#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on October 23, 2020; 22:06 GMT TreeBASE (cc) 1994-2008 Study reference: Halleen F., Schroers H., Groenewald J.Z., & Crous P.W. 2004. Novel species of Cylindrocarpon (Neonectria) and Campylocarpon gen. nov. associated with black foot disease of grapevines (Vitis spp.). Studies in Mycology, 50. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1288] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=60; TAXLABELS Cylindrocarpon_album_CBS152_29 Cylindrocarpon_cylindroides_AY295301 Cylindrocarpon_cylindroides_CBS503_67 Cylindrocarpon_destructans_AF172261 Cylindrocarpon_destructans_CBS112591 Cylindrocarpon_destructans_CBS112595 Cylindrocarpon_destructans_CBS112596 Cylindrocarpon_destructans_CBS112597 Cylindrocarpon_destructans_CBS112599 Cylindrocarpon_destructans_CBS112602 Cylindrocarpon_destructans_CBS112606 Cylindrocarpon_destructans_CBS112607 Cylindrocarpon_destructans_CBS112610 Cylindrocarpon_destructans_CBS153_37 Cylindrocarpon_destructans_CBS156_47 Cylindrocarpon_destructans_CBS264_65 Cylindrocarpon_destructans_CBS301_93 Cylindrocarpon_destructans_CBS321_34 Cylindrocarpon_destructans_var_crassum_CBS773_83 Cylindrocarpon_faginatum_CBS217_67 Cylindrocarpon_heteronema_CBS316_34 Cylindrocarpon_macrodidymum_CBS112593 Cylindrocarpon_macrodidymum_CBS112594 Cylindrocarpon_macrodidymum_CBS112598 Cylindrocarpon_macrodidymum_CBS112601 Cylindrocarpon_macrodidymum_CBS112603 Cylindrocarpon_macrodidymum_CBS112604 Cylindrocarpon_macrodidymum_CBS112605 Cylindrocarpon_macrodidymum_CBS112608 Cylindrocarpon_macrodidymum_CBS112609 Cylindrocarpon_macrodidymum_CBS112615 Cylindrocarpon_magnusianum_CBS151_29 Cylindrocarpon_obtusisporum_CBS183_36 Cylindrocarpon_sp_AY295304 Cylindrocarpon_sp_AY295332 Fusarium_solani_CBS490_63 Nectria_cinnabarina_AF163025 Neonectria_coprosmae_AY295326 Neonectria_radicicola_AF220968 Neonectria_radicicola_AF220969 Neonectria_radicicola_AJ007351 Neonectria_radicicola_AJ007352 Neonectria_radicicola_AJ007354 Neonectria_radicicola_AJ007355 Neonectria_radicicola_AJ007356 Neonectria_radicicola_AJ007357 Neonectria_radicicola_AY295310 Neonectria_radicicola_AY295311 Neonectria_radicicola_AY295312 Neonectria_radicicola_AY295313 Neonectria_radicicola_AY295314 Neonectria_radicicola_AY295317 Neonectria_radicicola_AY295319 Neonectria_radicicola_AY295328 Neonectria_radicicola_AY295329 Neonectria_radicicola_AY295330 Neonectria_radicicola_AY295331 Neonectria_radicicola_AY295333 Neonectria_radicicola_var_coprosmae_AF220970 Neonectria_radicicola_var_coprosmae_AF220971 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=39; TAXLABELS CBS112592Campylocarpon_pseudofasciculare Campylocarpon_fasciculare_CBS112600 Campylocarpon_fasciculare_CBS112611 Campylocarpon_fasciculare_CBS112612 Campylocarpon_fasciculare_CBS112613 Campylocarpon_fasciculare_CBS112614 Campylocarpon_fasciculare_CBS113559 Campylocarpon_fasciculare_CBS113560 Campylocarpon_pseudofasciculare_CBS112679 Cylindrocarpon_album_CBS152_29 Cylindrocarpon_cylindroides_AY295301 Cylindrocarpon_cylindroides_CBS503_67 Cylindrocarpon_destructans_CBS112602 Cylindrocarpon_destructans_CBS264_65 Cylindrocarpon_faginatum_CBS217_67 Cylindrocarpon_heteronema_CBS316_34 Cylindrocarpon_ianthothele_var_majus_CBS328_81 Cylindrocarpon_ianthothele_var_minus_CBS266_36 Cylindrocarpon_macrodidymum_CBS112615 Cylindrocarpon_magnusianum_CBS151_29 Cylindrocarpon_obtusisporum_CBS183_36 Cylindrocarpon_olidum_CBS215_67 Cylindrocarpon_olidum_var_crassum_CBS216_67 Cylindrocarpon_sp_AY295304 Cylindrocarpon_sp_AY295334 Cylindrocarpon_sp_AY295335 Fusarium_solani_CBS490_63 Nectria_cinnabarina_AF163025 Neonectria_lucida_CBS112456 Neonectria_macroconidialis_AY29532 Neonectria_radicicola_AJ007353 Neonectria_radicicola_AJ007354 Neonectria_radicicola_AJ007355 Neonectria_radicicola_AJ007357 Neonectria_radicicola_AY295311 Neonectria_radicicola_AY295317 Neonectria_radicicola_AY295329 Neonectria_radicicola_var_coprosmae_AF220971 Neonectria_trachosa_CBS112467 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=71; TAXLABELS Campylocarpon_fasciculare_CBS112600 Campylocarpon_fasciculare_CBS112611 Campylocarpon_fasciculare_CBS112612 Campylocarpon_fasciculare_CBS112613 Campylocarpon_fasciculare_CBS112614 Campylocarpon_fasciculare_CBS113554 Campylocarpon_fasciculare_CBS113557 Campylocarpon_fasciculare_CBS113558 Campylocarpon_fasciculare_CBS113559 Campylocarpon_fasciculare_CBS113560 Campylocarpon_pseudofasciculare_CBS112592 Campylocarpon_pseudofasciculare_CBS112679 Cylindrocarpon_cylindroides_AY297172 Cylindrocarpon_cylindroides_AY297211 Cylindrocarpon_destructans_CBS102032 Cylindrocarpon_destructans_CBS112591 Cylindrocarpon_destructans_CBS112595 Cylindrocarpon_destructans_CBS112596 Cylindrocarpon_destructans_CBS112597 Cylindrocarpon_destructans_CBS112599 Cylindrocarpon_destructans_CBS112602 Cylindrocarpon_destructans_CBS112606 Cylindrocarpon_destructans_CBS112607 Cylindrocarpon_destructans_CBS112610 Cylindrocarpon_destructans_CBS113553 Cylindrocarpon_destructans_CBS113556 Cylindrocarpon_destructans_CBS153_37 Cylindrocarpon_destructans_CBS156_47 Cylindrocarpon_destructans_CBS264_65 Cylindrocarpon_destructans_CBS301_93 Cylindrocarpon_destructans_CBS321_34 Cylindrocarpon_destructans_var_crassum_CBS773_83 Cylindrocarpon_macrodidymum_CBS112593 Cylindrocarpon_macrodidymum_CBS112594 Cylindrocarpon_macrodidymum_CBS112598 Cylindrocarpon_macrodidymum_CBS112601 Cylindrocarpon_macrodidymum_CBS112603 Cylindrocarpon_macrodidymum_CBS112604 Cylindrocarpon_macrodidymum_CBS112605 Cylindrocarpon_macrodidymum_CBS112608 Cylindrocarpon_macrodidymum_CBS112609 Cylindrocarpon_macrodidymum_CBS112615 Cylindrocarpon_macrodidymum_CBS113552 Cylindrocarpon_macrodidymum_CBS113555 Cylindrocarpon_sp_AY297175 Cylindrocarpon_sp_AY297176 Cylindrocarpon_sp_AY297198 Fusarium_sp_U34422 Nectria_fuckeliana_CBS112466 Neonectria_coprosmae_AY297192 Neonectria_galligena_AY297216 Neonectria_macroconidialis_AY297193 Neonectria_radicicola_AY297179 Neonectria_radicicola_AY297181 Neonectria_radicicola_AY297182 Neonectria_radicicola_AY297184 Neonectria_radicicola_AY297185 Neonectria_radicicola_AY297187 Neonectria_radicicola_AY297188 Neonectria_radicicola_AY297191 Neonectria_radicicola_AY297194 Neonectria_radicicola_AY297195 Neonectria_radicicola_AY297196 Neonectria_radicicola_AY297197 Neonectria_radicicola_AY297202 Neonectria_radicicola_AY297205 Neonectria_radicicola_AY297212 Neonectria_radicicola_AY297213 Neonectria_radicicola_AY297214 Neonectria_radicicola_AY297215 Neonectria_radicicola_AY297217 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=58; TAXLABELS Albonectria_albosuccinea_U34554 Albonectria_rigidiuscula_U88104 Calonectria_morganii_U17409 Campylocarpon_fasciculare_CBS112612 Campylocarpon_fasciculare_CBS112614 Campylocarpon_fasciculare_CBS113560 Campylocarpon_pseudofasciculare_CBS112592 Cosmospora_episphaeria_U88100 Cosmospora_vilior_U57348 Cylindrocarpon_album_CBS242.29 Cylindrocarpon_candidum_CBS237.29 Cylindrocarpon_cylindroides_AY283551 Cylindrocarpon_cylindroides_CBS189.61 Cylindrocarpon_destructans_CBS102032 Cylindrocarpon_destructans_CBS112602 Cylindrocarpon_destructans_CBS112606 Cylindrocarpon_destructans_CBS112607 Cylindrocarpon_destructans_CBS156.47 Cylindrocarpon_destructans_CBS264.65 Cylindrocarpon_destructans_CBS301.93 Cylindrocarpon_destructans_CBS321.34 Cylindrocarpon_destructans_var_crassum_CBS773.83 Cylindrocarpon_didymum_CBS305.85 Cylindrocarpon_didymum_CBS640.77 Cylindrocarpon_faginatum_CBS217.67 Cylindrocarpon_heteronema_CBS232.31 Cylindrocarpon_macrodidymum_CBS112593 Cylindrocarpon_macrodidymum_CBS112603 Cylindrocarpon_macrodidymum_CBS112608 Cylindrocarpon_macrodidymum_CBS112615 Cylindrocarpon_magnusianum_CBS151.29 Cylindrocarpon_obtusisporum_CBS183.36 Cylindrocarpon_victoriae_CBS174.37 Cylindrocarpon_willkommii_CBS226.31 Cylindrocladium_floridanum_U17408 Fusarium_culmorum_AF006322 Fusarium_fujikuroi_U34528 Fusarium_oxysporum_AF060383 Fusarium_solani_L36629 Fusarium_verticillioides_U34526 Haematonectria_haematococca_L36623 Leuconectria_clusiae_U17412 Nectria_cinnabarina_U00748 Nectria_fuckeliana_CBS112466 Nectria_mariannaea_AY283553 Nectria_pseudotrichia_U17410 Nectria_ventricosa_L36613 Neocosmospora_diparietospora_U17413 Neocosmospora_endophytica_U17411 Neonectria_coccinea_U88124 Neonectria_discophora_CBS112460 Neonectria_galligena_U88126 Neonectria_lucida_CBS112455 Neonectria_lucida_CBS112457 Neonectria_radicicola_AY283552 Neonectria_radicicola_U17415 Neonectria_trachosa_CBS112467 Verticillium_dahliae_U17425 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=41; TAXLABELS Campylocarpon_fasciculare_CBS112611 Campylocarpon_fasciculare_CBS112613_112614 Campylocarpon_fasciculare_CBS113554_113558 Campylocarpon_fasciculare_CBS113557 Campylocarpon_fasciculare_CBS113559_112600 Campylocarpon_fasciculare_CBS113560_112612 Campylocarpon_pseudofasciculare_CBS112592 Campylocarpon_pseudofasciculare_CBS112679 Cylindrocarpon_destructans_CBS102032 Cylindrocarpon_destructans_CBS112591 Cylindrocarpon_destructans_CBS112595 Cylindrocarpon_destructans_CBS112596 Cylindrocarpon_destructans_CBS112597 Cylindrocarpon_destructans_CBS112599 Cylindrocarpon_destructans_CBS112602 Cylindrocarpon_destructans_CBS112606 Cylindrocarpon_destructans_CBS112607 Cylindrocarpon_destructans_CBS112610 Cylindrocarpon_destructans_CBS113553 Cylindrocarpon_destructans_CBS113556 Cylindrocarpon_destructans_CBS153_37 Cylindrocarpon_destructans_CBS156_47 Cylindrocarpon_destructans_CBS264_65 Cylindrocarpon_destructans_CBS301_93 Cylindrocarpon_destructans_CBS321_34 Cylindrocarpon_destructans_var_crassum_CBS773_83 Cylindrocarpon_macrodidymum_CBS112593 Cylindrocarpon_macrodidymum_CBS112598 Cylindrocarpon_macrodidymum_CBS112601_112594 Cylindrocarpon_macrodidymum_CBS112603_112605 Cylindrocarpon_macrodidymum_CBS112604 Cylindrocarpon_macrodidymum_CBS112608 Cylindrocarpon_macrodidymum_CBS112609 Cylindrocarpon_macrodidymum_CBS112615 Cylindrocarpon_macrodidymum_CBS113552 Cylindrocarpon_macrodidymum_CBS113555 Fusarium_sp_U34422 Nectria_fuckeliana_CBS112466 Neonectria_discophora_CBS112460 Neonectria_lucida_CBS112455 Neonectria_trachosa_CBS112467 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2727] TITLE LSU_rDNA; LINK TAXA = Taxa4; DIMENSIONS NCHAR=529; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Albonectria_albosuccinea_U34554 ????????????????????????????????????TGAAATCTGGCCCTA--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTGCCTTCCGAGTGCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTCAATCATCCGGGGTTCT-CCCTGGTGCACTTTTCC-AGTCCAGGCCAGCATCAGTTTGCTCCGGGGGATAAAGGCCTCGGGAATGTGGCTCCTCTC--GGGGAGTGTTATAGACCGTTGCGTAATACCCTGGGGCGGACTGAGGTACGCGCTTCTGCAAGGAT Albonectria_rigidiuscula_U88104 ????????????????????????????????????TGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCCAGGGTTCT-CCCTGGTGCACTTTTCC-AGTCCAGGCCAGCATCAGTTTGCTTCGGGGGATAAAGGCTTCGGGAATGTGGCTCCTCTC--GGGGAGTGTTATAGCCCGTTGCGTAATACCCTGGGGCGGACTGAGGTACGCGCTTCTGCAAGGAT Calonectria_morganii_U17409 CTAGTAACGGCGAGTGAAGCGGAAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTTGATCATCCTGGGTTCT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTCGCTGCGGGGGATAAAAGCTTTAGGAATGTGGCTCCC-TC---GGGAGTGTTATAGACTATTGCATAATACCCTGCTCCGGACTGAGGTTCGCGCATCTGCAAGGAT