#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 18:42 GMT TreeBASE (cc) 1994-2008 Study reference: Kaifuchi S., Nonaka K., Mori M., Shiomi K., Omura S., & Masuma R. 2012. Lecanicillium primulinum, a new hyphomycete (Cordycipitaceae) from soils in the Okinawa Main Island and the Bonin Islands, Japan. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12648] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=35; TAXLABELS Conoideocrella_luteorostrata Cordyceps_cardinalis Cordyceps_militaris Cordyceps_pseudomilitaris Lecanicillium_acerosum Lecanicillium_antillanum Lecanicillium_aphanocladii Lecanicillium_aranearum Lecanicillium_araneicola Lecanicillium_attenuatum Lecanicillium_dimorphum Lecanicillium_flavidum Lecanicillium_fungicola_aleophum Lecanicillium_fungicola_fungicola Lecanicillium_fusisporum Lecanicillium_kalimantanense Lecanicillium_lecanii Lecanicillium_longisporum Lecanicillium_muscarium Lecanicillium_nodulosum 'Lecanicillium primulinum FKI-6172' 'Lecanicillium primulinum FKI-6618' 'Lecanicillium primulinum FKI-6715' Lecanicillium_psalliotae Lecanicillium_saksenae Lecanicillium_sp._CBS_100890 Lecanicillium_sp._CBS_639.85 Lecanicillium_sp._NBRC104292 Lecanicillium_sp._NBRC104293 Lecanicillium_tenuipes Metacordyceps_chlamydosporia Simplicillium_lamellicola Simplicillium_lanosoniveum Simplicillium_obclavatum Torrubiella_wallacei ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=28; TAXLABELS Conoideocrella_luteorostrata Cordyceps_cardinalis Cordyceps_militaris Cordyceps_pseudomilitaris Lecanicillium_antillanum Lecanicillium_aranearum Lecanicillium_araneicola Lecanicillium_attenuatum Lecanicillium_dimorphum Lecanicillium_fusisporum Lecanicillium_kalimantanense Lecanicillium_lecanii Lecanicillium_longisporum 'Lecanicillium primulinum FKI-6172' 'Lecanicillium primulinum FKI-6618' 'Lecanicillium primulinum FKI-6715' Lecanicillium_psalliotae Lecanicillium_saksenae Lecanicillium_sp._CBS_639.85 Lecanicillium_sp._NBRC104292 Lecanicillium_sp._NBRC104293 Lecanicillium_tenuipes Metacordyceps_chlamydosporia Simplicillium_lamellicola Simplicillium_lanosoniveum Simplicillium_obclavatum Torrubiella_piperis Torrubiella_wallacei ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15800] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=590; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Conoideocrella_luteorostrata TCCCAAA-CCC--GTGTGAACTTATACCAT-----ACCGTTGCTTCGGCGGGCTTCGACGCCCGGGACCGCACCCGCACTCC----AGGCCCTC----GCC-GGACGCGGCAGGCCCCGGG-CGCGC-GCCCGCCGGAGGACCC----AAACTCTTCTGTATCTACGC---TACGC-ATGTCTGAGTG------GATTTA--ATAC-CAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCGC--------------TGC---TTGG-TGTTGGGGATCGGC-CTGAAGGA-------------------------------GCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCAGCGTCCTCTGCGTAGTAACATACCACCTCGCAGCAAGGA-GCGCGGCGCGCCCACTGCCGTAAAATTCGCCAGTGATGGCTTCTAGA- Cordyceps_cardinalis TCCCAAAACCC-AATGTGAAC--ATACC-TTC-----AGTTGCTTCGGCGGACT--------------CGCCCCAGCG-TCCGGA-CGGCCTCGC---GCC-GCCCGCGG----CCTGGAGCCAGGC-GGCCGCCGGAGACCCC----AAACTCTCT-GTAT-TGTA----CAGTC-TCTTCTGAATCCGCCGCAAGGCA--CTAT-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCC---CCCTT-----GGGGAGCCCGG-CGTTGGGGACCGGC-AGCA-------------CACC------------------GCCGCCCCCGAAATACAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGT--ACATC-ACCTCGCACTGG-AG-ACCCGGGGCGCCCAC-GCCGAAAAACACCCAAC------TTTCTGAAC Cordyceps_militaris TCCCA-A-CCC-TTTGTGAAC--ATACC-TAT-----CGTTGCTTCGGCGGACT--------------CGC-CCAGCG-CCTGGA--------------------CGCGGG---CCTGGGC---GGC-GGCCGTCGGGGGCCCC----AAACAC---TGTATCTAC-----CAGT--TTTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTC---CCCTG-----GGGGATGTCGG-CGTTGGGGACCGGC-AGCA-------------CACC------------------GCCGCCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTACCCCA--A-CTCGCACCGG-GA-ACCCGACGTGGCCAC-GCCGTAAAACGCCCAAC--------TCTGAAC