTTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACAAACCAACC-CAAACACAAAAAAAAAAAAC-CCACC-ACAAACCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTT?-T??GG?--GGGG?TGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGC?TGTGGTCGAATGGCCCTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGTGATGTGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTGGTTGCGTA-CATGGGGAATGC--CTCTCGGATTGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CCGCCCGTTTGGGTTAGTGTCGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACACAAAAACCACAAAACCCAACAAACACACCCAAACAACAAACAAA Carex_infirminervia TTGCCTCTCGAAAAACACGACCGTTGAACACGTGACAGA--ACGCTGCCGGAGA---GGCGCCCGCCGCCTCCTCGG-CCCCG-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAACACGGCGCGGGATGGCGCCAAGGAACACGAT-AAAGCTAAGGCG----------------------------CCGGGCGCCGAGGCCAATG---AGAAAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGCTGC----CTAACGGC-AGAGATGCGGACAATGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTGTGCGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTATGA-CCCCTGACGAGGAGCCTGCCGTGGCGGCTC-GCGCCGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAC-C------AAA-C-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGCCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-GCATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGTGCTGGCATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGCTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTCGGGCAGCCGGAATGACGGCGAGATCCTTGTGTGGGCGCGTGCGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCACTGTGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGGC-CGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGGCCGTGGCATGATCTC?T?-CACGGGGAATGC--CTCTCCGATCGTATGA?CA?C?AT??--?C?--C??C?TCCTGCGAAG?CCCCGCCCGTCCGGGCTGGTGCCGGAGCTGACGCGCCGGCTCTCGC???????????AAACAACCCAAAAACCACAAAACCCCACAAACACCCCCAAACAACC-AAAAA Carex_integra TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGTCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCTGTTGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTCG-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGCATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGTCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_interior TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAACATGCTGTCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTTCCTCTAG-CCCTTC----G--GGCGAGTTGGATGATGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCG-CCGGCTATAGCCGCTAAAGGGCTTGCGCCGGATGCCAAGGCCAATG--AAAAGAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGCACGGTGGGCCTAAGTGTGCGGCCGTCGTATGCGGCCGGGAGCGGCGAGTGGTGGGC--GACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACGCAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCCTGCCGTTGCAGCCT-GCGCTGCGCGGCGCCTTCGGACCAAAAACACCAACC-CAAACAAAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCCTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTACTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA--TTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCG--TGGTCGAATTGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCCAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGTCCGGGGCGTGATCGCGTA-CATGGGGAATGC--CTCTCGGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCCGCGAAGGC-CCGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCA-CACACCCCACAAACACCCCCAAACAACAAACAAA Carex_lachenalii TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCTA-CCGTCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGTTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTTCTGCGTCGGGTGCCGAGGCA--------------ATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CAGTTGC----CTATCGGC-ACAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTATCGACACATGGCC-TTTTTTTA-CCCCTAACGAGGAGCTTGTCGTCGTGGCTT-GCGCTGCGCGGCGCCT???????AAACACACCAACC-CAAACACAAAAAAAC---AC-CCACC-ACAACCCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Carex_laeviculmis TTGCCTCTCGAAAAACACGACCGTAGCACATGTGACAGA--ACGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAATACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCCTGCGTCGGGTGC{CT}GAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCTTACCGACGCAGGGCCTTTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAAACCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCGTGTGGTCGAATGGCCCTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGTAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGCGTGATCGCGTA-CATGGGGAATGC--CTCTCTGATCGTATAAGCATCGATTT--CCGGCTTGTGTCGTGCGAAGGC-CCGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACCCCACAAACACCCCCAAACAACAAACAAA Carex_laevivaginata TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGTCGGAGA---GGTGCTTGCTGCCTCCCCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCCTGCGTCGGGTGCCAAGGCCAATG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTATGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAACCCA??????????????????TGTCGGGCTCCCTGCACTTTTTGTGCGGCCAACCG-ACATGGGGCAGTCTCTTCACTCTCCCTCCTGTCAATAAATTTG-T----C--GGGGCTGGGATGCTTGTGATTGGTTGCCTGTGTTGTTCTACCCTGTTGCGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTGTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTAGTGTTGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACAGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCT-TTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGGTTGCGTA-CATGGGGAATGC--CTCTCGGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGTGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCACTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_leavenworthii