#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:15 GMT TreeBASE (cc) 1994-2008 Study reference: Leavitt S., Esslinger T.L., & Lumbsch T. 2012. Neogene-Dominated Diversification in Neotropical Montane Lichens: Dating Divergence Events in the Lichen-Forming Fungal Genus Oropogon (Parmeliaceae). American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12465] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=54; TAXLABELS Oropogon_americanus_4031 Oropogon_americanus_4032 Oropogon_americanus_4033 Oropogon_americanus_4034 Oropogon_atranorinus_4036 Oropogon_atranorinus_4398 Oropogon_atranorinus_4399 Oropogon_atranorinus_4401 Oropogon_barbaticus_AY251435 Oropogon_barbaticus_AY251451 Oropogon_bicolor_4040 Oropogon_bicolor_4042 Oropogon_bicolor_4043 Oropogon_bicolor_4402 Oropogon_bicolor_4403 Oropogon_caespitosus_A_4046 Oropogon_caespitosus_A_4047 Oropogon_caespitosus_A_4405 Oropogon_caespitosus_A_6054 Oropogon_caespitosus_A_6064 Oropogon_caespitosus_A_6068 Oropogon_caespitosus_B_4048 Oropogon_caespitosus_B_6071 Oropogon_caespitosus_C_4044 Oropogon_caespitosus_C_4420 Oropogon_caespitosus_C_6069 Oropogon_caespitosus_C_6072 Oropogon_granulosus_4049 Oropogon_granulosus_4050 Oropogon_granulosus_4051 Oropogon_granulosus_4052 Oropogon_lopezii_4039 Oropogon_lopezii_4056 Oropogon_lopezii_4411 Oropogon_lorobic_4057 Oropogon_lorobic_4058 Oropogon_lorobic_4413 Oropogon_lorobic_4414 Oropogon_loxensis_4059 Oropogon_loxensis_4060 Oropogon_loxensis_4061 Oropogon_loxensis_4062 Oropogon_loxensis_4064 Oropogon_mexicanus_4065 Oropogon_mexicanus_4066 Oropogon_mexicanus_4067 Oropogon_mexicanus_4068 Oropogon_mexicanus_4419 Oropogon_sperlingii_4069 Oropogon_sperlingii_4070 Oropogon_sperlingii_4071 Oropogon_sperlingii_4072 Oropogon_sperlingii_GenBank_EF105414 Xanthoparmelia_coloradoensis_BRYC55151 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M11865] TITLE 'Oropogon ITS, LSU, and beta-tubulin '; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1727; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Oropogon_americanus_4031 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATTGACAACGAGGTCAGTCGAATGTGTAATCTTGACAAAAATTAAGCACTGAAATGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCACCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTGCCG Oropogon_americanus_4032 ACGAGAGA-GGGGC-TCCGCG-CCCCCGGGGGTTTCGGCCCCCGACTCTT-CCCCCTCTGTGTACCCTACCTTCGTTGCTTTGGCGGG-CTT------------------------CCCCCCGGGGAGCGCCCGCCGGAGGCCCATTTCATTCCGATT--ATCCGTGACGTCCGAGCACATGAAAAACATAATTAG-TCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTCAAGGGTAGTAGTTTTT---CATCCCGCTTCGAAGGCGCGCCCCGAGGCCGGCCAGACAAC--CCCCATTTC-TCATCCACGAATGACC---------AATTTGAAATCTGG-CCCCGCCGGGGTCCGAGTTGTAATTTGCAGAGAGCGCTTCGGGCGAGGCCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGTGGGCCGAG-CCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTAGTATATTTTATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTATGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCTCCAGCGGTGCACTCGTGCCCCGACCAGGCCAGCATCGGTTCCGACGGATTCGAAAAGCAATTGACTGTTGGGAATGTAGCTCCCTTC--GGGGAGCCTTATAGCCCTCTGTCG-GCACGGCC-GTCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCTACATCCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAGCTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCTGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACCTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATTGACAACGAGGTCAGTCGAATGTGTAATCTTCACAAAAAGTAAGCACTGAAATGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCACCTTGTTTCCGCGGTCATGTCTGGGGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTGCCG Oropogon_americanus_4033 CCGAGAGA-GGGGC-CCCGCG-CCCCCGGGGGCTTCGGCCCCCGACTCTT-CCCCCTCTGTGTACCCTACCTTCGTTGCTTTGGCGGG-CTT----------------------CCCCCCCCGGGGAGCGCCCGCCGGAGGCTTATTTCATTCCGATT--ATCCGTGACGTCCGAGCATACGAAAAACACAATTAGTTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTCAAGCGTAGTAGTTTTT---CATCCCGCTTCGAAGGCGCGCCCCGAGGCCGGCCAGACAAC--CCCCATTTTTTCATCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCGCCGGGGTCCGAGTTGTAATTTGCAGAGAGCGCTTCGGGCGAGGCCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGTGGGCCGAG-CCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTAGTATATTTTATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTATGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCTCCAGCGGTGCACTCGTGCCCCGACCAGGCCAGCATCGGTTCCGACGGATTCGAAAAGCAATTGACTGTTGGGAATGTAGCTCCCTTC--GGGGAGCCTTATAGCCCTCTGTCG-GCACGGCC-GTCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCTACATCCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_americanus_4034 AAGAGAGA-GGGGG-GGCGCG-CCCCCGGGGGTTTCGGCCCCCGACTCTT-CCCCCTCTGTGTACCCTACCTTCGTTGCTTTGGCGGG-CTT----------------------CCCCCCCCGGGGAGCGCCCGCCGGAGGCTTATTTCATTCCGATT--ATCCGTGACGTCCGAGCATACGAAAAACACAATTAGTTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTCAAGCGTAGTAGTTTTT---CATCCCGCTTCGAAGGCGCGCCCCGAGGCCGGCCAGACAAC--CCCCATTTCCTCATCCACGAATGACAT-CGGATC-AATTTGAAATCTGG-CCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGAGCGCTTCGGGCGAGGCCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGTGGGCCGAG-CCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTAGTATATTTTATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTATGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCTCCAGCGGTGCACTCGTGCCCCGACCAGGCCAGCATCGGTTCCGACGGATTCGAAAAGCAATTGGCTGTTGGGAATGTAGCTCCCTTC--GGGGAGCCTTATAGCCCTCTGTCG-GCACGGCC-GTCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCTACATCCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAGCTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATTGACAACGAGGTCAGTCGAATGTGTAATCTTGACAAAAATTAAGCACTGAAATGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCACCTTGTTTCCGCGGTCATGTCTGGGGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTGCCG Oropogon_atranorinus_4036 CCGAGAGA-GGGGC-CCTGCGCCCC-CGGGGGCTCCGGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCCTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCCATCTCATTCCG-TTTTATCCGTGCCGTCCGAGTCATTG---ACAATAT--A-AAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGC---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTC---CATCCCGCTTTGAAGGTCCGCACCGAGGCTGGCCAGATAAC--CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTTCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCAGGTAACAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGATCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAGTTGGTCAAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAAAGTGTAATCTTCACAAGAAGTAAGTACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAAC----------------------------------------- Oropogon_atranorinus_4398 CCGAGAGA-GGGGC-CCTGCGCCCC-CGGGGGCTCCGGAGCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCCTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCCATCTCATTCCG-TTTTATCCGTGCCGTCCGAGTCATTG---ACAATAT--A-AAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGC---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTC---CATCCCGCTTTGAAGGTCCGCACCGAGGCTGGCCAGATAAC--CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_atranorinus_4399 CCGAGAGA-GGGGC-CCTGCGCCCC-CGGGGGCTCCGGAGCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCCTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCCATCTCATTCCG-TTTTATCCGTGCCGTCCGAGTCATTG---ACAATAT--A-AAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGC---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTC---CATCCCGCTTTGAAGGTCCGCACCGAGGCTGGCCAGATAAC--CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_atranorinus_4401 CCGAGAGA-GGGGC-CCTGCGCCCC-CGGGGGCTCCGGAGCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCCTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCCATCTCATTCCG-TTTTATCCGTGCCGTCCGAGTCATTG---ACAATAT--A-AAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGC---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTC---CATCCCGCTTTGAAGGTCCGCACCGAGGCTGGCCAGATAAC--CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_barbaticus_AY251435 CCGAGAGA-GGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGCGTACCCTACCTTTGTTGCTTTGGCGGG-TCCCGGGGCTTGCTCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTATTGCATTCCGATTT-ATCCGTGCCGTCCGAGTAC----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAGGCCCGCCCCGAGGCTGGCCAGACAAC--CCCAAATTT----TCCACGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_barbaticus_AY251451 CCGAGAGA-GGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGCGTACCCTACCTTTGTTGCTTTGGCGGG-TCCCGGGGCTTGCTCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTATTGCATTCCGATTT-ATCCGTGCCGTCCGAGTAC----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAGGCCCGCCCCGAGGCTGGCCAGACAAC--CCCAAATTT----TCCACGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_bicolor_4040 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGGCTCCGGCCCCCGACTCC-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCCTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCTATCTCATTCCG-TTTTATCCGTGACGTCCGAGTAATTG---TTACAAT--ATCAGAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGCCTTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTCGAGCGTAGTAATCATC---CATCCCGCTTCGAAGGTCCGCACCGGGGCTGGCCAGATAA---CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_bicolor_4042 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGTCTCCGGCCCCCGACTCC-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCTTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCTATCTGATTCCG-TTTTATCCGTGACGTCCGAGTAATTG---TTACAAT--ATCAGAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGCCTTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTCGAGCGTAGTAATCATC---CATCCCGCTTCGAAGGTCCGCACCGGGGCTGGCCAGATAA---CCCCC-TCTTC--------------------------------------------------------------------GAGGGTGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTATATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGCGCAATGCGGCCCGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAATTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_bicolor_4043 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGTCTCCGGCCCCCGACTCC-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGTGCCCCGGGGCCTCGCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCTATCTGATTCCG-TTTTATCCGTGACGTCCGAGTAATTG---TTACAAT--ATCAGAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGCCTTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTCGAGCGTAGTAATCATC---CATCCCGCTTCGAAGGTCCGCACCGGGGCTGGCCAGATAA---CCCCC-TCTTC--------------------------------------------------------------------GAGGGTGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTATATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGCGCAATGCGGCCCGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACATGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAATTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_bicolor_4402 ----------------------------------------------------------------------------------------------------GCCCCCGCGCCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCTATCTCATTCCG-TTTTATCCGTGACGTCCGAGTAATTG---TTACAAT--ATCAGAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGCCTTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTCGAGCGTAGTAATCATC---CATCCCGCTTCGAAGGTCCGCACCGGGGCTGGCCAGATAA---CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_bicolor_4403 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGTCTCCGGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTTTGTTGCTTTGGCGTGCCCCGGGG-CTCGCCCCCGCACCGGCCCCCG-CCGGTGAGCGCCCGCCAGAGGCCTATCTGATTCCG-TTTTATCCGTGACGTCCGAGTAATTG---TTACAAT--ATCAGAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGCCTTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCCGGTGCGGCTTCGAGCGTAGTAATCATC---CATCCCGCTTCGAAGGTCCGCACCGGGGCTGGCCAGATAA---CCCCC-GTCTTCTTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_A_4046 -------A-GGGGC-TCTGAGCCCCCCGGGGGCTCCGGCCCTCGACTCTTCGCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCTGCCGGAGGCCTATTGCATTCCGATTTAATCCGTGCCGTCCGAGTAT---CAAAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_A_4047 CCGAGAGA-GGGGC-TCCGTGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCGTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCTGCCGGAGGCCTATTGCATTCCGATTTAATCCGTGCCGTCCGAGTAT---CAAAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGCCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCGTAAGGATCAAGCACTGAAACATCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCGGTCATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAATATGGTGCCG Oropogon_caespitosus_A_4405 CCGAGAGA-GGGGC-TCCGTGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCTGCCGGAGGCCTATTGCATTCCGATTTAATCCGTGCCGTCCGAGTAT---CAAAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTCTAAGTCCATTGGAACACGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGCCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCGTAAGGATCAAGCACTGAAACATCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCGGTCATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAATATGGTGCCG Oropogon_caespitosus_A_6054 CCGAGAGA-GGGGC-TCCGTGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGTGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCTGCCGGAGGCCTATTGCATTCCGATTTAATCCGTGCCGTCCGAGTAT---CAAAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTCATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_A_6064 CCGAGAGA-GGGGC-TCCGTGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGTGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCTGCCGGAGGCCTATTGCATTCCGATTTAATCCGTGCCGTCCGAGTAT---CAAAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_A_6068 CCGAGAGA-GGGGC-TCCGTGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGTGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCTGCCGGAGGCCTATTGCATTCCGATTTAATCCGTGCCGTCCGAGTAT---CAAAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTCATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_B_4048 CCGAGAGA-GGGGC-TCTGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTTCCCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGTAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_B_6071 CCGAGAGA-GGGGC-TCTGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTTCCCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGTAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Oropogon_caespitosus_C_4044 CCGAGAGA-GGGGC-CCCGTGCCCC-CGGGGGCTCCGGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTTCGTTGCTTCGGCGTGGCCCCGGGGCCCGCCCCCGCGCCGGCCCCCGGCCGGTGAGCGCCCGCCAGAGGCCCAGTGGATTCTG-TTTCATCCGTGACGTCCGAGTATATATAATATCAAT--ATCAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCATATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTTATTACACCCCTCAAGCGTAGCTTGGTATTGGGTGCTCGCCCCCCGCGGGGGCGTGCCCGAAACTCAGTGGCGGTCCGGTGGGGCTTGAAGCGTAGTAAATTTT---TGTCCCGCTTGGAAGGCGCCCGCCGAGGCTGGCCAGATAAC--C----------------------------------AATTTGAAATCTGG-CCCCCCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAGTCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAATGGGTGGTATATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCCGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCTCC--GGGGAGTCTTAGAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAAGGCTTCCAGATCACGCATTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCAGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAACAAGTAATCACTGAATTGTCAATCTAGGCACTCTACGATATTTGTATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_caespitosus_C_4420 CCGAGAGA-GGGGC-CCCGTGCCCC-CGGGGGCTCCGGCCCCCGACTCT-TCCCCCGATGTCTATC-TACCTTCGTTGCTTCGGCGTGGCCCCGGGGCCCGCCCCCGCGCCGGCCCCCGGCCGGTGAGCGCCCGCCAGAGGCCCAGTGGATTCTG-TTTCATCCGTGACGTCCGAGTATATATAATATCAAT--ATCAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCATATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTTATTACACCCCTCAAGCGTAGCTTGGTATTGGGTGCTCGCCCCCCGCGGGGGCGTGCCCGAAACTCAGTGGCGGTCCGGTGGGGCTTGAAGCGTAGTAAATTTT---TGTCCCGCTTGGAAGGCGCCCGCCGAGGCTGGCCAGATAAC--CCCCC----GTCTCCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_C_6069 