Cordyceps_pseudomilitaris TCCCAAA-CCCAAATGTGAAC--ATACC-TCTC----AGTTGCTTCGGCGGACT--------------CGCCCCAGCG-TCCGGATCGGCCCTGT---GCC-GTCCGCGG----CCTGGAGCCAGGC-GGCCGCCGGAGACCAT----AAACTCTTCTGTATTGAC-----CAGTC-TCTTCTGAATCCGCCGCAAGGCA--CTAT-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCCTT-----GGGGAGCCCGG-CGTTGGGGACCGGC-AGCA-------------TACC------------------GCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAAACATC-ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAAC Lecanicillium_acerosum TCCCACA-CCC-CCTGTGAAC--ATACC-TAC-----CGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCCTGT---GCT-GGCCGCGG----CCCGGAACCAAGGTGGCCGCCGGGGAAACCC--AAAACTGTCA-GTAT-TAT-----CAGCT-TTTTCTGAATCCGCCGCAAGGCA--ACAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCCTT-----GGGGAGGTCGGTCGTTGGAGATCGGC-ACC---------------ACT------------------GCCGGCTCCCAAATTCAGTGGCGACCCG-CCGTGGCGACCTCTGCGTAGTAGCTAAC-A-CTCGCACCGG-GA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCGAC------TTTCTGAAG Lecanicillium_antillanum TCCCAAA-CCCAAATGTGAAC--ATACC-AAAC----TGTTGCTTCGGCGGACT--------------CGCCCCAGCG-TCCGGACCGGCCTCGC---GCCGGCCCGCGG----CCTGGATCCAGGC-GGCCGCCGGGGAAAACCAAAAAACTCTTT-GTATCTTT-----GTATA-TCTTCTGAGCACGCCGCAAGGCAA-AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCATTCTGCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCTTT-----GGGGAGCACGG-TGTTGGGGACCGGC-AGCA-------------CACTGA----------------GCCGACCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCATC-ACCTCGCACCGG-GA-ACCCGACGTGGCCAC-GCCTTGAAACAACCCAA------TTTCTGAAC Lecanicillium_aphanocladii TCCCAAA-CCCTTATGTGAAC--ATACC-ACGA----TGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTAGC---GCC-GCCCGCGG----CCCGGATCCAGGC-GGCCGCCGGAGACCACC--AAAACTATTTTGTAT-CAG-----CAGTT-TTTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAATCGG-CGTTGGGGACTGGC-AGCA-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCCAC------TTTCTGAAC Lecanicillium_aranearum TCCCAAA-CCCAAATGTGAAC--ATACC-AAT-----CGTTGCTTCGGCGGACC--------------CGTCCCGGCG-TCCGGA-CGGCCCTACGGGGCC-GCCCGCGG----CCCGGACCCAGGC-GACCGCCGGGGGCCCAACCCAAACTTTTT-GTAT-TCT-----GAATC-TCTTCTGAATCCGCCGCAAGGCA--ACAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCCTT-----GGGGAGCCCGG-CGTTGGGGATCGGC-AGC---------------ACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGT-ACAACC-A-CTCGCTCTGG-AA-CCCCGACGCGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAAC Lecanicillium_araneicola TCCCAAAACCCAAATGTGAAC--ATACC-AAT-----CGTTGCTTCGGCGGACC--------------CGTCCCGGCG-TCCGGA-TGGCCCTGTGGGGCC-GTCCGCGG----CCCGGACCCAGGC-GGCCGCCGGGGACCCAACCAAAACTTTTT-GTAT-TCT-----CAGTT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCTTT-----GGGGAGCCCGG-CGTTGGGGATCGGC-TGT---------------ACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAACAACC-A-CTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCCAC------TTTCTGAAC Lecanicillium_attenuatum TCCCAAA-CCCTTATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTCGC---GCC-GCCCGCGG----CCCGGACCCAGGC-GGCCGCCGGAGACCCCC---AAACTCT---GTAT-TAT-----CAGCA-TTTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAATCGG-CGTTGGGGAACGGC-AGCA-------------TACC------------------GCCGGCCCCGAAATGAAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--A-CTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCAAC-------TTCTGAAC Lecanicillium_dimorphum