#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 28, 2021; 13:43 GMT TreeBASE (cc) 1994-2008 Study reference: Shirouzu T., Ishikawa N.K., Hirose D., & Maekawa N. 2013. A new Amazonian species of Calocera with dendroid and multi-headed basidiocarp. Mycoscience, 54: 252-256. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12760] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=102; TAXLABELS Calocera_arborea_TSBR004 Calocera_arborea_TSBR005 Calocera_cornea_AB299068 Calocera_cornea_AB299076 Calocera_cornea_AB299077 Calocera_cornea_AB472722 Calocera_cornea_AB472725 Calocera_cornea_AB472738 Calocera_cornea_AB472739 Calocera_cornea_AY701526 Calocera_lutea_AB712379 Calocera_viscosa_AB299048 Calocera_viscosa_AB299082 Calocera_viscosa_AB472740 Calocera_viscosa_DQ520102 Cerinomyces_albosporus_AB299050 Cerinomyces_canadensis_AB472696 Cerinomyces_canadensis_AB472697 Cerinomyces_canadensis_AB472698 Cerinomyces_canadensis_AB472699 Cerinomyces_crustulinus_AY600248 Cerinomyces_pallidus_AB472724 Dacrymyces_adpressus_AB472707 Dacrymyces_adpressus_AB472729 Dacrymyces_ancyleus_AB472713 Dacrymyces_aureosporus_AB299057 Dacrymyces_aureosporus_AB299084 Dacrymyces_aureosporus_AB472706 Dacrymyces_aureosporus_AB472715 Dacrymyces_aureosporus_AB472734 Dacrymyces_capitatus_AB299049 Dacrymyces_capitatus_AB299055 Dacrymyces_capitatus_AB472695 Dacrymyces_capitatus_AB472723 Dacrymyces_capitatus_AB472737 Dacrymyces_capitatus_AB472741 Dacrymyces_chrysospermus_AB299073 Dacrymyces_chrysospermus_AB299083 Dacrymyces_chrysospermus_AB472721 Dacrymyces_chrysospermus_AB472732 Dacrymyces_chrysospermus_AF287855 Dacrymyces_lacrymalis_AB299053 Dacrymyces_lacrymalis_AB299062 Dacrymyces_lacrymalis_AB299066 Dacrymyces_lacrymalis_AB299069 Dacrymyces_lacrymalis_AB472701 Dacrymyces_lacrymalis_AB472702 Dacrymyces_lacrymalis_AB472703 Dacrymyces_lacrymalis_AB472704 Dacrymyces_lacrymalis_AB472705 Dacrymyces_lacrymalis_AB472730 Dacrymyces_microsporus_AB472711 Dacrymyces_microsporus_AB472712 Dacrymyces_microsporus_AB472716 Dacrymyces_minor_AB299059 Dacrymyces_minor_AB299063 Dacrymyces_minutus_AB299070 Dacrymyces_minutus_AB472733 'Dacrymyces novae-zelandiae AB472700' 'Dacrymyces novae-zelandiae AB472742' Dacrymyces_pinacearum_AB472718 Dacrymyces_punctiformis_AB299052 Dacrymyces_punctiformis_AB299056 Dacrymyces_punctiformis_AB299071 'Dacrymyces san-augustinii AB299081' 'Dacrymyces san-augustinii AB472735' Dacrymyces_stillatus_AB299061 Dacrymyces_stillatus_AB299064 Dacrymyces_stillatus_AB299065 Dacrymyces_stillatus_AB472714 Dacrymyces_stillatus_AB472717 Dacrymyces_stillatus_AB472719 Dacrymyces_stillatus_AB472743 Dacrymyces_stillatus_AF291309 Dacrymyces_subalpinus_AB299060 Dacrymyces_subalpinus_AB472731 Dacrymyces_subarcticus_AB472727 Dacrymyces_subarcticus_AB472736 Dacrymyces_unisporus_AB299074 Dacrymyces_variisporus_AB299067 Dacrymyces_variisporus_AB299072 Dacrymyces_variisporus_AB299075 Dacryomitra_pusilla_AJ406406 Dacryopinax_spathularia_AB299078 Dacryopinax_spathularia_AB472710 Dacryopinax_spathularia_AB472744 Dacryopinax_spathularia_AY701525 Dacryopinax_spathulariaAB299079 Dacryopinax_sphenocarpa_AB472708 Dacryopinax_sphenocarpa_AB472709 Dacryopinax_sphenocarpa_AB472720 Dacryopinax_sphenocarpa_AB472726 Dacryopinax_sphenocarpa_AB472728 Dacryoscyphus_chrysochilus_AY604567 Ditiola_haasii_AF291314 Exidia_uvapsassa_AY645056 Femsjonia_peziziformis_AB299080 Femsjonia_peziziformis_AF291330 Guepiniopsis_buccina_AB299085 Guepiniopsis_buccina_AB472745 Guepiniopsis_buccina_AY745711 Pseudohydnum_gelatinosum_DQ520094 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17123] TITLE TSBR_Shirouzy_2009_Clutea; LINK TAXA = Taxa1; DIMENSIONS NCHAR=472; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calocera_arborea_TSBR004 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTCCGAGTTGTAACCTAGAGAAGCGTTTTCGGCCATGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAGTGTCCAGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAGAGACTCAGCCGGTGCACTTCTCTGGACGGGCCAGTATCGATTGCCGCGGGACAAGGCCGAGGAATGTGGCAGCTTGCTGTGTTATAGCCTCGGTCGTATGCCGCGGCTGGGATCGAGGATCCAGGATAC Calocera_arborea_TSBR005 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTCCGAGTTGTAACCTAGAGAAGTGTTTTCGGCCGTGCTCGGACAAGTCCCTTGGAACAGGGTGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAGCGTCCAGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAGAGACTCAGCCGGTGCATTTCTCTGGACGGGCCAGTATCGATTACCGCGGGACAAGGCTAAGGAATGTGGCAGCTCGCTGTGTTATAGCCTTGGTCGTATGCCGCGGTTGGGATCGAGGATCCAGGATAC Calocera_cornea_AB299068 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGGGCCTGGCTAAGTCCCTTGGAACAGGGCGTCGTAGAGGGTGACAATCCCGTATATCAGGCAACCGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAATGTGGCAACCTGTTGTGTTATAGCCTCTACCGTACACCGCGCCCGGGATCGAGGACCTAGGATGT Calocera_cornea_AB299076 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTCGGGTAATTCTTATGGAAGATGAGATCATAGAGGGTTACAATCCCGTTTACCGAGCAACAGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAAGGTGGCAACCTGTTGTGTTATAGCCCCTACCGTACACCGCGCCTGGGATCGAGGACCTAGGATGT Calocera_cornea_AB299077 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGGGCCTGGCTAAGTCCCTTGGAACAGGGCGTCGTAGAGGGTGACAATCCCGTATATCAGGCCCCCGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAATGTGGCAACCTGTTGTGTTATAGCCTCTACCGTACACCGCGCCCGGGATCGAGGACCTAGGATGT Calocera_cornea_AB472722 