CCGAGAGA-GGGGC-CCCGTGCCCC-CGGGGGCTCCGG-CCCCGACTCT-TCCCCCGATGTCTACC-TACCTTCGTTGCTTCGGTGTGGCCCCGGGGCCCGCCCCCGCGCCGGCCCCCGGCCGGTGAGCGCCCGCCAGAGGCCCAGTTTATTCTG-TTTAATCCGTGACGTCCGAGTATATATAATATCAAT--ATCAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCATATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTTATTATACCCCTCAAGCGTAGCTTGGTATTGGGTGCTCGCCCCCCGCGGGGGCGTGCCCGAAACTCAGTGGCGGTCCGGTGGGGCTTTAAGCGTAGTAAATTTT---TGTCCCGCTTGGAAGGCGCCCGCCGAGGCTGGCCAGATAAC--CCCCC----GTCTCCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_caespitosus_C_6072 ---------------------------------------------------------------------------------------------------CGCCCCCGCGCCGGCCCCCGGCCGGTGAGCGCCCGCCAGAGGCCCAGTTTATTCTG-TTTCATCCGTGACGTCCGAGTATATATAATATCAAT--ATCAAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCATATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTTATTATACCCCTCAAGCGTAGCTTGGTATTGGGTGCTCGCCCCCCGCGGGGGCGTGCCCGAAACTCAGTGGCGGTCCGGTGGGGCTTGAAGCGTAGTAAATTTT---TGTCCCGCTTGGAAGGCGCCCGCCGAGGCTGGCCAGATAAC--CCCCC----GTCTCCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_granulosus_4049 -------------------------------------GCCCCGAACTCT-TCCCCCACTGTTTATCCTGCCTCCGTTGCTTTGGCGAG-CCCCGGGGCCCGTCCCCGCGCCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTACTGCATTCCGAT---ATCCGTGCCGTCCGAGT-CTTATACAAACAAT--AGT-TAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGGGCGGCCTCAAGCGTAGTAATTTCT---CATCCCGCTTCGAAGGTCCGCCCCGAGGCTGGCCAGACAAC--CCCCCCATCGTCTCC--------------------AATTTGAAATCTGG-CCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGTGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCCGTTCT-CGGCGGTGCACTCGTGCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTCGGCGGAATACGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTCTAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACAGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATCCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACGGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTGATCTTCACAAGGAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCGTCTTACGGAGATCTCAACCACCTTGTTTCTGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_granulosus_4050 -------------------------------------GCCCCGAACTCT-TCCCCCACTGTTTATCCTGCCTCCGTTGCTTTGGCGAG-CCCCGGGGCCCGTCCCCGCGCCGG-CCGCGCCCGGTGAGCGGCCGCCAGAGGCCTACTGCATTCCGAT---ATCCGTGCCGTCCGAGT-CTTATACAAACAAT--AGT-TAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGGGCGGCCTCAAGCGTAGTAATTTCT---CATCCCGCTTCGAAGGTCCGCCCCGAGGCTGGCCAGACAAC--CCCCCCATCGTCTCC--------------------AATTTGAAATCTGG-CCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCCTATAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCCGTTCT-CGGCGGTGCACTCGTGCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTCGGCGGAATACGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTCTAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACAGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATCCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACGGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTGATCTTCACAAGGAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCGTCTTACGGAGATCTCAACCACCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCTGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_granulosus_4051 --------------------------------------CCCCGAACTCT-TCCCCCACTGTTTATCCTGCCTCCGTTGCTTTGGCGAG-CCCCGGGGCCCGTCCCCGCGCCGG-CCGCGCCCGGTGAGCGGCCGCCAGAGGCCTACTGCATTCCGAT---ATCCGTGCCGTCCGAGT-CTTATACAAACAAT--AGT-TAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGGGCGGCCTCAAGCGTAGTAATTTCT---CATCCCGCTTCGAAGGTCCGCCCCGAGGCTGGCCAGACAAC--CCCCCCATCGTCTTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGTGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCCGTTCT-CGGCGGTGCACTCGTGCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTCGGCGGAATACGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTCTAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACAGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATCCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACGGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTGATCTTCACAAGGAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCGTCTTACGGAGATCTCAACCACCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCTGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_granulosus_4052 -------------------------------------GCCCCGAACTCT-TCCCCCACTGTTTATCCTGCCTCCGTTGCTTTGGCGAG-CCCCGGGGCCCGTCCCCGCGCCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTACTGCATTCCGAT---ATCCGTGCCGTCCGAGT-CTTATACAAACAAT--AGT-TAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCGGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGGGCGGCCTCAAGCGTAGTAATTTCT---CATCCCGCTTCGAAGGTCCGCCCCGAGGCTGGCCAGACAAC--CCCCCCATCGTCTCC--------------------AATTTGAAATCTGG-CCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGTCGCGGTCTAATTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCCGTTCT-CGGCGGTGCACTCGTGCCCCGATCAGGCCAGCATCGGTTCTGGCGGTCGGACAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTCGGCGGAATACGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTCTAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACAGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATCCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACGGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTGATCTTCACAAGGAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCGTCTTACGGAGATCTCAACCACCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_lopezii_4039 