#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 4:15 GMT TreeBASE (cc) 1994-2008 Study reference: Raja H.A., Fournier J., Shearer C., & Miller A.N. 2012. Freshwater Ascomycetes: Coniochaeta gigantospora sp. nov. based on morphological and molecular data. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12255] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=53; TAXLABELS Chaetosphaeria__ellisii_AY906939 Chaetosphaeria_ellisii_AY906940 Coniochaeta_africana_GQ154539 Coniochaeta_gigantospora_JN684909 Coniochaeta_ligniaria_AY198390 Coniochaeta_ligniaria_EU450836 Coniochaeta_ligniaria_FN394684 Coniochaeta_nepalica_DQ093664 Coniochaeta_prunicola_GQ154540 Coniochaeta_prunicola_GQ154541 Coniochaeta_savoryi_GQ922522 Coniochaeta_sp_JN673041 Coniochaeta_sp._CRCF1_HQ657291 Coniochaeta_sp._CRCF17_HQ657307 Coniochaeta_sp._CRCF20_HQ657309 Coniochaeta_sp._CRCF21_HQ657310 Coniochaeta_sp._CRCF22_HQ657311 Coniochaeta_sp._CRCF23_HQ657312 Coniochaeta_sp._CRCF24_HQ657313 Coniochaeta_sp._CRCF29_HQ657317 Coniochaeta_sp._CRCF30_HQ657318 Coniochaeta_sp._CRCF31_HQ657319 Coniochaeta_sp._CRCF7_HQ657297 Coniochaeta_sp._HS_EF21_GQ334428 Coniochaeta_sp._M136_HM595554 Coniochaeta_sp._SS_1760_AM262406 Coniochaeta_sp._ZLY_2010b_HM595513 Coniochaeta_sp._agrAR062_FN435672 Coniochaeta_sp._agrAR113_FN435704 Coniochaeta_velutina_GQ154542 Coniochaeta_velutina_GQ154543 Coniochaeta_velutina_GQ154544 Coniochaeta_velutina_GQ154545 Lecythophora_decumbens_IMUFRJ_52014_FN428890 Lecythophora_fasciculata_GQ377492 Lecythophora_hoffmannii_AY781227 Lecythophora_hoffmannii_JF440598 Lecythophora_luteoviridis_DQ404354 Lecythophora_mutabilis_DQ093680 Lecythophora_mutabilis_HM036599 Lecythophora_mutabilis_HQ157861 Lecythophora_sp_LS6_2009a_HQ660445 Lecythophora_sp._123_FJ228192 Lecythophora_sp._A14_FJ903286 Lecythophora_sp._ADJL_2009a_GU166485 Lecythophora_sp._F47_GU067748 Lecythophora_sp._I179_GU062252 Lecythophora_sp._I302_GU062289 Lecythophora_sp._JZ_103_HQ637295 Lecythophora_sp._JZ_104_HQ637298 Lecythophora_sp._JZ_169_HQ637296 Lecythophora_sp._NG_p46_HQ115712 Lecythophora_sp._UBC_AY219880 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=44; TAXLABELS Barrina_polyspora_AY346261 Coniochaeta__discoidea_AY346297 Coniochaeta_SMH2569_AY346275 Coniochaeta_africana_GQ154601 Coniochaeta_boothii_AJ875226 Coniochaeta_cruciata_AJ875222 Coniochaeta_discoidea_AJ875230 Coniochaeta_gigantospora_JN684909 Coniochaeta_hansenii_AJ875223 Coniochaeta_leucoplaca_FJ167399 Coniochaeta_ligniaria_AF353583 Coniochaeta_ligniaria_AF353587 Coniochaeta_malacotricha_AF353589 Coniochaeta_malacotricha_AF353590 Coniochaeta_ornata_AJ875228 Coniochaeta_ostrea_AJ875227 Coniochaeta_ostrea_DQ470959 Coniochaeta_prunicola_GQ154602 Coniochaeta_prunicola_GQ154603 Coniochaeta_pulveracea__GQ351560 Coniochaeta_pulveraceae_AF353591 Coniochaeta_punctulata_AJ875231 Coniochaeta_rhopalochaeta_GQ351561 Coniochaeta_savoryi_AY346276 Coniochaeta_sp_JN673041 Coniochaeta_sp._SJ069_AY953951 Coniochaeta_sp._SJ153_AY953952 Coniochaeta_subcorticalis_AF353593 Coniochaeta_tetraspora_AJ875225 Coniochaeta_velutina_FJ167400 Coniochaeta_velutina_FJ167401 Coniochaeta_velutina_FJ167402 Coniochaeta_velutina_GQ154604 Coniochaeta_velutina_GQ154605 Coniochaeta_velutinosa_GU553330 Coniochaeta_verticillata_AJ875232 Lecythophora_decumbens_AF353597 Lecythophora_fasciculata_AF353598 Lecythophora_hoffmannii_AF353599 Lecythophora_lignicola_AF353601 Lecythophora_luteoviridis_AF353603 Lecythophora_mutabilis_AF353604 Xylaria_acuta_AY544676 Xylaria_hypoxylon_AY544648 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=59; TAXLABELS Annulohypoxylon_atroroseum_DQ840060 Anthostomella_brabeji_EU552098 Anthostomella_leucospermi_EU552100 Astrocystis_cocoes_AY083823 Barrina_polyspora_AY346261 Coniocessia_anandra_GU553349 Coniocessia_cruciformis_GU553346 Coniocessia_cruciformis_GU553347 Coniocessia_cruciformis_GU553348 Coniocessia_maxima_GU553344 Coniocessia_minima_GU553345 Coniocessia_nodulisporioides_AJ875224 Coniocessia_nodulisporioides_GU553350 Coniocessia_nodulisporioides_GU553351 Coniochaeta_africana_GQ154601 Coniochaeta_boothii_AJ875226 Coniochaeta_cruciata_AJ875222 Coniochaeta_discoidea_AJ875230 Coniochaeta_gigantospora_JN684909 Coniochaeta_hansenii_AJ875223 Coniochaeta_ligniaria_AF353583 Coniochaeta_ligniaria_AF353587 Coniochaeta_malacotricha_AF353589 Coniochaeta_ornata_AJ875228 Coniochaeta_ostrea_AJ875227 Coniochaeta_prunicola_GQ154602 Coniochaeta_pulveracea_GQ351560 Coniochaeta_punctulata_AJ875231 Coniochaeta_rhopalochaeta_GQ351561 Coniochaeta_savoryi_AJ875229 Coniochaeta_sp_JN673041 Coniochaeta_subcorticalis_AF353593 Coniochaeta_tetraspora_AJ875225 Coniochaeta_velutina_GQ154605 Coniochaeta_verticillata_AJ875232 Coniolariella_australis_EF489464 Coniolariella_ershadii_GU553331 Coniolariella_gamsii_GU553329 Coniolariella_limoniispora_EF489469 Diatrype_disciformis_DQ470964 Diatrype_stigma_FJ430588 Diatrype_whitmanensis_FJ430587 Halorosellinia_oceanica_AY083822 Heterorosellinia_hispanica_EF489465 Hypoxylon_fragiforme_AY083829 Hypoxylon_monticulosum_DQ840067 Nemania_diffusa_DQ840076 Nemania_maritima_DQ840074 Novaxylaria_murandii_AJ875233 Rosellinia_bambusae_s_EF489466 Rosellinia_necatrix_2_AY083824 Sordaria_fimicola_AF132330 Xylaria_badia_AB376705 Xylaria_escharoidea_AB376822 Xylaria_hypoxylon_AY327481 Xylaria_mellissii_AB376710 Xylaria_phyllocharis_AB376686 Xylaria_psidii_AB376698 Xylaria_psidii_AB376713 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M11187] TITLE Coniochaeta_gigantospora_Exp_LSU; LINK TAXA = Taxa3; DIMENSIONS NCHAR=505; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Annulohypoxylon_atroroseum_DQ840060 ----GAGATGGCCTTCGCCCTAGTAACGGCGAGTGAAGCGGCAAAAGCTC-CATTTGAAATCTGGCCCCGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTTGGACACCTAGCCTCTATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTCTCCAGGGGGATCAACCGTTATTC-TTAGCGGTGCACTCCCCCTGGTTTAGGCCAGCATCGGTTCTCTTAGGGGGATAAAGGCCTGGGGAACGTAGCT-CTTTAGGGAGTGTTATAGCCCCTAGCGT-AATACC Anthostomella_brabeji_EU552098 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTACGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCTAGGTCGAGGCCAGCATCGGTTTCCGTAGGGGGATAAAAGCTTGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCCTTGCAT-AATACC Anthostomella_leucospermi_EU552100 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCTCTGGAACGAGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCTAGGTCGAGGCCAGCATCGGTTTTCGTAGGGGGATAAAAGCCTTGGGAACGTAGCT-CCTTCGGGAGTGTTATAGCCCTTGGCAT-AATACC Astrocystis_cocoes_AY083823 GAAACCAACAGGGATTGCCCCAGTAGCGGCGAGCGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTGAGAGGGTGAGAGCCCCGTACGGTTGGACGCCAGGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCTGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTTCGCCAGGTTCAGGCCAGCATCGGCTCTCGCAGGGGGACAAAAGCTCTGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCTCTGCAC-AATACC Barrina_polyspora_AY346261 GAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGCCCGAGTTGTAATTTGTAGAGGACGCTCCTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTACAGTCGGACACCTAGCCTCTGTGGAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATCTCTTCTAAAGCTAAATACAGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCCGATCACCCAGCGTTC-TCGCTGGTGCGCTCGACCCGGCCCAGGCCAGCGTCGGTTCCCGCGGGGGGACAAAAACTTCGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCTGTGC-AATGCC Coniocessia_anandra_GU553349 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTCCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCCCTTCGGGAGTGTTATAGCCCGTTGCGT-AATACC Coniocessia_cruciformis_GU553346 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCCCTCCGGGAGTGTTATAGCCCGTTGCGT-AATACC Coniocessia_cruciformis_GU553347 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCCCTCCGGGAGTGTTATAGCCCGTTGCGT-AATACC Coniocessia_cruciformis_GU553348 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCCCTCCGGGAGTGTTATAGCCCGTTGCGT-AATACC Coniocessia_maxima_GU553344 GAAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTTCGGGAGTGTTATAGCCCGTTGCG-------- Coniocessia_minima_GU553345 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTCCGGGAGTGTTATAGCCCGTTGCGT--ATACC Coniocessia_nodulisporioides_AJ875224 ----------------------------------------------GCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTTCGGGAGTGTTATAGCCCGTTGCGT-AATACC Coniocessia_nodulisporioides_GU553350 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTCCGGGAGTGTTATAGCCCGTTGCGT-AATACC Coniocessia_nodulisporioides_GU553351 -AAACCAACAGGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAACAGCTCAAATTTGAAAGCTGGCCTTGGTCCGCATTGTAATTTGTAGAGGATGCTTTTGACGCGGTACCTTCTGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACAGTTGGATACCAAGTCTCTGTATAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTTTTCCTGGCGGATCATCCGGGGTTC-TCCCCGGTGCACTTCGCCTGGTTTAGGCCAACATCGATTTCCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCTCTCCGGGAGTGTGATAGCCCGTTGCGT--ATACC Coniochaeta_africana_GQ154601 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCA-CCTTCGGGTGTGTTATAGCCCGTTGCTT-AATACC Coniochaeta_boothii_AJ875226 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGGGTTC-TCCCTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTGGTAGGGGGACAAAAGCTTAGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCTTTGCTC-AATACC Coniochaeta_cruciata_AJ875222 ----------------------------------------------GCTCAAATTTGAAATCTGGCCTGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACGTGCGCCGGGGCGACCATCCAGTGTTC-TCACTGGTGCACTCGCCCCGGCGCAGGCCAGCGTCGGTTTCCGCAGGGGGAAAAAAGCGGCGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCCGTTT-AATACC Coniochaeta_discoidea_AJ875230 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCAGCCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGTGGACAAAAGCTCCGGGAACGTAGCT-CCTTCGGGAGTGTTATAGCCCGTTGCTC-AATAC- Coniochaeta_gigantospora_JN684909 GAAACCAACGGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGCCTCAGGGCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGGGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTATAGTAGGACACCTAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTCCGCGGGGGGATAAAGGCTCCGGGAACGTGGCTCTCCTTGGGAGTGTTATAGCCCGCTGCTC-AATGCC Coniochaeta_hansenii_AJ875223 ----------------------------------------------GCTCAAATTTGAAATCTGGCCTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTACAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCTGGGGGACAAAAGCTCCGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGTTGTTT-AATACC Coniochaeta_ligniaria_AF353583 -------------------------------AGT{CG}AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGTGGGGGGATAAAAGCTTCGGGAACGTGGCA-CCTTCGGGTGTGTTATAG{AC}CCGTTGCTT-AATACC Coniochaeta_ligniaria_AF353587 -----------------------------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGTGGGGGGATAAAAGCTTCGGGAACGTGGCA-CCTTCGGGTGTGTTATAGCCCGTTGCTT-AATACC Coniochaeta_malacotricha_AF353589 -----------------------------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGTAGGGGGATAAAAGTAGTGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCTGCTC-AATACC Coniochaeta_ornata_AJ875228 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAGGCGGCGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCCGCTC-AATACC Coniochaeta_ostrea_AJ875227 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGACAAAAGCTCCGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCTGCTC-AATACC Coniochaeta_prunicola_GQ154602 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCA-CCTTCGGGTGTGTTATAGCCCGCTGCTT-AATACC Coniochaeta_pulveracea_GQ351560 --------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGTGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCC?GAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAA?TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCGCGGTTCTTCCGCGG?GCACTCTGCCCGGCCCAGGCCAGCGTCGGTTCTGGC??GGGGACAAAAGCTTGGGGAACGTGGCT-CCTTCGGGAGTGTTATAGCCCCTTGCCC-AATGCC Coniochaeta_punctulata_AJ875231 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCGGCGGGAACGTGGCT-CCTCCGGGAGTGT-ATAGCCCGCCGCTC-AATACC Coniochaeta_rhopalochaeta_GQ351561 --------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCCTACGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCACGGTTC-TCCGTGGTGCACTCTGCCCGGCCCAGGCCAGCGTCGGTTCTGGGACGGGGACAAAAGCTTGGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCCTTGCCC-AATACC Coniochaeta_savoryi_AJ875229 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCGGCGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCCGCTC-AATACC Coniochaeta_sp_JN673041 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCA-CCTCCCGGTGAGTTATAGCCCGTTGCTT-AATACC Coniochaeta_subcorticalis_AF353593 -----------------------------------AAGC{CG}GCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCG{AT}{GT}TTGT{AT}ATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCACGGTTC-TCCGTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTGGCAGGGGGACAAAAGCTTAGGGAACGTGGCT-CCTCCGGGAGTGTTATA{AG}CCCTT{AT}GCTC-AATACC Coniochaeta_tetraspora_AJ875225 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCCGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCTGCCGGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGACAAAAGCTTCGGGAACGTAGCT-CCTCCGGGAGTGTTATAGCCCGTCGCTC-AATACC Coniochaeta_velutina_GQ154605 GAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCA-CCTCCGGGTGTGTTATAGCCCGCTGCTT-AATACC Coniochaeta_verticillata_AJ875232 ----------------------------------------------GCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCGTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGACACCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTC-TCACTGGTGCACTCGACCCGGTTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTCTGGGAACGTGGCT-CCTCCGGGAGTGTTATAGCCCGCTGCTT-AATACC Coniolariella_australis_EF489464 --------------------------------------------------------------------------------------------------------GCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTCCGCCGGGCTGAGGCCAGCATCGGTTCCCGCGGGGGGACAAAAGCGGGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCTCCGCAT-AATACC Coniolariella_ershadii_GU553331 -AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTCCGCCGGGCTGAGGCCAGCATCGGTTCCCGCGGGGGGACAAAAGCGGGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCTCCGCAT-AATACC Coniolariella_gamsii_GU553329 -AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTCCGCCGGGCTGAGGCCAGCATCGGTTCCCGCGGGGGGACAAAAGCGGGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCTCCGCAT-AATACC Coniolariella_limoniispora_EF489469 --------------------------------------------------------------------------------------------------------GCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTCCGCCGGGCTGAGGCCAGCATCGGTTCCCGCGGGGGGACAAAAGCGGGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCTCCGCAT-AATACC Diatrype_disciformis_DQ470964 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACCTTTGTCAGGCGGATCATCCGGTGTTCTTCACCGGTGCACTTCGCCTGGCTCAGGCCAGCATCGATTTCTGTAGAGGGATAAAGACCATGGGAACGTAGCTCTCTTCGGGAGTGTTATAGCCCTAGGTGT-AATACC Diatrype_stigma_FJ430588 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACCTTTGTCAGGCGGATCATCCGGTGTTCTTCACCGGTGCACTTCGCCTGGCTTAGGCCAGCATCGATTTCTGTAGGGGGACAAAGACCATGGGAACGTAGCTCTCTTCGGGAGTGTTATAGCCCTAGGTGT-AATACC Diatrype_whitmanensis_FJ430587 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCAGTGCCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACCTTTGCCGGGCGGATCATCCGGTGTTCTTCACCGGTGCACTTCGCCCGGCTTAGGCCAGCATCGATTTCTGTAGGGGGACAAAGGCCATGGGAACGTAGCTCTCTTCGGGAGTGTTATAGCCCTAGGTGT-AATACC Halorosellinia_oceanica_AY083822 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCAGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCTAGCGGATCATCCGGTGTTA-TCACCGGTGCACTTTGCTAGGTTGAGGCCAGCATCGGTTTTCGTAGGGGGATAAAAGCCTGGGGAATGTAGCT-CCCTCGGGAGTGTTATAGCCCCTCGTAT-AATGCC Heterorosellinia_hispanica_EF489465 --------------------------------------------------------------------------------------------------------GCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTCCGCCGGGCTGAGGCCAGCATCGGTTTCCGCGGGGGGATAAAAGCGGGGGGAACGTAGCTACCCTCGGGAGTGTTATAGCCCCCCGCATGAATACC Hypoxylon_fragiforme_AY083829 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTACCCTATATATAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTTTTTCCAGGGGGATCATCCGGTGTTC-TCACCGGTGCACTCCGCCTGGTTTAGGCCAGCATCGGTTCTCTTAGGGGGATAAAGGCTTGGGGAACGTAGCT-CCTTCGGGAGTGTTATAGCCCCTTGCGT-AATACC Hypoxylon_monticulosum_DQ840067 ----------------GCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTGGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTACGGTTGGACACCTACCCTATATATAGCTCCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCAGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCTGGTTTAGGCCAGCATCGGTTCTCGTAGGGGGACAAAGGCCTGGGGAACGTATCT-CCTTCGGGAGTGTTATAGCCCCTCGCGT-AATACC Nemania_diffusa_DQ840076 ----------------GCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTCTTCGCCGGTGCACTTCGCTAGGTCGAGGCCAGCATCGGTTTCTGCAGGGGGATAAAAGCCCAGGGAACGTAGCT-CTTTCGGGAGTGTTATAGCCCTCCGCAT-AATACC Nemania_maritima_DQ840074 --------------------------CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTACGGTTGGCAACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTCTTCGCCGGTGCACTTCGCCAGGTCGAGGCCAGCATCGGTTTCTGTGGGGGGATAAAAGCCTGGGGAACGTAGCT-CCTCCGGGAGTGTTATAGCCCCTCGCAT-AATACC Novaxylaria_murandii_AJ875233 ----------------------------------------------GCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTCCCCGGCGGATCATCCGGCGTTC-TCGCCGGTGCACTCCGCCGGGCTGAGGCCAGCATCGGTTCCCGCGGGGGGACAAAAGCGGGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCTCCGCAT-AATACC Rosellinia_bambusae_s_EF489466 --------------------------------------------------------------------------------------------------------GCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTCTTCCCGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCTGGTCTAGGCCAGCATCGGTTTCCGCGGGGGGAGAAAAGCTCGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCCTTGCAT-AATACC Rosellinia_necatrix_2_AY083824 GAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCAGGTCGAGGCCAGCATCGGTTTCCGCGGGGGGATAAAAGCTCTGGGAACGTAGCT-CCTTCGGGAGTGTTATAGCCCTCTGCAC-AATACC Sordaria_fimicola_AF132330 ---ACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCCGCAACAGCTCAAATTTGAGATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGAAACTTTCGGTGAGGCACCTTCTGAGTCCCTTGGAACAGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGATGCCGATCCAATGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGTGACCAGACTTGCGCCGTTCCGATCATCCGGTGTTC-TCACCGGTGCACTCGGGGCGGCTCAGGCCAGCATCGGTTTTGGTGGGGGGATAAAGGTCCAGGGAACGTAGCT-CCTCCGGGAGTGTTATAGCCCTGGGCGT-AATGCC Xylaria_badia_AB376705 -AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCAGGTTGAGGCCAGCATCGGTTTCCGCAGGGGGATAAAAGCTCTGGGAATGTAGCT-CCCTCGGGAGTGTTATAGCCCTCTGCAT-AATACC Xylaria_escharoidea_AB376822 -AAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCAGGTTTAGGCCAGCATCGGTTCTCGCAGGGGGATAAAAGCTTGGGGAACGTGGCT-CCTTCTGGAGTGTTATAGCCCCTTGCAT-AATACC Xylaria_hypoxylon_AY327481 GAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCCAGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCTGGGTTGAGGCCAGCATCGGTTTTCGCAGGGGGATAAAAGCTTGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCCTCGCAT-AATACC Xylaria_mellissii_AB376710 -AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTC-TCACCGGTGCACTGCGTCAGGTTTAGGCCAGCATCGGTTTTCGCAGGGGGATAAAAGCTCTGGGAACGTAGCT-CCTCCGGGAGTGTTATAGCCCTCTGCAT-AATACC Xylaria_phyllocharis_AB376686 -AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTCGCCCGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCGGGCCTAGGCCAGCATCGGTTTCCGCGGGGGGACAAAAGCGGGGGGAACGTAGCT-CCCTCGGGAGTGTTATAGCCCCTCGCAT-AATACC Xylaria_psidii_AB376698 -AAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGACGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCAGGTCGAGGCCAGCATCGGTTTCCGCAGGGGGACAAAAGCTCGGGGAACGTAGCT-CCTCCGGGAGTGTTATAGCCCTCTGCAT-AATACC Xylaria_psidii_AB376713 -AAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTGGCGGATCATCCGGTGTTC-TCACCGGTGCACTTCGCCAGGTTGAGGCCAGCATCGGTTTTCGCAGGGGGATAAAAGCCCGGGGAACGTAGCT-CCTCCGGGAGTGTTATAGCCCCTCGCAT-AATACC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M11189] TITLE Coniochaeta_gigantospora_sp._nov.__ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=522; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Chaetosphaeria__ellisii_AY906939 --------TTACAG--------TTACAGTTAACCAT-GTGAATACGTTGCCTCGGTGGCGCTAT------------GTGCTGCTG-----------TGCCATGGCGTTGAGCCTGCCGGGGCCCGACTCTACA----AGCTGTACTCTCGAGT--CATATTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCGGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCTGCCTGGTGTTGGAGCACCACTACT---GTGGGCTCCCAAATTCAGCGGCGGGCGCGTCCCGGCCCCGAGCGTAGTAAC---TTACATCGCTTAGGGCGCCGAGCGGTGTCTCAGCCGTTAAA--CTCATTTTCTA-------------------------------------------- Chaetosphaeria_ellisii_AY906940 --------TTACAG--------TTACCGTTAACCAT-GTGAATACGTTGCCTCGGTGGCGCTAT------------GTGCTGCTG-----------TGCCATGGCGTTGAGCCTGCCGGGGCCCGACTCTACA----AGCTATACTCTCGAGT--CATATTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCGGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGTATTCCGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCTGCCTGGTGTTGGAGCACCACTACT---GTGGGCTCCCAAATTCAGCGGCGGGCGCGTCCCGGCCCCGAGCGTAGTAAC---TTACATCGCTTAGGGCGCCGAGCGGTGTCTCAGCCGTTAAA--CTTATTTTCTA-------------------------------------------- Coniochaeta_africana_GQ154539 AGGGATCATTACAACCGAAAGGCTACTTACAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCGCCCTCACGGGGGCGCCGCAGCCCGGCCTCTCAGGGGGCGCGGGGCACCCGCCGGAGGTAAACTCTGTCTCATAGTGGTATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGA-GGCGTGGCGTGCTCCGGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_gigantospora_JN684909 AGGGATCATTAAAGTTGCGAGACTCCC--AGACCATTGTGAACCTGTTGCTTCGGCGGCGT-----CCCCGGGGAGGGGACGCAGCCCAAGGCCCCAAGGGGCGGCGGGCGCCCGCCGGAGGTAAACCCTGTATTATAGTGGCACTTCTGAGTAACAAGCAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAAGAAGTGGCGGGCTCGCTATAACTCCGAGCGCAGTAGA--AATATCTCGCTAGGGA-AGTGTGGCGTGCTCCGGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGG------------------ Coniochaeta_ligniaria_AY198390 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_ligniaria_EU450836 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Coniochaeta_ligniaria_FN394684 ---GATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACC-------------------------------- Coniochaeta_nepalica_DQ093664 ----------------CGAAAGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCGTCACCGGGGCGCCGCAGCCCGGCCTCTCCGGAGGCGCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-TGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGC-GAACTA-- Coniochaeta_prunicola_GQ154540 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGTGAACTAGTTGCTTCGGCGGCGCGGCCCCCTCGCGGG-GTGCCGCAGCCCCGCCCCCTCGGGGGTGGTGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGTATTTCTGAGT-AAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAAGAAGTGGCGGGCTCGCTGCAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-CGCGGCGTGCTCCTGCCGTTAAAGA-CCATCTTTAACAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_prunicola_GQ154541 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGTGAACTAGTTGCTTCGGCGGCGCGGCCCCCTCGCGGG-GTGCCGCAGCCCCGCCCCCTCGGGGGTGGTGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGTATTTCTGAGT-AAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTATTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAAGAAGTGGCGGGCTCGCTGCAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-CGCGGCGTGCTCCTGCCGTTAAAGA-CCATCTTTAACAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_savoryi_GQ922522 AGGGATCATTACAGTAAAAAGACT-CCCAAAACCATTGTGAACGCGTTGCCTCGGCGG-GCGGCCTCCCTG-----GGGCCGCTG-CCTCCCTCGC-------GGGGGGTGCCCGCCGG-CGTAAACTCTGTATTTTAGTGGCCTCTCTGAGAAACAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAGCTAGTGGCGGGCTCGCTATAACTCCGAGCGTAGTAGTAAAATATCTCGCTAGGGAGG-TGTCGCGGGTTCCGGCCGTGAAAGCCCCATCTTTTACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp_JN673041 -----------------------------------------------------------------------------------------------------GTGACGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCAGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCAAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGTCTGACGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGCTGAGGCGTGCTCCCGCCTTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF1_HQ657291 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF17_HQ657307 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF20_HQ657309 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF21_HQ657310 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF22_HQ657311 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF23_HQ657312 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF24_HQ657313 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGG-GCGCCGCAGCCCCGCCTCTCCGGAGGCGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGATGTTGCGGCGTGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF29_HQ657317 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF30_HQ657318 AGGGATCATTATTACCGAAAGGCTACTTAAATCCATCGCGAACTAGTTGGTTCGGCGGCGCGGCTCCCTCACGGG-GCGCCGCAGCCCCGCCTCTCCGGAGGCGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGATGTTGCGGCGTGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF31_HQ657319 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._CRCF7_HQ657297 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._HS_EF21_GQ334428 ----------------------CATCTTAAAACCATCGCGAACTAGTTGCTTCGGCGGTGCGGACGCATTGC-------CCGCGGCCTCGCCTCTCCGGAGGTGCCAGGCAGCCGCCGGAGGTAAACTCTGTCTCACAGCGGTATCTCTGAGT-AAAAACAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCCGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTGCAACTCCGAGCGTAGTAACTCATTATCTCGCTAGGGA-GGCGTGGCGTGCTCCGGCCGTTAAAGACAAATCTTTAACCAAGGTTGACCTCGGATCGGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._M136_HM595554 AGGGATCATTACAGCTAAAAGACT-CCCAAAACCATTGTGAACGCGTTGCCTCGGCGG-GCGGCCTCCCTG-----GGGCCGCTG-----CCTCCC-----TCGGGGGGTGCCCGCCGG-CGTAAACTCTGTATTTTAGTGGCCTCTCTGAGAAACAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAGCTAGTGGCGGGCTCGCTATAACTCCGAGCGTAGTAGTAAAATATCTCGCTAGGGAGG-CGTCGCGGGTTCCGGCCGTGAAAG-CCCATCTTTTACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._SS_1760_AM262406 ---------TACAGTAAAAAGACTC--CCAAACCATTGTGAACGTGTCGCCTCGGCGGCGT---CCCCTCCCTGGG--GACGCTG----GCACCCCCGGGTGC------TGCCCGCCGGAGCGCAACTATGTATTCTAGTGGCCTCTCTGAGAAACAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAGAAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAGTAACATATCTCGCTAGGGAG---------------------------------------------------------------------------------- Coniochaeta_sp._ZLY_2010b_HM595513 AGGGATCATTACAGTCTAAAAGACTCCCAAAACCATTGTGAACGCGTTGCCTCGGCGG-GCGGCCTCCCTG--GGGCCGCTGCCTCCC-------------TCGGGGGGTGCCCGCCGG-CGTAAACTCTGTATTTTAGTGGCCTCTCTGAGAAACAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAGCTAGTGGCGGGCTCGCTATAACTCCGAGCGTAGTAGTAAAATATCTCGCTAGGGA-GGTGTCGCGGGTTCCGGCCGTGAAAG-CCCATCTTTTACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_sp._agrAR062_FN435672 -----------CAACCGAAA--CTACTTCAAACCATCGCGAACCAGTTGCTTCGGCGGCGCGGCCCCCCAACGG--GCGCCGCAGCCCCGCCTCCCCGGAGGTGAGGGGCGCCCGCCGGAGGTAAACCCTGTATTATAGTGGCATATCTGAGT--AAAACAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCGCTTGGTGTTGGGGC-CTACGGCTGCCGTA-GCCCTGAAA-GAAGTGGCGGGCTCGCTGCAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-CGCGGCGCGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGA---------------------------------- Coniochaeta_sp._agrAR113_FN435704 -----------CAACCGAAAGG-TACTTCAAACCATCGCGAACCAGTTGCTTCGGCGGCGCGGCTCCCCAACGGG-GCGCCGCAGCCCCGCCTCCCCGGAGGTGAGGTGCGCCCGCCGGAGGTAAACCCTGTATTATAGTGGCATATCTGAGT--AAAACAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCGCTTGGTGTTGGGGC-CTACGGCTGCCGTA-GCCCTGAAAGGAAGTGGCGGGCTCGCTGCAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGA---GGCGGCGCGCTCCTGCCGTTAAAGACCCATCTTTAACCAA-GTTGTCCTC-GATCA-GTAGGAATA-------------- Coniochaeta_velutina_GQ154542 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGGGGCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGCGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_velutina_GQ154543 