Campylocarpon_fasciculare_CBS112612 CCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGGGCTTGGTTGATCAACCTGGGTTCT-CCCCGGTGCACTCTTCCTCGCCCAGGCCAGCATCAGTTTGCTTCGGGGGATAAAGGCGTCGGGAATGTGGCTCCC-CC---GGGAGTGTTATAGCCCGTCGTGCAATACCCTGCGGCAGACTGAGGTTCGCG-TTCCGCAAGGAT Campylocarpon_fasciculare_CBS112614 CCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGGGCTTGGTTGATCAACCTGGGTTCT-CCCCGGTGCACTCTTCCTCGCCCAGGCCAGCATCAGTTTGCTTCGGGGGATAAAGGCGTCGGGAATGTGGCTCCC-CC---GGGAGTGTTATAGCCCGTCGTGCAATACCCTGCGGCAGACTGAGGTTCGCG-TTCCGCAAGGAT Campylocarpon_fasciculare_CBS113560 CCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGGGCTTGGTTGATCAACCTGGGTTCT-CCCCGGTGCACTCTTCCTCGCCCAGGCCAGCATCAGTTTGCTTCGGGGGATAAAGGCGTCGGGAATGTGGCTCCC-CC---GGGAGTGTTATAGCCCGTCGTGCAATACCCTGCGGCAGACTGAGGTTCGCG-TTCCGCAAGGAT Campylocarpon_pseudofasciculare_CBS112592 ???????????????????????????????????????????TGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGC-GGCACCTTCCGAGTCCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCCGGTCGGATGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGGGCTTGGTTGATCAACCTGGGTTCT-CCCTGGTGCACTCTTCCTAGCCCAGGCCAGCATCAGTTTGCCTCGGGGGACAAAGGCGTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGTCGCGTAATACCCTGCGGCAGACTGAGGTTCGCG-TTCCGCAAGGAT Cosmospora_episphaeria_U88100 ????????????????????????????????????TGAAATCTGGCCCTT--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGAGCCCGGTTAATCATCCAGCCTTCT-GGCTGGTGCACTTGGCC-GGCTCAGGCCAGCATCAGTTCGGCGCGGGGGATAAAGACTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGCTGTGTAATACCCTGTACTGGACTGAGGTTCGCGCATCTGCAAGGAT Cosmospora_vilior_U57348 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGAGCCCGGTTAATCATCCAGCCTTCT-GGCTGGTGCACTTGGCC-GGCTCAGGCCAGCATCAGTTCGGCGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGTTGCGTAATACCCTGTACTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_album_CBS242.29 ????TAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCTCTGGAACGAGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAAACCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCCGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGCAATACCCTGCGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_candidum_CBS237.29 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAAACCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCCGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGTAATACCCTGCGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_cylindroides_AY283551 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_cylindroides_CBS189.61 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTCGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTCCC-GGCCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAGGCGTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGCAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_destructans_CBS102032 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGCTGCGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS112602 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCACTGCGTAATACCCTGTAGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS112606 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCACTGCGTAATACCCTGTAGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS112607 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCACTGCGTAATACCCTGTAGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS156.47 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS264.65 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCC-CC---GGGAGTGTTATAGCCCACTGCGTAATACCCTGTAGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS301.93 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCACTGCGTAATACCCTGTAGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_CBS321.34 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGCTGCGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_destructans_var_crassum_CBS773.83 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGCTGCGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_didymum_CBS305.85 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_didymum_CBS640.77 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Cylindrocarpon_faginatum_CBS217.67 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCTCTGGAACGAGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAAACCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCCGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGTAATACCCTGCGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_heteronema_CBS232.31 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTGCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_macrodidymum_CBS112593 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_macrodidymum_CBS112603 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_macrodidymum_CBS112608 ?????AACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_macrodidymum_CBS112615 ?????AACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_magnusianum_CBS151.29 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_obtusisporum_CBS183.36 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocarpon_victoriae_CBS174.37 ??????ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCATTTGGCGC-GGTGCCTTCCAAGTTCCCTGGAACGGGACGCCTTTGAGGGTGAGAGCCCCGAACGGTCGGTTACCAAGCCTCTGTAATGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCGTGTTAGATCAACCAGGGTTCT-CCCCGGTGCACTCTCTCACGCCCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAAGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTTGCACAATACCCTGCCGTGGACTGAGGTCCGCGCATCTGCAAGGAT Cylindrocarpon_willkommii_CBS226.31 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTGCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGTAATACCCTGTGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Cylindrocladium_floridanum_U17408 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTTGATCATCCTGGGTTCT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTCGCTGCGGGGGATAAAAGCTTTAGGAATGTGGCTCCC-TC---GGGAGTGTTATAGACTATTGCATAATACCCTGCTCCGGACTGAGGTTCGCGCATCTGCAAGGAT Fusarium_culmorum_AF006322 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTTC--G-GGCCCGAGTTGTAATTTGTAGAGGATGATTTTGATGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCT-CTCCAGTGCACTTTTCC-AGTCCAGGCCAGCATCAGTTTTCGCCGGGGGATAAAGGCTTCGGGAATGTGGCTCCCCTC--GGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGTGGGGACTGAGGTTCGCGCTTCTGCAAGGAT Fusarium_fujikuroi_U34528 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC--G-GGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCT-CCCCAGTGCACTTTTCC-AGTCCAGGCCAGCATCAGTTTTCCCCGGGGGATAAAGACTTCGGGAATGTGGCTCTCTTC--GGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGGGGGGACTGAGGTTCGCGCATCTGCAAGGAT Fusarium_oxysporum_AF060383 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC--G-GGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCT-CCCCAGTGCACTTTTCC-AGTCCAGGCCAGCATCAGTTTTCCCCGGGGGATAAAGGCGGCGGGAATGTGGCTCTCTTC--GGGGAGTGTTATAGCCCACCGTGTAATACCCTGGGGGGGACTGAGGTTCGCGCATCTGCAAGGAT Fusarium_solani_L36629 TCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC--G-GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTTGCCCCGGGGGATAAAGGCGTCGGGAATGTGGCTCCC-TCC-GGGGAGTGTTATAGCCCGGCGCGCAATACCCTGAGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Fusarium_verticillioides_U34526 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC--G-GGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCT-CCCCAGTGCACTTTTCC-AGTCCAGGCCAGCATCAGTTTTCCCCGGGGGATAAAGACTTCGGGAATGTGGCTCTCTTC--GGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGCGGGGACTGAGGTTCGCGCATCTGCAAGGAT Haematonectria_haematococca_L36623 CCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC--G-GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCGAACCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCTTGGTTGATCATCCGGGGTTCT-CCCCGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCCCTGGGGGACAAAGGCTTCGGGAACGTGGCTCTC-TCC-GGGGAGTGTTATAGCCCGTTGCGTAATACCCTGTGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Leuconectria_clusiae_U17412 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTTGATCATCCTGGGTTTT-CCCTGGTGCACTCTTCC-AGTTCAGGCCAGCATCAGTTTGTTTCGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTTGTGTAATACCCTGGAGTAGACTGAGGTTCGCGCATCTGCAAGGAT Nectria_cinnabarina_U00748 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTT--GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCTTGGTTAATCATCCAGGGTTCT-CCCTGGTGCACTTGGCC-AGCCCAGGCCAGCATCAGTTTGTCGCGGGGGATAAAGGCGTTGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCTTCGTGTAATACCCTGCTTTAGACTGAGGTTCGCGCATCTGCAAGGAT Nectria_fuckeliana_CBS112466 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCCGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGCTGCGTAATACCCTGTGGCGGACTGAGGTTCGCGCATCTGCAAGGAT Nectria_mariannaea_AY283553 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCTTGGTAGATCAACCTGGGTTCT-CCCTGGTGCACTCTTCCTCGTCCAGGCCAGCATCAGTTCGCTGCGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGTGGACTGAGGTTCGCG-TTCTGCAAGGAT Nectria_pseudotrichia_U17410 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--GTGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTTA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTCAATCATCCAGGGTTCT-CCCTGGTGCACTTTTCC-GGCTCAGGCCAGCATCAGTTTGTCGCGGGGGATAAAGACGTTGGGAATGTGGCTCCC-CC---GGGAGTGTTATAGCCCTTCGTGTAATACCCTGCTTCGGACTGAGGTTCGCGCATCTGCAAGGAT Nectria_ventricosa_L36613 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTC--G-GGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCCCGGTTAATCATCCAGCGTTCT-CGCTGGTGCACTTTTCC-GGCTCAGGCCAGCATCAGTTTGCCTCGGGGGACAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGTTGCGTAATACCCTGGGGCGGACTGAGGTTCGCGCATCTGCATGGAT Neocosmospora_diparietospora_U17413 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTGC-GGGGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCCGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGCTGCGCAATACCCTGCGGCGGACTGAGGTTCGCGC-TCCGCAAGGAT Neocosmospora_endophytica_U17411 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTGC-GG-GCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCCGGTGCACTCTTCC-AGTCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCCCTGCGCAATACCCTGCGGCGGACTGAGGTTCGCGC-TCCGCAAGGAT Neonectria_coccinea_U88124 ????????????????????????????????????TGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAAACCTTTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCCGGTTCATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGTAATACCCTGCGGCGGACTGAGGTTCGCGCATTCGCAAGGAT Neonectria_discophora_CBS112460 CCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACGTGGGCCTGTCGGATCATCCTGGGTTCT-CCCGGGTGCACTCCTTCAGTCCCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAGGCTTCGGGAATGTGGCTCCCCTC--GGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGCGGACTGAGGACCGCGCATCTGCAAGGAT Neonectria_galligena_U88126 ????????????????????????????????????TGAAATCTGGCCCCC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGC-GGTACCTTCCGAGTGCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACGCCAATCCTTTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGAGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCAAGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-GGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCC-TC---GGGAGTGTTATAGCCCGTCGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATTCGCAAGGAT Neonectria_lucida_CBS112455 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAA-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCCCGTCGGATCAACCTGGGTTCT-CCCGGGTGCACTCCTTCGGGTTCAGGCCAGCATCAGTTCGTCGCGGGGGACAAAGGCTTCGGGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGTGGACTGAGGACCGCGCTTCGGCAAGGAT Neonectria_lucida_CBS112457 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCTATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGGCCTGTTGGATCAACTTGGGTTCT-CCCGGGTGCACTCCCTCAGGTTCAGGCCAGCATCAGTTCGGCGCGGGGGATAAAGGTTTCGGGAACGTGGCTCCCCTC--GGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGCTGGACTGAGGACCGCGCGAAAGCAAGGAT Neonectria_radicicola_AY283552 CTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAATTGTAATTTGTAGAGGATGCTTTTGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCCCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTTGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCATTGTGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Neonectria_radicicola_U17415 CTAGTAACGGCGAGTGAAGCGG-AACAGCTCAAATTTGAAATCTGGCCTTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGGTGA-GGTACCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCTTGGTTGATCATCCAGGGTTCT-CCCTGGTGCACTCTTCC-AGCTCAGGCCAGCATCAGTTCGCTGTGGGGGATAAAGGCTTCGGGAATGTGGCTCCT-CC---GGGAGTGTTATAGCCCGCTGCGTAATACCCTGTGGTGGACTGAGGTTCGCGCATCTGCAAGGAT Neonectria_trachosa_CBS112467 ??????ACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTC--G-GGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGC-GGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCCTGTTTGATCAACCTGGGTTCT-CCCGGGTGCACTCTCTCAGGCCTAGGCCAGCATCAGTTCGCCGCGGGGGACAAAGGCCTCGGGAATGTGGCTCCCCTC--GGGGAGTGTTATAGCCCGTTGCGTAATACCCTGCGGCGGACTGAGGACCGCGCGAAAGCAAGGAT Verticillium_dahliae_U17425 TTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTCGAGTTATGGTTCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTAGGAAACCATGCTCATGTGAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATACTCCTTCCAAGGCTAAATACCGGTTAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTCGCTACCAGACGTGGGTTCGGTGGTTCAACCAGGTCCATGACCTGGGGCACTCCGCC-GGCCCAGGCCAGCATCAGTTTCCGTCGGGGG-CAAAGGCGTCGGGAATGTGGCTCTCCTTCGGGGGAGTGTTATAGCCCGTCGCGTCATACCCTTCGGGGGGCTGAGGTACGCGCT-CCGCAAGGAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2657] TITLE its_60_tax; LINK TAXA = Taxa1; DIMENSIONS NCHAR=533; FORMAT DATATYPE=DNA SYMBOLS= "1 C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cylindrocarpon_album_CBS152_29 ??????????????????????CTCCC-111CCCC-TGTG11C1T1CCC1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCCC-111CTCTTTGTTT--1TT-1C1GT-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CCCGCCCCC-?????????-------CCGTCCCCC111TCT1GTGGCGGTCTCGCTGC1G-CTTCCTCCGCGT1GT1GC11C1--CTCGCG-CTGG1GCGC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_cylindroides_AY295301 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCC--111CTCTT-GTTTT-1T--1C1GT-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CGTGCCCT--CGCGGCGCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC11C1--CTCGCT-CTGG1TCGC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_cylindroides_CBS503_67 1TC1TT1CC-G1GT-TT1C111CTCCC-111CCCC-TGTG11C1T1CCC1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCCC-111CTCTT-GTTTT-1T--1C1GC-1-TCTT--CT-G1GT11C1CG1TT111--TC111TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CGTGCCCT--CGCGGCGCG-------CCGCCCCCT111TCT1GTGGCGGTCTCGCTGC1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CCGG1G1GC1-GCGCGGCC1CGCCGTG111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_AF172261 ???????CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTT???? Cylindrocarpon_destructans_CBS112591 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112595 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1TC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112596 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112597 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112599 ????TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112602 ??????1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112606 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1TC1TT1TCGTTGCCTCGGCGGTGCCCCGCTTCGGCGG-------------------CCCGCCC1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112607 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS112610 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGGTG1CC Cylindrocarpon_destructans_CBS153_37 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS156_47 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS264_65 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CTC---111CCCTT-G11TTTTT--1T1TT-1-TCTT--CT-G1GT1C1T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGGGCCCTC-CGGGGCGCG-------CCGGCTCCC111T1C1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS301_93 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCCCTGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTTT1T11C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_CBS321_34 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT1-G1TT1C1TT-111GC-1-TTTT--CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_destructans_var_crassum_CBS773_83 ??????????????????C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT1-G1TT1C1TT-111GC-1-TTTT--CTTG1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_faginatum_CBS217_67 1TC1TT1TC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCCC-111CTCTTTGTTT--1TT-1C1GT-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CCTGCCCCC-CGCGGCGGG-------CCGTCCCCC111TCT1GTGGCGGTCTCGCTGC1G-CTTCCTCCGCGT1GT1GC11C1--CTCGCG-CTGG1GCGC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_heteronema_CBS316_34 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCC1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCCC-111CTCTT-GTTTT-1T--1C1GC-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CGTGCCCTT-CGCGGCGCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGC1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CCGG1G1GC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_macrodidymum_CBS112593 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112594 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C11GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112598 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C11GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112601 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C11GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112603 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C11GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112604 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C11GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112605 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C11GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112608 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112609 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_macrodidymum_CBS112615 ????TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Cylindrocarpon_magnusianum_CBS151_29 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCCC-111CTCTT-GTTTT-1T--1C1GT-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CGTGCCCT--CGCGGCGCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC11C1--CTCGC1-CTGG1TCGC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GTTTG1CC Cylindrocarpon_obtusisporum_CBS183_36 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCC--111CTCTT-GTTTT-1T--1C1GT-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CGTGCCCT--CGCGGCGCG-------CCGTCCCCG111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG111GC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_sp_AY295304 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------CCCGCC-1G1GG1CCCC--111CTCTT-GTTTT-1T--1C1GT-1-TCTT--CT-G1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CGTGCCCT--CGCGGCGCG-------CCGTCCCCG111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG111GC1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Cylindrocarpon_sp_AY295332 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G-------------------CCCGCC-1G1GG1CCCC--111CCCT--G1TT1C1TTT11G11-G-TCTT--CT-G1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---CG1GCCTCC--CGCGCCCG-------CCGTCCCCT111TCT1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCC11CTTCTG11CGTTTG1CC Fusarium_solani_CBS490_63 1TC1TT1CC-G1GTT1T1C-11CTC1T-C11CCC--TGTG11C1T1CCT1111CGTTGCTTCGGCGGG11C-1G1CG-GCCCCGT11C1C----GGGCCGCCCCCGCC-1G1GG1CCCCCT11CTC---TGTTTCT1TT--1TGT-T--TCT-TCT-G1GT1111C11GC111--T1-11TT1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TT1C11CCCTC1GGCCCCC--GGGCCTGGCGTTGGGG1TCGGCG1GGCGCCCCC-TGCGGG---C1C1-CGCCGTCCCCC111T1C1GTGGCGGTCCCGCCGC1G-CTTCC1TTGCGT1GT1GCT11C1CCTCGC11CTGG1G1GCG-GCGCGGCC1CGCCGT1111C1CCC11CTTCTG11-TGTTG1CC Nectria_cinnabarina_AF163025 1TC1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CCTTT1CTGTTGCTTCGGCGGG1TCGCCGT--GCCCTCGGGCCG1CCC-------1GGCGCCCGCG1G1CCC---111CTCTT-GTTTCCTTT-----G-TG1TCT--CT-G1GTG1T1-C1GC111--T1-11TT1111CTTTC11-C11CGG-1TCTCCTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGTTTG-GCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCTTCGGGCTTGGTGTTGGGG1TCGG---CCTGCGGCG--TG1CG-----CGTGGCCGGCCCCG111TCT1GTGGCGGTCTCGCTGT1GTCCTCCTCTGCGT1GT1GC1C1C--CTCGC1-CCGG11CTT1-GCGCGGCC1--CCGTT111CCCC11CTTTCTG11-G111G1CC Neonectria_coprosmae_AY295326 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGGGCCCTC-CGGGGCGCG-------CCGCCTCCC111TTT1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AF220968 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCC-GTTTCGGCGG-------------------CCCGCC-1G1GG1CCC---111CCCTG-T1TT------111GT-1TTCTT--CT-G1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGC1CG-------CCGTCTCCC111TTT1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTG1CC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AF220969 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGTCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT1-G1TT1C1TT-111GC-1-TTTT--T?TG1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AJ007351 ???1TT1CCTG1GT-TT1C-11CTCCCT111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGGC-1G1GG1CCC---111CCCT11G1TT1C1TTT111GT-1-TCTT1-CT-G1GTC11T-G1TT11-GGTC-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1?? Neonectria_radicicola_AJ007352 ???1TT1CCTG1GT-TT1C-11CTCCCT111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT11G1TT1C1TTT111GT-1-TCTT1-CT-G1GTC11T-G1TT111GGTC-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGTG111CCCCCC1CTTCTG111GGTTG1?? Neonectria_radicicola_AJ007354 ???1TT1CCTG1GT-TT1C-11CTCCCT111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT11G1TT1C1TTT1C1GT-1-TCTT1-CT-G1GTC11T-G1TT11-GGTC111TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1?? Neonectria_radicicola_AJ007355 ???1TT1CCTG1GT-TT1C-11CTCCCT111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT11G1TT1C1TTT111GC-1-T1TT1-CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1?? Neonectria_radicicola_AJ007356 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT11G1TT1C1TTT111GC-1-TTTT--CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1?? Neonectria_radicicola_AJ007357 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT1G1TTTT--T-1C1GT-1-TCTT--CT-G1GT111T-G1T-111--T1-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT11C1C1C--CTC1C1-CTGGG111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1?? Neonectria_radicicola_AY295310 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCTC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295311 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGC1CTGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295312 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295313 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295314 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295317 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCCCCGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295319 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCTT-G1TTTT-1T-1C1GT-1-TCTT--CT-G1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGTGCCCCC-CGGGGCGCG-------CCGGCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295328 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGTCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CC-T1-G1TT1C1TT-111GC-1-TTTT--CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295329 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGTCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CC-T1-G1TT1C1TT-111GC-1-TTTT--CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295330 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGTCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT1-G1TT1C1TT-111GC-1-TTTT--CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295331 ???1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT1-G1TT1C1TT-111GC-1-TTTT--CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCCC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_AY295333 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CTC---111CCCTT-G11TTTTT--1C1GTTG-TCTT--CT-G1GT1C1T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CGGGCCCTC-CGGGGCGCG-------CCGCCTCCC111T1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_var_coprosmae_AF220970 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1T-1TTGTTGCCTCGGCGGTGTCT-GTTTCGGC1G-------------------CCCGCC-1G1GG1CCC---111CCCT1-G1TT1C1TT-111GC-1-TTTTT-CT-G1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---CG1GCCCTC-CGGGGCGCG-------CCGTCTCCC111T1T1GTGGCGGTCCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGGCC1CGCCGT1111CCCCCC1CTTCTG111GGTTG1CC Neonectria_radicicola_var_coprosmae_AF220971 ??C1TT1CC-G1GT-TT1C-11CTCCC-111CCCC-TGTG11C1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG-------------------CCCGCC-1G1GG1CTG---111CCCTT-G11TTTTTT-1C1GTT1-TCTT--CT-G1GT1C1T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTTC11CCCTC11GCCCCC--GGGCTCGGTGTTGG1G1CCGG---CG1GGCCC-------------------------------1T1GTGGCGGTCTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGGCC1CGCCGTT111CCCCCC1CTTCTG111GGTTG1CC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2859] TITLE ITS_39_tax; LINK TAXA = Taxa2; DIMENSIONS NCHAR=588; FORMAT DATATYPE=DNA SYMBOLS= "1 C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] CBS112592Campylocarpon_pseudofasciculare 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCTTCCCCTC1CCGGGTGGGCGGCGTGGTTCCGCC-1G1GG1CC1T1TC1111CT---C1TGTTTTTTT-C1G111G-G1TTCCGCTCTG1GT111CC111G111-1CC--1TT1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCT11CCC-----------GGCGCCCTT-CCGCCG---------GCGTCCCGGG------CCCGTCCCCC111TCCC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCGCG-GCCTGG-CC1CGCCGT1111-CCCCCG1-CTTTT1TC--GTGGTG1CC Campylocarpon_fasciculare_CBS112600 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGG1CGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCGC----------CGGCG-----------CCGTCCCTC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_fasciculare_CBS112611 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGG1CGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCGC----------CGGCG-----------CCGTCCCTC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_fasciculare_CBS112612 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGG1CGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCGC----------CGGCG-----------CCGTCCCTC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTTGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_fasciculare_CBS112613 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGG1CGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCGC----------CGGCG-----------CCGTCCCTC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_fasciculare_CBS112614 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGG1CGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCGC----------CGGCG-----------CCGTCCCTC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_fasciculare_CBS113559 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGGGTGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TT1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCTC----------CGGCG-----------CCGTCCCCC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_fasciculare_CBS113560 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCCCTCCCGG-----GGGG1CGCGG-GGTTCCGCC-1G1GG1CCCT1T-111CC----CTCTGTTTTCTT-1G111G-G1TTCCGCTCTG1GT11C11111C111--CC--1TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCCC1CC------------GGCGCCCTC-GCGCGC----------CGGCG-----------CCGTCCCTC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCCCG-GC1CGG-CC1CGCCGT1111-CCCCCT1-CTTCTTGT---GGTTG1CC Campylocarpon_pseudofasciculare_CBS112679 1TC1TT1CC-G1GT-CTCG--11CTC1CC111CCCCTGTG11C-1T1CC1---GTGTTGCTTCGGCGGTCG1CCCCTCCGCCCTTCCCCTC1CCGGGTGGGCGGCGTGGTTCCGCC-1G1GG1CC1T1TC1111CT---C1TGTTTTTTTTC1G111G-G1TTCCGCTCTG1GT111CC111G111-1CC--1TT1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGCG11TTGC1G1TTTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1GCC11CC------------GGCGCCCTC-GCGGGC-----------GTTCGGGG-------CCGTCCCCC111T-CC1TCGGCGGT-C1CGCCGCGG-CGTCCCCTGCGT1GT1CTGC1C--CTCGC1-CCGG1CCGCG-GCCTGG-CC1CGCCGT1111-CCCCCG1-CTTTT1TC--GTGGTG1CC Cylindrocarpon_album_CBS152_29 ???????????????????????CTCCC-111CCCCTGTG11C-1T1CCC1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCCC--111CT----CTTTGTTT--1TT-1C1GT-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CCCGCCCCC-?????????-----------------------CCGTCCCCC111T-CT1GTGGCGGT-CTCGCTGC1G-CTTCCTCCGCGT1GT1GC11C1--CTCGCG-CTGG1GCGC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_cylindroides_AY295301 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCC---111CT----CTT-GTTTT-1T--1C1GT-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CGTGCCCT--CGCGGCGCG-----------------------CCGTCCCCT111T-CT1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC11C1--CTCGCT-CTGG1TCGC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_cylindroides_CBS503_67 1TC1TT1CC-G1GT-TT1C1-11CTCCC-111CCCCTGTG11C-1T1CCC1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCCC--111CT----CTT-GTTTT-1T--1C1GC-1-TCTT---CTG1GT11C1CG1TT111--TC111TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CGTGCCCT--CGCGGCGCG-----------------------CCGCCCCCT111T-CT1GTGGCGGT-CTCGCTGC1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CCGG1G1GC1-GCGCGG-CC1CGCCGTG111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_destructans_CBS112602 ??????1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG--------------------------CCCGCC-1G1GG1CCC----111CC----CTT-G1TTTTT1T11C1GT-1-TCTT---CTG1GT111T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CG1GCCCTC-CGGGGCGCG-----------------------CCGGCTCCC111T-1T1GTGGCGGT-CCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_destructans_CBS264_65 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG--------------------------CCCGCC-1G1GG1CTC----111CC----CTT-G11TTTTT--1T1TT-1-TCTT---CTG1GT1C1T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CGGGCCCTC-CGGGGCGCG-----------------------CCGGCTCCC111T-1C1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_faginatum_CBS217_67 1TC1TT1TC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCCC--111CT----CTTTGTTT--1TT-1C1GT-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CCTGCCCCC-CGCGGCGGG-----------------------CCGTCCCCC111T-CT1GTGGCGGT-CTCGCTGC1G-CTTCCTCCGCGT1GT1GC11C1--CTCGCG-CTGG1GCGC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_heteronema_CBS316_34 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCC1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCCC--111CT----CTT-GTTTT-1T--1C1GC-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CGTGCCCTT-CGCGGCGCG-----------------------CCGTCCCCT111T-CT1GTGGCGGT-CTCGCTGC1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CCGG1G1GC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_ianthothele_var_majus_CBS328_81 1TC1TT1CC-G1GTCTT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1T1TC-TTGCTTCGGCGG1CC1-CCCTC-GCCCCCCGGCG1-----GG-----------GCCCGCC-1G1GG1C-CC1--111CCC11-CTTTGTTTTTGCCTT1C1G-TG11CT--TCTG1GTGG1TTTT1T111--TC111TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGGGC1TGCCTGTTCG1GCGTC1TT1-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGGG11TCGC--------------C1CGGCGGC-CGGGG111----CCC1CCGCCCG1CG--CGCCCCGTCCCCC111T-CT1TCGGCGGT-C1CGTCGCGG-CCTCTTGTGCGT1GT1GCT11C1CCTCGC1-CCGG1GCCCG-1CGTGGTCC1CGCCGT1111-CCCCCG1-CTTTTT1CC-11GTTG1CC Cylindrocarpon_ianthothele_var_minus_CBS266_36 ????????????TC-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT-T11CGTTGCTTCGGCGG1C11-CCCTC-GCCTT1CCGCGG-----GG-----------GCCCGCC-1G1GG1C-CC1--11-CCC11CCTTT1TTTTT1TCTT11CC-T1C1TC--TCTG1GTGG1TTTT1T111--TC111TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TT11C1CCCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGGG11C1GCGG1-----------TCGGCCCCC--CGGGG----------CCGCG11GC-----CCCCGTCCCCC111T-GC1TCGGCGGT-C1CGCCGCGG-CCTCTTGCGCGT1GT1GCT11C1CCTCGCG-CCGG1GCCCG-TCGTGGTCC1CGCCGCT111-CCCCCG1-CTTTTT1C--11GTTG1CC Cylindrocarpon_macrodidymum_CBS112615 ????TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1-TTTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G--------------------------CCCGCC-1G1GG1CCCC---111CC----CT--G1TT1C1TTT11G11-G-TCTT---CTG1GT111CCG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCT-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CG1GCCTCC---GCGCCCG-----------------------CCGTCCCCT111T-CT1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGG-CC1CGCCGTT111-CCCCC11-CTTCTG11--CGTTTG1CC Cylindrocarpon_magnusianum_CBS151_29 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCCC--111CT----CTT-GTTTT-1T--1C1GT-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CGTGCCCT--CGCGGCGCG-----------------------CCGTCCCCT111T-CT1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC11C1--CTCGC1-CTGG1TCGC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GTTTG1CC Cylindrocarpon_obtusisporum_CBS183_36 