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTCGGTTAATTCCTATGGAAGATGAGATCATAGAGGGTTACAATCCCGTTTACCGAGCAACAGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAAGGTGGCAACCTGTTGTGTTATAGCCCCTGCCGTACACCGCGCCTGGGATCGAGGACCTAGGATGT Calocera_cornea_AB472725 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGGGCCTGGCTAAGTCCCTTGGAACAGGGCGTCGTAGAGGGTGACAATCCCGTATATCAGGCCCCCGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAATGTGGCAACCTGTTGTGTTATAGCCTCTGCCGTACACCGCGCCCGGGATCGAGGACCTAGGATGT Calocera_cornea_AB472738 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTTGGACAAGTCCCCTGGAACAGGGCGTCATAGAGGGTGATAATCCCGTATACCAAGACCCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAAGGTGGCAACCTGTTGTGTTATAGCCCCTACCGTACACCGCGCCTGGGATCGAGGACCTAGGATGT Calocera_cornea_AB472739 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTTGGACAAGTCCCCTGGAACAGGGCGTCATAGAGGGTGATAATCCCGTATACCAAGACCCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAAGGTGGCAACCTGTTGTGTTATAGCCCCTACCGTACACCGCGCCTGGGATCGAGGACCTAGGATGT Calocera_cornea_AY701526 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTTGGACAAGTCCCCTGGAACAGGGCGTCATAGAGGGTGATAATCCCGTATACCAAGACCCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTATGAGACTCAGCCGGTGTATTTCTCTTAACGGGCCAACATCGATTGGCGCGGGAAAAGGTTGGGGAAGGTGGCAACCTGTTGTGTTATAGCCTCTACCGTACACCGCGCCTGGGATCGAGGACCTAGGATGT Calocera_lutea_AB712379 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTCCGAGTTGTAATCTAGAGAAGCGTTTTCGGCCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTCGCGTAGGAAAAGGCCGAGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGTCGTACACTACGGGTTGGATCGAGGACCTAGGATGT Calocera_viscosa_AB299048 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTCGGATAAGTCCCCTGAAACAGGGCGTCATAGAGGGTAACAATCCCGTCTACCGAGGCGCAATGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGAGACTCAACCGGTGTATTTCTCTGGACGGGCCAACATGGATTGGCGTGGGAAAAGGGCAGGGAATGTGGCAGCCTGCTGTGTTATAGCCCTGATCGTACACCACGCCTGGGATCGAGGACCTAGGATGT Calocera_viscosa_AB299082 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTCGGATAAGTCCCCTGAAACAGGGCGTCATAGAGGGTAACAATCCCGTCTACCGAGGCGCAATGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGAGACTCAACCGGTGTATTTCTCTGGACGGGCCAACATGGATTGGCGTGGGAAAAGGGCAGGGAATGTGGCAGCCTGCTGTGTTATAGCCCTGATCGTACACCACGCCTGGGATCGAGGACCTAGGATGT Calocera_viscosa_AB472740 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTCGGACAAGTCCCCTGAAACAGGGCGTCATAGAGGGTAACAATCCCGTCTACCGAGGCGCAATGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTGTAGAGACTCAACCGGTGTATTTCTCTGGACGGGCCAACATCGATTGGCGTGGGAAAATGTTATGGAATGTGGCAGCTTGCTGTGTTATAGCCCCGATCGTACACCACGCCCGGGATCGAGGACCTAGGATGT Calocera_viscosa_DQ520102 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCCCGGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCTCGGATAAGTCCCCTGAAACAGGGCGTCATAGAGGGTAACAATCCCGTCTACCGAGGCGCAATGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGAGACTCAACCGGTGTATTTCTCTGGACGGGCCAACATCGATTGGCGTGGGAATAGGTCAGGGAATGTGGCAGCCTGCTGTGTTATAGCCCTGATCGTAAACCACGCCTGGGATCGAGGACCTAGGATGT Cerinomyces_albosporus_AB299050 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCGGCGAGTTGTAAACTAGAGAAGCGTTATCAGGCCCGCGCGCTAAAGTCCCTTGGAACAGGGTGTCATAGAGGGTGAGAATCCCGTGTGGCGTGGTGCGGGGCTGTGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATAGTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTAAGTCGCGTGGCAGGAATCAGCTCGCGCATTTCCTGCCACGGGCCAGCATCGACCGGCGGCGGAGAAGGCGGAGGAATGTGGCATCTTGGTGTGTTATAGCCTCCGCCGTACACGTCGCGCGGGGTCGAGGACCTAGGATGC Cerinomyces_canadensis_AB472696 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTCCGAGTTGTAATCTGGAGAAGCGTTATCAGGCGCGCGCATTAAAGTCTCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTGTAATGCGGTGCGGCGTTGTGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTGAGTCGCGCGGCAGGATTCAGCTTGCGTATTTCCTGCTGTGGGCCAGCATCGACGGGCGGCGGACAAGGCGTGGGAATGTGGCACCTTGGTGTGTTATAGCCCGCGTCGTACACGCTGCCTTACGTCGAGGACTTAGGATGC Cerinomyces_canadensis_AB472697 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTCCGAGTTGTAATCTGGAGAAGCGTTATCAGGCGCGCGCATTAAAGTCTCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTGTAATGCGGTGCGGCGTTGTGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTGAGTCGCGCGGCAGGATTCAGCTTGCGTATTTCCTGCTGTGGGCCAGCATCGACGGGCGGCGGACAAGGCGTGGGAATGTGGCACCTTGGTGTGTTATAGCCTGCGTCGTACACGCTGCCTTACGTCGAGGACTTAGGATGC Cerinomyces_canadensis_AB472698 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTCCGAGTTGTAATCTGGAGAAGCGTTATCAGGCGCGCGCATTAAAGTCTCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTGTAATGCGGTGCGGCGTTGTGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTGAGTCGCGCGGCAGGATTCAGCTTGCGTATTTCCTGCTGTGGGCCAGCATCGACGGGCGGCGGACAAGGCGTGGGAATGTGGCACCTTGGTGTGTTATAGCCTGCGTCGTACACGCTGCCTTACGTCGAGGACTTAGGATGC Cerinomyces_canadensis_AB472699 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTCCGAGTTGTAATCTGGAGAAGCGTTATCAGGCGCGCGCATTAAAGTCTCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTGTAATGCGGTGCGGCGTTGTGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTGAGTCGCGCGGCAGGATTCAGCTTGCGTATTTCCTGCTGTGGGCCAGCATCGACGGGCGGCGGACAAGGCGTGGGAATGTGGCACCTTGGTGTGTTATAGCCCGCGTCGTACACGCTGCCTTACGTCGAGGACTTAGGATGC Cerinomyces_crustulinus_AY600248 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCGGCGAGTTGTAAACTAGAGAAGCGTTATCAGGCCCGCGCGCTAAAGTCCCTTGGAACAGGGTGTCATAGAGGGTGAGAATCCCGTGTGGCGTGGTGCGGGGCTGGGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATAGTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTAAGTCGCGCGGCGGGAATCAGCTTGCGTATTTCCTGCCGCGGGCCAGCATCGACCGGCGGCGGAGAAGGCGGAGGAATGTGGCATCTTGGTGTGTTATAGCCTGCGCCGTACACGTCGCGCGGGGTCGAGGACCTAGGATGC