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGGGGCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGCGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_velutina_GQ154544 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGGGGCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGCGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Coniochaeta_velutina_GQ154545 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGGGGCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGCGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_decumbens_IMUFRJ_52014_FN428890 AGGGATCATTACCATCGCGAGACTCCC--AAACCATTGTGAACCCGTTGCTTCGGCGG-GCGTCCTTCTACCGGAGGGGACGCGG-----CCCCTC---------GGGGTGCCCGCCGGGGCCGAACTCGATATCCCAGTGGACTCTCTGAGAAACAAACCAATAAGTTAAAACTTGCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAAGCCCCGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAGCTAGTGGCGGGCTCGCTACCACTCCGAGCGCAGTAACGC---ATCTCGCTAGGGACGTTGTGGCGGGTTCCGGCCGTGAAACCCCCATTTTCA--CAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_fasciculata_GQ377492 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGGGGCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGCGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_hoffmannii_AY781227 -----------CAACCGAAAGGCTACTTCAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCTTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGA--CTAA Lecythophora_hoffmannii_JF440598 AGGGATCATTACAACCGAAAGGCTACTTCAAACCATTGCGAACTAGTTGCTTCGGCGGCGCGGCCCCCTAACGGGGGCGCCGCAGCCCTGCCTCTCCGGAGGTTCGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTAGTACTCTACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGG-TGACCTCGGATCAGGT--------------------- Lecythophora_luteoviridis_DQ404354 AGGGATCATTATTACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGTGCGGCTCCCTCACGGG-GCGCCGCGGCCCCGCCTCTCCGGAGGTGT-GGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACGAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGTGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_mutabilis_DQ093680 --------------CGGGTAGAC--CTCCCACCCTTTGTTTACATGTTGCTTTGGCGGCCCGTTGCCCC-------GCGCTGAACACCGGCCCC-----GGCTGGTCAGTGCCCGCCAGAGAACAACTCTGAATTA-AATGTCG--TCTGAGT--ACTATGAAT-AGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGG---CTACACCCGACGTGGGCCTTAAAA-TCAGTGGCGGTGCCATC-TGGCTCTAAGCGTAGTAATTC---TTCTCGCTCTGGAGATCTAGGTGTTTGCTTGCCAGCAA---CCCCAATTTATCAAAGGTTGACCTCGGATCAGGTAGGGATA-CCCCCGAA----- Lecythophora_mutabilis_HM036599 AAGGATCATTAAAGCCTCACGGGTACTCCCACCCTTTGTTTACATGTTGCTTTGGCGGCCCGTTGCCCC-------GCGCTGAACACCGGCCCC-----GGCTGGTCAGTGCCCGCCAGAGAACAACTCTGAATTA-AATGTCG--TCTGAGT--ACTATGAAT-AGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGG---CTACACCCGACGTGGGCCTTAAAA-TCAGTGGCGGTGCCATC-TGGCTCTAAGCGTAGTAATTC---TTCTCGCTCTGGAGATCTAGGTGTTTGCTTGCCAGCAA---CCCCAATTTATCAAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA Lecythophora_mutabilis_HQ157861 AAGGATCATTAAAGCCTCACGGGTACTCCCACCCTTTGTTTACATGTTGCTTTGGCGGCCCGTTGCCCC-------GCGCTGGACACCGGCCCC-----GGCTGGTCAGTGCCCGCCAGAGAACAACTCTGAATTA-AATGTCG--TCTGAGT--ACTATGAAT-AGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGG---CTACACCCGACGTGGGCCTTAAAA-TCAGTGGCGGTGCCATC-TGGCTCTAAGCGTAGTAATTC---TTCTCGCTCTGGAGATCTAGGTGTTTGCTTGCCAGCAA---CCCCAATTTATCAAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA Lecythophora_sp_LS6_2009a_HQ660445 --GGATCATTACAACCGAAAGGCTACTTAAAACCATTGCGAACTAGTTGCTTCGGCGGCGCGGCCCCCTCGCGGG-GTGCCGCAGCCCCGCCTCTCCGGAGGTGACGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAGCAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGTCTGACGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_sp._123_FJ228192 -----------------------------------------ACTAGTTGCTTCGGCGGCGCGGCCCCCTAAC-CGGGCGCCGCAGCTCCGCCTCCTCGGAGGCGT--GGCACCCGCCGGAGGTAAACCCTGTATTATAGCGGCATCTCTGAGT--AAAACAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTGCAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGA-GGCGCGGCGCGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAAGAATACCCGCTGAACTTAA Lecythophora_sp._A14_FJ903286 AGGGATCATTACAACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGTCCCCTCACAGG-GCGCCGCAGCCTCGCCTCTTAGGAGGTATGGGGCACCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAAGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-TGCAGCGTGCTCCTGCCGTTAAAGACCCATCTTAA--------------------------------------------- Lecythophora_sp._ADJL_2009a_GU166485 -----------------------TACTT-AAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCTCCCTCACGGGGGCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGCGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_sp._F47_GU067748 AGGGATCATTACAACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGTCCCCTCAC-AGGGCGCCGCAGCCCCGCCTCTCAGGAGGTATGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGTATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGA-GGTGCAGCGTGCTCCTGCCGTTAAAGACCCATC------------------------------------------------- Lecythophora_sp._I179_GU062252 AGGGATCATTACAACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCCTCACAGG-GCGTCGCAGCCCCGCCTCTCAGGAGGTATGGGGCACCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAAGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-TGCAGCGTGCTCCTGCCGTTAAAGACC----------------------------------------------------- Lecythophora_sp._I302_GU062289 AGGGATCATTACAACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGTCCCCTCAC-AGGGCGCCGCAGCCTCGCCTCTTAGGAGGTATGGGGCACCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGTCCTACGGCTGCCGTAGGCCCTGAAAAGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGA-GGTGCAGCGTGCTCCTGCCGTTAAAGACCCATC------------------------------------------------- Lecythophora_sp._JZ_103_HQ637295 TGGGAACATAAG--CCG-AAGGCTACTT-ACACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCCTCAC-GGGGGACTGTAGCCCCGCCTCTCAGGAGGTATGGGGCACCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAACACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGTCTGACGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAAG-TGTGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_sp._JZ_104_HQ637298 GGGAATTATTAGGAGCCGACGGCTACTT-AAACCATCGCGAACTAGTTGCTTCGGCGGTGTGGCTCCCTCACGGG-GCGCCGCGGCCCCGCCTCTCCGGAGGTGT-GGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTAAAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGACGTTGCGGCGTGCTCCTGCCGTTAAAGA-CCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_sp._JZ_169_HQ637296 -GGGGACTTAGTAG-------GCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCCCCTCACGGG-GGACCGCAGCCCCGCCTCTCAGGAGGTATGGGGCACCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGTATAACACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCTCTACGTCTGACGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAAG-TGTGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_sp._NG_p46_HQ115712 AGGGATCATTACAACCGAAAGGCTGCTTAAAACCATCGTGAACCCGTTGCTTCGGCGGAGCG-----CTCGCGGGGGGGCCGTGGCCCCACACCTCCGGGTGCG-GGGCCGCCCGCCGGAGGTAAACTCTGCATCTTAGTGGCATCTCTGAGTAACAAGCAAATAA-TTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAGAATCCTATCTCGCTAGGGA-GGTGCGGCGTGCTCCAGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA Lecythophora_sp._UBC_AY219880 AGGGATCATTACAACCGAAAGGCTACTTAAAACCATCGCGAACTAGTTGCTTCGGCGGCGCGGCCTCCTCACGGG-GCGCCGCAGCCCCGCCTCTCCGGAGGTGTGGGGCGCCCGCCGGAGGTAAACTCTGTATTATAGTGGCATCTCTGAGT-AAAAACAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTAGTACTCTAGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACGGCTGCCGTAGGCCCTGAAAGGAAGTGGCGGGCTCGCTACAACTCCGAGCGTAGTAATTCATTATCTCGCTAGGGAGG-TGCGGCGTGCTCCTGCCGTTAAAGACCCATCTTTAACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M11188] TITLE Coniochaeta_gigantospora_sp._nov.