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCC---111CT----CTT-GTTTT-1T--1C1GT-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CGTGCCCT--CGCGGCGCG-----------------------CCGTCCCCG111T-CT1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG111GC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_olidum_CBS215_67 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT---1TGTTGCTTCGGCGG1CC1-CCCC1-1CCCCCTCGGGG-----CG--1GG------GGCCGCC-1G1GG1C-CC1--111CCC11-CTGTTTTTTCCGT11CG11-1CCT1T--TCTG1GTGG11TT1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGGC1C11GGCG------------G1GGCTCCC-CCGGG1GC----CC--CCCCGCCCG-------CCGTCCCCC111T-GC1GTGGCGGT-C1CGCCGCGG-CCCCCCGTGCGT1GT1GC11C1C-CTCGC1-CCGG1GCCCG-TCGTGC-CC1CGCCGT1111-CCCCCG1-CTTTT1C1--1GGTTG1CC Cylindrocarpon_olidum_var_crassum_CBS216_67 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11CT1T1CC1GT1CCGTTGCTTCGGCGG1CC1-CCCCG-1CCCCT1CGGGG-----CG-11GG------GCCCGCC-1G1GG1C1CCT1-111TTC11-1TGT1TCTTGCCCTG1111-TTTT1T--TCTG1GTGG11TTTTT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGGC1C11GGCG------------CTGGC1CCT-CCGGG1GC----CGCGCG-CGCCCG-------CCGTCCCCC111T-CC1GTGGCGGTTCGCGCCGTGT-GT1CCTC1GCGC1GT1GC11CG1-CTCGCT-CCGGG1CCCTCCTGCG11CC1CGCCGT1111-CCCCCG1-CTTTTTTTTCTGGTTG1CC Cylindrocarpon_sp_AY295304 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1--TCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG--------------------------CCCGCC-1G1GG1CCCC---111CT----CTT-GTTTT-1T--1C1GT-1-TCTT---CTG1GT11C1CG1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CGTGCCCT--CGCGGCGCG-----------------------CCGTCCCCG111T-CT1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG111GC1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Cylindrocarpon_sp_AY295334 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1---CGTTGCTTCGGCGG1CC1CCCC11CCCCCTCGGGGCG---------1GG------GGCCGCC-1G1GG1C-CC1--111CCC11-CTGTTTTTTCCGT11CG11-1CCT1T--TCTG1GTGG11TT1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTCG1GCCCCC--GGGCTCGGTGTTGGGG1TCGGC1C11GGCG------------G1GGCTCCCCCGGG1GCC--------CCCCGCCCG-------CCGTCCCCC111T-GC1GTGGCGGT-C1CGTCGCGG-CCCCCCGTGCGT1GT1GC11C1C-CTCGC1-CCGG1GCCCG-TCGTGC-CC1CGCCGT1111-CCCCCG1-CTTTT1C1--1GGTTG1CC Cylindrocarpon_sp_AY295335 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCT1---CGTTGCTTCGGCGG1CC1CCCC11CCCCCTCGGGGCG---------1GG------GGCCGCC-1G1GG1C-CC1--111CCC11-CTGTTTTTTCCGT11CG11-1CCT1T--TCTG1GTGG11TT1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTCG1GCCCCC--GGGCTCGGTGTTGGGG1TCGGC1C11GGCG------------G1GGCTCCCCCGGG1GCCC-------CCCCGCCCG-------CCGTCCCCC111T-GC1GTGGCGGT-C1CGTCGCGG-CCCCCCGTGCGT1GT1GC11C1C-CTCGC1-CCGG1GCCCG-TCGTGC-CC1CGCCGT1111-CCCCCG1-CTTTT1C1--1GGTTG1CC Fusarium_solani_CBS490_63 1TC1TT1CC-G1GTT1T1C--11CTC1T-C11CCC-TGTG11C-1T1CCT1111CGTTGCTTCGGCGGG11C-1G1CG-GCCCCGT11C1C-----GGGCCGC------CCCCGCC-1G1GG1CCCCCT-11CTC-------TGTTTCT1TT--1TGT-T--TCT--TCTG1GT1111C11GC111--T1-11TT1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TT1-C11CCCTC1GGCCCCC--GGGCCTGGCGTTGGGG1TCGGCG1------------------GGCGCCCCC-TGCGGG--------C1C1-CG-----------CCGTCCCCC111T-1C1GTGGCGGT-CCCGCCGC1G-CTTCC1TTGCGT1GT1GCT11C1CCTCGC11CTGG1G1GCG-GCGCGG-CC1CGCCGT1111-C1CCC11-CTTCTG11---TGTTG1CC Nectria_cinnabarina_AF163025 1TC1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CCTTT1CTGTTGCTTCGGCGGG1TCGCCGT--GCCCTCGGGCCG1CCC--------------1GGCGCCCGCG1G1CCC----111CT----CTT-GTTTCCTTT-----G-TG1TCT---CTG1GTG1T1-C1GC111--T1-11TT1111CTTTC11-C11CGG-1TCTCCTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGTTTG-GCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCTTCGGGCTTGGTGTTGGGG1TCGG---------------------CCTGCGGCG--TG1CG----------CGTGG-----------CCGGCCCCG111T-CT1GTGGCGGT-CTCGCTGT1GTCCTCCTCTGCGT1GT1GC1C1C--CTCGC1-CCGG11CTT1-GCGCGG-CC1--CCGTT111-CCCC11C-TTTCTG11---G111G1CC Neonectria_lucida_CBS112456 1TC1TT1TC-G1GT--T1CGC11CTCCC-111CCCCTGTG11C-1T1CCT---1CGTTGCTTCGGCGG1CC1-CCCCG-GCTT11CC1CCG-----GG-----------GCCCGCC-1G1GG1C-CC1--11-CCC111CTTTGT1TTTTGCTTT111-TG11CT--TCTG1GTGG1TTTT1T111--TC111TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGGGC1TGCCTGTTCG1GCGTC1TT1-C1CCCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGGGG1T-----------------CGCGCCTCC-1GTGCCTC----CGGGC1-CGGGGGC--CGCCCCGTCCCCC111T-GC1TCGGCGGT-CCCGCCGCGG-CCTCTTGCGCGT1GT1GCT11C1CCTCGCG-CCGG1TCCCG-1CGTGGCCC1CGCCGT1111-CCCCCG1-CTTTTTTC--11GTTG1CC Neonectria_macroconidialis_AY29532 ??C1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1T-GTCGTTGCCTCGGCGGTGCCC-GCTCCGGCGG-------------------------TCCCGCC-1G1GG1CCCCC--111CC----CTT-G11TCT1TT-1CTGT1T1TCTT---CTG1GT111-CG1TG111-1TC111TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCG-1GT1TTCTCGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTCG1GCCCCC--GGGCTCGGTGTTGG1G1CCGGCG1GGCCCCGCC11CCGCTCCCTCTCCCCT-CCGGGGGCGGGGGGG1CGGGGG1CGGGGCGCGCCGCCTCCC111T-1T1GTGGCGGT-CCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGG-CC1CGCCGT1111CCCCCC111CTTCTG11--1GGTTG1CC Neonectria_radicicola_AJ007353 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTCCG1C1G--------------------------CCCGCC-1G1GG1CCC----111CC----CT11G1TT1C1TTT11G11-G-TCTT---CTG1GT11-CCG1TT111--T1-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGGGG1TCGG---------------------CG1GCCTCC---GCGCCCG-----------------------CCGTCCCCC111T-CT1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGG-CC1CGCCGTT111-CCCCC11-CTTCTG11--1GGTTG1?? Neonectria_radicicola_AJ007354 ???1TT1CCTG1GT-TT1C--11CTCCCT111CCCCTGTG11C-1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G--------------------------CCCGCC-1G1GG1CCC----111CC----CT11G1TT1C1TTT1C1GT-1-TCTT1--CTG1GTC11T-G1TT11-GGTC111TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CG1GCCCTC-CGGGGCGCG-----------------------CCGGCTCCC111T-1T1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1?? Neonectria_radicicola_AJ007355 ???1TT1CCTG1GT-TT1C--11CTCCCT111CCCCTGTG11C-1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GTTTCGGC1G--------------------------CCCGCC-1G1GG1CCC----111CC----CT11G1TT1C1TTT111GC-1-T1TT1--CTG1GTC11T-G1TT111--TC-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CG1GCCCCC-CGGGGCGCG-----------------------CCGTCTCCC111T-1T1GTGGCGGT-CCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGG-CC1CGCCGT1111-CCCCCC1-CTTCTG11--1GGTTG1?? Neonectria_radicicola_AJ007357 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1T-1TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G--------------------------CCCGCC-1G1GG1CCC----111CC----CTT1G1TTTT--T-1C1GT-1-TCTT---CTG1GT111T-G1T-111--T1-11TC1111CTTTC111C11CGGG1TCTCTTGGGTTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCCC1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CGTGCCCCC-CGGGGCGCG-----------------------CCGGCTCCC111T-1T1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT11C1C1C--CTC1C1-CTGGG111C1-GCGTGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1?? Neonectria_radicicola_AY295311 ??C1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G--------------------------CCCGCC-1G1GG1CCC----111CC----CTT-G1TTTT-1T-1C1GT-1-TCTT---CTG1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CGTGCCCCCCCGGGGCGCG-----------------------CCGGCTCCC111T-1T1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGG-C1CTGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Neonectria_radicicola_AY295317 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1T--TTGTTGCCTCGGCGGTGCCT-GCTTCGGC1G--------------------------CCCGCC-1G1GG1CCC----111CC----CTT-G1TTTT-1T-1C1GT-1-TCTT---CTG1GT111T-G1TT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CGTGCCCCCCCGGGGCGCG-----------------------CCGGCTCCC111T-1T1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGG1111C1-GCGTGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Neonectria_radicicola_AY295329 ???1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1T-1TTGTTGCCTCGGCGGTGTCT-GTTTCGGC1G--------------------------CCCGCC-1G1GG1CCC----111CC-----T1-G1TT1C1TT-111GC-1-TTTT---CTG1GTC11T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-TTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTCCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGTGTTGG1G1TCGG---------------------CG1GCCCCC-CGGGGCGCG-----------------------CCGTCTCCC111T-1T1GTGGCGGT-CCCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGTGG-CC1CGCCGT1111-CCCCCC1-CTTCTG11--1GGTTG1CC Neonectria_radicicola_var_coprosmae_AF220971 ??C1TT1CC-G1GT-TT1C--11CTCCC-111CCCCTGTG11C-1T1CC1TT1TCGTTGCCTCGGCGGTGCCC-GCTTCGGCGG--------------------------CCCGCC-1G1GG1CTG----111CC----CTT-G11TTTTTT-1C1GTT1-TCTT---CTG1GT1C1T-G1TT111--TC-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11TC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1TTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTCGGTGTTGG1G1CCGG---------------------CG1GGCCC------------------------------------------------1T1GTGGCGGT-CTCGCTGT1G-CTTCCTCTGCGT1GT1GC1C1C--CTCGC1-CTGGG111C1-GCGCGG-CC1CGCCGTT111-CCCCCC1-CTTCTG11--1GGTTG1CC Neonectria_trachosa_CBS112467 ???????????????????--11CTCCC-111CCCCTGTG11C-1T1CC1---1TGTTGCTTCGGCGG11CCTCCCTC-GCCTCGCTGCGG-----GG-----------GCCCGCC-CG1GG1C-CC1--111TTC11-CTGT1TTTT1TTTTTC111-C-GT1T--TCTG1GTGG11TTTTT111--T1-11TC1111CTTTC11-C11CGG-1TCTCTTGG-CTCTGGC1TCG1TG11G11CGC1GCG111TGCG1T11GT11TGTG11TTGC1G11TTC1GTG11CC1TCG11TCTTTG11CGC1C1TTGCGCCCGCC-1GT1CTCTGGCGGGC1TGCCTGTTCG1GCGTC1TTT-C11CCCTC11GCCCCC--GGGCTTGGCGTTGGGG1TCGGC1C11GGCGCGCGCG------CGG1CCCCT--CGGGG------CG1GCGCCGCCCG-------CCGTCCCCC111T-CC1GTGGCGGT-C1CGTCGCGG-CCTTCT1TGCGT1GT1GC11C1C-CTCGC1-CCGG1GCCCG-TCGTGC-CC1CGCCGT1111-CCCCCG1-CT1TTTTC--TGGTTG1CC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2712] TITLE beta_tubulin_572_bp; LINK TAXA = Taxa5; DIMENSIONS NCHAR=572; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Campylocarpon_fasciculare_CBS112611 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACCGCCTCAACACAACCACAACCACAACCACAACCACAACAACACAGCTCACGACAGCAGTCATGACTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGTC--CTTTGTCCCTGGGAAACACAAC----AACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Campylocarpon_fasciculare_CBS112613_112614 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACCGCCTCAACACAACCACAACCACAACCACAACCACAACAACACAGCTCACGACAGCAGTCATGACTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGTC--CTTTGTCCCTGGGAAACACAAC----AACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS113554_113558 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACCGCCTCAACACAACCACAACCACAACCACAACCACAACAACACAGCTCACGACAGCAGTCATGACTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGTC--CTTTGTCCCTGGGAAACACAAC----AACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Campylocarpon_fasciculare_CBS113557 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACCGCCTCAACACAACCACAACCACAACCACAACCACAACAACACAGCTCACGACAGCAGTCATGACTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGTC--CTTTGTCCCTGGGAAACACAAC----AACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Campylocarpon_fasciculare_CBS113559_112600 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACCGCCTCAACACAACCACAACCACAACCACAACCACAACAACACAGCTCACGACAGCAGTCATGACTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGTC--CTTTGTCCCTGGGAAACACAAC----AACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS113560_112612 