TCCCAAA-CCCTTATGTGAAC--ATACC-ATAA----TGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTAGC---GCC-GCCCGCGG----CCCGGACCCAGGC-GGCCGCCGGAGACCACC--AAAACTATTTTGTAT-CAG-----CAGTT-TTTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAATCGG-CGTTGGGGACTGGC-AGCA-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCCAC------TTTCTGAAC Lecanicillium_flavidum TCCCAAA-CCCAAATGTGAAC--ATACC-AAT-----CGTTGCTTCGGCGGACT--------------CGTCCCGGCG-TCCGGG-TGGCCTTGT---GCT-GCCCGCGG----CCCGGATCCAGGC-GGCCGCCGGAGACCATC---AAACCCTTT-GTAT-TAT-----ACGTA-TCATCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCTTT-----GGGGAGCCCGG-CGTTGGGGACCGGC-AGC--------------TACC------------------GCCGACCCCGAAATACAGTGGCGGCCCG-TCACGGCGACCTCTGCGTAGTAATCCA--ACCTCGCACCGG-GA-ACCCGACGCGGCCAC-GCCGTAAAACACCCCAA-------TTCTGAAC Lecanicillium_fungicola_aleophum TCCCAAA-CCCAAATGTGAAC--ATACC-AAT-----CGTTGCTTCGGCGGACT--------------CGTCCCAGCG-TCCGGG-TGGCCTTGC---GCC-GCCCGCGG----CCTGGAACCAGGC-GACCGCCGGAGGCCATT--CAAACTCTTT-GTAT-TAC-----CAGTA-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCCTT-----GGGGAGCCCGG-CGTTGGGGACCGGC-CTC--------------TACC------------------GCCGACCCCGAAATACAGTGGCGGCCCCGTCACGGCGACCTCTGCGTAGTAACTCA--ACCTCGCACCGG-AA-ACCCGACGTGGCCAC-GCCGTAAAACACCCCAC-------TTCTGAAC Lecanicillium_fungicola_fungicola TCCCAAA-CCCAAATGTGAAC--ATACC-AAT-----CGTTGCTTCGGCGGACT--------------CGTCCCGGCG-TCCGGG-TGGCCTTGC---GCT-GCCCGCGG----CCCGGATCCAGGC-GGCCGCCGGAGGCCATC---AAACTCTTT-GTAT-TAC-----CAGTA-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCTTT-----GGGGAGCCCGG-CGTTGGGGACCGGC-CTC--------------TACC------------------GCCGCCCCCGAAATACAGTGGCGGCCCCGTCACGGCGACCTCTGCGTAGTAACTCA--ACCTCGCACCGG-AA-ACCCGACGTGGCCAC-GCCGTAAAACACCCCAC-------TTCTGAAC Lecanicillium_fusisporum TCCCAAA-CCC-TATGTGAAC--ATACC-TAT-----TGTTGCTTCGGCGGACC--------------CGCCCCGGCG-TCCGGA-CGACCTAGC---GTC-GCCCGCGG----CCCGGGCTCAGGC-GGCCGCCGGAGACCACC---AAACTCTTT-GTAT-TAT-----GAGAA-TCTTCTGAATTCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAATCGG-TGTTGGGGATCGGC-AGCAC------------TA--------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAACTCA--ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAAC Lecanicillium_kalimantanense TCCCAAA-CCC--ATGTGAAC--ATACC-ATTA----TGTTGCTTCGGCGGAGC--------------CGCCCCGGCG-CCCGGAACGA---------GAG-TTTCGCGG----CCCGGAACCAGGC-GCCCGCCGGAGGCCAC----AAACTCTTCTGTTT-TTA-----CAGTA-TCTTCTGAACGTGCCGCAAGGCAACAAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCC---CCCTT-----GGGGGGCCCGG-CGTTGGGGACCGGC-ACTAA------------CACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAACTCA--ACCTCGCATCGG-GA-CCCGGGCGCGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAAC Lecanicillium_lecanii TCCCAAA-CCCTTCTGTGAAC--ATACC-TAC-----CGTTGCTTCGGCGGACT--------------CGC-CCGGCG-TCCGGA-CG----------------------------CGGACCCAGGC-GGCCGCCGGAGACCCCC---AAACTC---TGTAT-TAT-----CAGCA-TCTTCTGAATTCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTC---CCCTC-----GGGGAAGTCGG-CGTTGGGGAACGGC-AGCA-------------CACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--A-CTCGCACCGG-AA-ACCCGACGCGGCCAC-GCCGTAAAACACCCAAC-------TTCTGAAC Lecanicillium_longisporum TCCCAAA-CCCTTCTGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTCGC---GCC-GCCCGCGG----CCCGGACCCAGGC-GGCCGCCGGAGACCCCC---AAACTCT---GTAT-CAT-----GAGCA-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTCT-----GGGGAAATCGG-CGTTGGGGAACGGC-AGCA-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--A-CTCGCACCGG-AA-CCCCGACGCGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAAC Lecanicillium_muscarium TCCCAAA-CCCTTATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTCGC---GCC-GCCCGCGG----CCCGGACCCAGGC-GGCCGCCGGAGACCTCT---AAACTCT---GTAT-TAT-----CAGCA-TTTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAATCGG-CGTTGGGGAACGGC-AGCA-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--A-CTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCAAC-------TTCTGAAC