TTGCCTCTCGAAAAACACGACCGTCGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCAAAAGGGCCTGTGTCGGGTGCCAAGGCCAACG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGT?TTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGTGGGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCCGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTGAT----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGCGAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCACGGATGCATTGCCTAGTGTTGGCTCTGCATGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTATATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAAACCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_leptopoda TTGCCTCTCGAAAAACACGACCGTTGAACACGTGACAGA--ACGCTGCCGGAGA---GGCGCCCGCCGCCTCCTCGG-CCCCA-CCGGCCTCGTCC{CT}TCTAG-CC{CT}TTC----G--GGCGAGTTGGATGCTGGCCGGAACACGGCGCGGGATGACGCCAAGGAACACGATAGAA?{CT}TGAGGCG-CCGGCCG--{CG}CCG{AC}TTAAGGGCCTGCGCCGGGCGCCGAGGCCAATG---AGAAAATATGACTCTCGGCAACGGATAT{CT}TCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AGAGATGCGGACAATGGCCCTCCGAACCTCGGGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGGGCCCCGTACCGACACAGGGCC-TTCTATGA-CCCCTGACGAGGAGCTTGCCGTCGCGGCTC-GCGCCGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGCCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTCGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGCTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTCGGGCAGCCGAAATGATGGCGAGATCCTTGTGTGGGCGCGTGTGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCACTGTGAT-CGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGGC-CGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGGCCGTGGCATGATCGCGTA-CACGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGCCCCGCCCGTCCGGGCTGGTGCTGGAGCTGGCGCGCCGGCTCTCGTGGAAGACGTGCAAACAACCCAAAAACCACAAAACCCCACAAACACCCCCAAACAACAAAAAAA Carex_longii TTGCCTCTCGAAAAACACGACCGTCGTA-AGG???CAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCCG-????ATCCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGG?TGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCACCCCCGAGCCCGGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTG-GCCCTGCGCGG??CCTTCGAACCAACCACACAAACC-CAAACACAAAAAAAACA-AC-CCACC-AAAACCCA?????????????????????????????????????????????????????-???????????????????????????????????????????-??????????????????????????ATTGGTTG?CTTTGT??TT????CCT??T?TGGGTAGGGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC??GACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTTGGGAGGTT??-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTG???AT?TATA-CATG-GGAATGC--CTCTTTGACCGAAAGAGCAACGATTA--CCTACAAAC-TCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGT-TAAGAC-TG?AAACAACAAAAAAACAACAACACCCCACAAACACCCCCCAACAACAACCACC Carex_macloviana TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGCGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCTTCATTTAATTTG-T----T--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGTCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--TCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGATGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_microptera TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGG{AC}TTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGACCTTGTTGCTATCACTTGGATTTTAGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGAGATGA{CT}GA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTCCG{AT}TAGTATGAGCAGCGATTT--CTGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_missouriensis TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CC{AG}GCCTCGTCCCTCTAG-CTCTTC----G--AGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCCTCAAAAGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGC{CT}CTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACAGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATGGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCTGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_molesta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAACG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCAATCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGCTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_molestiformis TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCAGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATACTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCAAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGTGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCTGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-{CT}CGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_muehlenbergii TTGCCTCTCGAAAAACACGACCGTCGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCCTGTGTCGGGTGCCAAGGCCAACG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACAGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGT-GGC--TACAG--CGCACGTCA-CCCCGAGCCC?GTAACGACACAGGGCC-TTTTATGACCCCCTAACGAGGAGCTTGCTGTCGCGGCTT-GCGCTGCAGCGAGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCCCC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-A{AC}ATGGGGCTGTCTTTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCGAAGTTGTGCCTCGATTGATA-TTTGCTTGCCTTGC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCACGGATGCATTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-{CT}TCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAG{GT}C-A--GAAT-GAAGTGTCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCACTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_multicostata TTGCCTTTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC---GG--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACACTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACACCAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTTTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--G{AG}GGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTT{GT}AATGACCTTGTTGCTATCACATGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGAGATGA{CT}GA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGAT{CT}GTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGC-CTGCCCGTTTGGGTCGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_muskingumensis TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGG{ACT}A---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTTATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTTGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGTCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CTGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_nubigena TTGCCTCTCGAAGAACATGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGTTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCATCCCT-----TGCTGCATATGATGCTGCGTTGGATGTTGGTTGGAATACGGCGCGGGATGACGCCAAGGAACACGAT-AAAGCTGAGGCA-CCGGCTA--GTTGCTCGAGGGCTTGCGTCGGGTGCTGAGGC-AATG---GAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCACACACGCT--CGGTTGC----CTAATTGC-AAAGATGCGGACATTGGCCCTCCGAACTGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGCTATACTG--CGCACGTCA-CCCCGAGCCCTGTACTGACACA-GGCC-ATTTTTGA-CCCCTGACGAGGAGGTTGCCGTCGCGGCTG-TTGCTGTGCGGTGCCTCCGGACCAAACACACCAC-AAAAACCACAAAAAACA-C-AC-CCAAC-ACACCCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCATCATTCTCCCTCCCATCATTGAATTTG-T----T--GGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCTTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATT-TTTGCTTGCCTTTC-TGAC--TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCTTTGTTGCTATCACTTGGATTTTTGTCGGCTCTCATGGATGCAGTGCTTAGTGCTAGCGCTGTGTGACTTTGCCTCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATAGCTTT-CGGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGCGTGTTTGCGTA-CATGGGGAATGCCTCTCTCTGATAGTATGAGCAGCGATTT--CCGGCTTGTGTCCTGCGAAGGC-CTGCCCGTTTGGGTTGTTGCTGGAGCTGACGCGCCGGCTCTCGTTTAAGACGTGCAAACAACCCAAAAACCC-AACACCCCACAAACACCCCCAAAAAACAAACAAA Carex_oronensis TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCTTCTTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AAACCACC-ACAACCCAATCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTG{CT}G--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCG{CT}CTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTC{AG}TGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCTGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_ovalis TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCAC-CT--CTGTTGC----CTATCAGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGATGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGT-GGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGTGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-CC-CCCCC-ACAACCCATTTTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTTCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--TCGGCTTGTGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_pachystachya TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAT-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGCGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--TCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGATGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_panicea TTGCCTTTCCAAAAACACGACCGTCGAACACGTGACAGA--ATGCTGCCGCGGA---GGCG-TTGCCGCCTCCTCGG-CCCCA-CCGGCCTCCTCCCTCGCT-CCCTTC---GG--GGCGCGTTGGTTGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTGAGGCG-CCGGCGA--GCCGCTCAAGGG-TTCTGTCGGTTGCCAATGCAAACA--AAAGAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGCCTAACTAACGGC-AAAGACGCGGATGTTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTGTTGGAACCCCTAACGAGGAGCATCCCGCCGCGGCTT-GTGCTGCGCGGGGCCTTCGGACCAAACACCCCAACACCAAACACAACAAAAACA-AC-ACACC-ACAACACATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCGAACATAGGGCTGTCTCTTCACTCTCCCTCCCGTCATTGAACATG-T----C--GTGGCCGGGATGCTTCCGATCGGTTGCCTGTGCGGTTCTACCCTCTTGTGGGTAGCGAAGTCGTCCCTTGATGGATA-TTTGCTTGCC?TTC-TGACA-TCTTTGTGTCGTTTG?GCAGCCGAAATGTTGGCAAAATCCTTGTGTTGGCGCG--TGGTC?AACG-CCGTGTTGCCTTCGCTTGGATTCTTGCCGGCTCTCACGGATGCGGTGCCTAGTGCTAGCTCTGCGGGACTTTGCCCCGCAGAC-ATCGGGAGGTCCC-TTGTAC-GAATCATTGCTCT-TATACGCCGTTTGTCGTGTCGCCACC-GCGGCGCGCAGATCGTGTTCTTTCG---CGCCGTCGGATTGACAGCGCGTT-ACCGAACATTAGTGTCCGGAGCGTGGTCTTGTG-CACGTGGATTGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGTTTGCTTCACGCGAAGGC-CCGCCCGTCTGGGTCGGTGCTGGAGCTGACGCGCCGGCTCTCGTTTAAGACGTGCAAAAAACCCAAAAACCACAACCCCCCACAAC-AACAACAAACAACAAACAAA Carex_phaeocephala TTGCCTCTCGAAAAACATGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGA-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCTGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATG----TGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTTGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTCGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACAA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--TCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCACCGGCTCTCGTGTAGGACGTGCAAACAACCCA-CAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_praticola TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTTCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTCGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGC{CT}CATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTA-CAACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACCACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTATTGTCCTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCATAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGATGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_preslii TTGCCTCTCGAAAAACATGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGA-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTT----G--GGCGAGTTGGATGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGTGTGCCGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATG----TGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTTGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACAA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCGTGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--TCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCA-CAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_projecta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG-AAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAAAACAC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTATGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_radiata TTGCCTCTCGAAAAACACGACCGTTGCACCCGTGACAGA--ACGCTGCCGGGA----GGCGCTTGCCGCCTCCTCGG-CCCCC-CCGGCCTCCTCCCTCACG-CCCCCC----G--TGCGAGTAGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTGAGGCA-CCGGCCG--GCCGCTCAAGGGCTCGCGTCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AGAGATGCGGACATTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGCCG-CCCCGAGCCCCGTACCGACACAGGGCC-TCTTCTGACCCCCTAACGAGGAGCCTGCCGTCGCGGCCT-GTGCTGCGCGGTGCCTTCGGACCAAACC-ACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACACATTCTGGACTCGCTCTGCATGTCGGGCTCCCTGCACTTCTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTGATTTG-T----C--GGGGCTGGGATGCTCGTGATCGGTTGCCTGTGCGGCTCTACCCTGCTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTCTC-TGACA-TTTTTTTGTCGTTTTGGCAGCCGAAATGATGGCGAAATCCTTGTGCAGGTGCG--TGGTCGAATGTCCCCGTAGCTGTAACTTGGAATTTTGCTGGCTCTCACGGACGCAGTGCCCAGTGCTGGCTCTGCGTGGCTTTGCCCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCACTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-CGGAGTCGGGATGACGA-AAGTC-A--GAAC-GAAGTGTCTGGGGCGTGCTTGCGTA-CACGGGGAATGC--CTCTCCGATCGTACGAGCAGCGATTT--CCGGCTCGCGTCCTGCGAAGGC-CCGCCCGTCCGGGCCGGTGCCGGAGCTGACGCGCCGGGTGTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_rochebrunii TTGCCTCTCGAAAAACACGACCGTTGCACAAGTGACAGA--ACGCTGCTGGAGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTTGTCCCTCTAG-CCTTTC----G--GGCGAGTTGGATGCAGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCT--GTCGCTAAAGGGCTGGCGTCGGGTGCCAAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATTCACGCT--TGGTTGC----CTCACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCAC?TC?-CCCCGAGCCCTATACCGACACAGGGCC-TTTTTTT?-???CT??CAAGGAGCTTGCCGTAGCGGCTT--TGCCGCGCGGTGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACC-CTTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTTGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCAATGAATTTG-T----C--GTGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGCGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTTCCTTTC-TGACA-TTTTGTTGTCGTTTGGGAAGCCAAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTACTATCACTTGGATTTTTGCCGCCTCTCACAGATGCAGTGCCTAGTGTTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCTC-TTGTAT-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTGGTTGCTTA-CATGGGGAATGC--CTCTCGGATTGTATGAGCAGCGATTT--CCGGCTTGCGTCCGGCGAAGGC-CTGCCTGTTTGGGTTGGTGCCGGAGCGGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_rosea TTGCCTCTCGAAAAACACGACCGTTGTA?CCG?GACAGA--ACGCTGCCGGGA----GGCGCTTGCCGCCTCCTCGGCCCCCCCCCGGCCTCCTCCCTCACG-CCCCCC----G--TGCGAGTAGGATGCTGGCCGGAATACGGCGCGGGATGACCCCAAGGAACACGATAAAAGCTGAGGC?-CCGGCCG--GCCGCTCAAGGGCTCGCGTCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AGAGATGCGGACATTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--C???CGCCG-CCCCGAGCCCCGTACCGACACAG??CC-TCTT???C-CCCCTAACGAGGAGCCTGCCGTCGCGGCCT-GTGCTGCGCGGTGCCTTCGGACCAAACC-AAAAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCA????????????????????????????CCTGCACATCTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTG?TTTA-T----?--GGGG?TGGGATGCTCGTGATCGGTTGCCTGTGCGGCTCTACCCTG?TG?GGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTCTC-TGACA-TTTTTTTGTCGTTTTGGCAGCCGAAATGATGGCGAAATCCCTGTGCAGGTGCG--TGGTCGAATGTCCCCGTAGCTGTAACTTGGAATTTTGCTGGCTCTCACGGACGCAGTGCCCAGTGCCGGCTCTGCGTGGCTTTGCCCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCACTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-CGGAGTCGGGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGCGTGCTCGCGTA-CACGGGGAATGC--CTCTCCGATCGTACGAGCAGCGATTT--CCGGTCCGCGTCCTGCGAAGGC-CCGCCCGTCCGGGCCGGTGCCGGAGCTGACGCGCCGGGTCTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_sartwellii