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACCGCCTCAACACAACCACAACCACAACCACAACCACAACAACACAGCTCACGACAGCAGTCATGACTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGTC--CTTTGTCCCTGGGAAACACAAC----AACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_pseudofasciculare_CBS112592 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTCCCACCGCCTCAAC-----------------CACAACCACAACAACACAGCTCGCGGCAGCAATCACGCCTTGATAT-TGGAACGAGATGGCTAACGACAATGTTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTCGTC-CCTTCGCGTCCGAAAAACACCACACGGCAATCATCTAACCTCTCATAT-TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTTGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCAGCTCGCTCATC--CTTTGTCCCTGG-AAACACAGC----AACTAAACTTACACAATAC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCC????? Campylocarpon_pseudofasciculare_CBS112679 TGC---CCCTGATCCTACCCCGCCGCCG-AATCATTTTCCACTGCCTCAACT-----ACAACCACAACCACAACCACAACAACACAGCTCGCGGCAGCAATCACGACTTGATAT-TGGAACGAGATGGCTAACGACAATATTTTTCTTCAAATATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTTGTC-CCTTCGCGTCCGAAACACACCACACGGCAATCATCTAACCTCTCATAT-TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTTGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCAGCTCGCTCATC--CTTTGTCTCTGG-AAACACAGC----AACTAAACTTACACAACAC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS102032 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACTTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CATCCTCTTCAACGATCCGACGTGCGGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTGTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATCTACCCATCTGCCCTTATCCAGG-AGGTGTCG-----AACTCACAC-----CACGC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS112591 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112595 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112596 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112597 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112599 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112602 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112606 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112607 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTGTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112610 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS113553 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS113556 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS153_37 TGC---CCCTGATTCTACCCCGCCGCTG-CAT----TTCCACCGCCTTTAG--------------------------GACAACAAAGCTCGGGACTTCAACCACGACGTGATTT-TGGGACAAGATGGCTGAC-------TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CATCCTCTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATCTACTCATCTGCCCCTATACAGG-AGGTGTCG-----AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS156_47 TGC---CCCTGATTCTACCCCGCCGCTG-CAT----TTCCACCGCCTTTAG--------------------------GACAACAAAGCTCGGGACTTCAACCACGACGTGATTT-TGGGACAAGATGGCTGAC-------TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CATCCTCTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATCTACTCATCTGCCCTTATACAGG-AGGTGTCG-----AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGT??????? Cylindrocarpon_destructans_CBS264_65 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGACGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CATCCTCCTCAACGATTCGACGTGCGGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTT{CT}TGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATCTACTA---TGCCACCATACAGG-AAGTGTCC-----AACTCACAC-----CGCGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS301_93 TGC---CCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACGTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT--CTGCCCCTATACATG-AAGTGTCA-----AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS321_34 TGCTGCCCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACTTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CATCCTCTTCAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATCTACCCATCTGCCCCTATCCAAG-AGCTGTTG-----AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Cylindrocarpon_destructans_var_crassum_CBS773_83 TGCTGCCCCTGATTCTACCCCGCCGCAG-CAT----TTCCACCGCCTTCAG--------------------------GACAACAAAGCTCGGGACTTCAACCACGACGTGATTT-TGGGACAAGATGGCTGACCATGAC-TTTCTTCTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCTT-CATCCTCTTCAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATCTACCCATCTGCCCCTATCCAAG-AGCTGTTG-----AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Cylindrocarpon_macrodidymum_CBS112593 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCAGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112598 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112601_112594 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112603_112605 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112604 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112608 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCAGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112609 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112615 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Cylindrocarpon_macrodidymum_CBS113552 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCAGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Cylindrocarpon_macrodidymum_CBS113555 TGC---CCCTGATTCTACCCCGCTGCAG-CAT----TTCCACCGCCTCGAG--------------------------CAAAACAAAGC-CACGGCTTCAACCACGACGTGATTC-TGGGACATGATGGCTAA-TATGAC--TTCTTGTGCAATATAGGTCCACCTCCAGACCGGCCAGTGCGTAAGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGCCTGCTCTGCCTCTGG-AAGCACGA-----AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Fusarium_sp_U34422 TGC---CCCTGATTCTACCCCGCTGGGCGGTGGCAGCTCAACGACAAT------------------------------GCACGATAGCTAGCAGCTTTA-CCAT-ACCTTCTGT-CAAGACA-AGAAGCTAATCAGATC---TCTTCTCTACAATAGGTTCACCTCCAGACCGGTCAGTGCGTAAGTGCTCATCGCTTCCTCAACGTCGCAT---ACGGGGGAT-GCTCACAATGTTGAT-CAGGGTAACCAAATCGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGTGTCTACTTCAACGAGGTATGC-----------ATTAAC-AGTCAATGTCAAG-AATTCCCA-----AGCTCACAC------AACT--AGGCCTCTGGCAACAAGTATGTTCCCCGAGCTGTCCTCGTCGATCTTGAGCCTGGTACCATGGACGCCGTCCGTGCTGGTCCCTTCGGTCAGCTCTTCCGTCCTGACAACTTCGTTTTCGGTCAGTCCGGTGC Nectria_fuckeliana_CBS112466 TGC---CCCTGATTCTACCCCGCCGAAG-GGC----TTCCACCGCCTCCAG--------------------------CACAACAAAGATCGTGGCCGCAACCACGACGTGATTA-TGGGACGAGATGGCTAA--CTGT---GTCTTCTGCAATATAGGTCCACATCCAGACCGGCCAGTGCGTAAGTGCCTACCTCCTCCTCGATTGTTCGCCGTGCGGGGATTCACTAACAACGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAACGGTGTCTACGCCGGCAACTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGAAAAAAAAC-CCAACTCCGTCATTATCTGCCGAATGCCC-----AACTCACACCACAAAACCCTTAGGCCTCTGGCAACAAGTATGTCCCCCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGGTTTTCCGCCCCGA??????????????????????????? Neonectria_discophora_CBS112460 TGC---CCCTGATTCTACCCCGCCGG---AATCATTTCGCACCACGGCCTCAG-----------------CAACAACAACAACACAGATCGCCGACTCGAACACGACGTGATATGTGGAATAAGATGGCTGACTGTGTGTGTTTTCTGCAAATATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTATTC---ATCGCATCCGAATAGCATCATGCGGGCATTCGCTGATCTC-CTTT--TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCTTGCCCAATCTGCCCCCATTGCCTGCGAGAAGATGCAAACAAACTCA-----CACCATAT--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCG???????????????????????????????????????????????????????????????? Neonectria_lucida_CBS112455 TGC---CCCTGATTCTACCCCGCCGG---AATCACCTCGCATTGCCTCAACAC-----------------------CAACAACGCCGCTCGCCGACTCGAACACGACGTGACAGACGGACCAAGATGGCTAACCATGTGTATTTCCCGCGAATATAGGTCCACCTCCAGACCGGTCAGTGCGTAAGTTCTC-TCCAAGCACCCGAATACCATCGCGTGGCCATC-GCTGACCTC-CTTC--AAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTTTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATTTGGTGCATCTGCCCCTTGGGTTGTGAGAAAATGCAGA--CAAACTCA-----CACCACAT--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGC???????????????????????????????????????? Neonectria_trachosa_CBS112467 TGC---CCCTGATTCTACCCCGCTGG----AT-ATTT----CCACCTCAACAC-----------------------CAGCAACACAGCTCGCCAACTCGAAAACGACGTGATACATGGGATAAAATGGCTGACTATGTGTGTTTTCTTCAAATATAGGTTCACCTTCAGACCGGTCAGTGCGTAAGTGCTT-CCCTCGCATCCGAAGAGCACTACGTGGGCATTCGCTGATCTC-CCC---TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTTGACAGCAATGGTGTTTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATTTTAGCAAATCTGC-----------GAGACAATAAACA----AACTCA-----CACGACAC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCCGTCCGTGCCGGTCCTTTCGGTCAGC???????????????????????????????????????? ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2761] TITLE beta_tubulin_386_bp; LINK TAXA = Taxa3; DIMENSIONS NCHAR=386; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Campylocarpon_fasciculare_CBS112600 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS112611 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Campylocarpon_fasciculare_CBS112612 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS112613 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS112614 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS113554 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Campylocarpon_fasciculare_CBS113557 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Campylocarpon_fasciculare_CBS113558 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Campylocarpon_fasciculare_CBS113559 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_fasciculare_CBS113560 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGTCCATCGTCTAACCTCTCATAT-TAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCATCTCACTCGT-C--CTTTGTCCCTGGGAAACACAACAACTAATATTGGACTACAC--AGGCCTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCTGTCCGCGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Campylocarpon_pseudofasciculare_CBS112592 AGTCGTC-CCTTCGCGTCCGAAAAACACCACACGGCAATCATCTAACCTCTCATAT-TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTTGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCAGCTCGCTCAT-C--CTTTGTCCCTGG-AAACACAGCAACTAAACTTACACAATAC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCC????? Campylocarpon_pseudofasciculare_CBS112679 AGTTGTC-CCTTCGCGTCCGAAACACACCACACGGCAATCATCTAACCTCTCATAT-TAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTTGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGCGAACCAGCTCGCTCAT-C--CTTTGTCTCTGG-AAACACAGCAACTAAACTTACACAACAC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGATGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_cylindroides_AY297172 ???????????????????????TCCAACGTGCGGGGATTCACTGACAATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCCGGCGAGCATGGCCTCGACAGCAACGGTGTCTACGCCGGTAACTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTTCGTGGA-GAATCGCCTCAT-CTGCCCAT-CTCTCAGAGATGCCA-AACTCACAC-----CACAC--AGGCTTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Cylindrocarpon_cylindroides_AY297211 ???????????????????????TCCAACGTGCGGGGATTCACTGACAATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCCGGCGAGCATGGCCTCGACAGCAACGGTGTCTACGCCGGTAACTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTTCGTGGA-GAATCGCCTCAT-CTGCCCAT-CTCTCAGAGATGCCA-AACTCACAC-----CACAC--AGGCTTCTGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS102032 