CCGAGAGACGGGGC-CCTGCG--CC-CGGGGGCTCCGGCCCCCGACCCTCCCCCCCGATGTTTACC-TACCTTCGTTGCTTCGGCGGGCCCCTGGGGTCTGACCCCCGCACCGGCCGCGCCCGGTGAGCGCCCGCCAGGGGCCTACTACATTCCGATTTTATCTGTGACGTCCGAGGAAATACACGAAATAG--AAC-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTCTTGGGCCTCTCGCCCCCGT---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAAATTTCTCATCTCCCGCTTTGAAGGTCCGCGCCGAGGCTGGCCAGACAAA--CCCCCCGT-CTTCTCCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_lopezii_4056 CCGAGAGACGGGGC-CCTGCGCCCC-CGGGGGCTCCGGCCCCCGACCCTCCCCCCCGATGTTTACC-TACCTTCGTTGCTTCGGCGGGCCCCTGGGGTCTGACCCCCGCACCGGCCGCGCCCGGTGAGCGCCCGCCAGGGGCCTACTACATTCCGATTTTATCTGTGACGTCCGAGGAAATACACGAAATAG--AAC-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTCTTGGGCCTCTCGCCCCCGT---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAAATTTCTCATCTCCCGCTTTGAAGGTCCGCGCCGAGGCTGGCCAGACAAA--CCCCCCGTCTTCTTCCACGATTGACCT-CGGATCA-------------------------------------------AGAGGGTGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGTGATCAGCCGCTGTTCTCCAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCTTTC--GGGGAGTCTTATAGCCCTGGACGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAGGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAGCTTTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAGATTCGCGAGGAGTTTCCAGATCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGTACTGAAACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCACCTGGTTTCCGCGGTCATGTCTGGTGTTACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_lopezii_4411 ----------------------------------------CCCGACCCTCCCCCCCGATGTTTACC-TACCTTCGTTGCTTCGGCGGGCCCCTGGGGTCTGACCCCCGCACCGGCCGCGCCCGGTGAGCGCCCGCCAGGGGCCTACTACATTCCGATTTTATCTGTGCCGTCCGAGGAAATACACGAAATAG--AAC-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTCTTGGGCCTCTCGCCCCCGT---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAAATTTCTCATCTCCCGCTTTGAAGGTCCGCGCCGAGGCTGGCCAGACAAA--CCCCCCGT-TTCTTCCACGATTGACCT-CAGATCA----------------------------------------------------------------CGCGGTATAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGTGACCGCGGCTCGAGCCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGTGATCAGCCGCTGTTCTCCAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_lorobic_4057 CCGAGAGA-CGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGCGTACCCTACCTTTGTTGCTTTGGCGGG-TCTCGGGGCTTGCTCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTATTACATTCCGATTA-ATCCGTGCCGTCCGAGTAT----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAGGATCGCCCCGAGACCGGCCAGACAAC--CCCAAATTT----TCCACGATTGACCT-CGGATCAAATTTGAAATCTGGCCCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GTCCCGGGAATGTAGCTCCCCTT--GGGGAGTCTTATATCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_lorobic_4058 CCGAGAGA-CGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCTCGGGGCTTGCTCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTATTACATTCCGATTA-ATCCGTGCCGTCCGAGTAT----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAGGATCGCCCCGAGACCGGCCAGACAAC--CCCAAATTT----TCCACGATTGACCTTCGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_lorobic_4413 CCGAGAGA-CGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCTCGGGGCTTGCTCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTATTACATTCCGATTA-ATCCGTGCCGTCCGAGTAT----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAGGATCGCCCCGAGACCGGCCAGACAAC--CCCAAATTT----TCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GTCCCGGGAATGTAGCTCCCCTT--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGATGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCGTAAGGATTAAGCACTGAAACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCGGTCATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_lorobic_4414 CCGAGAGA-CGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCTCGGGGCTTGCTCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCCTATTACATTCCGATTA-ATCCGTGCCGTCCGAGTAT----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAGGATCGCCCCGAGACCGGCCAGACAAC--CCCAAATTT----TCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GTCCCGGGAATGTAGCTCCCCTT--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCGTAAGGATTAAGCACTGAAACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCGGTCATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_loxensis_4059 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGGTTCCCGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGGGCCCGGGGGCCTTGTCCCCGCGTCGGCCCCCG-CCGGCGAGCGCCCGCCAGAGGCCCATTTAATTCTG-TTTTATCCGTGACGTCCGAGTATTTG---ACAATAT--A--AAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCGGGCGCGACTTTGAGCGTAGTAATTTTT---CG-CCCGCTCTGAAGGTCCGCGCCCAGGCTGGCCAGATAAC--CCCGT-GTCTTCTTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCCCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GGCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACAGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTCCCG Oropogon_loxensis_4060 ACGAGAGA-GGGGC-CCCGCGCCCC-CGGGGGTTCCCGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGGGCCCGGGGGCCTTGTCCCCGCGTCGGCCCCCG-CCGGCGAGCGCCCGCCAGATGCCCATTTAATTCTG-TTTTATCCGTGACGTCCGAGTATTTG---ACAATAT--A--AAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCGGGCGCGACTTTGAGCGTAGTAATTTTT---CG-CCCGCTCTGAAGGTCCGCGCCCAGGCTGGCCAGATAAC--CCCGT-GTCTTCTTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCCCCGGGGTTCGAGTTGTAATTTGCAGAGGGCGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAGGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GGCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACAGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTCCCG Oropogon_loxensis_4061 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGGTTCCCGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGGGCCCGGGGGCCTTGTCCCCGCGTCGGCCCCCG-CCGGCGAGCGCCCGCCAGAGGCCCATTTAATTCTG-TTTTATCCGTGACGTCCGAGTATTTG---ACAATAT--A--AAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCGGGCGCGACTTTGAGCGTAGTAATTTTT---CG-CCCGCTCTGAAGGTCCGCGCCCAGGCTGGCCAGATAAC--CCCGT-GTCTTCTTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCCCCGGGGTTCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GGCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACAGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTCCCG Oropogon_loxensis_4062 ACGAGAGA-GGGGC-CCCGCGCCCC-CGGGGGTTCCCGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGGGCCCGGGGGCCTTGTCCCCGCGTCGGCCCCCG-CCGGCGAGCGCCCGCCAGAGGCCCATTTAATTCTG-TTTTATCCGTGACGTCCGAGTATTTG---ACAATAT--A--AAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCGGGCGCGACTTTGAGCGTAGTAATTTTT---CG-CCCGCTCTGAAGGTCCGCGCCCAGGCTGGCCAGATAAC--CCCGT-GTCTTCTTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCCCCGGGGTTCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGGCGCGGTCTAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GGCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACAGAAGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTCCCG Oropogon_loxensis_4064 CCGAGAGA-GGGGC-CCCGCGCCCC-CGGGGGTTCCCGCCCCCGACTCT-TCCCCCGATGTCTACC-TACCTCCGTTGCTTCGGCGGGCCCGGGGGCCTTGTCCCCGCGTCGGCCCCCG-CCGGCGAGCGCCCGCCAGAGGCCCATTTAATTCTG-TTTTATCCGTGACGTCCGAGTATTTG---ACAATAT--A--AAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCCCTCG-CCCCCGT---GGCGTGCCCGAAACGCAGTGGCGGTCGGGCGCGACTTTGAGCGTAGTAATTTTT---CG-CCCGCTCTGAAGGTCCGCGCCCAGGCTGGCCAGATAAC--CCCGT-GTCTTCTTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCCCCGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTCGGGCGAGGGCGCGGTATAAGTCCATTGGAACATGGCGTCGGAGAGGGTGAGAATCCCGTATGCGACCGCGCGCCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAGGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCGTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCCCCGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GGCCGGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCCGGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCGAACTCTTCCGACCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAACAACTGGGCCAAGGGTCATTATACAGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCTAAAATTCGTGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCACAAGAAGTAAGCACTGAAACGTCAATCTAGGCACTCTACGATATTTGCATGCGCACGCTCAAGCTCCCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTCACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAGTTGGCCGTCAACATGGTCCCG Oropogon_mexicanus_4065 CCGAAAGA-GGGGC-TCCGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGGAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGCCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATCTTCGTAAGGATTAAGCACTGAAACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCGGTTATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAATATGGTGCCG Oropogon_mexicanus_4066 CCGAGAGA-GGGGC-TCCGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCTTCGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGGAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGCTCCTCGTGCTGTCCTTGTTGATGGGGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGCCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATTTTCGTAAGGATTAAGCACTGAAACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCCGTTATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAATATGGTGCCG Oropogon_mexicanus_4067 CCGAAAGA-GGGGC-TCCGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGGAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTCTAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTTGACCTTTCGGCCAACTCTTCCGGCCTGATAACTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCTAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGACCAGGTCCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGCCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGTATGGGTACGCTTTTGATTTCCAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCACCAATTGGTCGAGAACTCGGATGAGACCTTCTGTATCGACAACGAGGTTAGTCGAATGTGTAATTTTCGTAAGGATTAAGCACTGAAACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTGTCCAATCCATCTTACGGAGATCTCAACCACCTCGTTTCCGCCGTTATGTCTGGTGTCACTACTTGTCTACGTTTCCCTGGTCAACTTAACTCCGACCTACGCAAATTGGCCGTCAATATGGTGCCG Oropogon_mexicanus_4068 CCGAGAGA-GGGGC-TCCGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGGAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCATGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_mexicanus_4419 CGGAGAGA-GGGGCTTCCGCGCCCCCCGGGGGCTCCGGCCCTCGACTCTT-CCCCCTTTGCGTACCCTACCTTTGTTGCTTGGGCGGG-GCCCGGGGCTTGCCCCCGCACCGG-TCGCGCCCGGTGAGTGCCCGCCGGAGGCCTATTGCATTCCGATTTTATCCGTGCCGTCCGAGGAA---CAAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTTT---CATCCCGCTTTGAAAGATCGCCCCGAGGCCGGCCAGACAAC--CCCGAATTT---TTCCACGATTGACCT-CGGATCAAATTTGAAATCTGG-CCCCTTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGGTTGCGGTATAAGTCCATTGGAACATGGCGTCGTAGAGGGTGAGAATCCCGTATGCGACCGCGGACCGAG-CCCATGTGAAGCCTCCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGATCAGGCCAGCATCGGTTCCGGCGGTCGGACAAAG-------GCCCCGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCGGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oropogon_sperlingii_4069 