Lecanicillium_nodulosum CCCCA-A-CCC-TTTGTGAAC--ATACC-TAT-----CGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGG-CGGCCC---TGCGCC-GCTCGCGA----CCCGGATCCAGGC-GGCCGCCGGGGACCCT----AAACTC---TGTATTCTT----CGAACCATCTTCTGAATCCGCCGCAAGGCA--ACAC-AAATAAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCACCCCTCGACCCC--GCGTTT-----AGCGGAGTCGG-CGTTGGGGGACGGC-ACTA-------------CCCC------------------GCCGCCCCCGAAACGAATCGGCGGCCCGTCCGCGGCGACATCTGCGTAGTAACTCA--G-CGCGCACCGG-AACCCCCGACGCGGCCAC-GCCGTAAAACACCCAAC--------TCTGAAC 'Lecanicillium primulinum FKI-6172' TCCCAAA-CCCACATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCTCGT---GCT-GGTCGCGG----CCCGGAACCAGGT-GGCCGCCGGAGAAAACCAAAAAACTCTTT-GTAT-TAT-----CAGCT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAGTCGGCCGTTGGAGATCGGC-AGC---------------ACT------------------GCCGGCTCCCAAATCCAGTGGCGACCCG-CCGCGGGGACCCCTGCGTAGTAACTAAC-A-CTCGCACCGG-AA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCCAC------TTTCTGAAC 'Lecanicillium primulinum FKI-6618' TCCCAAA-CCCACATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCTCGT---GCT-GGTCGCGG----CCCGGAACCAGGT-GGCCGCCGGAGAAAACCAAAAAACTCTTT-GTAT-TAT-----CAGCT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAGTCGGCCGTTGGAGATCGGC-AGC---------------ACT------------------GCCGGCTCCCAAATCCAGTGGCGACCCG-CCGCGGGGACCCCTGCGTAGTAACTAAC-A-CTCGCACCGG-AA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCCAC------TTTCTGAAC 'Lecanicillium primulinum FKI-6715' TCCCAAA-CCCACATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCTCGT---GCT-GGTCGCGG----CCCGGAACCAGGT-GGCCGCCGGAGAAAACCAAAAAACTCTTT-GTAT-TAT-----CAGCT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAGTCGGCCGTTGGAGATCGGC-AGC---------------ACT------------------GCCGGCTCCCAAATCCAGTGGCGACCCG-CCGCGGGGACCCCTGCGTAGTAACTAAC-A-CTCGCACCGG-AA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCCAC------TTTCTGAAC Lecanicillium_psalliotae TCCCAAA-CCC-TATGTGAAC--ATACC-TAC-----AGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTAGC---GCC-GCCCGCGG----CCCGGATCCAGGC-GGCCGCCGGAGACCACC---AAACTCTTT-GTAT-TAT-----CAGTG-TATTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTC---CCCTT-----GGGGAAGTCGG-CGTTGGGGACCGGC-AGTA-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACCCCCAAC------TTTCTGAAC Lecanicillium_saksenae TCCCAAA-CCCTTATGTGAAC--ATACC-TATA----TGTTGCTTCGGCGGACT--------------CGCCCCGGCG-TCCGGA-CGGCCTAGC---GCC-GCCCGCGG----CCCGGACTCAGGC-GGCCGCCGGAGACCTAC--CAAACTCTTTTGTAT-CAT-----GAGTA-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTC---CCTTT-----GGGGAAATCGG-CGTTGGGGACCGGC-AGCA-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATCCA--ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCCAC------TTTCTGAAC Lecanicillium_sp._CBS_100890 TCCCAAA-CCCCAATGTGAAC--ATACC-TCT-----TGTTGCTTCGGCGGACC--------------CGCCCCGGCG-TCCGGA-AGGCCCCACACGGCC-CTCCGCGG----CCCGGACCCAGGC-GGCCGCCGGAGACCAAACCAAAACTATT--GTAT-TAT-----CAGTT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCTTT-----GGGGAGCCCGG-CGTTGGGGACCGGC-AGCT-------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAACTTAC-ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCAAC-------TTTTGAAC Lecanicillium_sp._CBS_639.85 TCCCAAA-CCCAAATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCTCGT---GCT-GGTCGCGG----CCCGGAACCAGGT-GGCCGCCGGAGAAAACC--AAAACTCTTT-GTAT-TAT-----CAGCT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGATTTC---CCTTT-----GGGGAAGTCGGCCGTTGGGGATCGGC-AGC---------------ACT------------------GCCGGCTCCCAAATACAGTGGCGACCCG-CCGCGGGGACCCCTGCGTAGTAACTTAC-A-CTCGCACCGG-AA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCAAC------TTTCTGAAC