#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:27 GMT TreeBASE (cc) 1994-2008 Study reference: Lennox C., Serdani M., Groenewald J.Z., & Crous P.W. 2004. Prosopidicola mexicana gen. et. sp. nov., causing a new pod disease of Prosopis species. Studies in Mycology, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1236] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=41; TAXLABELS Aureobasidium_pullulans Candida_fukuyamaensis Cercospora_cruenta Cercospora_zebrina Cladosporium_cladosporioides Cladosporium_colocasiae Coniothyrium_leucospermi Coniothyrium_ovatum_CPC_18 Coniothyrium_ovatum_CPC_23 Coniothyrium_ovatum_CPC_40 Coniothyrium_ovatum_CPC_42 Coniothyrium_palmarum Cryphonectria_parasitica Cryphonectria_radicalis Davidiella_tassiana Debaryomyces_sp. Discosphaerina_fagi Discula_quercina Dissoconium_dekkeri Dothidea_insculpta Dothidea_ribesia Endothia_eugeniae Hormonema_dematioides Leptosphaeria_maculans Leptosphaeria_microscopica Leucostoma_persoonii Mycosphaerella_latebrosa Mycosphaerella_nubilosa Mycosphaerella_populorum Mycosphaerella_punctiformis Paraphaeosphaeria_agavensis Passalora_dodonaea Passalora_fulva Phoma_glomerata Phoma_herbarum Pleospora_betae Pleospora_herbarum Prosopidicola_mexicana Pseudocercospora_angolensis Pseudocercospora_protearum_var._leucadendri Valsa_ambiens_subsp._leucostomoides ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=24; TAXLABELS Aureobasidium_pullulans Coniothyrium_leucospermi Coniothyrium_palmarum Cryphonectria_cubensis_AF265654 Cryphonectria_cubensis_AF265657 Cryphonectria_macrospora Cryphonectria_parasitica Diaporthe_helianthi Diaporthe_meridionalis Diaporthe_phaseolorum_AF001016 Diaporthe_phaseolorum_AF001028 Dothidea_insculpta Endothia_gyrosa_AF368324 Endothia_gyrosa_AF368326 Hormonema_dematioides Hormonema_macrosporum Kabatina_juniperi Kabatina_thujae Leucostoma_persoonii Phaeosphaeria_nodorum Phaeosphaeria_vagans Prosopidicola_mexicana_CBS_113529 Prosopidicola_mexicana_CBS_113530 Sydowia_polyspora ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2844] TITLE 18S_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1131; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aureobasidium_pullulans --------------------------------------------------------AGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGCCGTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Candida_fukuyamaensis -------------AGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAATCCCGACTGTTTGGAAGGGATGTATTTATTAGATAAAAAATCAATGCTCTTTGAG-CTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATAACGATACAGGGCCCTTTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CTTGGTTGGCCGGTCCGCCTTTTTGGCGAGTACTGGACCCAACCGAGCCTTTCCTTCTGGCTAACCATTCGCCCTT------GTGGTGTTTGGCGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATATTAGCATGGAATAATAGAATAGGACGTTATGGTTCTATTTTGTTGGTTTCTAGGACCATCGTAATGATTAATAGGGACGGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGACGTTTTCATTAATCAA-GAACGAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGTGTTGTTCTTTTTTTGACGCACTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Cercospora_cruenta ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCTCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Cercospora_zebrina ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Cladosporium_cladosporioides ---------------------------------------------------??CTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCT?GGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAA??ATGCCGACTAGGGATCGGACGGTGTTAGTATTTTGACCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTT?????????????????????? Cladosporium_colocasiae ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACGGTGTTAGTATTTTGACCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Coniothyrium_leucospermi ---------------------------------------------ATGCATGTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAA- Coniothyrium_ovatum_CPC_18 ---------------------------------------------ATGCATGTCTAAGTATAAGCAA-TTGTACGGTGAAACTGCGAACGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCCCCTTGGTGAATCATAATAACTCAGCGGATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGGATTAGGGTTCGGTTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAGCGAGGAACAATTAGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCTAATAGC-GTATATTAAATTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCGCTGGGC-GTGCCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGACCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGCGGGTGTTTTTATTTTGACCCCGTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAA- Coniothyrium_ovatum_CPC_23 -------------------------------------------CCATGCAAGTCTAAGTATAAGCAA-TTGTACGGTGAAACTGCGAACGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCCCCTTGGTGAATCATAATAACTCAGCGGATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGGATTAGGGTTCGGTTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAGCGAGGAACAATTAGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCTAATAGC-GTATATTAAATTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCGCTGGGC-GTGCCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGACCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGCGGGTGTTTCTATTTTGACCCCGTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAA- Coniothyrium_ovatum_CPC_40 ---------------------------------------------ATGCAAGTCTAAGTATAAGCAA-TTGTACGGTGAAACTGCGAACGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCCCCTTGGTGAATCATAATAACTCAGCGGATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGGATTAGGGTTCGGTTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAGCGAGGAACAATTAGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCTAATAGC-GTATATTAAATTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCGCTGGGC-GTGCCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGACCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGCGGGTGTTTCTATTTTGACCCCGTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTC----- Coniothyrium_ovatum_CPC_42 ---------------------------------------TTAGCCATGCAAGTCTAAGTATAAGCAA-TTGTACGGTGAAACTGCGAACGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCCCCTTGGTGAATCATAATAACTCAGCGGATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGGATTAGGGTTCGGTTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAGCGAGGAACAATTAGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCTAATAGC-GTATATTAAATTTGTTGCAGTTAAAAAGCTCGTAGTTGGACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCGCATGCCCTTCGCTGGGC-GTGCCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGACCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGCGGGTGTTTCTATTTTGACCCCGTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Coniothyrium_palmarum --------------------------------------ATTAGCCATGCATGTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTT--CGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-TCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAA- Cryphonectria_parasitica ---------------------------------------TAAGCCATGCAAGTCTAAGTTTAAGCAC-CTAAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTT--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTCTTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCG-TCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGCCTTTCCCTCTGGGGAGCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTTGTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATT-CTTTGACTCGCTCGGCACCTTACACGAAAGTAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Cryphonectria_radicalis ------------------------------------------GCCATGCAAGTCTAAGTTTAAGCAC-CTAAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTT--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTCTTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCG-TCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGCCTTTCCCTCTGGGGAGCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTTGTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATT-CTTTGACTCGCTCGGCACCTTACACGAAAGTAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Davidiella_tassiana ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATTGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACGGTGTTAGTATTTTGACCCGTTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Debaryomyces_sp. ---------------------TATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAATCCCGACTGTTTGGAAGGGATGTATTTATTAGATAAAAAATCAATGCTTTTCGGAGCTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGTGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATAACGATACAGGGCCCTTTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CTTGGTTGGCCGGTCCGCCTTTTTGGCGAGTACTGGACCCAACCGAGCCTTTCCTTCTGGCTAACCTTTCGCCCTT------GTGGTGTTTGGCGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATATTAGCATGGAATAATAGAATAGGACGTTATGGTTCTATTTTGTTGGTTTCTAGGACCATCGTAATGATTAATAGGGACGGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTACCTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGACGTTTTCATTAATCAA-GAACGAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGTGTTGTTCTTTTTTTGACGCACTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Discosphaerina_fagi ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTAAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Discula_quercina --------------------ATATGCTTGTCTCAAAGATTAAGCCATGCAAGTCTAAGTTTAAGCAC-ATAAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTT--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTATTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAG-TAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATAGGAGG?????????????????????GCGGTAATTC-AGCTCCA-TAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGTCTTTCCCTCTGGGGATCCGCATGCCCTTCATTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGACGATGTTATTTCTT-GACTCGTTCGGCACCTTACACGAAAGTAAAGTTTTTGGGTTCT-------------------- Dissoconium_dekkeri ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TCACTACATGGACAACTGTGGCAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--ACGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATGATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTCTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGCCGTCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTCGGCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGGTGTTATTATTTTGACCCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Dothidea_insculpta ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTAGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGTATGCCCTTCACTGGGC-GTATTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Dothidea_ribesia ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAGCGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGTATGCCCTTCACTGGGC-GTATTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Endothia_eugeniae ------------TGTAAGTCATATGCTTGTCTCAAAGATTAAGCCATGCAAGTCTAAGTTTAAGCAC-CTAAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTT--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTCTTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAA?TGGAG???????????????????GA-GCGGT?ATT?CAGCTCCAATAGCCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGCCTTTCCCTCTGGGGAGCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTTTT-CTTTGACTCGCTCGGCACCTTACACGAAAGTAAAGTTTTTGGGTTCT-------------------- Hormonema_dematioides --------------GTAGTCATATGCTTGTCTCAGAGATTAAGCCATGCATGTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCTCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATCATTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTCTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Leptosphaeria_maculans GGTTGATTCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-TCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Leptosphaeria_microscopica --------------GTAGTCATATGCTTGTCTCACAGATTAAGCCATGCATGTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTT--CGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-TCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Leucostoma_persoonii ---------------------------------------------ATGCAAGTCTAAGTTTAAGCAC-CTAAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTT--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTCTTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGCCTTTCCCTCTGGGGATCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCATATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCGTCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATTTCTT-GACTCGCTCGGCACCTTACACGAAAGTAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Mycosphaerella_latebrosa ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTTACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTAGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCTAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Mycosphaerella_nubilosa ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTACATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTATCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGCCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTCGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTTCTATATTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Mycosphaerella_populorum ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCTATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGGTATT-TTTTGCCTCCATCGGCACCTTACGAGAAATCAAAGTTTT-GGGTTC-GGGGGGAGTATGGTC????? Mycosphaerella_punctiformis ---------------------------------------------ATGCATGTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TC----- Paraphaeosphaeria_agavensis --------------------------------------------------TGTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATACCTGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTT--CGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTTGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-TCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Passalora_dodonaea ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTAGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTGTGGGTTCTGGGGGGAGTATGGTCGCAAG Passalora_fulva ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCCTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCGCATGCCCTTCACTGGGC-GTGTCGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCCGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACGAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGC--- Phoma_glomerata ------------------TCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTT--CGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-CCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGT-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTT----------------------------- Phoma_herbarum --------------GTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTT--CGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-CCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGT-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Pleospora_betae ---------------------------------------------------GTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-TCTGGCTGGCAGGTCCGCCTCACCG-CGTGTACTTGTCC-GGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGT-GCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATGGTCGCAAG Pleospora_herbarum ---------------------------------------------------GTCTAAGTATAAGCAA-TTATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACC-TTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTT--CGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGG-CCTGGCTGGCGGGTCCGCCTCACCG-CGTGCACTCGTCC-GGCCGGGCCTT-CCTTCTGAAGAACCTCATGCCCTTCACTGGGC-GTGTTGGG-GAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGT-GCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGATTATGGTCGCAAG Prosopidicola_mexicana --------------------------------------------CATGCAAGTCTAAGTTTAAGCAC-CTTAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTC--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTCTTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGCCTTTCCCTCTGGGGAGCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTATTTCTT-GACCCGCTCGGCACCTTACACGAAAGTAAAGT-TTTGGGTTCTGGGGGGAGTATGGTCGCAAG Pseudocercospora_angolensis ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTT--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACCATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCTCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Pseudocercospora_protearum_var._leucadendri ---------------------------------------------------GTCTAAGTATAAGCAA-CTATACGGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACC-TTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTC--CGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTCCGGGGCTCCTTGGTGAATCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGACTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCCGCCTCACCG-CGTGTACTGGTCC-GGCCGGGCCTTTCCTTCTGGGGAGCCTCATGCCCTTCACTGGGC-GTGTTGGG-GAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGT-GTGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCTGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACAAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGTGGATGTTATCTTTTTGACTCCATCGGCACCTTACGAGAAATCAAAGTTTTTGGGTTCTGGGGGGAGTATG-TCGCAAG Valsa_ambiens_subsp._leucostomoides -------------TTGTAGTATATGCTTGTCTCAAAGATTAAGCCATGCAAGTCTAAGTTTAAGCAC-CTAAACGGCGAAACTGCGAATGGCTCATTAAATCAGTTATCGTATATTTGATAGTACC--TACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCCCGACTT--CGGAAGGGATGTATTTATTAGATTAAAAACCAATGCCCTTCGGGGCTCACTGGTGATTCATAATAACTTCTCGAATCGCATGGCCTTGTGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGACGGCTGGGTCTTGGCCAGCCGTGGTTACAACGGGTAACGGAGGGTTAGGGCTTGACCCCGGAGAAGGAGCCTGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAG-TAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAATCCCTTAA?GAGGAACAATAGGAGG?????????????????????GCGGTAATTC-AGCTCCA-TAGC-GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG-CCTGGCTGGCCGGTCTGCCTCACCG-CATGCACTGGTCC-GGCCGGGCCTTTCCCTCTGGGGATCCGCATGCCCTTCACTGGGT-GTGTCGGG-GAACCAGGACTTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCCTATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCGTCAGTATTCAATCGTCAGAGGTGAAATTCTTGGATCGATTGAAGACTAACTACTGCGAAAGCATTCGCCAAGGATGTTTTCATTAATCAG-GAACGAAAGTTAGGGGATCGAAAACGATCAGATACCGTTGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGATGTTATTTCTT-GACTCGCTCGGCACCTTACACGAAAGTAAAGTTTTTGGGTTCT-------------------- ; END; BEGIN SETS; CHARSET ssu (CHARACTERS = 18S_rDNA) = 57-1102; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 18S_rDNA) = N: 1-1131; CODONPOSSET CodonPositions (CHARACTERS = 18S_rDNA) = N: 1-1131; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2752] TITLE ITS_data; LINK TAXA = Taxa2; DIMENSIONS NCHAR=662; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aureobasidium_pullulans --------------------AGGGTCTTCAT-GGCCCGA-CCTCCAACCCTC-TGTTGTTAAAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGTTTCGGT-CTCCGA----GCGC-----------------ACTAACCCT------------------------CGG--GT--TGGT--GAGCGCCCGCCAGA-GTCCAACC----AAACTCT-TGTA-TTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ATCGCTTGGTATT-GGGAA-CGGTCC-----GTCG-AAAG-GCGGG--CCTTCCTCGAAGA-CCTC-GGCGGGGTT-CAA-CCAACTTCGGGC-GTAGTAGAGTT-------AAATC-GAACGTCTT-ATAAGC-TTGGTCGGATCTCATTGCCGTTAAA-CCTTTATATT---TTCTAGGTTGACCTCGGATCA?G Coniothyrium_leucospermi AGGATCATTAAA---GAGTTAGGGTCCTAGT-GGCCCAA-CCTCCAACCCTC-TGTTGTTAAAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGT-TCGGT-CTCCGA----GCGC-----------------GTTAACCTC------------------------CGG--GT--TGGC--GAGCGCCCGCCAGA-GTCCAACC----AAACTCT-TGTA-TTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ACTGCTTGGTGTT-GGGCA-TCGTCC-----GTCG-AAAG-GCGGG--CGTGCCTCGAAGA-CCTC-GGCGGGGTTTCT--TCAACTTCGGGC-GTAGTAGAGTT-------AAATC-AAACGTCTT-ATAAGC-TTGGTGAGATCTCATTGCCGTTAAA-CCTTTT-AT----TTC-AGGTTGACCTCGGATCAGG Coniothyrium_palmarum AGGATCATTA-ACTATATCTCGGGGGGCCGGACCC--AAGGTG-CGAGCGTACACGGCGTTTAACC----AC-GCT--------------GTGGCATTCGACATTTT-------GA--CCCGCCCTGTCT----GAAT----------ATATACCCCTGTT---TATTGCGTAC-TACTT---GTTTCCTTGGTGGGCTTGCCCGCCAAAAGGAC-ACCTATAAAAC-CT-CTTGT---AAT---T-GC-AGTCAGCGTCAGAA-----AAAC----TTAA-T-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACC-CTCAAGC-----TTTGCTTGGTGTT-GGGTGTTTGTCCC----GT-GTTA-T-GCGTG--GACTCGCCTTAAAGCGATTGGCAGCCGGCATATTGGCCGTGGAGCAGCAGTA---------------CATTCAGCTCTCTACACC---ATAAAGTTGGCA---TCCATCAAGTCTATAC-ATT---TGCT--CTTGACCTCGGATCAGG Cryphonectria_cubensis_AF265654 --------------------------------------C-CCAGATACCCTT-TGT-G----AACTTAT-ACCTTTTT---------ATCGTTGCCTCGGCGCCGA--GCC--GGGAGTGCTCTTCTG-TGCT-------------------CCCCCACC--------------GCGCAA---GC-AG--TGGA--GCAGGCCCGCCGGC-GGCCCACC---AAAACTCTTTGTTTTT-AGAACGTATCTCTTCTGAGTG-TTTA----TAACAAAACAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGAATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTACCT----GTT-CACA--GCGGG--TAGGCCCTGAAATTTAGT-GGCG-GGCTCGCTAAGA-CTCTGAGC-GTAGT--AGTTTTT------ATCACCTCGCTTT-GGAAGG-ATTAGCGGT-GCTCTTGCCG-TAAAACC---------------------------------- Cryphonectria_cubensis_AF265657 --------------------------------------C-CCAGATACCCTT-TGT-G----AACTTAT-ACCTTTTT---------ATCGTTGCCTCGGCGCCGA--GCC--GGGAGTGCTCTTCTG-TGCT-------------------CCCCCACC--------------GCGCAA---GC-AG--TGGA--GCAGGCCCGCCGGC-GGCCCACC----AAACTCTTTGTTTTT-AGAACGTATCTCTTCTGAGTG-TTTA----TAAC-AAACAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGAATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTACCT----GTT-CACA--GCGGG--TAGGCCCTGAAATTTAGT-GGCG-GGCTCGCTAAGA-CTCTGAGC-GTAGT--AGTTTTT------ATCACCTCGCTTT-GGAAGG-ATTAGCGGT-GCTCTTGCCG-TAAAACC---------------------------------- Cryphonectria_macrospora --------------------------------------C-CCAGATACCCTT-TGT-G----AACTCAT-ACCATTTT---------ATCGTTGCCTCGGCGCTGA--GCCCCGGGGGGGATTTTTGAGAG-AG----------TCTCTCTCTCCTTCCTTCTCGCCTTCTACCGTGCAAACGGTTGTT--GGA--GCAGGCCCGCCGGC-GGCCCACC----AAACTCTTTGTTTTT-ATAACCTATCTCTTCTGAGTA--CAT----TTAAAAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGAATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGTA--CTACCC----GT---CAA--ACGG---TAGGCCCTGAAATTTAGT-GGCG-GGCTCGCTAAGA-CTCTGAGC-GTAGT--AGTTTTTT------CAACCTCGCTTT-GGAAGG-ATTAGCGGTTGCTCTTGCCG-TAAAACC---------------------------------- Cryphonectria_parasitica --------------------------------------C-CCAGATACCCTT-TGT-G----AACTTATAACCATTTT---------ATCGTTGCCTCGGCGCTGA--GCCCGGGGGGGGGTTGGCGAAGGCAGATTTTCTTCCTTCTCCCCTCCCTCCCCCCCCTCTTCCACCGTGCAAACGGTTGTTGGGGA--GCAGGCCCGCCGGC-GGCCCACT----AAACTCTTTGTTTTT-ATAACCTATCTCTTCTGAGTA--CAT----AAACAAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGAATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----TTGGCTTGGTGTTGGGGTA--CTACCC----GT---AAA--ACGG---TAGGCCCTGAAATTTAGT-GGCG-GGCTCGCTAAGA-CTCTGAGC-GTAGT--AGTTTTTTTTTCTTCAACCTCGCTTT-GGAAGG-ATTAGCGGTTGCTCTTGCCG-TAAAACC---------------------------------- Diaporthe_helianthi -GGATCATTGCT--GGAACGC-GCCTC-----GGCGCAC-CCAGAAACCCTT-TGT-G----AACTTAT-ACCTA------------TCTGTTGCCTCGGCGAAG---GCC--GGCCTCCCCACCG-A-GG---------------------CCCCT------------------------TGGGAACA-AGGA--GCAG-CCCGCCGGC-GGCCAACC----AAACTCT-TGTTTCTTAG--TGAA---TCTCTGAGTA-AAAA----AAAC---ATAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGATGGGGCA--CTGCTT----C-CG-A----GAGGGAGCAGGCCCTGAAATCTAGT-GGCG-AGCTCGCCAGGA-CCCCGAGC-GTAGT--AGTT--------ATAT--CTCGCTCC-GGAAGGCCCTGGCGGT-GCCC-TGCCGTTAAA-CCCCCAACTTC--TGAAAATTTGACCTCGGATCAGG Diaporthe_meridionalis -GGATCATTGCT--GGAACGC-GCCCCA----GGCGCAC-CCAGAAACCCTT-TGT-G----AACTCAT-ACCTT------------ACTGTTGCCTCGGCGCAG---GCC--GGCCCCCCCA-GG-G-GG---------------------CCCCT------------------------CGGATACT-ATGA--GCAGGCCCGCCGGC-GGCCAAGC----CAACTCT-TGTTTTT-ACACCGAA---ACTCTGAGCA--AA-----AAAC---ACAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTGCCT----GT---A----GAAGG-GCAGGCCCTGAAATCTAGT-GGCG-GGCTCGCCAGGA-CCCCGAGC-GCAGT--AGTT--------AAAC-CCTCGCTCG-GG-AGGCCCTGGCGGT-GCCC-TGCCGTTAAA-CCCCCAACTTC--TGAAAATTTGACCTCGGATCAGG Diaporthe_phaseolorum_AF001016 -GGATCATTGCT--GGAACGC-GCCCCA----GGCGCAC-CCAGAAACCCTT-TGT-G----AACTCAT-ACCTT------------ACTGTTGCCTCGGCGCAG---GCC--GGCCCCCCCA-GG-G-GG---------------------CCCCT------------------------CGGAGACG-AGGA--GCAGGCCCGCCGGC-GGCCAAGC----CAACTCT-TGTTTTT-ACACCGAA---ACTCTGAGCA--AA-----AAAC---ACAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTGCCT----GT---A----GAAGG-GCAGGCCCTGAAATCTAGT-GGCG-GGCTCGCCAGGA-CCCCGAGC-GCAGT--AGTT--------AAAC-CCTCGCTCG-GG-AGGCCCTGGCGGT-GCCC-TGCCGTTAAA-CCCCCAACTTC--TGAAAATTTGACCTCGGATCAGG Diaporthe_phaseolorum_AF001028 -GGATCATTGCT--GGAACGC-GCCCCA----GGCGCAC-CCAGAAACCCTT-TGT-G----AACTTAT-ACCTT------------ACTGTTGCCTCGGCGCAG---GCC--GGCCCCCT-AC-G-G-GG---------------------CCCCT------------------------TGGCGACA-AGGA--GCAGGCCCGCCGGC-GGCCAAGT----TAACTC--TGTTTTT-ACACTGAA---ACTCTGAGCA--CA-----AAAC---ATAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTGCCT----C-CT-C----GCGGGGGCAGGCCCTGAAATACAGT-GGCG-AGCTCGCCAGGA-CTCCGAGC-GCAGT--AGTT--------AAAC-CCTCGTTCT-GGAAGG-CCTGGCGGT-GCCC-TGCCGTTAAA-CCCCCAACTCC--TGAAAATTTGACCTCGGATCAGG Dothidea_insculpta ---------------GAGTGACTAACCG--T-CCTCCGA-CTTCCAACCCTC-TGTTGTTATAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGT-TCGGTCCTCCGA----GCGC-----------------ACCAGTCTT------------------------CGG--AC--AGGT--GAGTGCCCGCCAGA-GTCCAACC----AAACTCT-TGTTTTT-AACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ACTGCTTGGTATT-GGGCA-TCGTCC-----GTCG-AAAG-GCGGG--CGTGCCTCGAAGA-CCTC-GGCGGGGTTTCT--CCAACTTCGGGC-GTAGTAGAGTT-------AAATC-GAACGTCTT-ATAAGC-TTGGTGGGACTCCATTGCCGTTAAA-CCTTTT-ATT---TTCTAGGTTGACCTCGGAT---- Endothia_gyrosa_AF368324 --------------------------------------C-CCAGATACCCTT-TGT-G----AACTTAT-ACCATTTT---------ATCGTTGCCTCGGCGCTGA--GCT--GGGGGCACTCTCCTG-TGCC-------------------CCCCCACC--------------GTGCAA---GC-GG--TGGA--GCAGGCCCGCCGGC-GGCCCACC----AAACTCTTTGTTTTT-AGACCGTATCTCCTCTGAGTG-TTTA----CAA--AAACAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGAATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTACCT----GT---ACA--ACGG---TAGGCCCTGAAATTTAGT-GGCG-GGCTCGCTAAGA-CTCTGAGC-GTAGT--AGTTT--------ATCACCTCGCTTT-GGAAGG-ATTAGCGGT-GCTCTTGCCG-TAAAACC---------------------------------- Endothia_gyrosa_AF368326 --------------------------------------C-CCAGATACCCTT-TGT-G----AACTTAT-ACCATTTT---------ATCGTTGCCTCGGCGCTGA--GCT--GGGGGCACTCTCCTG-TGCC-------------------CCCCCACC--------------GTGCAA---GC-GG--TGGA--GCAGGCCCGCCGGC-GGCCCACC----AAACTCTTTGTTTTT-AGACCGTATCTCCTCTGAGTG-TTTA----CAA--AAACAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGAATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTGGCTTGGTGTTGGGGCA--CTACCT----GT---ACA--ACGG---TAGGCCCTGAAATTTAGT-GGCG-GGCTCGCTAAGA-CTCTGAGC-GTAGT--AGTTT--------ATCACCTCGCTTT-GGAAGG-ATTAGCGGT-GCTCTTGCCG-TAAAACC---------------------------------- Hormonema_dematioides AGGATCATTAAA---GAGATAGGGTCTTCAT-GGCCCGA-CCTCCAACCCTC-TGTTGTTAAAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGTCTCGGT-CTCCGA----GCGC-----------------ACTAACCCT------------------------CGG--GT--TGGT--GAGCGCCCGCCAGA-GTCCAACC----AAACTCT-TGTA-TTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ATCGCTTGGTATT-GGGAA-CGGTCC-----GTCG-CAAG-GCGGG--CCTTCCTCGAAGA-CCTC-GGCGGGGTTCCAA-CCAACTTCGGGC-GTAGTAGAGTT-------AAATC-GAACGTCTT-ATAAGC-TTGGTCGGATCTCATTGCCGTTAAA-CCTTTAAATT---TTCTAGGTTGACCTCGGATCAGG Hormonema_macrosporum ---ATCATTAAA---GAGATAGGGTCTTCAC-GGCCCGA-CCTCCAACCCTC-TGTTGTTAAAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGTCTCGGT-CTCCGA----GCGC-----------------ACTAACCCT------------------------CGG--GT--TGGT--GAGCGCCCGCCAGA-GTCCAACC----AAACTCT-TGTA-TTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ATCGCTTGGTATT-GGGAA-CGGTCC-----GTCG-AAAG-GCGGG--CCTTCCTCGAAGA-CCTC-GGCGGGGTT-CAA-CCAACTTCGGGC-GTAGTAGAGTT-------AAATC-GAACGTCTT-ACAAGC-TTGGTCGGATCTCATTGCCGTTAAA-CCTTTAAATT---TTCTAGGTTGACC---------- Kabatina_juniperi -----CATTAAA---GAGTTAGGGTCCTAGT-GGCCCAA-CCTCCAACCCTC-TGTTGTTAAAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGT-TCGGT-CTCCGA----GCGC-----------------GTTAACCTT------------------------CGG--GT--TGGC--GAGCGCCCGCCAGA-GTCCAACC----AAACTCT-TGTA-TTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ACTGCTTGGTATT-GGGCA-TCGTCC-----GTCG-AAAG-GCGGG--CGTGCCTCGAAGAACCTC-GGCGGGGTTTTT--CCAACTTCGGGC-GTAGTAAAGTT-------AAATCAAAACGTCTT-ATAAGC-TTGGTGAGATCTCATTGCCGTTAAA-CCTTTT-ATTT--TTC-AGGTTGACCTCGGAT---- Kabatina_thujae -----CATTAAA---GAGATAGGGTCCTAGT-GGCCCAA-CCTCCAACCCTC-TGTTGTTATAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGT-TCGGT-CTCCGA----GCGC-----------------ACCAGTCTT------------------------CGG--AC--AGGT--GAGCGCCCGCCGGA-GTCCAACC----AAACTCT-TGTTTTTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ACTGCTTGGTATT-GGGCACTCGTCC-----GCCG-CAAG-GCGGG--CGTGCCTCGAAGA-CCTC-GGCGGGGTTTCA--TCAACTTCGGGC-GTAGTAGAGTT-------AAATC-GAACGTCTT-ATAAGC-TTGGTGAGATCTCATTGCCGTTAAA-CCCTTTTATTT--TTC-AGGTTGACCTCGGATCAGG Leucostoma_persoonii -GGATCATTGCT--GGAA-GC-GCCGCAA---GGTGCAC-CCAGAAACCCTT-TGT-G----AACTTAT-ACC-----TAT------ATCGTTGCCTCGGCGCCGGCCGCC--TCTCCC-TCGTGGA-GGGGG-------------------CCCCCTCCTGGTCGT--AAAAA--GCCA--GG--GG--AGGACAGCAGGCCCGCCGGT-GGCCTACT----AAACTCT-TGTTTTT-ATTGAGTAA-AATC-TGAGTAA---------GCTT-C-TAAA-TGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGC-----CTAGCTTGGTGTTGGGGCA--TTACCTGACTGTTT-ACAG-AAGGG--TAAGCCCTGAAATTTAGT-GGCG-AGCTCGCCAGGA-CTCCGAGC-GCAGT--AGTT--------AAAC-CCTCGCTTT-GGATAGTACTGGCGCG-GCCC-TGCCG-TAAAACCCCCAACTTC--TGAAAATTTGAC----------- Phaeosphaeria_nodorum -----CATTACACT-CAG-TAGTTT--ACTACTGTAA--------AAGGG----GCTGT---TAG-----TC-TGT--------------ATAGCG-CAA-GCTGAT-------GA-GCAGCTGGCCTCTT---TT------------ATCCACCCTTGTC---TTTTGCGTAC--CCAC---GTTTCCTCGGCAGGCTTGCCTGCCGGTTGGACAAA-TTTATAAC-CT-TTTT----AATT--T-TC-AATCAGCGTCTGAA-----AAAC----TTAA-T-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACC-CTCAAGC-----TCTGCTTGGTGTT-GGGTGTTTGTCCT----CTCCCTAGT-GTTTG--GACTCGCCTTAAAATAATTGGCAGCCAGTGTTTTGGTATTGAAGC-GCAGCA---------------CAAGTCGCGATTCGTAAC----AAACACTTGCG---TCCAC-AAG-CCTTTT-T-----AACT--TTTGACCTCGGATCAGG Phaeosphaeria_vagans -----CATTACATT-CAG-TAGCTT--GCTACTGGTCG------GGAGGC----GCTGT---AAC-----TC-CGC--------------ATAGTATTAATT-TACT-------GA-TGAGCGGCAGGCCCTCTGT------------CTGTACCCTTGTC---TTTTGCGCAC--TCAT---GTTTCCTCGGCGGGCTTGCCCGCCGATTGGACAAA-ACTATAAC-CT-TTTT----AATT--T-TC-AATCAGCGTCTGAAA----AAAC----TTAA-T-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACC-CTCAAGC-----TCTGCTTGGTGTT-GGGTGTTTGTCCT----CTCCTTTGC-GTTTG--GACTCGCCTTAAAGCAATTGGCAGCCAGTGTTTTGGTATTGAAGC-GCAGCA---------------CATTTTGCGATTCTAGCC--GATAATACTTGCG---TCCAT-AAG-CCTTTT-TT----AACT--TTTGACCTCGGATCAGG Prosopidicola_mexicana_CBS_113529 -GGATCATTGCT--GGAAGGC-GCCGCCCCGCGGCGCGCCCCAGACACCCTT-TGT-G----AACTTATGATTCTCGACCCGAGAATATCGTTGCCTCGGCGC-G---GCC--CGGGGGGTTTCGGCCCTGAA-------------------CCCCTCCCCGTCCCG-GTAC----TCCC--GG---G--CGGA--GCAGGCCCGCCGGC-GGCCCTAT----AGACTCT-TGTTTTTCAG--CGT--CTCCTCTGAGTTTTTTTTT-ACCACAAAACAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGCCCCCCGGGGCCTGGTGTTGGGGCG--CTGCCT----CTTTTACCCCGAGG---CAGGCCCCGAAATCGAGT-GGCG-GGCTCGCCAGGA-CTCCGAGC-GTAGT--AGTCTG-------ACCACCTCGCTTT-GGACCGTACTGGCGCG-GCCC-TGCCG-TAAAACCGTCTCTGACCTCGTAGAGTTGACCTCGGATCAGG Prosopidicola_mexicana_CBS_113530 -GGATCATTGCT--GGAAGGC-GCCGCCCCGCGGCGCGCCCCAGACACCCTT-TGT-G----AACTTATGATTCTCGACCCGAGAATATCGTTGCCTCGGCGC-G---GCC--CGGGGGGTTTCGGCCCTGAA-------------------CCCCTCCCCGTCCCG-GTAC----TCCC--GG---G--CGGA--GCAGGCCCGCCGGC-GGCCCTAT----AGACTCT-TGTTTTTCAG--CGT--CTCCTCTGAGTTTTTTTTTTACCACAAAACAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCTGGTATTCCAGCGGGCATGCCTGTTCGAGCGTCATTTCAACC-CTCAAGCCCCCCGGGGCCTGGTGTTGGGGCG--CTGCCT----CTTTTACCCCGAGG---CAGGCCCCGAAATCGAGT-GGCG-GGCTCGCCAGGA-CTCCGAGC-GTAGT--AGTCTG-------ACCACCTCGCTTT-GGACCGTACTGGCGCG-GCCC-TGCCG-TAAAACCGTCTCTGACCTCGTAGAGTTGACCTCGGATCAGG Sydowia_polyspora ---ATCATTAAA---GAGATAGGGTCTTCAT-GGCCCGA-CCTCCAACCCTC-TGTTGTTAAAACT----ACCTT---------------GTTGCTTTGGCGG-GACCGTCTCGGT-CTCCGA----GCGC-----------------ACTAACCCT------------------------CGG--GT--TGGT--GAGCGCCCGCCAGA-GTCCAACC----AAACTCT-TGTA-TTAAACCAGT----CGTCTGAGTA-TAA-----AATT---TTAAT-TAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTAC-ACCACTCAAGC-----ATCGCTTGGTATT-GGGAA-CGGTCC-----GTCG-CAAG-GCGGG--CCTTCCTCGAAGA-CCTC-GGCGGGGTT-CAA-CCAACTTCGGGC-GTAGTAGAGTT-------AAATC-GAACGTCTT-ATAAGC-TTGGTCGGATCTCATTGCCGTCAAA-CCTTTAAATT---TTCTAGGTTGACC---------- ; END; BEGIN SETS; CHARSET its (CHARACTERS = ITS_data) = 39-628; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = ITS_data) = N: 1-662; CODONPOSSET CodonPositions (CHARACTERS = ITS_data) = N: 1-662; END; BEGIN TREES; TITLE Tb7020; LINK TAXA = Taxa1; TRANSLATE 1 Pleospora_herbarum, 2 Pleospora_betae, 3 Coniothyrium_palmarum, 4 Phoma_herbarum, 5 Phoma_glomerata, 6 Paraphaeosphaeria_agavensis, 7 Leptosphaeria_microscopica, 8 Leptosphaeria_maculans, 9 Coniothyrium_leucospermi, 10 Dothidea_ribesia, 11 Dothidea_insculpta, 12 Aureobasidium_pullulans, 13 Discosphaerina_fagi, 14 Hormonema_dematioides, 15 Davidiella_tassiana, 16 Cladosporium_colocasiae, 17 Cladosporium_cladosporioides, 18 Dissoconium_dekkeri, 19 Coniothyrium_ovatum_CPC_42, 20 Coniothyrium_ovatum_CPC_40, 21 Coniothyrium_ovatum_CPC_23, 22 Coniothyrium_ovatum_CPC_18, 23 Passalora_fulva, 24 Passalora_dodonaea, 25 Mycosphaerella_punctiformis, 26 Mycosphaerella_populorum, 27 Mycosphaerella_nubilosa, 28 Mycosphaerella_latebrosa, 29 Pseudocercospora_protearum_var._leucadendri, 30 Pseudocercospora_angolensis, 31 Cercospora_zebrina, 32 Cercospora_cruenta, 33 Endothia_eugeniae, 34 Cryphonectria_radicalis, 35 Cryphonectria_parasitica, 36 Leucostoma_persoonii, 37 Valsa_ambiens_subsp._leucostomoides, 38 Discula_quercina, 39 Prosopidicola_mexicana, 40 Debaryomyces_sp., 41 Candida_fukuyamaensis; TREE Fig._2 = [&R] ((41,40),(((39,((38,((37,36),33)),(35,34)Cryphonectria)),((((((((((32,(30,29)Pseudocercospora),31),(24,23)Passalora),28),25),26),18),(27,(22,(21,(20,19)))Coniothyrium_ovatum))Mycosphaerella,((17,15),16)Davidiella),((14,((11,10)Dothidea,9)),(13,12)))),(((8,2),((7,(6,3)),(5,4)Phoma)),1))); END; BEGIN TREES; TITLE Tb7021; LINK TAXA = Taxa2; TRANSLATE 1 Phaeosphaeria_nodorum, 2 Phaeosphaeria_vagans, 3 Coniothyrium_palmarum, 4 Sydowia_polyspora, 5 Hormonema_dematioides, 6 Aureobasidium_pullulans, 7 Hormonema_macrosporum, 8 Kabatina_juniperi, 9 Coniothyrium_leucospermi, 10 Kabatina_thujae, 11 Dothidea_insculpta, 12 Diaporthe_phaseolorum_AF001016, 13 Diaporthe_meridionalis, 14 Diaporthe_phaseolorum_AF001028, 15 Diaporthe_helianthi, 16 Endothia_gyrosa_AF368324, 17 Endothia_gyrosa_AF368326, 18 Cryphonectria_macrospora, 19 Cryphonectria_parasitica, 20 Cryphonectria_cubensis_AF265654, 21 Cryphonectria_cubensis_AF265657, 22 Prosopidicola_mexicana_CBS_113530, 23 Prosopidicola_mexicana_CBS_113529, 24 Leucostoma_persoonii; TREE Fig._3 = [&R] ((((24,((23,22)Prosopidicola_mexicana,(((21,20)Cryphonectria_cubensis,(17,16)Endothia_gyrosa),(19,18)Cryphonectria))),(15,(14,(13,12)))Diaporthe),(11,(10,((9,8),(7,6,(5,4)))))),(3,(2,1)Phaeosphaeria)); END;