Cerinomyces_pallidus_AB472724 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTCCGAGTTGTAATCTGGAGAAGCGTTATCAGGCGCGCGCATTAAAGTCTCTTGGAACAGGGCGTCACAGAGGGTGAGAATCCCGTGTAATGCGGTGCGGCGTTGTGAGGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTGAGTCGCGCGGCAGGATTCAGCTTGCGTATTTCCTGCTGTGGGCCAGCATCGACGGGCGGCGGACAAGGCGTGGGAATGTGGCACCTTGGTGTGTTATAGCCTGCGTCGTACACGCTGCCTTACGTCGAGGACTTAGGATGC Dacrymyces_adpressus_AB472707 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTCCGCATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCCCGGAAAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGGACAACAGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTTAGTCGCGTGTTGAGACTCAGCCGGTGCATTTCTCAGGACGGGCCAGCATCAGTTAGCGTGGAATAAAGCTGGGGAATGTGGCAACCTGTTGTGTTATAGCCCTTGTCATACGTCACGTCGGGGACTGAGGAACTAGGATGC Dacrymyces_adpressus_AB472729 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCTCCGCGTTGTAATCTAGAGAAGTGTTTTCGGCCGTGCCCGGAAAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGGACAACAGCGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTTAGTCGCGTGTTGAGACTCAGCCGGTGCATTTCTCTGGACGGGCCAGCATCAGTTAGCGTGGAATAAAGCTGGGGAATGTGGCAACCTGTTGTGTTATAGCCCCTGTCATACGTCACGTCGGGGACTGAGGAACTAGGATGC Dacrymyces_ancyleus_AB472713 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTCCGAGTTGTAATCTATAGAAGTGTTTTCGGCCGTGCCTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAGGCCCCAACGTCTGGATACACTTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCAATTGCCGGGGAACAAGGCTGGGGAATGTGGCAGCTTGCTGTGTTATAGCCCCTGTCGTACGCCTCGGACGGGATTGAGGACCTAGGATGT Dacrymyces_aureosporus_AB299057 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGAAAAAGGCTGGGGAATGTGGCAACCTGTTGTGTTATAGCCCCCGTCGTACGCCGCGGTTGGGACTGAGGTCTCAGGATGT Dacrymyces_aureosporus_AB299084 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGAAAAAGGCTGGGGAATGTGGCAACCTGTTGTGTTATAGCCCCCGTCGTACGCCGCGGTTGGGACTGAGGTCTCAGGATGT Dacrymyces_aureosporus_AB472706 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGAAAAAGGCTGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACGCCGCGGTTGGGACTGAGGTCTCAGGATGT Dacrymyces_aureosporus_AB472715 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGAAAAAGGCTGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACGCCGCGGTTGGGACTGAGGTCTCAGGATGT Dacrymyces_aureosporus_AB472734 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCCTTGAACGGGTCAACATCAGTTACCGCGGAATAAGGCTGAGGAATGTGGCAGCCTGCTGTGTTATAGCCTCCGTCGTACGTCGCGGTTGGGACTGAGGTCTCAGGATGT Dacrymyces_capitatus_AB299049 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGAAGTGTCTTCGGTCGTGCTCGAACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTTTGTCGAGCACCAACGTCTGGATGCACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTGGCGGGGGATAAAGTTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTTCCATGAACCCCGCCCGGGACTGAGGACGAAGGATGT Dacrymyces_capitatus_AB299055 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGAAGTGTCTTCGGTCGTGCTCGAACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTTTGTCGAGCACCAACGTCTGGATGCACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCTGAACGGGTCAACATCAGTTGGCGGGGGATAAAGTTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTTCCATGAACCCCGCTTGGGACTGAGGACGAAGGATGT Dacrymyces_capitatus_AB472695 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGAAGTGTCTTCGGTCGTGCTCGAACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTTTGTCGAGCACCAACGTCTGGATGCACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTGGCGGGGGATAAAGTTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTTCCATGAACCCCGCCCGGGACTGAGGACGAAGGATGT Dacrymyces_capitatus_AB472723 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTCTTCGGTCGTGCTCGAACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTTTGTCGAGCACCAACGTCTGGATGCACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGGACGGGTCAACATCAGTTGGCGCGGGATAAAGTTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTTCCATGAACCGCGCCCGGGACTGAGGACGAAGGATGT Dacrymyces_capitatus_AB472737 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATGCACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGCATTTCTTTGAACGGGTCAACATCAGTTGGCGTGGGAAAAGGCTGAGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGTCGTACACCATGCTTGGGACTGAGGACCCAGGATGT Dacrymyces_capitatus_AB472741 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGCATTTCTTTGAACGGGTCAACATCAGTTGGCGTGGGAAAAGGCTGAGGAATGTGGCAGCTTGCTGTGTTATAGCCTCCGTCGTACACCATGCCTGGGACTGAGGACCTAGGATGT Dacrymyces_chrysospermus_AB299073 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGGAAAAGGCTGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACACCGCGGTCAGGACTGAGGTCTCAGGATGT Dacrymyces_chrysospermus_AB299083 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGGAAAAGGCCGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACACCGCGGTCGGGACTGAGGTCTCAGGATGT Dacrymyces_chrysospermus_AB472721 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGGAAAAGGCTGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACACCGCGGTCAGGACTGAGGTCTCAGGATGT Dacrymyces_chrysospermus_AB472732 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATGTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGGAAAAGGCCGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACACCGCGGTCGGGACTGAGGTCTCAGGATGT