Lecanicillium_sp._NBRC104292 TCCCAAA-CCCAAATGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCTCGT---GCT-GGTCGCGG----CCCGGAACCAGGT-GGCCGCCGGAGAAAACC--AAAACTCTTT-GTAT-TAT-----CAGCT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGATTTC---CCTTT-----GGGGAAGTCGGCCGTTGGAGATCGGC-AGC---------------ACT------------------GCCGGCTCCCAAATACAGTGGCGACCCG-CCGCGGGGACCCCTGCGTAGTAACTTAC-A-CTCGCACCGG-AA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCAAC------TTTCTGAAC Lecanicillium_sp._NBRC104293 TCCCAAA-CCCAATTGTGAAC--ATACC-TAC-----TGTTGCTTCGGCGTGCT--------------CGCCCCGGCG-TCCGGC-TGGCCTCGT---GCT-GGTCGCGG----CCCGGAACCAGGT-GGCCGCCGGAGAAAACC--AAAACTCTTT-GTAT-TAT-----CAGCT-TCTTCTGAATCCGCCGCAAGGCA--AAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGGAGCATTCTCCCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGATTTC---CCTTT-----GGGGAAGTCGGCCGTTGGAGATCGGC-AGC---------------ACT------------------GCCGGCTCCCAAATACAGTGGCGACCCG-CCGCGGGGACCCCTGCGTAGTAACTTAC-A-CTCGCACCGG-AA-ACCAGACGTG-TCAC-GCCGTAAAACCCCCAAC------TTTCTGAAC Lecanicillium_tenuipes TCCCAAA-CCCTTATGTGAAC--ATACC-TTT-----AGTTGCTTCGGCGGACT--------------CGCCCCGGTG-TCCGGA-CGGCCC--TCGTGCC-GGCCGCGA----CCCGGATCCAGGC-GGACGCCGGAGACCATCT-CAAACTCTT-TGTATCCAAT---ACAG---TCTTCTGAATAAGCCGCAAGGCA--AAAC-AAATGAAT-AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC---CCTTT-----GGGGAGCCCGG-CGTTGGGG-TCGGC-AGC--------------TACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATTTC--ACCTCGCACCGG-AA-CCCCGACGTGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAAC Metacordyceps_chlamydosporia TCCCAAA-CCC-CATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTC------------TCGCCCCGG----------------------GCT-TTACAC------CCCGGAACCAGGCGGCCCGCCGGGGGACCC----AAACTCTAG-ATTTATATTT---TAGCA--TGTCTGAGTG------GAATCA--TTACAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCC-------------CAGCGGTTTGG-TGTTGGGGACCGGCGAGTACAGAGGCTTTGGGGACTTGTCCCCCTTCCCTCGGCGCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCGGCCTCCTCTGCGTAGTAGCACA--ACCTCGCATCAG-GA-GCGCGACGCGGCCACTGCCGTAAAACGCCCAACT-----TTTTTTAAG Simplicillium_lamellicola TCCCAAA-CCC-TTTGTGAAC-CTTACCACTTA----CGTTGCTTCGACGGAA---------------CGCGCTGGTG-TC-----------------GCC--CTCACGGGTGCCCCAGGTCAACGC-GCCCGCCGGAGACCAT----AAACTCTT-GATTT-TGCGAAAGCAGTATTCTTCTGAGTG-GCCGAAAGGCAAAAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACTTCACGTCTTTACGGACGAGAAGCCGG-TGTTGGGGCGCGGCGATCGAG-----CCTAG-CTCGC-----------------GCCGGCTCCGAAATTTAGTGGCGGCCCG-TTGCGGCGACCTCTGCGTAGTAACTTA--ACCTCGCACTGG-GA-CAGCAGCGCGGCCAC-GCCGTAAAACCCCCGAC-----TTTTTTTAAG Simplicillium_lanosoniveum TCCCA-A-CCC-TATGTGAAC--CTACC-TTTA----TGTTGCTTCGGCGGTCT--------------CGCGCCGGGT-T------------------GCT-CCCTTGGGGGCTCCCGGGACCACGC-GTCCGCCGGAGACCAA----AAACTCTT-GATTT-TGCGAAAGCAGTATTATTCTGAGTG-GCCGAAAGGCAAAAAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC--GTCTTCATTGACGAGA--TCGG-TGTTGGGACCCGGCGAGCGGGGA--CTCTTG--TCCCCT---------------GCCGGCCCCGAAATTCAGTGGCGGCCCG-TTGCGGCGACCTCTGCGTAGTAACTTA--ACCTCGCACCGGTAA-CAGCATCGTGGCCAC-GCCGTAAAACCCCCGAC------TTTTTTAAG Simplicillium_obclavatum TCCCA-A-CCC-TTTGTGAAC--CTACC-TTTA----TGTTGCTTCGGCGGTGA--------------CGCGCCGGGT-T------------------GCTCCCTCAGGGAGCTCCCGGGACCACGC-GCCCGCCGGAGACCAC----AAACTCTT-GATTT-TGCGAAAGCAGTATTCTTCTGAGTG-GCCGAAAGGCAAAAAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCTC--GTCTTCATTGACGAGA--TCGG-TGTTGGGACCCGGCGATCGGGGA--CTTTAG-TTCCCCT---------------GCCGGTCCCGAAATTCAGTGGCGGCCCG-TTGCGGCGACCTCTGCGTAGTAACTTA--ACCTCGCACTGG-GA-CAGCAGCGCGGCCAC-GCCGTAAAACCCCCGAC-----TTTTTTTAAG Torrubiella_wallacei