AGTGCTT-CATCCTCTTCAACGATCCGACGTGCGGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTGTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCTTATCCAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS112591 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112595 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112596 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112597 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112599 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112602 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112606 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112607 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTGTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS112610 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_destructans_CBS113553 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS113556 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS153_37 AGTGCTT-CATCCTCTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATACAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS156_47 AGTGCTT-CATCCTCTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCTTATACAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGT??????? Cylindrocarpon_destructans_CBS264_65 AGTGCTT-CATCCTCCTCAACGATTCGACGTGCGGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTT{CT}TGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTA---TGCCACCATACAGG-AAGTGTCC-AACTCACAC-----CGCGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS301_93 AGTGCTT-CCTCCTCTTCAACGATCCGACGTGCCGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGCGA---AATC-TGCT---CTGCCCCTATACATG-AAGTGTCA-AACTCACAC-----CACGT--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Cylindrocarpon_destructans_CBS321_34 AGTGCTT-CATCCTCTTCAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCCTATCCAAG-AGCTGTTG-AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Cylindrocarpon_destructans_var_crassum_CBS773_83 AGTGCTT-CATCCTCTTCAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCCTATCCAAG-AGCTGTTG-AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Cylindrocarpon_macrodidymum_CBS112593 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCAGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTTGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112594 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112598 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112601 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112603 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112604 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112605 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112608 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCAGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112609 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTT????????????????????? Cylindrocarpon_macrodidymum_CBS112615 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTAATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Cylindrocarpon_macrodidymum_CBS113552 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCAGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Cylindrocarpon_macrodidymum_CBS113555 AGTGCCT-CCTCTTCCTCGTTGA-CAACACGGCGGAGATT--CTAACAACGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTGC-CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCG???? Cylindrocarpon_sp_AY297175 ???????????????????????TC-AACGTGCGGGGAT{CT}CACTGACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGCCTTGACAGCAACGGTGTCTACGCCGGTAACTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTTCGTGGA-GAATCACCTCAT-CTGCCCA---TCTCGGAGATGCCA-AACTCACAC-----CACAC--AGGCTTCCGGCAACAAGTATGT{CT}CCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGAGC Cylindrocarpon_sp_AY297176 ???????????????????????TC-AACGTGCGGGGATTCACTGACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGCCTTGACAGCAACGGTGTCTACGCCGGTAACTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTTCGTGGA-GAATCACCTCAT-CTGCCCA---TCTCGGAGATGCCA-AACTCACAC-----CACAC--AGGCTTCCGGCAACAAGTATGTTCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGTCCCG{AG}CAACTTCGTTTTCGGTCAGTCCGGAGC Cylindrocarpon_sp_AY297198 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGTGTCTACAACGGCACCTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGATCAAACCCTGCTG--CTGCTCTGCCTCTGG-AAGCACGA-AACTCACAC-----CACCC--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGCCCCTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCTGGTGC Fusarium_sp_U34422 AGTGCTC---ATCGCTTCCTCAACGTCGCATACGGGGGATGCTCACAATGTTG-AT-CAGGGTAACCAAATCGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTCCAGCTCGAGCGCATGAGTGTCTACTTCAACGAGGTATGCATTAACAGTCAATGTC-A--AGAATTCCCAAGCTCACACAACT--------------------AGGCCTCTGGCAACAAGTATGTTCCCCGAGCTGTCCTCGTCGATCTTGAGCCT-GGTACCATGGACGCCGTCCGTGCTGGTCCCTTCGGTCAGCTCTTCCGTCCTGACAACTTCGTTTTCGGTCAGTCCGGTGC Nectria_fuckeliana_CBS112466 AGTGCCTACCTCCTCCTCGATTGTTCGCCGTGCGGGGATTCACTAACAACGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTTGACAGCAACGGTGTCTACGCCGGCAACTCCGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGAAAAAAAAC-CCAAC-TCCGTCATTATCTGCCGAATGCCC-AACTCACACCACAAAACCCTTAGGCCTCTGGCAACAAGTATGTCCCCCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGGTTTTCCGCCCCGA??????????????????????????? Neonectria_coprosmae_AY297192 ??????????????CTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCC-TATCCCGG-AGC-GTCG-ATCTAACAC-----CACGC--AGGCCACTGGAAACAAGTATGT-CCTCGCGCCGTCCTCGTCGATCTCGAGCCT-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTTGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_galligena_AY297216 ???????????????????????TCTAACGTGCGGGGAT--ACTGACAATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGCCTCGACAGCAACGGTGTCTACGCCGGTAACTCCGAGCTTCAACTCGAGCGCATGAGCGTCTACTTCAACGAGGTTCGTGCG-GAATCCCCTCAA-CTGCTCA---TCTTAGAGATATCA-AACTCACAC-----AACAC--AGGCTTCCGGCAACAAGTATGTTCCTCGCGCCGTCCTCG-CGATCTCGAGCCC-GGTACCATGGACGCTGTCCGCGCCGGTCCCTTCGGCCAGCTTTTCCGCCCCGACAACTTCGTTTTCGGTCAGTCCGGTGC Neonectria_macroconidialis_AY297193 ??????????????C{CG}TCAAAACTCCGACGTGCAGGAATTCGCTGACGATGTGTGGATAGGGCAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGCCTCGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTCCAGCTTGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGAA-GAACC-AGCTCATGTACCTATTTTCGGG-ACACGTCA-AACTCACAC-----CACCA--AGGCCTCTGGCAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297179 ????????????????TCAACGATCCGACGTGCGGGGATTCGCTAACCATGCGTGGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACGC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297181 ?????????????????????GATCCGACGTGCGGGGATTCGCTAACGATGCCTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGTGG---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297182 ?????????????????????????????????????ATTCGCTAACGATGCCTCGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTATGTGG---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297184 ??????????????CTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297185 ??????????????CTTCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCC-TATACAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCG-CCCGACAA{AC}TTCGTCTTCGGTCAGTC{CG}GGTGC Neonectria_radicicola_AY297187 ????????????????TCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCATGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCTTCTGGAAACAAGTATGTCCCTCGCGCCGTTCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297188 ????????????????TCAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATACAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297191 ??????????????CTTCAACGATCCGACGTGCGGGGATTCGCTAACCATGCGTGGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACGC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297194 ????????????????TCAACGATCCGACGTGCGGGGATTCGCTAACAATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGCACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TGCT---CTGCCCCTATACAGG-AAGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCCTTCGGCCAGCTCTTCCG-CCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297195 ??????????????CTTCAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCCTATCCAAG-AGCTGTTG-AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Neonectria_radicicola_AY297196 ?????????????????CAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCCTATCCAAG-AGCTGTTG-AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Neonectria_radicicola_AY297197 ?????????????????????????CGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCCTATCCAAG-AGCTGTTG-AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGT-CCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCG-CCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297202 ????????????????TCAACGATCCGACGTGCGGGGATTCGCTAACCATGCGTGGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACGC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297205 ??????????????CTTCAACGATCCGACGTGCGGGGATTCGCTAACCATGCGTGGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACGC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCCCGGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297212 ???????????????????ACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATACAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297213 ?????????????????CAACGATCCGACGTGCGGGGATTCGCTAACGATGCGTGGATAGGGTAACCAAATTGGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATACAGG-AGGTGTCG-AACTCACAC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297214 ??????????????CTTCAACGATCCGACGTGCGGGGATTCGCTAACCATGCGTGGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACGC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCG-CCCGACAACTTCGTCTTCGGTCAGTCCGGTGC Neonectria_radicicola_AY297215 ?????????????????CAACGATCCGACGTGCAGGCATTCGCTAACGATGCGTGGATAGGGTAACCAAATCGGTGCTGCTTTCTGGCAGACCATCTCTAGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACCCATCTGCCCCTATCCAAG-AGCTGTTG-AACTCACAC-----TAGGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCCGTCCTTGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGC Neonectria_radicicola_AY297217 ???????????????TTCAACGATCCGACGTGCGGGGATTCGCTAAC-ATGCGTGGACAGGGTAACCAAATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGTCTCGACAGCAATGGTGTCTACAACGGTACCTCCGAGCTGCAGCTCGAGCGCATGAGCGTCTACTTCAACGAGGTACGTGA---AATC-TACTCATCTGCCCCTATCCAGG-AGGTGTCG-AACTCACGC-----CACGC--AGGCCTCTGGAAACAAGTATGTCCCTCGCGCTGTCCTCGTCGATCTCGAGCCC-GGTACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGC ; END; BEGIN TREES; TITLE Tb7168; LINK TAXA = Taxa5; TRANSLATE 1 Fusarium_sp_U34422, 2 Cylindrocarpon_destructans_CBS264_65, 3 Cylindrocarpon_destructans_CBS102032, 4 Cylindrocarpon_destructans_var_crassum_CBS773_83, 5 Cylindrocarpon_destructans_CBS321_34, 6 Cylindrocarpon_destructans_CBS156_47, 7 Cylindrocarpon_destructans_CBS153_37, 8 Cylindrocarpon_destructans_CBS113553, 9 Cylindrocarpon_destructans_CBS301_93, 10 Cylindrocarpon_destructans_CBS113556, 11 Cylindrocarpon_destructans_CBS112595, 12 Cylindrocarpon_destructans_CBS112606, 13 Cylindrocarpon_destructans_CBS112591, 14 Cylindrocarpon_destructans_CBS112610, 15 Cylindrocarpon_destructans_CBS112599, 16 Cylindrocarpon_destructans_CBS112602, 17 Cylindrocarpon_destructans_CBS112607, 18 Cylindrocarpon_destructans_CBS112597, 