Dacrymyces_chrysospermus_AF287855 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAGTTACCGCGGGAAAAGGCTGAGGAATGTGGCAACCTGTTGTGTTATAGCCTCCGTCGTACACCGCGGTCGGGACTGAGGTCTCAGGATGT Dacrymyces_lacrymalis_AB299053 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB299062 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGGACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB299066 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAAAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB299069 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCCCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB472701 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB472702 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB472703 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB472704 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCCGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB472705 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_lacrymalis_AB472730 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCACCAACGTCTGGATACACTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCGGAACGGGTCAACATCAGTTAGCGCGGGAAAAGGCTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCCCCGTCGTACACCGCGCCCGGGACTGAGGACCTAGGATGT Dacrymyces_microsporus_AB472711 CCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTAGAGAAGTGTTTTCGGTCGAGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCTACGTCTGGATGCACTTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTAGAGGCTCAGCCGGTGTATTCCTCTGAACGGGTCAACATCAGTTGGCGCGGGAAAAGGTTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGCCGTACACCGCGCCTGGGACTGAGGACCTAGGATGT Dacrymyces_microsporus_AB472712 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAATTGTAATCTAGAGACATGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGTACCAGCGTCTGGATACATGCTCGAGAGTCGAGTTGTTTGGGATTGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAGCGCTTGAAGTCAGTCACGTCCAGGGACTCAGCCGGTGCATTTCTCTGGACGGGTCAACATCAGTTGCCGCGGGAAAAGGCTGGGGAAGGTGGCAGCTTGCTGTGTTATAGCCTCTGTCGTACACCGCGGCTGGGACTGAGGCCCTAGGATGT Dacrymyces_microsporus_AB472716 CCCTGATAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTAGAGAAGTGTTTTCGGTCGAGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCTACGTCTGGATGCACTTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGACAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTAGAGGCTCAGCCGGTGTATTCCTCTGAACGGGTCAACATCAGTTGGCGCGGGAAAAGGTTGGGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGCCGTACACCGCGCCTGGGACTGAGGACCTAGGATGT Dacrymyces_minor_AB299059 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTGTAGAAGTGTTATCAGTCGTGCTTGGATAAGTCTCTTGGAACAGAGCGTCATTGAGGGTGAGAATCCCGTCTGCCAAGCACCAACGTCTGGATACACTCTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTTTGTGAACGGGTCAACATTAGTTGGCGCGGAATAAGGCTGGGGAATGTGGCAACTTGTTGTGTTATAGCCCTTGTCGTACGCCGTGCCTGGGACTAAGGTCTAAGGATGT Dacrymyces_minor_AB299063 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTGTAGAAGTGTTTTCAGTCGTGCTTGGATAAGTCTCTTGGAACAGAGTGTCAAAGAGGGTGAGAATCCCGTTTGCCAAGCACCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTCTATGAACGGGTCAACATTAGTTGGCGGGGGATAAGGCCGAGGAATGTGGCAACCCGTTGTGTTATAGCCTCTGTCGTACACCCCGCCCGGGACTAAGGTCTAAGGATGT Dacrymyces_minutus_AB299070 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCTCCGAGTTGTAATCTAGAGAAGCGTTTTCAGTCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCACCAGTGCCTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGGAGAAGGCTGAGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGTCGTATGCCGCGGCCGGGATCGAGGACCTAGGATGT Dacrymyces_minutus_AB472733 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGTAATCTCCGAGTTGTAATCTAGAGAAGCGTTTTCAGTCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCACCAGTGCCTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGGAGAAGGCTGAGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGTCGTATGCCGCGGCCGGGATCGAGGACCTAGGATGT 'Dacrymyces novae-zelandiae AB472700' CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTCCGAGTTGTAATCTAGAGAAGTGTTTTCGGTTGTACTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTGTGCCGAGCCGTAATAACTGGATACACGCTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTTAGTCGCGTGCAGGGACTCAGCCGGTGTATTTCCTTGAACGGGCCAACATCAATTAGCGTAGGAAAAGGCGGAGGAATGTGGCAACCCGTTGTGTTATAGCCTCTGTCGTACACTATGCTTGGGATTGAGGACATACGATGT 'Dacrymyces novae-zelandiae AB472742' CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTCCGAATTGTAATCTAGAGAAGTGTTTTCGGTCGCACTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGTACTGATGTCTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTTAGTCGCGTTCGGGGACTCAGCCGGTGTATTTCCTCGAACGGGCCAGCATCAGTTGACGTAGGAAAAGGTTGGGGAATGTGGCAACTCGTTGTGTTATAGCCTCTGTCGTATGCTACGTTTGGGACTGAGGACTTAGGATGC Dacrymyces_pinacearum_AB472718 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTCCGAGTTGTAATCTAGAGAAGTGTTTTCGGCCGTACCTGGGAAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAGTCCCGTCTACCAGGCTCTAATGTCTGGATGCACTCTCGAGAGTCGAGTTGTTTGGGATTGCAGCTCAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTGTGGACTCAGCCGGTGCACTTCTACTAACGGGCCAACATCAGTTGCCGCAGAAAAAGGCCGAGGAATGTGGCAACTTGTTGTGTTATAGCCTCCGTCGTACGCTGCGGATGGGACTGAGGACTTAGGATGT Dacrymyces_punctiformis_AB299052 