TTGCCTCTC-AAAAACACGACCGTTGCACACGTCACAGA--ACGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CCTTCC----G--GGCGCGTCGGTCAGTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGTGA--GTCGCCCGAGGGCTTGCGTCGGGTGCCGAGGCCAATG--ATAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTCGAGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGT-GGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTACAGACACAAGGCC-TTTCTGGA-CCCCTAACGAGGAGCTTGCTGTCGCGGCCT-GCGC???????????????????ACACACACCAACC-CAAACACAAAAAAAACA-AC-CCCCC-ACAACCCATTCTGGACTTGCTTTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCATCACTCTCCCTCCCGTCATTGAATTTG-T----C--GGGGCTGGGATGCTGTTGATTGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGCCCCTCGATAGATA-TTTGCTTGCCTTTC-TGACA-TTTTCTTGTCATTTGGGTAGCCGAAATGTTGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTGTCACTTGGATTTTCGCCGGCTCTCACGGATGCGGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATCGCGATTTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCTGGGGCGTTGTTGCGTA-CACGGGGAATGC--CTCTCGGATTGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGCGAAGGC-CCGCCTGTTCGGG{CT}TGGTGCCGGAGCTGACGTGCCGGCTCTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_scoparia_var._scoparia TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCTGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTTA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAAATTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATT-TGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTTCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCT{AC}TCGTGTAA{GT}AC{AG}T{AG}CAAACAACCCAAACACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_scoparia_var._tessellata TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-TCGGCTA--GCTGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTTA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAAATTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATT-TGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTTCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAACACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_seorsa TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGAACACGCTGTCGGGGA---GGTGCTTGCTGCCTCCCCGG-CCCCA-CCGGCCTCGTTCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCAGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCATAGCCGCTAAAGGGCTTGCGCCGGATGCCAAGGCCAATG--AAAAGAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGCACGGTGGGCCTAAGTGTGCGGCCGTCGTATGCGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCG-CCCCGAGCCCCGTACCGACGCAGGGCC-TTTTTTGA-CCCCTAACGAGGAGCCTGCCGTTGCAGCCT-GCGCTGTGCGGCGCCTTCGGACCAAAAACACCAACC-CAAACAAAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCCTCACTCTCCCTCCCGTCATTTAATTTG-T----C??GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTACTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA--TTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGCGCG--TGGTTGAATTGCCTCGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CGGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTGTGCGGGGCGTGATCGCGTA-CATGGGGAATG---CTCTCGGATCGTATGA?CAGCGATTT--CCGGCTTGCTTCCCGCGAAGGC-CCGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCAAAAAACCA-CACACCCCACAAACACCCCCAAC-AACAAACAAA Carex_shinnersii TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCAGGCTGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCTGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTG?ACTTGCT?TGCATGTCGGGCTCCCTGCACTTTTGGT-CGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C---GGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCAAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGTGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCTGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGG{AC}TCTCGTGTAAGACGTGCACACAACC-CAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_siccata TTGCCTCTC-AAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CCTTTC----G--GGCGCGTTGGTCAGTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGAT-AAAGCTAAGGCA-CCGGTGA--GCCGCTCGAGGGCTTGCGTCGGGTG{CT}TGAGGCCAATG-AAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTCATGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCATGTACTGACACAAGGCT-TTTTTGGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCCT-GCGCTGCGCGGCGCCTTCGGACCACACACACCAACC-CAACCACAAAAAAAAAACAC-CCACC-ACAACCCATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTCGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGCCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACATTCTTTTTGTCATTTGGGTAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGCTGCTGTCACTTGGATTTTTGCCGGCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCTTGACTTTGCCACGCAGAC-TTCGGGAGGTCCC-CTGTAC-GAATCATTGCGATGTGGACGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGAAGCGTGGTTGCGTA-CATGCGGAATGC--CTCTCTGATCGTATGAGCAGCGATTT--CCGGCTCGCGTCCTGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTTTAAGACGTGCAAACAACCCAAAAACCAAAACACCCAACAAACACACCCAAACAACAAACAAA Carex_siderosticta TTGCCTTT-GGAAAACACGACCTGTGCACACGTGACAGA--ATGCTG?CGGGGA---GGTGCTTG?TGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CCCTCTTGATG--GGCGCGTTGGACGCTGGTCGGAATACGGCGCGGGATGACGCCAAGGAACACGA-AAATGCTGAGGCA-CCGGCGA--GCCGCTCAAGGG-TTGCGTCGATTGCCAAGGCCAATT-GAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CAGTTGC----CTCATGGCCTCTGATGCGGACATTGGCCCTCCGAACCGCTAGGTGCGGTGAGCCTAAGAGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCATG?CGACACAGGGCC-TTGTTTGA?CCCATAACGAGGAGTATGTCGTCGCGGCTTCTTGCTGTGCGGCATCTTCGGACCCAACACACCAACAACACACACAACAAAAAAACAC-CAACC-ACAACAAATTTTAGACTTGCTCTACATGTCGGGCTCCCTGCACTT-TGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACT?TCCCTCCCGTCATTGAATTTG-T----C--GGGGTTGGGATGCTTGTGATCGGTTGCCTGTGTGGTTCTACCCTCTTGTGGGTAGCGAAGTCGTCCCTTGATGGATATTTTGCTTGCCCAGC-TGACA-TTGTTTTGTCGCTTGGTCAGCCGAAATGTTGGCAAAATCCTTGTGTTGTTGCG--TGGTTGAATT-CCTTGTTGATATCACTCGGATTTTTGCCGGCTCTCACGGATGCGGTGCCTATTGCTAGCTCTGCGGGCCTCTGTCCCGTAGAC-TTCGGGAGGTCCC-TTGTACGGGAACATTGCTCT-TGCGTG-CGTTTGTCGTGTTGCCTGCGG?GACACGCGAATTAAGT--TTTGGCCTTGTTGTCAG--TGGCGACACGTC-A--AAAC-TGTGTGTGCGGAGCATG{AG}TCACGTG-CTTGTGGAATGC--CTCTCTG-TTTTATTAGCAGCGATTT--CTGG-TTGCGTCATGCGAAGGC-CCGCCCGTCCGGGT-GGTGCTGGAGCTAACGTACCGGCTCTCGTTTAAGAC?TGCCAACAACCCAAAAAACACAACCCCACCAACAACACCCCAAACACCACACCAA