TCCCA-A-CCC--ATGTG-AC--ATACC-ATTA----TGTTGCTTCGGCGGAGC--------------CGCCCCGGCGCCCCGTTACGA---------GAG-TTTCGCGG----CCCGGAACCAGGC-GCCCGCCGGAGGCCAC----AAACTCTTCTGTTT-TTA-----CAGTA-TCTTCTGAACGTGCCGCAAGGCAACAAAC-AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCC---CCCTT-----GGGGGGCCCGG-CGTTGGGGACCGGC-ACTAA------------CACC------------------GCCGGCCCCGAAATGGAGTGGCGGCCCGTCCCCGGCGACCTCTGCGTAGTAACTCA--ACCTCGCATCGG-GA-CCCGGGCGCGGCCAC-GCCGTAAAACACCCAAC------TTTCTGAGC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15801] TITLE D1D2; LINK TAXA = Taxa2; DIMENSIONS NCHAR=571; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Conoideocrella_luteorostrata TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCCCAGGCCAGCATCAGTTTGCCTCGGGGGATAAAGGCTCTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCACAATGCCCTGGGGCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGGCCCGTCTTGAAACACGGACC Cordyceps_cardinalis TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCGCGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGGCCCGGTGAATCATCTAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTCGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCACTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCATC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Cordyceps_militaris TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCC-GGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCACCCAGCGTTCTCGCTGGTGCACTTCGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCGTTGCGCAATACCCTGCGCTGGACTGAGGTACGCGCATTCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Cordyceps_pseudomilitaris TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGTCCCCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTCTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCACTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_antillanum TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGTCCCCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGACTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATCGTGCAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_aranearum TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGCGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGACAAAGGCGTTGGGAATGTGGCTCCCCCGGGAGTGTTATAGCCCATCGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_araneicola TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGTCCCCAAGGCCCGAATTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGAC------------------- Lecanicillium_attenuatum -----------------------------------------------TCTGGCCCTT-GGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATA?AGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_dimorphum --------------------------------------------------GGCCCTC-GGGTCCGAATTG?AATTTGTAGAGGATACTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATA?AGGGTGAGAGCCCCGTCTGGTCGGATACCAAGCCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCATTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_fusisporum TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGTCCCCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCGCGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATTTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_kalimantanense TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGTACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGTTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGC----------------------------------------- Lecanicillium_lecanii TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCCCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCACTGCGCAATACCCTGCGCCGGACTGAGGCACGCGCATC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_longisporum ------------------------------------------------------------------------------AGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATA?AGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGCTCTGGGAATGTGGCTCCTCCGGGAGTGTTATAGCCCACTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC 'Lecanicillium primulinum FKI-6172' TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC 'Lecanicillium primulinum FKI-6618' TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC 'Lecanicillium primulinum FKI-6715' TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_psalliotae -------------------------------------------------------------------------------------------------GTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATA?AGGGTGAGAGCCCCGTCTGGTCGGATACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAACCCATTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATC-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_saksenae --------------------------------------------------GGCCTTC-GGG-CCGAGTTGTAATTTGTAGAGGATACTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCAAGCCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_sp._CBS_639.85 ------------------------------------------TGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Lecanicillium_sp._NBRC104292 TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGAC------------------- Lecanicillium_sp._NBRC104293 TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGAC------------------- Lecanicillium_tenuipes TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGTCCCCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGCGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCC?CGTCTGGTCGGATACCTAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGTGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Metacordyceps_chlamydosporia TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGACCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCTCAGGCCAGCATCAGTTTGCCTCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCACAATACCCTGGGGCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGTGACCCGTCTTGAAACACGGACC Simplicillium_lamellicola ------------------------------------AAA-TTTGAAATCTGGCTCCTAGAGTCCGAATTGTAATTTGCAGAGGATGCTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAATCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGCCTTGGGGGAAAAAGGCTTTGGGAATGTAGCTCCCTCGGGAGTGTTATAGACCATTGCACAATACCCTGGGGCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Simplicillium_lanosoniveum ------------------------------------AAA-TTTGAAATCTGGCTCCTAGAGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAATCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGG-GAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGTCTTGGGGGAAAAAGGCTTTGGGAACGTGGCTCCTTCGGGAGTGTTATAGACCATTGCATAATACCCTGGGACGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Simplicillium_obclavatum TTG-CCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTTGAAATCTGGCTCCCAGAGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAATCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGTCTTGGGGGAAAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGACCATTGCATAATACCCTGGGACGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Torrubiella_piperis TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCTC-GGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGCGAGGTGCCTTCCGAGTTCCCTGGAAC-GGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGCGTTGGGAACGTGGCTCCCCCGGGAGTGTTATAGCCCATCGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC Torrubiella_wallacei TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAA-TTTGAAATCTGGCCCCTAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGAAC-GGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGATGCCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGATAAAGGTTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATT-GCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAAACACGGACC ; END; BEGIN TREES; TITLE Fig.2; LINK TAXA = Taxa1; TRANSLATE 1 Simplicillium_lanosoniveum, 2 Simplicillium_obclavatum, 3 Simplicillium_lamellicola, 4 Torrubiella_wallacei, 5 Lecanicillium_kalimantanense, 6 Lecanicillium_tenuipes, 7 Lecanicillium_nodulosum, 8 Lecanicillium_lecanii, 9 Cordyceps_militaris, 10 Lecanicillium_aphanocladii, 11 Lecanicillium_dimorphum, 12 Lecanicillium_fusisporum, 13 Lecanicillium_saksenae, 14 Lecanicillium_attenuatum, 15 Lecanicillium_muscarium, 16 Lecanicillium_longisporum, 17 Lecanicillium_psalliotae, 18 Lecanicillium_aranearum, 19 Lecanicillium_araneicola, 20 Lecanicillium_sp._CBS_100890, 21 Cordyceps_cardinalis, 22 Cordyceps_pseudomilitaris, 23 'Lecanicillium primulinum FKI-6618', 24 'Lecanicillium primulinum FKI-6715', 25 Lecanicillium_sp._NBRC104292, 26 Lecanicillium_sp._NBRC104293, 27 Lecanicillium_sp._CBS_639.85, 28 'Lecanicillium primulinum FKI-6172', 29 Lecanicillium_acerosum, 30 Lecanicillium_antillanum, 31 Lecanicillium_fungicola_fungicola, 32 Lecanicillium_fungicola_aleophum, 33 Lecanicillium_flavidum, 34 Metacordyceps_chlamydosporia, 35 Conoideocrella_luteorostrata; TREE Fig._2 = [&R] ((34:0.03771,35:0.28329):0.14453,((3:0.07759,(2:0.00924,1:0.04129)75:0.03524)100:0.15753,((4:0.01436,5:0.0)100:0.07035,(6:0.04682,((((21:0.07748,22:0.0134)94:0.0447,(20:0.03335,(18:0.04487,19:0.01015)96:0.03559)50:0.01803)23:0.01538,((33:0.02476,(31:0.00241,32:0.02009)85:0.02097)80:0.03921,(30:0.08781,(27:0.0,(25:0.0,(26:0.00262,(29:0.08533,(24:0.0,(28:0.0,23:0.0)22:0.0)39:0.0)64:0.0135)23:0.0)55:0.00261)100:0.11037)49:0.02479)14:0.00709)21:0.01271,(17:0.02341,((12:0.02903,13:0.012)51:0.00728,((10:0.00793,11:0.0)99:0.02885,((15:0.00539,14:0.00279)47:0.00212,(16:0.0084,(7:0.14741,(8:0.0,9:0.09774)50:0.01222)45:0.01681)39:0.00633)47:0.01372)6:0.0)18:0.00463)40:0.02214)19:0.00729)50:0.05374)61:0.05512):0.08423)100; END; BEGIN TREES; TITLE Fig.1; LINK TAXA = Taxa2; TRANSLATE 1 'Lecanicillium primulinum FKI-6172', 2 'Lecanicillium primulinum FKI-6618', 3 'Lecanicillium primulinum FKI-6715', 4 Lecanicillium_sp._NBRC104292, 5 Lecanicillium_sp._CBS_639.85, 6 Lecanicillium_sp._NBRC104293, 7 Lecanicillium_lecanii, 8 Lecanicillium_longisporum, 9 Lecanicillium_saksenae, 10 Lecanicillium_aranearum, 11 Lecanicillium_araneicola, 12 Lecanicillium_antillanum, 13 Lecanicillium_dimorphum, 14 Lecanicillium_fusisporum, 15 Lecanicillium_attenuatum, 16 Lecanicillium_psalliotae, 17 Lecanicillium_tenuipes, 18 Lecanicillium_kalimantanense, 19 Torrubiella_wallacei, 20 Cordyceps_militaris, 21 Cordyceps_pseudomilitaris, 22 Cordyceps_cardinalis, 23 Torrubiella_piperis, 24 Simplicillium_lanosoniveum, 25 Simplicillium_obclavatum, 26 Simplicillium_lamellicola, 27 Metacordyceps_chlamydosporia, 28 Conoideocrella_luteorostrata; TREE Fig._1 = [&R] ((28:0.05725,27:0.01996):0.05268,((26:0.02744,(24:0.01736,25:0.01366)60:0.01751)93:0.07441,((((9:0.01056,13:0.01614)74:0.01839,((17:0.00635,(21:0.01171,22:0.05024)76:0.02265)42:0.01228,(12:0.02055,((10:0.0371,14:0.0)37:0.01009,(11:0.00959,16:0.01281)1:3.7E-4)14:0.00572)26:0.00192)25:0.0118)28:0.0,((23:0.03772,(8:0.02192,20:0.03457)43:0.00803)25:0.00398,(7:0.02805,15:0.02341)27:0.0)12:0.01398)18:0.01258,(((18:0.00512,19:0.0)100:0.03749,(6:0.0,(4:0.0,5:0.0)39:0.0)77:0.0)23:0.0,(3:0.0,(1:0.0,2:0.0)15:0.0)58:0.00494)77:0.01567)92:0.06067):0.00277)99; END;