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGCGAGTTGTAAACTGGAGAAGCGTTATCAGACGCGCGCACTAAAGTCTCCTGGAATGGAGTGTCATAGAGGGTGAGAATCCCGTGTGGTGCGATGCGGCGTTGTGAGGCGTTTTCTAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTGAGTCGCGCGGCGGGAGTCAGCTTGCGTACTTCCTGCCGTGGGCCAGCATCGACCGACGGCGGATAAGGCGTGGGAATGTGGCATCTCGATGTGTTATAGCCTGCGTCGTACACGCCGACTGGGGTCGAGGACTTAGGATGC Dacrymyces_punctiformis_AB299056 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGCGAGTTGTAAACTGGAGAAGCGTTATCAGACGCGCGCACTAAAGTCTCCTGGAATGGAGTGTCATAGAGGGTGAGAATCCCGTGTGGTGCGATGCGGCGTTGTGAGGCGTTTTCTAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTGAGTCGCGCGGCGGGAGTCAGCTTGCGTACTTCCTGCCGTGGGCCAGCATCGACCGACGGCGGATAAGGCGTGGGAATGTGGCATCTCGATGTGTTATAGCCTGCGTCGTACACGCCGACCGGGGTCGAGGACTGAGGATGC Dacrymyces_punctiformis_AB299071 CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTGCGAGTTGTAAACTGGAGAAGCGTTATCAGACGTGCGCACTAAAGTCTCCTGGAATGGAGTGTCATAGAGGGTGAGAATCCCGTGTGGTGCGATGCGGCGTTGTGAGGCGTTTTCTAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTTTGGAAAGAGAGTTAAAGAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGGAGTGAGTCGCGCGGCGGGAGTCAGCTTGCGTACTTCCTGCCGTGGGCCAGCATCGACCGACGGCGGATAAGGCGTGGGAATGTGGCATCTCGATGTGTTATAGCCTGCGTCGTACACGCCGACTGGGGTCGAGGACTTAGGATGC 'Dacrymyces san-augustinii AB299081' CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTCCGAGTTGTAATCTAGAGAAGTGTTTTCGGTTGTACTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCTCCAATAACTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTCCGGGGACTCAGCCGGTGTATTTCTTCGAACGGGCCAACATCAGTTAGCGTGGGAAAAGGCGGGGGAATGTGGCAACTTGTTGTGTTATAGCCTCCGTCGTACACCACGCTTGGGACTGAGGACTTAGGATGT 'Dacrymyces san-augustinii AB472735' CCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTCCGAGTTGTAATCTAGAGAAGTGTTTTCGGTTGTACTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCTCCAATAACTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGGGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTCCGGGGACTCAGCCGGTGTATTTCCTCGAACGGGCCAACATCAGTTAGCGTGGGAAAAGGCGGAGGAATGTGGCAACTTGTTGTGTTATAGCCTCCGTCGTACACCACGCTTGGGACTGAGGACTTAGGATGT Dacrymyces_stillatus_AB299061 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTGTAGAAGTGTTTTCAGTCGTGCTTGGATAAGTCTCTTGGAACAGAGTGTCAAAGAGGGTGAGAATCCCGTTTGCCAAGCACCAACGTCTGGATACACTCTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTCTATGAACGGGTCAACATTAGTTGGCGGGGGATAAGGCCGAGGAATGTGGCAACCCGTTGTGTTATAGCCTCCGTCGTACACCCCGCCCGGGACTAAGGTCTAAGGATGT Dacrymyces_stillatus_AB299064 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTGTAGAAGTGTTATCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCAAAGAGGGTGAGAATCCCGTTTGTCGAGCACCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTCTATGAACGGGTCAACATTAGTTGGCGCGGAATAAGGTTGGGGAATGTGGCAACCTGTTGTGTTATAGCCCTTGTCGTACGCTGCGCCCGGGACTAAGGTCTAAGGATGT Dacrymyces_stillatus_AB299065 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTGTAGAAGTGTTATCAGTCGTGCTTGGATAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAGCCCCTTCTGCCAAGCACCAACGTCTGGATACACTCTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTCTATGAACGGGTCAACATTAGTTGGCGGGGGATAAGGCCGAGGAATGTGGCAACCCGTTGTGTTATAGCCTCCGTCGTACACCCCGCCCGGGACTAAGGTCTAAGGATGT Dacrymyces_stillatus_AB472714 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTATAGAAGTGTTTTCGATCGTGCTTGGTTAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTACCAAGCCCCAACGTTTAGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTGTAGACTCAGCCGGTGTATTTCTACTAACGGGTCAACATCAGTTGGCGCGGGATAAGGTTGGGGAATGTGGCAGCTTGCTGTGTTATAGCCCTTGTCGTACACCGCGCCCTGGACTGAGGTCTCAGGATGT Dacrymyces_stillatus_AB472717 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAAGCCGGGCGTTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGGCTCAGCCGGTGTATTCCTATGAACGGGTCAACATCAGTTGGCGAGGGATAAGGCCGAGGAATGTGGCACCCTGGTGTGTTATAGCCTCCGTCGTACACCTCGCCCGGGACTGAGGTCTAAGGATGT Dacrymyces_stillatus_AB472719 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAAGCCGGGCGTTGTAATCTAGAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGGCTCAGCCGGTGTATTCCTATGAACGGGTCAACATCAGTTGGCGAGGGATAAGGCCGAGGAATGTGGCACCCTGGTGTGTTATAGCCTCCGTCGTACACCTCGCCCGGGACTGAGGTCTAAGGATGT Dacrymyces_stillatus_AB472743 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCAAAGAGGGTGAGAATCCCGTTTGCCGAGCACCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTCTGTGAACGGGTCAACATCAGTTGGCGGGGGAAAAGGCTGGGGAATGTAGCAACCTGTTGTGTTATAGCCCCTGTCGTACACCTCGCCCGGGACTGAGGTCTAAGGATGT Dacrymyces_stillatus_AF291309 CCCTAGTAACTGCGAGTGAAGCGGGACAAGCTCAAATTTAAAAGCCGGGCGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCAAAGAGGGTGAGAATCCCGTTTGCCGAGCACCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGGAGTCAGTCGCGTTCATGGACTCAGCCGGTGTATTTCTATGAACGGGTCAACATCAGTTGGCGGGGGAAAAGGCTGGGGAATGTAGCAACCTGTTGTGTTATAGCCCCTGTCGTACACCTCGCCCGGGACTGAGGTCTAAGGATGT Dacrymyces_subalpinus_AB299060 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCACGTTCAAGGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAATTACCGCGGGAAAAGGTTGAGGAATGTGGCAACTTGTTGTGTTATAGCCTCTGCCGTACACCGCGGTTGGGATTGAGGTCTCAGGATGT Dacrymyces_subalpinus_AB472731 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTATAGAAGTGTTTTCGGTCGTGCTCGGACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAACGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAAAGACTCAGCCGGTGTATTTCTTTGAACGGGTCAACATCAATTACCGCGGGAAAAGGTTGAGGAATGTGGCAACTTGTTGTGTTATAGCCTCTGCCGTACACCGCGGTTGGGATTGAGGTCTCAGGATGT Dacrymyces_subarcticus_AB472727 