Carex_stipata TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGTCGGAGA---GGTGCTTGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCCTGCGTCGGGTGCCAAGGCCAATG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCAT?CACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGT-GGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTATGA-CCCCTAACGAGGAGTTTGCTGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCCCC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTTGTGCGGCCAACCG-ACATGGGGCAGTCTCTTCACTCTCCCTCCTGTCAATAAATTTG-T----C--GGGGCTGGGATGCTTGTGATTGGTTGCCTGTGTTGTTCTACCCTGTTGCGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTGTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTAGTGTTGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACAGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCT-TTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGGTTGCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCCTGTGAAGGC-CTGCCCGTTCGGGTTGGTGCTGGAGCTGACGCGTCGGCACTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCAACAAACACACCCAAACAACAAACAAA Carex_straminea TTGCCTCTCGAAAAACACGACCGTTGCACATGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCACCCCCGAGCCCTGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGCTTGCCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-AAAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_suberecta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCTGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCACCCGGCTA--TCCGTCAAAGGGCTTGCATTGGGTGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTTA-CCCCTAACGAGGAGCTTGCCGTCGCAGCTT-GTGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAAAACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGT{CT}GGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAAATTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATT-TGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTA{GT}GTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGATGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTA-CATGGGGAATGC--CTCTTCGA{CT}CGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-TCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAACACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_subfusca TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGCTGGCTGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGGCTTGCATCGGGTGCTGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGATGAGCTTGCTGTCGCGGCTT-GTGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTATGGGTAGCGATGTTGTCCCTCGATTGATA-TTTGCTTGCCTTCA-TGACA-TTTTTTTGTTGTTTGGGCAGCCGAAATGATGGCGAAATCCTTGTGTAGGTGCA--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGTCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATTGTGTG-CATGGGGAATGC--CTCTCCGATCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGTCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_tenera TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ACGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--TTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTAGGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCTGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_tenuiflora TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGCCGCGGA---GGTGCTTGCTGCCTCCTCGG-CCCTA-CCGTCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGTTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTTCTGCGTCTGGTGTCGAGGCAAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACTGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTATCGACACAGGGCC-TTTTTTAA-CCCCTAACGAGGAGCTTGTCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGG?TGGGATGTTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCGTGTGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATACAGTGCCTATTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-AAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACAA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGATTGCCTA?CATGGGGAATGC--CTCTCCGATTGAATTAGCAG??ATTTAAC???TTG?CGTCATGCGAAGGC-CCGCCCGTTTGGGTTGGTGCCGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACCCAACAAACACACCAAAACAAAAAACAAA Carex_tincta TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTCG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGT----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGGCCCGTACCGACACAGGGCC-TTTTTCGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGTCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTA{AG}GTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTTTGGGTTGGTGCTGGAGCTGACGCGCTGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_tribuloides TTGCCTCTCGAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGTCGGGGA---GGTGCTTGTTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTAG-CTCTTC----G--GGCGAGTTGGATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCAGCTA--GCCGTCAAAGGGCTTGCATCGGATGCCGAGGCCAATG-AAAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CTGTTGC----CTATCGGC-AAAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCCGTACCGACACAGGGCC-TTTTTTGA-CCCCTAACGAGGAGATTGCTGTCGCAGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAAAACAC-CCACC-ACAACCCA???????????????????????????????GCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCAAAATCCTTGTGTATGTGCG--TGGTTGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACGGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-TAATCATTGCGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGCC-TGGAGTCGAGATGACGA-AAGTC-A--GAAT-GAAGTGTCTGGGGTGTGATCATGTA-CATGGGGAATGC--CTCTCCGACCGTATGAGCAGCGATTT--CCGGCTTGCGTCATGCAAAGGC-CCGCCCGTT{CT}GGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTG??????????AAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA Carex_trisperma TTGCCTCTCAAAAAACACGACCGTTGCACACGTGACAGA--ATGCTGCCGGGGA---GGTGCTTGCTGCCTCCTCGG-CCCTA-CCGGCCTCGTCCCTCTAG-CCCTTC----G--GGCGAGTTGGATGTTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCTA--GCCGTCAAAGGTTCTGCGTCGGGTGCCGAGGCAAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGATCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CAGTTGC----CTATAGGC-ACAGATGCGGACATTGGCCCTCCGAACCGTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGCACGTCA-CCCCGAGCCCTGTACCGACACAGGGCC-TTTTTTTA-CCCCTAACGAGGAGCTTGTCGTCGCGGCTT-GCGCTGCGCGGCGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTGGACTTGCTCTGCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCCGTCATTTAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTATTGTGGGTAGCGAAGTTGTCCCTCGATTGATA-TTTGCTTGCCTTTC-TGACA-TTTTTTTGTCGTTTGGGCAGCCGAAATGATGGCGAGATCCTTGTGTAGGTGCGTGTGGTCGAATGGCCTTGTTGCTATCGCTTGGATTTTTGCCGCCTCTCACGGATACAGTGCCTATTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCCTTTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGATTGCGTA-CATGGGGAATGC--CTCTCCGATCGTATGAGTAGCGATTT--CTGGCTTGCGTCATGCGAAGGC-CCGCCTGTTCGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCACAAAACACAACAAACACACCCAAACAACAAACAAA Carex_vulpina TTGCCTCTCGAAAAACACGACCGTTGCACAAGTGACAGA--ACGCTGCCGGAGA---GGTGCTTGCTGCCTCCTCGG-CCCCA--CGGCCTCGTCCCTCTTG-CTTTTC----G--GGCGAGTGGAATGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CTGGCTA--GCCGCTAAAGGGCTGGCGTCTGGTGCCAAGGCCAATG--AAAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATTCACGCT--TGATTGC----CTCACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTCGAGGTGCGGTGGGCCTAAGTGTGTGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGC--TACTG--CGGACGTCA-CCCCCAGCCCCGTACCGACACAGTGCC-TTTTTTGA-CCCCTAACGAGGAGCTTGCCGTTGCGGCTT-GCGCCG{CT}GCGGTGCCTTCGGACCAAACACAC-CACC-CAAACACAAAAAAAACA-AC-CCACC-ACAACCCATTCTTGACTTGCTCTGCATGTTGGGCTCCCTGCACTTTTTGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCAATGAATTTG-T----C--GGGGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGCGGGTAGCGAAGTTGTCCCTCTATTGATA-TTTGCTTGCCTTTC-TGACA--TTTTTTGTCGTTTGGGCAGCCGAAATGATGGTGAAATCCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACTTGGATTTTTGCCGCCTCTCACAGATGCAGTGCCTAGTGCTAGCTCTGCGTGACTTTACTCCGCAGAC-TTCGGGAGGTCCC-TTGTAC-GAATCATTGCGACGTGGGCGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGACGA-AGGGCAA--GAAT-GAAGTGTCCGGGGTGTGGTTGCGTA-CATGGGGAATGC--CTCTCGGATTGAATGAGCAGCGATTT--CCGGCTTGTGTCCTGCGAAGGC-CCGCCTGCTTGGGTTGGTGCTGGAGCTGACGCGCCGGCTCTCGTGTAAGACGTGCAAACAACCCAAAAACCA-CACACCCAACAAACACACCCAAACAACAAACAAA Carex_vulpinoidea TTGCCTCTCGAAAAACACGACCGTCGCACACGTGACAGA--ATGCTGTCGGAGA---GGTGCTAGCTGCCTCCTCGG-CCCCA-CCGGCCTCGTCCCTCTTG-CCCTTC----G--GGCGAGTTTGACGCTGGCCGGAATACGGCGCGGGATGACGCCAAGGAACACGATAAAAGCTAAGGCA-CCGGCCA--GCCGCTAAAGGGCCTGTGTCGGGTGCCAAGGCCAATG---AAAAAATATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTCATGGGCGTTAGAAGCCCATCCACGCT--CGGTTGC----CTAACGGC-AAAGATGCGGACATTGGCCCTCCGAACCTTGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTTGTATGTGGCCGGGAGTGGCGAGTGGT-GGC--TACAG--CGCACGTCA-CCCCGAGCCCCGTAACGACACAGGGCC-TTATATGACCCCCTAACGAGGAGTTTGCTGTCGCGGCTC-GCGCTGCGCGGGGCCTTCGGACCAAACACACCAACC-CAAACACAAAAAAAA-C-AC-CCCCC-ACAACACATTCTGGACTTGCTCTTCATGTCGGGCTCCCTGCACTTTTGGTGCGGCCAACCG-ACATGGGGCTGTCTCTTCACTCTCCCTCCTGTCATTTAATTTG-T----C--AGTGCTGGGATGCTTGTGATCGGTTGCCTGTGTAGTTCTACCCTGTTGTGCGTAGCTAAGCTGTCCCTCGATTGATA-TTTGCTTGCCTTTT-TGACA-TTTTTTTGTCATTTGGGCAGCCGAAATGATGGCGAAATTCTTGTGTAGGTGCG--TGGTCGAATGGCCTTGTTGCTATCACCTGGATTTTTGCCGGCTCTCACGGATGCAGTGCCTAGTGTTGGCTCTGCGTGGCTTTGCCCTGCAGAC-CTCGGGAGGTCCC-TTGTAC-GAATCATTGTGAT-CAGATGCCGTTTGTCGTGTTGCTTGT-TTGGCACGCAAATCGTATTGTTCTGTC-TGGAGTCGGGATGATGA-AAGTC-A--GAAT-GAAGTATCTGGGGCGTGCTTGCGTA-CTTGGGGAATGC--CTCTCCGATTGTATGAGCAGCGATTT--TCGGCTTGCGTCCTGCGAAGGC-CTGCCCGTTCGGGTTGGCGCTGGAGCTGACGCGTCGGCATTCGTTTAAGACGTGCAAACAACCCAAAAACCACAACACCCCACAAACACCCCCAAACAACAAACAAA ; END; BEGIN TREES; TITLE Carex; LINK TAXA = Taxa1; TRANSLATE 1 Carex_gibba, 2 Carex_nubigena, 3 Carex_radiata, 4 Carex_rosea, 5 Carex_infirminervia, 6 Carex_leptopoda, 7 Carex_deweyana, 8 Carex_interior, 9 Carex_echinata, 10 Carex_exilis, 11 Carex_seorsa, 12 Carex_laeviculmis, 13 Carex_illota, 14 Carex_arcta, 15 Carex_vulpina, 16 Carex_rochebrunii, 17 Carex_stipata, 18 Carex_laevivaginata, 19 Carex_divulsa, 20 Carex_disperma, 21 Carex_canescens, 22 Carex_brunnescens, 23 Carex_trisperma, 24 Carex_elongata, 25 Carex_lachenalii, 26 Carex_glareosa, 27 Carex_tenuiflora, 28 Carex_multicostata, 29 Carex_ebenea, 30 Carex_microptera, 31 Carex_haydeniana, 32 Carex_integra, 33 Carex_subfusca, 34 Carex_abrupta, 35 Carex_preslii, 36 Carex_phaeocephala, 37 Carex_davyi, 38 Carex_bohemica, 39 Carex_foenea, 40 Carex_praticola, 41 