19 Cylindrocarpon_destructans_CBS112596, 20 Nectria_fuckeliana_CBS112466, 21 Cylindrocarpon_macrodidymum_CBS113552, 22 Cylindrocarpon_macrodidymum_CBS112593, 23 Cylindrocarpon_macrodidymum_CBS112608, 24 Cylindrocarpon_macrodidymum_CBS113555, 25 Cylindrocarpon_macrodidymum_CBS112615, 26 Cylindrocarpon_macrodidymum_CBS112603_112605, 27 Cylindrocarpon_macrodidymum_CBS112601_112594, 28 Cylindrocarpon_macrodidymum_CBS112598, 29 Cylindrocarpon_macrodidymum_CBS112604, 30 Cylindrocarpon_macrodidymum_CBS112609, 31 Campylocarpon_fasciculare_CBS112611, 32 Campylocarpon_fasciculare_CBS113554_113558, 33 Campylocarpon_fasciculare_CBS113557, 34 Campylocarpon_fasciculare_CBS112613_112614, 35 Campylocarpon_fasciculare_CBS113559_112600, 36 Campylocarpon_fasciculare_CBS113560_112612, 37 Neonectria_lucida_CBS112455, 38 Neonectria_trachosa_CBS112467, 39 Neonectria_discophora_CBS112460, 40 Campylocarpon_pseudofasciculare_CBS112679, 41 Campylocarpon_pseudofasciculare_CBS112592; TREE Fig._5 = [&R] (1,(((41,40),(36,35,34,33,32,31)),((39,38),37)),((((30,29,28,(27,26,25),24),23,22,21),20),(((19,18,17,16,15,14,13,12,11,10,9,8),2),((7,6),((5,4),3))))); END; BEGIN TREES; TITLE Tb7169; LINK TAXA = Taxa2; TRANSLATE 1 Neonectria_radicicola_AY295311, 2 Neonectria_radicicola_AY295317, 3 Neonectria_radicicola_AJ007357, 4 Cylindrocarpon_destructans_CBS112602, 5 Neonectria_radicicola_var_coprosmae_AF220971, 6 Cylindrocarpon_destructans_CBS264_65, 7 Neonectria_radicicola_AJ007354, 8 Neonectria_radicicola_AY295329, 9 Neonectria_radicicola_AJ007355, 10 Neonectria_radicicola_AJ007353, 11 Cylindrocarpon_macrodidymum_CBS112615, 12 Neonectria_macroconidialis_AY29532, 13 Cylindrocarpon_sp_AY295304, 14 Cylindrocarpon_obtusisporum_CBS183_36, 15 Cylindrocarpon_cylindroides_CBS503_67, 16 Cylindrocarpon_heteronema_CBS316_34, 17 Cylindrocarpon_faginatum_CBS217_67, 18 Cylindrocarpon_album_CBS152_29, 19 Cylindrocarpon_cylindroides_AY295301, 20 Cylindrocarpon_magnusianum_CBS151_29, 21 Nectria_cinnabarina_AF163025, 22 Campylocarpon_pseudofasciculare_CBS112679, 23 CBS112592Campylocarpon_pseudofasciculare, 24 Campylocarpon_fasciculare_CBS113559, 25 Campylocarpon_fasciculare_CBS113560, 26 Campylocarpon_fasciculare_CBS112614, 27 Campylocarpon_fasciculare_CBS112611, 28 Campylocarpon_fasciculare_CBS112613, 29 Campylocarpon_fasciculare_CBS112612, 30 Campylocarpon_fasciculare_CBS112600, 31 Neonectria_trachosa_CBS112467, 32 Cylindrocarpon_olidum_var_crassum_CBS216_67, 33 Cylindrocarpon_olidum_CBS215_67, 34 Cylindrocarpon_ianthothele_var_minus_CBS266_36, 35 Neonectria_lucida_CBS112456, 36 Cylindrocarpon_ianthothele_var_majus_CBS328_81, 37 Cylindrocarpon_sp_AY295335, 38 Cylindrocarpon_sp_AY295334, 39 Fusarium_solani_CBS490_63; TREE Fig._3 = [&R] (39,(((((38,37),33),(32,31)),(36,(35,34))),(((30,29,28,27,26,25),24),(23,22))),(21,(((((20,19),(18,17)),(16,15)),14,13),(((12,(6,5)),4),(((((11,10),(9,8)),7),3),(2,1)))))); END; BEGIN TREES; TITLE Tb7167; LINK TAXA = Taxa4; TRANSLATE 1 Cylindrocarpon_cylindroides_CBS189.61, 2 Cylindrocarpon_willkommii_CBS226.31, 3 Neonectria_galligena_U88126, 4 Cylindrocarpon_heteronema_CBS232.31, 5 Cylindrocarpon_faginatum_CBS217.67, 6 Neonectria_coccinea_U88124, 7 Cylindrocarpon_candidum_CBS237.29, 8 Cylindrocarpon_victoriae_CBS174.37, 9 Neonectria_discophora_CBS112460, 10 Neonectria_trachosa_CBS112467, 11 Neonectria_lucida_CBS112455, 12 Cylindrocarpon_album_CBS242.29, 13 Cylindrocarpon_macrodidymum_CBS112608, 14 Cylindrocarpon_macrodidymum_CBS112593, 15 Cylindrocarpon_macrodidymum_CBS112603, 16 Cylindrocarpon_macrodidymum_CBS112615, 17 Cylindrocarpon_didymum_CBS305.85, 18 Cylindrocarpon_destructans_CBS156.47, 19 Neonectria_radicicola_AY283552, 20 Cylindrocarpon_didymum_CBS640.77, 21 Cylindrocarpon_destructans_CBS264.65, 22 Cylindrocarpon_destructans_CBS301.93, 23 Cylindrocarpon_destructans_CBS112607, 24 Cylindrocarpon_destructans_CBS112602, 25 Cylindrocarpon_destructans_CBS112606, 26 Cylindrocarpon_destructans_CBS321.34, 27 Cylindrocarpon_destructans_var_crassum_CBS773.83, 28 Neonectria_lucida_CBS112457, 29 Nectria_mariannaea_AY283553, 30 Leuconectria_clusiae_U17412, 31 Calonectria_morganii_U17409, 32 Cylindrocladium_floridanum_U17408, 33 Nectria_cinnabarina_U00748, 34 Nectria_pseudotrichia_U17410, 35 Cosmospora_vilior_U57348, 36 Cosmospora_episphaeria_U88100, 37 Nectria_fuckeliana_CBS112466, 38 Cylindrocarpon_magnusianum_CBS151.29, 39 Cylindrocarpon_cylindroides_AY283551, 40 Cylindrocarpon_obtusisporum_CBS183.36, 41 Cylindrocarpon_destructans_CBS102032, 42 Neonectria_radicicola_U17415, 43 Neocosmospora_diparietospora_U17413, 44 Neocosmospora_endophytica_U17411, 45 Haematonectria_haematococca_L36623, 46 Fusarium_solani_L36629, 47 Nectria_ventricosa_L36613, 48 Albonectria_albosuccinea_U34554, 49 Albonectria_rigidiuscula_U88104, 50 Fusarium_culmorum_AF006322, 51 Fusarium_oxysporum_AF060383, 52 Fusarium_fujikuroi_U34528, 53 Fusarium_verticillioides_U34526, 54 Campylocarpon_pseudofasciculare_CBS112592, 55 Campylocarpon_fasciculare_CBS113560, 56 Campylocarpon_fasciculare_CBS112614, 57 Campylocarpon_fasciculare_CBS112612, 58 Verticillium_dahliae_U17425; TREE Fig._2 = [&R] (58,((57,56,55),54),(((((((53,52),51),50),(49,48)),((((((((42,41,(27,26)),(25,24,23,22,21)),(20,19,18,17)),((16,15,14,13),(((((((12,5),7,6),37),1),(4,3,2)),40,39),38))),(34,33)),(32,31)),30),29)),((47,(36,35)),((46,45),(44,43)))),((((28,11),9),10),8))); END; BEGIN TREES; TITLE Tb7170; LINK TAXA = Taxa1; TRANSLATE 1 Cylindrocarpon_macrodidymum_CBS112594, 2 Cylindrocarpon_macrodidymum_CBS112604, 3 Cylindrocarpon_macrodidymum_CBS112603, 4 Cylindrocarpon_macrodidymum_CBS112601, 5 Cylindrocarpon_macrodidymum_CBS112615, 6 Cylindrocarpon_macrodidymum_CBS112609, 7 Cylindrocarpon_sp_AY295332, 8 Cylindrocarpon_macrodidymum_CBS112605, 9 Cylindrocarpon_macrodidymum_CBS112593, 10 Cylindrocarpon_macrodidymum_CBS112608, 11 Cylindrocarpon_macrodidymum_CBS112598, 12 Cylindrocarpon_sp_AY295304, 13 Cylindrocarpon_obtusisporum_CBS183_36, 14 Cylindrocarpon_cylindroides_CBS503_67, 15 Cylindrocarpon_heteronema_CBS316_34, 16 Cylindrocarpon_faginatum_CBS217_67, 17 Cylindrocarpon_album_CBS152_29, 18 Cylindrocarpon_cylindroides_AY295301, 19 Cylindrocarpon_magnusianum_CBS151_29, 20 Nectria_cinnabarina_AF163025, 21 Fusarium_solani_CBS490_63, 22 Neonectria_radicicola_AY295319, 23 Neonectria_radicicola_AY295317, 24 Neonectria_radicicola_AY295314, 25 Neonectria_radicicola_AY295312, 26 Cylindrocarpon_destructans_CBS156_47, 27 Neonectria_radicicola_AF220968, 28 Neonectria_coprosmae_AY295326, 29 Neonectria_radicicola_AJ007357, 30 Neonectria_radicicola_AY295310, 31 Cylindrocarpon_destructans_CBS153_37, 32 Neonectria_radicicola_AY295311, 33 Neonectria_radicicola_AY295313, 34 Cylindrocarpon_destructans_AF172261, 35 Cylindrocarpon_destructans_CBS112610, 36 Cylindrocarpon_destructans_CBS301_93, 37 Cylindrocarpon_destructans_CBS112599, 38 Cylindrocarpon_destructans_CBS112607, 39 Cylindrocarpon_destructans_CBS112602, 40 Cylindrocarpon_destructans_CBS112597, 41 Cylindrocarpon_destructans_CBS112596, 42 Cylindrocarpon_destructans_CBS112591, 43 Cylindrocarpon_destructans_CBS112595, 44 Cylindrocarpon_destructans_CBS112606, 45 Neonectria_radicicola_var_coprosmae_AF220971, 46 Neonectria_radicicola_AY295333, 47 Cylindrocarpon_destructans_CBS264_65, 48 Neonectria_radicicola_AJ007352, 49 Neonectria_radicicola_AJ007351, 50 Neonectria_radicicola_AJ007354, 51 Cylindrocarpon_destructans_var_crassum_CBS773_83, 52 Neonectria_radicicola_AY295331, 53 Neonectria_radicicola_AJ007355, 54 Neonectria_radicicola_var_coprosmae_AF220970, 55 Cylindrocarpon_destructans_CBS321_34, 56 Neonectria_radicicola_AJ007356, 57 Neonectria_radicicola_AF220969, 58 Neonectria_radicicola_AY295330, 59 Neonectria_radicicola_AY295329, 60 Neonectria_radicicola_AY295328; TREE Fig._4 = [&R] (21,20,(((((19,18),(17,16)),(15,14)),(13,12)),((11,10,9,8,7,6,5,4,3,2,1),(((((60,59,58,(56,55,53,52,51)),57,54),49,48),27),(50,(((((47,46),45),((44,43),42,41,40,39,38,37,36,35)),((34,33,32,31,29,26,25,24,23,22),30)),28)))))); END; BEGIN TREES; TITLE Tb7166; LINK TAXA = Taxa3; TRANSLATE 1 Cylindrocarpon_destructans_CBS112607, 2 Cylindrocarpon_destructans_CBS112596, 3 Neonectria_galligena_AY297216, 4 Cylindrocarpon_sp_AY297176, 5 Cylindrocarpon_sp_AY297175, 6 Cylindrocarpon_cylindroides_AY297172, 7 Cylindrocarpon_cylindroides_AY297211, 8 Nectria_fuckeliana_CBS112466, 9 Cylindrocarpon_sp_AY297198, 10 Cylindrocarpon_macrodidymum_CBS113552, 11 Cylindrocarpon_macrodidymum_CBS113555, 12 Cylindrocarpon_macrodidymum_CBS112593, 13 Cylindrocarpon_macrodidymum_CBS112608, 14 Cylindrocarpon_macrodidymum_CBS112615, 15 Cylindrocarpon_macrodidymum_CBS112594, 16 Cylindrocarpon_macrodidymum_CBS112603, 17 Cylindrocarpon_macrodidymum_CBS112605, 18 Cylindrocarpon_macrodidymum_CBS112601, 19 Cylindrocarpon_macrodidymum_CBS112604, 20 Cylindrocarpon_macrodidymum_CBS112598, 21 Cylindrocarpon_macrodidymum_CBS112609, 22 Campylocarpon_fasciculare_CBS112611, 23 Campylocarpon_fasciculare_CBS113557, 24 Campylocarpon_fasciculare_CBS113554, 25 Campylocarpon_fasciculare_CBS113558, 26 Campylocarpon_fasciculare_CBS112613, 27 Campylocarpon_fasciculare_CBS113560, 28 Campylocarpon_fasciculare_CBS112600, 29 Campylocarpon_fasciculare_CBS113559, 30 Campylocarpon_pseudofasciculare_CBS112592, 31 Campylocarpon_pseudofasciculare_CBS112679, 32 Campylocarpon_fasciculare_CBS112614, 33 Campylocarpon_fasciculare_CBS112612, 34 Fusarium_sp_U34422, 35 Neonectria_macroconidialis_AY297193, 36 Cylindrocarpon_destructans_CBS264_65, 37 Neonectria_radicicola_AY297191, 38 Neonectria_radicicola_AY297214, 39 Neonectria_radicicola_AY297205, 40 Neonectria_radicicola_AY297202, 41 Neonectria_radicicola_AY297179, 42 Neonectria_radicicola_AY297217, 43 Neonectria_radicicola_AY297182, 44 Neonectria_radicicola_AY297181, 45 Neonectria_radicicola_AY297187, 46 Neonectria_radicicola_AY297184, 47 Cylindrocarpon_destructans_CBS102032, 48 Neonectria_radicicola_AY297197, 49 Neonectria_radicicola_AY297195, 50 Neonectria_radicicola_AY297196, 51 Neonectria_radicicola_AY297215, 52 Cylindrocarpon_destructans_var_crassum_CBS773_83, 53 Cylindrocarpon_destructans_CBS321_34, 54 Neonectria_coprosmae_AY297192, 55 Neonectria_radicicola_AY297185, 56 Cylindrocarpon_destructans_CBS156_47, 57 Neonectria_radicicola_AY297188, 58 Neonectria_radicicola_AY297213, 59 Neonectria_radicicola_AY297212, 60 Cylindrocarpon_destructans_CBS153_37, 61 Neonectria_radicicola_AY297194, 62 Cylindrocarpon_destructans_CBS113556, 63 Cylindrocarpon_destructans_CBS301_93, 64 Cylindrocarpon_destructans_CBS113553, 65 Cylindrocarpon_destructans_CBS112595, 66 Cylindrocarpon_destructans_CBS112599, 67 Cylindrocarpon_destructans_CBS112597, 68 Cylindrocarpon_destructans_CBS112602, 69 Cylindrocarpon_destructans_CBS112606, 70 Cylindrocarpon_destructans_CBS112610, 71 Cylindrocarpon_destructans_CBS112591; TREE Fig._6 = [&R] (34,((33,32,29,28,27,26,25,24,23,22),(31,30)),((((21,20,19,(18,17,16,15,14),11,9),13,12,10),(8,(((2,1,71,70,69,68,67,66,65,64,63,62),(61,(((60,59,58,57,56,55,(54,(((53,52,51,50,49),48),47),46,45,(44,43))),(42,41,40,39,38,37)),36))),35))),(((7,6),(5,4)),3))); END;