__Lim_LSU; LINK TAXA = Taxa2; DIMENSIONS NCHAR=524; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Barrina_polyspora_AY346261 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGCCCGAGTTGTAATTTGTAGAGGACGCTCCTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTACAGTCGGACACCTAGCCTCTGTGGAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATCTCTTCTAAAGCTAAATACAGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCCGATCACCCAGCGTTCTCGCTGGTGCGCTCGACCCGGCCCAGGCCAGCGTCGGTTCCCGCGGGGGGACAAAAACTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCTGTGCAATGCCCTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta__discoidea_AY346297 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCAGCCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGTGGACAAAAGCTCCGGGAACGTAGCTCCTTCGGGAGTGTTATAGCCCGTTGCTCAATACACCTGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_SMH2569_AY346275 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGGCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGCACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCGCCGTTCTCGGCGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGACAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGCTGCTCAATACCCTCGTGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_africana_GQ154601 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGTTGCTTAATACCCTTGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_boothii_AJ875226 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGGGTTCTCCCTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTGGTAGGGGGACAAAAGCTTAGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCTTTGCTCAATACC---------------------------------------------- Coniochaeta_cruciata_AJ875222 -----------------------GCTCAAATTTGAAATCTGGCCTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACGTGCGCCGGGGCGACCATCCAGTGTTCTCACTGGTGCACTCGCCCCGGCGCAGGCCAGCGTCGGTTTCCGCAGGGGGAAAAAAGCGGCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGTTTAATACC---------------------------------------------- Coniochaeta_discoidea_AJ875230 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCAGCCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGTGGACAAAAGCTCCGGGAACGTAGCTCCTTCGGGAGTGTTATAGCCCGTTGCTCAATAC----------------------------------------------- Coniochaeta_gigantospora_JN684909 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGCCTCAGGCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGGGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTATAGTAGGACACCTAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTCCGCGGGGGGATAAAGGCTCCGGGAACGTGGCTCTCCTGGGAGTGTTATAGCCCGCTGCTCAATGCCTCCGGGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_hansenii_AJ875223 -----------------------GCTCAAATTTGAAATCTGGCCTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCGTAGAGGGTGAGAGCCCCGTACAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCTGGGGGACAAAAGCTCCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGTTTAATACC---------------------------------------------- Coniochaeta_leucoplaca_FJ167399 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCTTAATACCCTTGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAAT- Coniochaeta_ligniaria_AF353583 --------AGT{CG}AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGTGGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAG{AC}CCGTTGCTTAATACCTCCGTGGAGACCGAGGTTCGCGCTCTGCAAGGACG----------- Coniochaeta_ligniaria_AF353587 ------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGTGGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGTTGCTTAATACC---------------------------------------------- Coniochaeta_malacotricha_AF353589 ------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGTAGGGGGATAAAAGTAGTGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCTGCTCAATACC---------------------------------------------- Coniochaeta_malacotricha_AF353590 ------------AAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGTAGGGGGATAAAAGTAGTGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCTGCTCAATACC---------------------------------------------- Coniochaeta_ornata_AJ875228 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAGGCGGCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGCTCAATACC---------------------------------------------- Coniochaeta_ostrea_AJ875227 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGACAAAAGCTCCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCTGCTCAATACC---------------------------------------------- Coniochaeta_ostrea_DQ470959 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCTCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGACAAAAGCTCCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCTGCTCAATACCCTTGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_prunicola_GQ154602 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGCTGCTTAATACCCCTGTGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_prunicola_GQ154603 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGCTGCTTAATACCCCTGTGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_pulveracea__GQ351560 ---CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCC?GAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAA?TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCGCGGTTCTCCGCGG?GCACTCTGCCCGGCCCAGGCCAGCGTCGGTTCTGGC??GGGGACAAAAGCTTGGGGAACGTGGCTCCTTCGGGAGTGTTATAGCCCCTTGCCCAATGCCCCTGCCGGGACCGAGGTTCGCGCTCTGCAAG--------------- Coniochaeta_pulveraceae_AF353591 ---CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCC?GAGAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAA?TAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCGCGGTTCTCCGCGG?GCACTCTGCCCGGCCCAGGCCAGCGTCGGTTCTGGC??GGGGACAAAAGCTTGGGGAACGTGGCTCCTTCGGGAGTGTTATAGCCCCTTGCCCAATGCCCCTGCCGGGACCGAGGTTCGCGCTCTGCAAG--------------- Coniochaeta_punctulata_AJ875231 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCGGCGGGAACGTGGCTCCTCCGGGAGTG-TATAGCCCGCCGCTCAATACC---------------------------------------------- Coniochaeta_rhopalochaeta_GQ351561 ---CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCCTACGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCACGGTTCTCCGTGGTGCACTCTGCCCGGCCCAGGCCAGCGTCGGTTCTGGGACGGGGACAAAAGCTTGGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCCTTGCCCAATACCCGTGCCGGGACCGAGGTTCGCGCTCTGCAAG--------------- Coniochaeta_savoryi_AY346276 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAGGCGGCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCCGCGCAATACCCTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCGTAATG Coniochaeta_sp_JN673041 