Carex_straminea, 42 Carex_longii, 43 Carex_scoparia_var._tessellata, 44 Carex_scoparia_var._scoparia, 45 Carex_albolutescens, 46 Carex_suberecta, 47 Carex_alata, 48 Carex_ovalis, 49 Carex_feta, 50 Carex_tincta, 51 Carex_missouriensis, 52 Carex_tenera, 53 Carex_festucacea, 54 Carex_oronensis, 55 Carex_bicknellii, 56 Carex_muskingumensis, 57 Carex_molesta, 58 Carex_projecta, 59 Carex_tribuloides, 60 Carex_cristatella, 61 Carex_bebbii, 62 Carex_cumulata, 63 Carex_brevior, 64 Carex_shinnersii, 65 Carex_molestiformis, 66 Carex_athrostachya, 67 Carex_adusta, 68 Carex_harfordii, 69 Carex_pachystachya, 70 Carex_macloviana, 71 'Carex crus-corvi', 72 Carex_bromoides, 73 Carex_alopecoidea, 74 Carex_vulpinoidea, 75 Carex_annectens, 76 Carex_conjuncta, 77 Carex_aggregata, 78 Carex_gravida, 79 Carex_cephaloidea, 80 Carex_leavenworthii, 81 Carex_cephalophora, 82 Carex_muehlenbergii, 83 Carex_diandra, 84 Carex_hoodii, 85 Carex_disticha, 86 Carex_sartwellii, 87 Carex_siccata, 88 Carex_siderosticta, 89 Carex_baldensis, 90 Carex_caryophyllea, 91 Carex_panicea, 92 Carex_humilis; TREE TREE1 = [&R] ((1:0.08505851824075035,((2:0.0535072098977809,((3:0.005198391828260557,4:0.005198391828260557):0.045104948041448455,((((((5:0.010253179894902185,6:0.010253179894902185):0.00290239878545376,7:0.013155578680355945):0.016887161894514384,(((8:0.0015331792956581108,9:0.0015331792956581108):0.007148805707514854,(10:0.006919098709685531,11:0.006919098709685531):0.001762886293487434):0.011359355338550287,12:0.02004134034172325):0.010001400233147075):0.0022167686149663322,(((13:0.005181248731756743,14:0.005181248731756743):0.021318406961300204,((((15:0.012550870485891895,16:0.012550870485891895):0.002739177094455845,(17:0.002015580106996243,18:0.002015580106996243):0.013274467473351497):0.002934758372055205,19:0.018224805952402945):0.004070930466238871,20:0.022295736418641816):0.004203919274415133):0.003747277155792879,(21:0.018098133472642268,((22:0.012431985594143437,(23:0.009330769256491732,(24:0.007097266535958763,(25:0.005433763668327689,26:0.005433763668327689):0.0016635028676310745):0.0022335027205329684):0.0031012163376517056):4.7711099148439566E-4,27:0.012909096585627833):0.005189036887014435):0.01214879937620756):0.002012576340986831):0.008290533029590076,((((28:0.00834405483242584,(29:0.0030508459364613962,(30:0.001584167819655637,31:0.001584167819655637):0.0014666781168057592):0.005293208895964444):0.002847455154847781,(32:0.009722848109663713,(33:0.004323330875264385,34:0.004323330875264385):0.0053995172343993285):0.001468661877609908):0.008320764363516265,((((35:0.006215906439205762,36:0.006215906439205762):0.004756170867807932,37:0.010972077307013694):7.711128332277932E-4,38:0.011743190140241487):0.001720153432537225,(39:0.01182144288784632,40:0.01182144288784632):0.001641900684932392):0.006048930778011174):0.0021006742661282274,((((41:0.013815557214562771,(42:0.013027347469886893,((((43:2.2576854109093602E-4,44:2.2576854109093602E-4):9.298354548200208E-4,45:0.0011556039959109568):0.0033672999140039947,46:0.0045229039099149515):0.002297055124490489,47:0.006819959034405441):0.006207388435481452):7.88209744675878E-4):0.0011656850083314983,((48:0.01029319425990906,49:0.01029319425990906):0.0024154626558580746,((((50:0.0052538729076641,((51:0.0033281701836726687,((52:0.0020706220325126174,53:0.0020706220325126174):1.266468814104236E-4,54:0.002197268913923041):0.0011309012697496277):0.0010750093460954696,(55:0.00382494136355782,56:0.00382494136355782):5.782381662103185E-4):8.506933778959615E-4):6.783560415982038E-4,57:0.005932228949262304):0.0026762637661466235,((((58:9.253875368069834E-5,59:9.253875368069834E-5):6.827147430104735E-4,60:7.752534966911719E-4):9.502412283955013E-4,61:0.0017254947250866732):0.004342893842692251,62:0.006068388567778924):0.0025401041476300033):6.912612025972136E-4,(63:0.005384338448978818,(64:0.003250923800537248,65:0.003250923800537248):0.0021334146484415705):0.003915415469027322):0.0034089029977609937):0.002272585307127135):8.837184057637771E-4,66:0.015864960628658047):7.469740251470416E-4,(67:0.014120712023668684,((68:0.005146331125162527,69:0.005146331125162527):0.0014818058923858892,70:0.006628137017548416):0.007492575006120268):0.0024912226301364044):0.005001013963113025):0.01893709360250862):0.007729834815527123,((71:0.022928534862077098,72:0.022928534862077098):0.016605484596247513,(((((73:0.006173566632749613,(74:0.005745512014814304,75:0.005745512014814304):4.2805461793530945E-4):3.699466510705138E-4,((76:0.0027728961180415223,77:0.0027728961180415223):0.002014891359937489,(78:0.004710608779073211,79:0.004710608779073211):7.717869890580022E-5):0.0017557258058411157):8.74942246306961E-4,80:0.007418455530127088):0.005721007918737264,(81:0.01092403096651766,82:0.01092403096651766):0.002215432482346692):0.014341133775119683,83:0.027480597223984035):0.012053422234340576):0.008745857576629247):0.0020234628347551506):0.0032038700280718896):0.004795985663855716,((84:0.010605861851717064,(85:0.003273645978342365,86:0.003273645978342365):0.007332215873374699):0.019373651252793167,87:0.02997951310451023):0.028323682457126385):0.026755322679113736):0.003143196569005094,(88:0.06849119320235424,(89:0.05994488315469019,((90:0.029943749303536958,91:0.029943749303536958):0.002884698974387964,92:0.03282844827792492):0.027116434876765266):0.008546310047664048):0.019710521607401207); END;