CCGAGAGACGGGGC-TTCGCGCCCCGCGGGGGCTTCGGCCCCCGACTCT-TCCCCCATTGTTTACCTTACCTTCGTTGCTTTGGCGGG-CCCCGGGGCTC-TCCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCATATACATTCCGAAT---ATCCGTGACGTCCGAG--CACACAAAACAATA--AGT-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTCT---CATCCCGCTTTGAAGGCGCGCCCCGAGGCTGGCCAGACAAC--CCTCCAATCTTTTAC---AATTGACCT-CGGATCAAATTTGAAATCTGG-CCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGACCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGCTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAATTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTTCTCGATGTCGTACGTCGCGAAGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGAATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCATCAATTGGTCGAGAACTCGGACGAGACCTTTTGTATCGACAACGAGGTCAGTCGAATGTGTAATTTTCACAAGAAGTAAGCACTGATACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTGACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_sperlingii_4070 CCGAGAGACGGGGC-TTCGCGCCCCGCGGGGGCTTCGGCCCCCGACTCT-TCCCCCATTGTTTACCTTACCTTCGTTGCTTTGGCGGG-CCCCGGGGCTC-TCCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCATATACATTCCGAAT---ATCCGTGACGTCCGAG--CACACAAAACAATA--AGT-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTCT---CATCCCGCTTTGAAGGCGCGCCCCGAGGCTGGCCAGACAAC--CCTCCAATCTTTTAC---AATTGACCT-CGGATCAAATTTGAAATCTGG-CCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGACCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGCTCCTCGTGCTGTCCTTGTTGATCTTGAGCCTGGTACCATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAATTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTTCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGAATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCATCAATTGGTCGAGAACTCGGACGAGACCTTTTGTATCGACAACGAGGTCAGTCGAATGTGTAATTTTCACAAGAAGTAAGCACTGATACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTGACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_sperlingii_4071 CCGAGAGACGGGGC-TTCGCGCCCCGCGGGGGCTTCGTCCCCCAATT----------GTGTTTACCTTACCTTCGTTGCTTTGGCGGG-CCCCGGGGCTC-TCCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCATATACATTCCGAAT---ATCCGTGACGTCCGAG--CACACAAAACAATA--AGT-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTCT---CATCCCGCTTTGAAGGCGCGCCCCGAGGCTGGCCAGACAAC--CCTCCAATCTTTTAC---AATTGACCT-CGGATCAAATTTGAAATCTGG-CCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGACCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTCGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTTCCTCGTGCTGTCCTTGTTGATGATGAGCCTGGTATTATGGACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAATTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTTCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGAATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCATCAATTGGTCGAGAACTCGGACGAGACCTTTTGTATCGACAACGAGGTCAGTCGAATGTGTAATTTTCACAAGAAGTAAGCACTGATACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTGACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_sperlingii_4072 CCGAGAGACGGGGC-TTCGCGCCCCGCGGAGGCTTCGGCCCCCGACTCT-TCCCCCATTGTTTACCTTACCTTCGTTGCTTTGGCGGG-CCCCGGGGCTC-TCCCCGCACCGG-CCGCGCCCGGTGAGCGCCCGCCAGAGGCATATACATTCCGAAT---ATCCGTGACGTCCGAG--CACACAAAACAATA--AGT-AAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTGGCTTGGTATTGGGTCTTCG-CCCCCGC---GGCGGGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAATTTCT---CATCCCGCTTTGAAGGCGCGCCCCGAGGCTGGCCAGACAAC--CCTCCAATCTTTTAC---AATTGACCT-CGGATCAAATTTGAAATCTGG-CCCTTCCGGGGTCCGAGTTGTAATTTGTAGAGAGCGCTTCGGGCGAGGTCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGACCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTATATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGGGGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGTTCCCCGACCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAG-------GCCTTGGGAATGTAGCTCCCCTC--GGGGAGTCTTATAGCCCTCGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCC-------------------------------------------ACGCCGTCCGCGCTGGACCTTTCGGCCAACTCTTCCGACCTGATAATTTTGTCTTTGGTCAATCTGGGGCCGGTAATAACTGGGCCAAGGGTCATTATACTGAGGGTGCAGAATTGGTGGACCAGGTTCTCGATGTCGTACGTCGCGAGGCTGAAGGATGCGATTGTCTCCAGGGCTTCCAGATCACGCACTCTCTCGGTGGTGGAACTGGCGCTGGAATGGGTACGCTTTTGATTTCTAAAATTCGCGAGGAGTTTCCAGACCGCATGATGGCTACATTTTCGGTAGTCCCTTCACCAAAGGTATCCGACACTGTTGTGGAGCCATACAACGCTACTTTGTCCGTGCATCAATTGGTCGAGAACTCGGACGAGACCTTTTGTATCGACAACGAGGTCAGTCGAATGTGTAATTTTCACAAGAAGTAAGCACTGATACGTCAATCTAGGCGCTCTACGATATTTGCATGCGCACCCTCAAGCTCTCCAATCCATCTTACGGAGATCTCAACCATCTTGTTTCCGCGGTCATGTCTGGTGTGACCACTTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTACGCAAATTGGCCGTCAACATGGTGCCG Oropogon_sperlingii_GenBank_EF105414 CCGAGAGA-GGGGC-TCCGCG-CCCCCGGGGGCTTCGGCCCTCGACTCTT-CCCCCTCTGTGTACCCTACCTTTGTTGCTTTGGCGGG-CCCCGGGGCTTGCCCCCGCGCCGG-CTGCGCCCGGTGAGCGCCCGCCAGAGTCCCATTACATTCCGATT--ATCCGTGCCGTCCGAGTAC----CAAACACAAT-AG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGTCCTCG-CCCCCGC---GGCGTGCCCGAAAAGCAGTGGCGGTCCGGTGCGGCTTTAAGCGTAGTAA-TTTT---CATCCCGCTTTGAAAGTCCGCCCCGAGGCTGGCCAGACAACAACACCATTCT----TTCACGATTGACCT-CGGATCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Xanthoparmelia_coloradoensis_BRYC55151 