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCCGGTGAGTTATAGCCCGTTGCTTAATACCCTTGTGGGGACCGAGGT----------------------------- Coniochaeta_sp._SJ069_AY953951 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGTGGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGTTGCTTAATACCTCCGTGGAGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_sp._SJ153_AY953952 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTATTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTTTCGTGGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGTTGCTTAATACCTCCGTGGAGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_subcorticalis_AF353593 ------------AAGC{CG}GCAACAGCTCAAATTTGAAATCTGGCTTCGCCCG{AT}{GT}TTGT{AT}ATTTGTAGAGGATGCTTTTGGTGCGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATCTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCACGGTTCTCCGTGGTGCACTCTGCCCGGCTCAGGCCAGCGTCGGTTCTGGCAGGGGGACAAAAGCTTAGGGAACGTGGCTCCTCCGGGAGTGTTATA{AG}CCCTT{AT}GCTCAATACC---------------------------------------------- Coniochaeta_tetraspora_AJ875225 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCCGGCTGATCATCCAGTGTTCTCACTGGTGCACTCTGCCGGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGACAAAAGCTTCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGTCGCTCAATACC---------------------------------------------- Coniochaeta_velutina_FJ167400 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_velutina_FJ167401 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_velutina_FJ167402 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_velutina_GQ154604 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_velutina_GQ154605 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGCTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Coniochaeta_velutinosa_GU553330 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTATAGTCGGACACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCCGATCATCCAGTGTTCTCACTGGTGCACTCGGCCCGGTATAGGCCAGCGTCGGTTTTCGTAGGGGGATAAAAGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTAGTTTAATACC---------------------------------------------- Coniochaeta_verticillata_AJ875232 -----------------------GCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCGTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGACACCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGTTCAGGCCAGCGTCGGTTCTCGCAGGGGGATAAAAGCTCTGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGCTGCTTAATACC---------------------------------------------- Lecythophora_decumbens_AF353597 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCCGGCTGATCATCCAGTGTTCTCACTGGTGCACTCTGCCGGGCTCAGGCCAGCGTCGGTTCTCGCAGGGGGACAAAAGCTTCGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGTTGCTCAATACCCCTGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Lecythophora_fasciculata_AF353598 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGTTGCTTAATACCTTCGCGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Lecythophora_hoffmannii_AF353599 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGACACCAAGCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAATCTAAATAT{AT}GGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGTGGGGGGATAAAAACTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGTTTAATACCCTCGTGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Lecythophora_lignicola_AF353601 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGTTGCTTAATACC-TCGCGG{CG}-------------------------------------- Lecythophora_luteoviridis_AF353603 ------------AAGCGGC{AC}ACAG{CG}TCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCG{AT}CCCGGCTCAGGCCAG{CG}GTCGGTTCTCGCGGGGGGATAAAAGCTTCGGGAACGTGGCACCTCCGGGTGTGTTATAGCCCGTTGCTTAATACCTTCGCGGG-------------------------------------- Lecythophora_mutabilis_AF353604 TA{AT}CGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCTGAGTTCCCTGGAACGGGACGCCAGAGAGGGTGAGAGCCCCGTATAGTCGGCCACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATCTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGTGCCGGGCTGATCATCCAGTGTTCTCACTGGTGCACTCGACCCGGCTCAGGCCAGCGTCGGTTCTCGTAGGGGGATAAAAGCTTCGGGAACGTGGCACCTTCGGGTGTGTTATAGCCCGTTGCTTAATACCCTTGTGGGGACCGAGGTTCGCGCTCTGCAAGGACGCTGGCATAATG Xylaria_acuta_AY544676 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGGACACTAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCCTAGCGGATCATCCGGTGTTTTCACCGGTGCACTTCGCTAGGTTTAGGCCAGCATCGGTTTCCGTAGGGGGATAAAAGCTCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCTCTGCATAATACCCTTACAGGGACCGAGGACCGCGCTTGGCAAGGATGCTGGCGTAATG Xylaria_hypoxylon_AY544648 TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTTGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCTTACAGGGTGAGAGCCCCGTACGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACCTTTTCTTAGCGGATCATCCGGTGTTATCACCGGTGCACTTCGCTAAGTTTAGGCCAGCATCGGTTTCTGTAGGGGGATAAAAGCCTTGGGAACGTAGCTCCTTCGGGAGTGTTATAGCCCTTTGCATAATACCCTTCTGGGGACCGAGGACCGCGCTATGCAAGGATGCTGGCATAATG ; END; BEGIN TREES; TITLE Coniochaeta_gigantospora_sp._nov._D3; LINK TAXA = Taxa1; TRANSLATE 1 Coniochaeta_gigantospora_JN684909, 2 Coniochaeta_sp._agrAR062_FN435672, 3 Coniochaeta_sp._agrAR113_FN435704, 4 Coniochaeta_sp._CRCF1_HQ657291, 5 Coniochaeta_sp._CRCF17_HQ657307, 6 Coniochaeta_sp._CRCF20_HQ657309, 7 Coniochaeta_sp._CRCF21_HQ657310, 8 Coniochaeta_sp._CRCF22_HQ657311, 9 Coniochaeta_sp._CRCF24_HQ657313, 10 Coniochaeta_sp._CRCF23_HQ657312, 11 Coniochaeta_sp._CRCF29_HQ657317, 12 Coniochaeta_sp._CRCF30_HQ657318, 13 Coniochaeta_sp._CRCF31_HQ657319, 14 Coniochaeta_sp._CRCF7_HQ657297, 15 Coniochaeta_sp._HS_EF21_GQ334428, 16 Coniochaeta_sp._M136_HM595554, 17 Coniochaeta_sp._SS_1760_AM262406, 18 Coniochaeta_sp._ZLY_2010b_HM595513, 19 Coniochaeta_africana_GQ154539, 20 Coniochaeta_ligniaria_EU450836, 21 Coniochaeta_ligniaria_AY198390, 22 Coniochaeta_ligniaria_FN394684, 23 Coniochaeta_nepalica_DQ093664, 24 Coniochaeta_prunicola_GQ154541, 25 Coniochaeta_prunicola_GQ154540, 26 Coniochaeta_savoryi_GQ922522, 27 Coniochaeta_velutina_GQ154545, 28 Coniochaeta_velutina_GQ154544, 29 Coniochaeta_velutina_GQ154543, 30 Coniochaeta_velutina_GQ154542, 31 Lecythophora_decumbens_IMUFRJ_52014_FN428890, 32 Lecythophora_fasciculata_GQ377492, 33 Lecythophora_hoffmannii_JF440598, 34 Lecythophora_hoffmannii_AY781227, 35 Lecythophora_luteoviridis_DQ404354, 36 Lecythophora_mutabilis_HQ157861, 37 Lecythophora_mutabilis_HM036599, 38 Lecythophora_mutabilis_DQ093680, 39 Lecythophora_sp._123_FJ228192, 40 Lecythophora_sp._A14_FJ903286, 41 Lecythophora_sp._ADJL_2009a_GU166485, 42 Lecythophora_sp._F47_GU067748, 43 Lecythophora_sp._I179_GU062252, 44 Lecythophora_sp._I302_GU062289, 45 Lecythophora_sp._JZ_103_HQ637295, 46 Lecythophora_sp._JZ_104_HQ637298, 47 Lecythophora_sp._JZ_169_HQ637296, 48 Lecythophora_sp._NG_p46_HQ115712, 49 Coniochaeta_sp_JN673041, 50 Chaetosphaeria_ellisii_AY906940, 51 Chaetosphaeria__ellisii_AY906939, 52 Lecythophora_sp_LS6_2009a_HQ660445, 53 Lecythophora_sp._UBC_AY219880; TREE D3 = [&R] ((50:0.00954,51:0.0):0.39255,((31:0.13324,(17:0.06322,(18:0.03065,(16:0.00731,26:0.00801)0.00:0.0)0.92:0.03301)0.44:0.02384)0.58:0.05376,(48:0.03687,(1:0.11576,(((38:0.01795,(36:0.00263,37:0.0)0.69:0.00875)1.00:0.47893,(24:0.0,25:0.0)0.00:0.0)0.96:0.02552,(((53:0.00249,((15:0.07561,19:0.01617)0.89:0.01732,((45:0.01016,47:0.00949)1.00:0.03571,(42:0.00959,(43:0.00293,(40:0.0,44:0.00255)0.89:0.00827)0.80:0.00817)0.76:0.00464)0.71:0.0027)0.44:0.00464)0.73:0.00235,(((52:0.0,49:0.02864)0.99:0.02274,((32:0.0,(30:0.0,(29:0.0,(27:0.0,(41:0.0,28:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.85:0.00238,((35:0.0023,46:0.02579)0.89:0.00742,(9:0.0,12:0.00479)0.92:0.00478)0.00:0.0)0.91:0.00732)0.75:0.00254,(23:0.02169,(33:0.01024,(21:0.0,(14:0.0,(13:0.0,(11:0.0,(10:0.0,(8:0.0,(7:0.0,(6:0.0,(5:0.0,((4:0.0,34:0.00244)0.00:0.0,(22:0.0,20:0.00392)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.74:0.00204)0.91:0.0089)0.94:0.01129)0.35:0.00246)0.54:0.00216,(39:0.02555,(2:0.0,3:0.01066)0.92:0.01413)0.94:0.02066)0.60:0.01615)0.92:0.03451)0.50:0.01758)0.00:0.0):0.26697)1.00:0.0; END; BEGIN TREES; TITLE Coniochaeta_gigantospora_sp._nov._D2; LINK TAXA = Taxa2; TRANSLATE 1 Barrina_polyspora_AY346261, 2 Coniochaeta_savoryi_AY346276, 3 Coniochaeta__discoidea_AY346297, 4 Coniochaeta_gigantospora_JN684909, 5 Coniochaeta_africana_GQ154601, 6 Coniochaeta_boothii_AJ875226, 7 Coniochaeta_cruciata_AJ875222, 8 Coniochaeta_discoidea_AJ875230, 9 Coniochaeta_hansenii_AJ875223, 10 Coniochaeta_ligniaria_AF353583, 11 Coniochaeta_ligniaria_AF353587, 12 Coniochaeta_malacotricha_AF353590, 13 Coniochaeta_malacotricha_AF353589, 14 Coniochaeta_ornata_AJ875228, 15 Coniochaeta_ostrea_DQ470959, 16 Coniochaeta_ostrea_AJ875227, 17 Coniochaeta_prunicola_GQ154603, 18 Coniochaeta_prunicola_GQ154602, 19 Coniochaeta_punctulata_AJ875231, 20 Coniochaeta_rhopalochaeta_GQ351561, 21 Coniochaeta_subcorticalis_AF353593, 22 Coniochaeta_tetraspora_AJ875225, 23 Coniochaeta_velutina_GQ154605, 24 Coniochaeta_velutina_GQ154604, 25 Coniochaeta_velutinosa_GU553330, 26 Coniochaeta_verticillata_AJ875232, 27 Xylaria_acuta_AY544676, 28 Xylaria_hypoxylon_AY544648, 29 Coniochaeta_SMH2569_AY346275, 30 Lecythophora_decumbens_AF353597, 31 Lecythophora_fasciculata_AF353598, 32 Lecythophora_hoffmannii_AF353599, 33 Lecythophora_lignicola_AF353601, 34 Lecythophora_luteoviridis_AF353603, 35 Lecythophora_mutabilis_AF353604, 36 Coniochaeta_sp._SJ069_AY953951, 37 Coniochaeta_sp._SJ153_AY953952, 38 Coniochaeta_pulveraceae_AF353591, 39 Coniochaeta_pulveracea__GQ351560, 40 Coniochaeta_sp_JN673041, 41 Coniochaeta_velutina_FJ167400, 42 Coniochaeta_velutina_FJ167401, 43 Coniochaeta_velutina_FJ167402, 44 Coniochaeta_leucoplaca_FJ167399; TREE D2 = [&R] ((27:0.0245,28:0.04728):0.17934,(25:0.0272,(((4:0.09173,(7:0.07069,(1:0.10604,9:0.02369)0.73:0.01341)0.64:0.00827)0.11:0.00638,((12:0.0,13:0.0)0.98:0.02362,(15:0.00371,16:0.0)0.82:0.00773)0.60:0.00232)0.00:0.0,((26:0.02011,((19:0.0044,(2:0.00525,14:0.0)0.87:0.01055)0.88:0.01826,((6:7.8E-4,(21:0.0,(20:0.02307,(38:0.0,39:0.0)0.89:0.01979)0.98:0.04429)0.94:0.01591)1.00:0.06119,((22:0.00427,30:0.0)0.89:0.00971,(3:0.0,8:0.0)0.99:0.0358)0.73:0.00472)0.73:0.00974)0.96:0.02668)0.74:0.00415,(44:0.0,(32:0.03307,(29:0.0659,(5:0.0114,((17:0.0,18:0.0)0.97:0.0115,(35:0.00378,(40:0.01256,((31:0.0,((37:0.00373,(10:0.0,(36:0.0,11:0.0)0.00:0.0)0.00:0.0)1.00:0.0273,(34:0.0,33:0.0)0.00:0.0)0.81:0.00369)0.00:0.0,(43:0.0,(42:0.0,(41:0.0,(23:0.0,24:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.80:0.00369)0.94:0.01575)0.68:0.00313)0.79:0.00394)0.00:0.0)0.88:0.01294)0.88:0.01636)0.64:0.00437)0.78:0.01572)0.74:0.00472)0.80:0.0413):0.09455)1.00:0.0; END; BEGIN TREES; TITLE Coniochaeta_gigantospora_sp._nov._D1; LINK TAXA = Taxa3; TRANSLATE 1 Coniolariella_limoniispora_EF489469, 2 Coniolariella_australis_EF489464, 3 Coniolariella_gamsii_GU553329, 4 Coniolariella_ershadii_GU553331, 5 Novaxylaria_murandii_AJ875233, 6 Heterorosellinia_hispanica_EF489465, 7 Xylaria_phyllocharis_AB376686, 8 Rosellinia_bambusae_s_EF489466, 9 Xylaria_psidii_AB376713, 10 Xylaria_mellissii_AB376710, 11 Xylaria_psidii_AB376698, 12 Xylaria_badia_AB376705, 13 Rosellinia_necatrix_2_AY083824, 14 Nemania_maritima_DQ840074, 15 Nemania_diffusa_DQ840076, 16 Anthostomella_brabeji_EU552098, 17 Anthostomella_leucospermi_EU552100, 18 Xylaria_hypoxylon_AY327481, 19 Halorosellinia_oceanica_AY083822, 20 Astrocystis_cocoes_AY083823, 21 Xylaria_escharoidea_AB376822, 22 Annulohypoxylon_atroroseum_DQ840060, 23 Hypoxylon_fragiforme_AY083829, 24 Hypoxylon_monticulosum_DQ840067, 25 Diatrype_disciformis_DQ470964, 26 Diatrype_stigma_FJ430588, 27 Diatrype_whitmanensis_FJ430587, 28 Coniocessia_maxima_GU553344, 29 Coniocessia_anandra_GU553349, 30 Coniocessia_nodulisporioides_AJ875224, 31 Coniocessia_nodulisporioides_GU553351, 32 Coniocessia_minima_GU553345, 33 Coniocessia_nodulisporioides_GU553350, 34 Coniocessia_cruciformis_GU553348, 35 Coniocessia_cruciformis_GU553346, 36 Coniocessia_cruciformis_GU553347, 37 Coniochaeta_cruciata_AJ875222, 38 Coniochaeta_hansenii_AJ875223, 39 Coniochaeta_ostrea_AJ875227, 40 Coniochaeta_verticillata_AJ875232, 41 Coniochaeta_discoidea_AJ875230, 42 Coniochaeta_tetraspora_AJ875225, 43 Coniochaeta_ornata_AJ875228, 44 Coniochaeta_punctulata_AJ875231, 45 Coniochaeta_savoryi_AJ875229, 46 Coniochaeta_gigantospora_JN684909, 47 Sordaria_fimicola_AF132330, 48 Coniochaeta_sp_JN673041, 49 Coniochaeta_malacotricha_AF353589, 50 Coniochaeta_velutina_GQ154605, 51 Coniochaeta_ligniaria_AF353587, 52 Coniochaeta_ligniaria_AF353583, 53 Coniochaeta_africana_GQ154601, 54 Coniochaeta_prunicola_GQ154602, 55 Coniochaeta_pulveracea_GQ351560, 56 Coniochaeta_rhopalochaeta_GQ351561, 57 Barrina_polyspora_AY346261, 58 Coniochaeta_subcorticalis_AF353593, 59 Coniochaeta_boothii_AJ875226; TREE D1 = [&R] (47:0.28453,((((43:0.0099,(44:0.00494,45:0.0)0.00:0.0)0.88:0.01373,(42:0.02074,(59:1.3E-4,(58:0.0,(55:0.03761,56:0.02351)0.98:0.05085)0.93:0.01946)1.00:0.07746)0.00:0.00283)0.78:0.01683,((41:0.0404,((54:0.00523,(53:0.00399,(51:0.0,52:0.0)0.86:0.01242)0.85:0.01102)0.87:0.00952,(48:0.01731,50:0.00983)0.00:0.0)0.88:0.01937)0.57:0.01455,(40:0.02639,((46:0.09194,(37:0.08538,(57:0.1181,38:0.02517)0.79:0.0147)0.78:0.01468)0.75:0.00583,(49:0.02798,39:0.00677)0.00:0.0)0.88:0.01095)0.72:0.00777)0.64:0.01041)0.83:0.09335,((24:0.03022,(23:1.0E-5,22:0.17898)0.84:0.02192)0.88:0.04082,(((8:0.02683,(7:0.02475,(6:0.01047,(4:0.0,(3:0.0,(5:0.0,(1:0.0,2:0.0)0.00:0.0)0.00:0.0)0.00:0.0)0.76:0.01119)0.94:0.04068)0.92:0.03008)0.85:0.02452,((21:0.03187,(((17:0.02588,15:0.04746)0.09:0.0076,(16:0.03246,(18:0.02833,19:0.04935)0.00:0.0)0.45:0.00634)0.88:0.01506,(9:0.0,14:0.06239)0.86:0.01116)0.84:0.01227)0.00:0.0,((12:0.00922,(13:0.01418,11:0.01895)0.79:0.00847)0.85:0.00905,(20:0.07966,10:0.0136)0.00:0.0)0.94:0.01465)0.69:0.00543)0.83:0.03617,((27:0.01844,(25:0.01849,26:0.0)0.85:0.01931)0.95:0.07672,(29:0.00123,((36:0.0,(34:0.0,35:0.0)0.00:0.0)0.00:0.0,((33:0.0,(31:0.00417,32:0.0)0.00:0.0)0.00:0.0,(28:0.0,30:0.0)0.86:0.00416)0.41:0.00416)0.61:0.00714)1.00:0.18216)0.84:0.0414)0.45:0.02678)0.95:0.14236):0.02228):0.0; END;