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCCGGGAGTTGTAATCTAGAGAAGTGTCTTCGGCCGTGCTCGAACAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTCGAACAGCAACGTCTGGATGCACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGGAGACTCAGCCGGTGTATTTCTCCAAACGGGCCAGCATCAGTTGCCGCGGGAAAAGACTGGGGAATGTGGCAACCTGTTGTGTTATAGCCTCTGTTGTACACCGCGGCTGGGACTGAGGTCTTAGGATGC Dacrymyces_subarcticus_AB472736 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGAAGTGTCTTCGGCCGTGCTCGAACAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTCGAACAGCAACGTCTGGATGCACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGGAGACTCAGCCGGTGTATTTCTCCAAACGGGCCAGCATCAGTTGCCGCGGGAAAAGACTGGGGAATGTGGCAACCTGTTGTGTTATAGCCCCTGTTGTACACCGCGGCTGGGACTGAGGTCTTAGGATGC Dacrymyces_unisporus_AB299074 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAGAATCTCCGAGTTGTAGCCTAGAGAAGCGTTTTCTGCGTGGCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGACAGGATCCCAGGGCTGGATGCGCTCTCGAGAGTCGGGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTGCCGGGACTCAGCCGGTGCACTTCCCGGGACGGGCCAGCATCAGTTATCGTTGGAAAAGGTTGAGGAATGTGGCACCTTGGTGTGTTATAGCCTCTGCCGCACGCGACGGTTGGGACTGAGGATCTAGGATGC Dacrymyces_variisporus_AB299067 CCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTCCGAGTTGTAACCTGTAGAAGCGTTTTCGGCCGCGTGTGGACAAGTCCCTTGGAACAGGGCGTCATAGCGGGTGAGAATCCCGTGTGCCAAACCCGTGCGTCTGGATGCGCTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGACGTATGTTCGTTCTAAGGCTAAATATCAACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTGGGGATTCAGCCGGTGCATTTCCTCCGACGGGCCAACATCGATTGTCGCGGGAAAAGGCCGAGGAATGTGGCAGCTCGCTGTGTTATAGCCTCGGTCGCACGCCGCGGTGGGGATCGAGGATCTAGGATGT Dacrymyces_variisporus_AB299072 CCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTCCGAGTTGTAACCTATAGAAGCGTTTTCGGCCGCGTGTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCAAACCCGTGTGTCTGGATACGCTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGACGTATGTTCGTTCTAAGGCTAAATATTAACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTGGGGATTCAGCCGGTGCATTTCCTCTGACGGGCCAACATCGATTGCCGCGGGAAAAGGCTGAGGAATGTGGCAGCTCGCTGTGTTATAGCCTCGGTCGTACGCCGTGGGGGGGATCGAGGACCTAGGATGT Dacrymyces_variisporus_AB299075 CCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTCCGAGTTGTAACCTATAGAAGCGTTTTCGGCCGCGTGTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAGTCCCGTGTGCCAAACCCGTGTGTCTGGATGCGCTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGACGTATGTTCGTTCTAAGGCTAAATATCAACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTGGGGATTCAGCCGGTGCATTTCCTCCGACGGGCCAACATCGATTGTCGCGGGAAAAGGCCGAGGAATGTGGCAGCTCGCTGTGTTATAGCCTCGGTCGCATGCCGCGGTGGGGATCGAGGACCTAGGATGT Dacryomitra_pusilla_AJ406406 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGAAGCGTTTCCGGTCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAAGCCCCAACTTCTGGATGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGAGACTCAGCCGGCGCATTTCTCTGGACGGGCCAGCATCAGTTGCCGCGGGAAAAGGCTGAGGAATGTGGCAGCCTGCTGTGTTATAGCCTCTGTCGTACACCGCGGCGGGGACTGAGGAATTAGGATGC Dacryopinax_spathularia_AB299078 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGACGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCCCCAATGACTGGATACACGTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCTGAACGGGTCAACATCAATTGCCGCGGGAAAAGGCTGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCTGTCGTACACCGCGGCCGGGATTGAGGACTCAGGATGT Dacryopinax_spathularia_AB472710 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGACGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCCCCAATGACTGGATACACGTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCTGAACGGGTCAACATCAATTGCCGCGGGAAAAGGCTGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCTGTCGTACACCGCGGCCGGGATTGAGGACTCAGGATGT Dacryopinax_spathularia_AB472744 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGACGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCCCCAATGACTGGATACACGTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCTGAACGGGTCAACATCAATTGCCGCGGGAAAAGGCTGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCTGTCGTACACCGCGGCCGGGATTGAGGACTCAGGATGT Dacryopinax_spathularia_AY701525 CCCTAGTAACTGCGATGAAAGCCGGGAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGACGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCCCCAACGACTGGATACACGTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCTGAACGGGTCAACATCAATTGCCGCGGGAAAAGGCTGGGGAATGTGGCAGCTTGCTGTGTTATAGGCTCTGTCGTACACCGTGGCCGGGATTGAGGACTCAGGATGT Dacryopinax_spathulariaAB299079 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGACGTGTTTTCGGTCGTGCTCGGACAAGTCCCTTGGAATAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCGAGCCCCAATGACTGGATACACGTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCTCTGAACGGGTCAACATCAATTGCCGCGGGAAAAGGCTGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCTGTCGTACACCGCGGCCGGGATTGAGGACTCAGGATGT Dacryopinax_sphenocarpa_AB472708 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTATAATCTCCGAGTTGTAGTCTGTAGAAGCGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAAGCCCCAACGTCTGGATACGTCTTCCAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGAATAAGGCCGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCAGTCGCACGCCGCGGACGGGATCGAGGACCTAGGATGT Dacryopinax_sphenocarpa_AB472709 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTATAATCTCCGAGTTGTAGTCTGTAGAAGCGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAAGCCCCAACGTCTGGATACGTCTTCCAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGAATAAGGCCGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCAGTCGCACGCCGCGGACGGGATCGAGGACCTAGGATGT