CTGAGAGA-GGGGC-TTCGTG-CTCCCGGGGGTTTCGGCCCCTAACTCTT-CACCCTTTGCGTA-CCTACCTTTGTTGCTTTGGCGGG-CCCGAGAGTCCTCTCGCGCCGACT-CTTCGGCCGGCGAGTGTCCGTCAGAGGCCCATTTAAATTCTATTC-ATTAGAGACGTCTGAGTTC-----CAACACAATAAG-TAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTGTTGGGCCCTCG-CCCCCGC---GGCGTGCCCGAAAAACAGTGGCGGTCCGGTGTGACTTTGAGCGTAGTAA--TAT---CATCCCGCTCTAGAG--TACTCGCCGGGCCGGCCAAAGAAC--CCCATTTAC--------------------------AATTTGAAATCTGG-CTCCTTCGGGGTCCGAATTGTAATTTGTAGAGAGTGCTTCGGGCGAGACCTCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAG-CCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCT-CAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAG-------GCCTTGGGAATGTAGCTTCCCTTCGGGGAAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCCCTCGCGCTGTCCTTGTCGATCTTGAGCCCGGTACCATGGATGCCGTTCGCGCTGGTCCTTTTGGCCAGCTCTTCCGACCTGATAACTTCGTCTTTGGTCAATCTGGTGCTGGTAACAACTGGGCCAAGGGTCATTACACTGAGGGTGCAGAATTGGTGGATCAGGTCCTCGATGTTGTACGTCGCGAGGCTGAAGGATGCGACTGCCTTCAAGGGTTCCAGATCACGCACTCTCTCGGTGGTGGAACCGGTGCTGGTATGGGTACGCTCTTGATCTCGAAAATCCGTGAGGAGTTCCCAGACCGTATGATGGCTACATTCTCCGTGGTCCCTTCACCAAAGGTATCCGATACCGTTGTGGAGCCCTACAACGCTACTTTATCTGTGCATCAGTTGGTCGAGAACTCGGATGAGACTTTCTGTATTGATAACGAGGTCGGTCAAGTGCGTCGCTCCTAC-AGACTTGAGGACTGACACGTCAAACTAGGCGCTCTACGACATTTGCATGCGCACCCTCAAACTTTCCAACCCATCCTATGGAGACCTTAACCACCTGGTCTCCGCAGTCATGTCTGGTGTCACGACCTGTCTCCGTTTCCCTGGTCAACTCAACTCCGACCTCCGCAAATTGGCCGTCAATATGGTGCCA ; END; BEGIN TREES; TITLE RAxML_from_concatenated_SATe_alignment; LINK TAXA = Taxa1; TRANSLATE 1 Oropogon_americanus_4031, 2 Oropogon_americanus_4032, 3 Oropogon_americanus_4033, 4 Oropogon_americanus_4034, 5 Oropogon_atranorinus_4036, 6 Oropogon_atranorinus_4398, 7 Oropogon_atranorinus_4399, 8 Oropogon_atranorinus_4401, 9 Oropogon_bicolor_4040, 10 Oropogon_bicolor_4042, 11 Oropogon_bicolor_4043, 12 Oropogon_bicolor_4402, 13 Oropogon_bicolor_4403, 14 Oropogon_caespitosus_A_4046, 15 Oropogon_caespitosus_A_4047, 16 Oropogon_caespitosus_A_4405, 17 Oropogon_caespitosus_A_6054, 18 Oropogon_caespitosus_A_6064, 19 Oropogon_caespitosus_A_6068, 20 Oropogon_caespitosus_B_4048, 21 Oropogon_caespitosus_B_6071, 22 Oropogon_caespitosus_C_4044, 23 Oropogon_caespitosus_C_4420, 24 Oropogon_caespitosus_C_6069, 25 Oropogon_caespitosus_C_6072, 26 Oropogon_granulosus_4049, 27 Oropogon_granulosus_4050, 28 Oropogon_granulosus_4051, 29 Oropogon_granulosus_4052, 30 Oropogon_lopezii_4039, 31 Oropogon_lopezii_4056, 32 Oropogon_lopezii_4411, 33 Oropogon_lorobic_4057, 34 Oropogon_lorobic_4058, 35 Oropogon_lorobic_4413, 36 Oropogon_lorobic_4414, 37 Oropogon_loxensis_4059, 38 Oropogon_loxensis_4060, 39 Oropogon_loxensis_4061, 40 Oropogon_loxensis_4062, 41 Oropogon_loxensis_4064, 42 Oropogon_mexicanus_4065, 43 Oropogon_mexicanus_4066, 44 Oropogon_mexicanus_4067, 45 Oropogon_mexicanus_4068, 46 Oropogon_mexicanus_4419, 47 Oropogon_barbaticus_AY251435, 48 Oropogon_barbaticus_AY251451, 49 Oropogon_sperlingii_GenBank_EF105414, 50 Oropogon_sperlingii_4069, 51 Oropogon_sperlingii_4070, 52 Oropogon_sperlingii_4071, 53 Oropogon_sperlingii_4072, 54 Xanthoparmelia_coloradoensis_BRYC55151; TREE tree_1 = [&R] (54:0.45,(((1:1.53584404259471E-6,(3:1.53584404259471E-6,(2:0.0068197018037111454,4:0.004758662060842151):0.003179792042835905):0.003482540648593356):0.044423559891752264,(49:0.010547663146798534,((48:1.53584404259471E-6,47:1.53584404259471E-6):0.0028912468226245853,(((33:0.0015755419453674449,35:1.53584404259471E-6):6.652257604866657E-4,(34:1.53584404259471E-6,36:1.53584404259471E-6):0.001719731786321403):0.004941153842846082,((15:0.0011701990713244449,(14:0.004895102173792135,(16:5.949523447198976E-4,(18:1.53584404259471E-6,(19:1.53584404259471E-6,17:1.53584404259471E-6):0.0010734970491783795):0.0010731456308279348):4.41676818967704E-6):1.53584404259471E-6):0.003017094590518976,((20:1.53584404259471E-6,21:1.53584404259471E-6):0.0015367683256783454,(42:1.53584404259471E-6,(44:5.933195071070536E-4,(43:0.001792384295869976,(45:0.0010858439169192555,46:0.003202612031299374):1.53584404259471E-6):0.0017856459328687564):0.0011865270189479085):0.0016204539566859399):7.596655023643012E-4):0.010195632439309266):0.0053667107900698926):0.007625104722973536):0.00750525393989038):0.0013114063989062758,((52:0.005297152082641606,(53:5.998994078454914E-4,(51:1.53584404259471E-6,50:5.897351123913472E-4):9.365255406878887E-4):4.4862993796432993E-4):0.02754483048544407,((29:0.0020071999047160125,(26:0.0011347269522957748,(27:0.001389073157923316,28:0.0011153543109321908):0.0012492537677733033):1.53584404259471E-6):0.026847420861895416,((31:1.53584404259471E-6,(30:0.0031452108456073357,32:0.005626259753842858):1.53584404259471E-6):0.03189948805753407,((24:0.0018808432193819185,(25:1.53584404259471E-6,(22:1.53584404259471E-6,23:0.0010801130143499853):0.0026706121925404915):0.001032954073145962):0.02888483712003529,(((41:0.0018031785534626298,37:1.53584404259471E-6):1.53584404259471E-6,(39:1.53584404259471E-6,(40:0.0012008359821185156,38:0.00180636770341397):5.99595442460065E-4):5.984133624315716E-4):0.015485756646498778,((5:1.53584404259471E-6,(7:1.53584404259471E-6,(6:1.53584404259471E-6,8:1.53584404259471E-6):1.53584404259471E-6):0.002169323044171307):0.010358848693739599,((12:1.53584404259471E-6,9:1.53584404259471E-6):1.53584404259471E-6,(13:0.005525735424562314,(11:6.348715808281758E-4,10:6.147679234774693E-4):0.0028872932668822476):0.0014159186511793367):0.010470069167598893):0.002371697514202224):0.005682857543236306):0.014391705495267006):0.017660025729618847):0.0047116095487776165):0.005298336843460743):0.45); END;