Dacryopinax_sphenocarpa_AB472720 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTATAATCTCCGAGTTGTAGTCTGTAGAAGCGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAAGCCCCAACGTCTGGATACGTCTTCCAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGAATAAGGCCGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCAGTCGCACGCCGCGGACGGGATCGAGGACCTAGGATGT Dacryopinax_sphenocarpa_AB472726 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTATAATCTCCGAGTTGTAGTCTGTAGAAGCGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAAGCCCCAACGTCTGGATACGTCTTCCAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGAATAAGGCCGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCAGTCGCACGCCGCGGACGGGATCGAGGACCTAGGATGT Dacryopinax_sphenocarpa_AB472728 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTATAATCTCCGAGTTGTAGTCTGTAGAAGCGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCCAAGCCCCAACGTCTGGATACGTCTTCCAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTGCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGCGGAATAAGGCCGGGGAATGTGGCAGCTTGCTGTGTTATAGCCTCAGTCGCACGCCGCGGACGGGATCGAGGACCTAGGATGT Dacryoscyphus_chrysochilus_AY604567 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTAGAGAAGTATTTTCGGCCGTGCTCGAACAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTCGAACAGCAATGTCTGGATGTACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTAAAAGGGAAACGCTTGAAGTCAGTCGCGTTTGGAGACTCAGCCGGTGTATTTCTCCAAACGGGCCAGCATCAGTTACCGCGGGAAAAGACCGGGGAATGTGGCAACCTGTTGTGTTATAGCCCCTGTTGTACACCGCGGTTGGGACTGAGGCTTTAGGATGC Ditiola_haasii_AF291314 CCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTAAAATCTCCGAGTTGTAACCTAGAGAAGTGTTTTCGGCCGCGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCAAGCCGCGATGTCTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAACGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGGAGTCAGTCGCGTTCAGGGACTCAGCCGGTGCATTTCCTTGGACGGGCCAACATCGATTGCCGTGGGAGAAGGCTGAGGAAAGTGGCAGCTTGCTGTGTTATAGCCTCTGTCGTACGCCACGGCTGGGATCGAGGACTTAGGATGT Exidia_uvapsassa_AY645056 CCCTAGTAACGGCGAGTGAAGCGGGATGAGCTCAAATTTGAAATCTCCGAGTTGTAATCTAGAGAGGTGTTTTCCGTGCGGCGTGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGACAGGATCCCGGTGCTGGATACACCTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTCCAGGACTCAGCCGGTGCAATTCTTGGGATGGGCCAGCATCGATTGTCGCCGGAAAAGGCGGAGGAAGGTGGCAGCTTGCTGTGTTATAGCCTCCGTCGTACACGGTGTCTGGGATCGAGGACTTAGGATGC Femsjonia_peziziformis_AB299080 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTCCGAGTTGTAACCTAGAGAAGTGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCCAAGCCACAGTGTCTGGATACGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTAGGGACTCAGCCGGTGCATTTCCTTGAACGGGCCAACATCGATTACCGTGGGAGAAGGCCGAGGAAGGTGGCAACTTGTTGTGTTATAGCCTCCGTCGTATGCCACGGTTGGGATCGAGGACCTAGGATGT Femsjonia_peziziformis_AF291330 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAGAATCTCCGAGTTGTAACCTAGAGAAGTGTTTTCGGCCGTGCTTGGACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTGTGCCAAGCCACAGTGTCTGGATGCGCTCTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAGCGCTTGAAGTCAGTCGCGTTTAGGGACTCAGCCGGTGCACTTCCTTGAACGGGCCAACATCGATTACCGTGGGAGAAGGCGGAGGAAGGTGGCAACTTGTTGTGTTATAGCCTCCGTCGTATGCCACGGTTGGGATCGAGGACCTAGGATGT Guepiniopsis_buccina_AB299085 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTGTAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAGCGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGGAGTCAGTCGCGTTCAGGGACTCAGCCGGTGTACTTTTCTGAACGGGTCAACATCAGTTGCCGCGGGATAAGATGGGGGAATGTGGCTCTCTGGAGTGTTATAGCCTCTGCTGTACACCGCGGCGGGGACTGAGGTCTAAGGATGT Guepiniopsis_buccina_AB472745 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTGTAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAGCGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGGAGTCAGTCGCGTTCAGGGACTCAGCCGGTGTACTTTTCTGAACGGGTCAACATCAGTTGCCGCGGGATAAGATGGGGGAATGTGGCTCTCTGGAGTGTTATAGCCTCTGCTGTACACCGCGGCGGGGACTGAGGTCTAAGGATGT Guepiniopsis_buccina_AY745711 CCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCCGGGAGTTGTAATCTGTAGAAGTGTTTTCGGTCGTGCTCGGATAAGTCTCTTGGAACAGAGTGTCATAGAGGGTGAGAATCCCGTCTGCCGAGCCCCAGCGTCTGGATACACTTTCAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTAAAAGGGAAACGCTTGGAGTCAGTCGCGTTCAGGGACTCAGCCGGTGTACTTTTCTGAACGGGTCAACATCAGTTGCCGCGGGATAAGATGGGGGAATGTGGCTCTCTGGAGTGTTATAGCCTCTGCTGTACACCGCGGCGGGGACTGAGGTCTAAGGATGT Pseudohydnum_gelatinosum_DQ520094 CCCTAGTAACGGCGAGTGAAGCGGGAAAAGCTCAAATTTGAAATCTCCGAGTTGTAGTCTAGAGAGGTGTCTTCTGCGTGGCATGCACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGGCAGGATCCCGGTGCTGGATGCGCCTTCGAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGGAGTCAGTCGCGTTCCGGGACTCAGCCGGTGCACTTCCTGGCACGGGCCAGCATCGATTATCGCCGGAAAAAGCTGGGGAAGGTGGCACCTTGGTGTGTTATAGCCCCTGTTGTATACGGTGGTTGGGATTGAGGACCTAGGATGC ; END; BEGIN TREES; TITLE TSBR_Shirouzy_2009_Clutea_without_gaps; LINK TAXA = Taxa1; TRANSLATE 1 Calocera_arborea_TSBR004, 2 Calocera_arborea_TSBR005, 3 Calocera_cornea_AB299068, 4 Calocera_cornea_AB299076, 5 Calocera_cornea_AB299077, 6 Calocera_cornea_AB472722, 7 Calocera_cornea_AB472725, 8 Calocera_cornea_AB472738, 9 Calocera_cornea_AB472739, 10 Calocera_cornea_AY701526, 11 Calocera_lutea_AB712379, 12 Calocera_viscosa_AB299048, 13 Calocera_viscosa_AB299082, 14 Calocera_viscosa_AB472740, 15 Calocera_viscosa_DQ520102, 16 Cerinomyces_albosporus_AB299050, 17 Cerinomyces_canadensis_AB472696, 18 Cerinomyces_canadensis_AB472697, 19 Cerinomyces_canadensis_AB472698, 20 Cerinomyces_canadensis_AB472699, 21 Cerinomyces_crustulinus_AY600248, 22 Cerinomyces_pallidus_AB472724, 23 Dacrymyces_adpressus_AB472707, 24 Dacrymyces_adpressus_AB472729, 25 Dacrymyces_ancyleus_AB472713, 26 Dacrymyces_aureosporus_AB299057, 27 Dacrymyces_aureosporus_AB299084, 28 Dacrymyces_aureosporus_AB472706, 29 Dacrymyces_aureosporus_AB472715, 30 Dacrymyces_aureosporus_AB472734, 31 Dacrymyces_capitatus_AB299049, 32 Dacrymyces_capitatus_AB299055, 33 Dacrymyces_capitatus_AB472695, 34 Dacrymyces_capitatus_AB472723, 35 Dacrymyces_capitatus_AB472737, 36 Dacrymyces_capitatus_AB472741, 37 Dacrymyces_chrysospermus_AB299073, 38 Dacrymyces_chrysospermus_AB299083, 39 Dacrymyces_chrysospermus_AB472721, 40 Dacrymyces_chrysospermus_AB472732, 41 Dacrymyces_chrysospermus_AF287855, 42 Dacrymyces_lacrymalis_AB299053, 43 Dacrymyces_lacrymalis_AB299062, 44 Dacrymyces_lacrymalis_AB299066, 45 Dacrymyces_lacrymalis_AB299069, 46 Dacrymyces_lacrymalis_AB472701, 47 Dacrymyces_lacrymalis_AB472702, 48 Dacrymyces_lacrymalis_AB472703, 49 Dacrymyces_lacrymalis_AB472704, 50 Dacrymyces_lacrymalis_AB472705, 51 Dacrymyces_lacrymalis_AB472730, 52 Dacrymyces_microsporus_AB472711, 53 Dacrymyces_microsporus_AB472712, 54 Dacrymyces_microsporus_AB472716, 55 Dacrymyces_minor_AB299059, 56 Dacrymyces_minor_AB299063, 57 Dacrymyces_minutus_AB299070, 58 Dacrymyces_minutus_AB472733, 59 'Dacrymyces novae-zelandiae AB472700', 60 'Dacrymyces novae-zelandiae AB472742', 61 Dacrymyces_pinacearum_AB472718, 62 Dacrymyces_punctiformis_AB299052, 63 Dacrymyces_punctiformis_AB299056, 64 Dacrymyces_punctiformis_AB299071, 65 'Dacrymyces san-augustinii AB299081', 66 'Dacrymyces san-augustinii AB472735', 67 Dacrymyces_stillatus_AB299061, 68 Dacrymyces_stillatus_AB299064, 69 Dacrymyces_stillatus_AB299065, 70 Dacrymyces_stillatus_AB472714, 71 Dacrymyces_stillatus_AB472717, 72 Dacrymyces_stillatus_AB472719, 73 Dacrymyces_stillatus_AB472743, 74 Dacrymyces_stillatus_AF291309, 75 Dacrymyces_subalpinus_AB299060, 76 Dacrymyces_subalpinus_AB472731, 77 Dacrymyces_subarcticus_AB472727, 78 Dacrymyces_subarcticus_AB472736, 79 Dacrymyces_unisporus_AB299074, 80 Dacrymyces_variisporus_AB299067, 81 Dacrymyces_variisporus_AB299072, 82 Dacrymyces_variisporus_AB299075, 83 Dacryomitra_pusilla_AJ406406, 84 Dacryopinax_spathularia_AB299078, 85 Dacryopinax_spathularia_AB472710, 86 Dacryopinax_spathularia_AB472744, 87 Dacryopinax_spathularia_AY701525, 88 Dacryopinax_spathulariaAB299079, 89 Dacryopinax_sphenocarpa_AB472708, 90 Dacryopinax_sphenocarpa_AB472709, 91 Dacryopinax_sphenocarpa_AB472720, 92 Dacryopinax_sphenocarpa_AB472726, 93 Dacryopinax_sphenocarpa_AB472728, 94 Dacryoscyphus_chrysochilus_AY604567, 95 Ditiola_haasii_AF291314, 96 Exidia_uvapsassa_AY645056, 97 Femsjonia_peziziformis_AB299080, 98 Femsjonia_peziziformis_AF291330, 99 Guepiniopsis_buccina_AB299085, 100 Guepiniopsis_buccina_AB472745, 101 Guepiniopsis_buccina_AY745711, 102 Pseudohydnum_gelatinosum_DQ520094; TREE Fig._3 = [&R] ((((16:0.00403936,(21:0.00384665,62:0.13055298):0.01385987):0.05756235,(80:0.01354729,(81:0.02489354,82:0.00546413):0.0):0.40167183):0.0,((64:0.11551718,(17:0.00263104,63:0.12025056):0.0):0.0,((18:1.0E-8,22:1.0E-8):1.0E-8,(19:1.0E-8,20:0.00263104):1.0E-8):1.3E-7):0.10307206):0.144731225,((((98:0.04894139,(1:0.08214622,95:0.02721979):0.00825343):0.03175682,(2:0.1064701,(89:1.0E-8,90:1.0E-8):0.0417756):0.0):0.0,((91:1.0E-8,(92:1.0E-8,93:1.0E-8):1.0E-8):0.041779,((23:0.01072329,24:1.0E-8):0.1380223,(25:0.01444034,61:0.12677164):0.0):0.02026165):0.0):2.3E-7,(((((55:0.05916408,(67:0.0052695,68:0.04935864):0.0):0.0,(56:1.0E-8,(69:0.0246377,74:0.04258214):1.0E-8):4.0E-8):0.04548415,((70:0.06418109,(83:0.10402315,99:0.05041012):0.0252774):2.0E-8,(73:0.02846252,(71:1.0E-8,72:1.0E-8):0.03040415):0.00465777):1.0E-8):0.0552589,(((78:0.00345089,(59:0.22434081,94:0.02129174):7.0E-8):0.07790639,(101:1.8E-7,(77:0.15954415,100:6.0E-8):1.0E-8):0.07676278):0.02469138,((65:0.00415717,(60:0.08620981,66:0.0011466):0.0):0.06221774,((11:0.03558242,97:0.05561757):6.814E-5,(57:1.0E-8,58:1.0E-8):0.03660896):0.0387419):0.0472382):2.0E-8):4.0E-8,(((((14:0.09427445,(3:0.0053408,5:1.0E-8):0.02159553):1.0E-8,(7:0.02439695,(8:1.0E-8,9:1.0E-8):0.01964512):1.0E-8):0.02963779,((12:1.0E-8,(13:1.0E-8,15:0.01075117):1.0E-8):0.07478792,(96:0.05013332,(79:0.10416045,102:0.02645979):0.03752783):0.21007848):2.0E-8):0.04845988,(((10:0.01056988,(4:0.00311683,6:0.00492559):0.05699253):0.09074187,(33:1.0E-8,(31:1.0E-8,32:0.00799925):1.0E-8):0.05838699):2.0E-8,((34:0.04895488,(35:0.00514894,36:0.00830876):0.02246926):0.0,((42:1.0E-8,46:1.0E-8):1.0E-8,(47:1.0E-8,51:1.0E-8):1.0E-8):0.02200895):0.00484341):0.00828485):0.00473302,((((49:0.00260153,(43:0.00262833,44:0.00262319):0.00263586):1.0E-8,(50:1.0E-8,(45:0.00260132,48:1.0E-8):1.0E-8):1.0E-8):0.03974499,((52:1.0E-8,(26:0.10599419,54:0.00528028):1.0E-8):0.04334355,((27:0.00528492,28:1.0E-8):1.0E-8,(29:1.0E-8,38:0.01337763):1.0E-8):0.05889179):2.0E-8):0.0,(((40:0.00527224,(30:0.02104244,75:0.02668021):0.00371796):1.0E-8,(41:1.0E-8,(37:1.0E-8,39:1.0E-8):0.00526892):1.0E-8):0.03877929,((76:0.07580483,(53:0.06974906,85:2.0E-8):1.0E-8):1.0E-8,((84:1.0E-8,88:1.0E-8):1.0E-8,(86:1.0E-8,87:0.02454547):1.0E-8):3.0E-8):0.03064589):0.00688029):0.0):0.0):0.07642554):0.144731225); END;