#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:48 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., & Takamatsu S. 2012. Erysiphe paracarpinicola: a new species of Erysiphe sect. Uncinula on Carpinus cordata (Betulaceae). Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12900] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=8; TAXLABELS 'Erysiphe arcuata ex_Carpinus_betulus_MUMH3197' 'Erysiphe arcuata ex_Carpinus_betulus_MUMH3237' 'Erysiphe carpini ex_Carpinus_cordata_MUMH207' 'Erysiphe carpini-cordatae ex_Carpinus_cordata_MUMH3408' 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_MUMH3503' 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_MUMH3640' 'Erysiphe carpinicola ex_Carpinus_japonica_MUMH243' 'Erysiphe carpinicola ex_Carpinus_japonica_MUMH3547' ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=41; TAXLABELS 'Erysiphe abbreviata ex_Quercus_AB271785' 'Erysiphe adunca ex_Salix_vulpina_AB022374' 'Erysiphe alphitoides ex_Quercus_AB237811' 'Erysiphe alphitoides ex_Quercus_AB257431' 'Erysiphe aquilegiae ex_Cimicifuga_simplex_AB022405' 'Erysiphe arcuata ex_Carpinus_betulus_AB252459' 'Erysiphe arcuata ex_Carpinus_tschonoskii_AB252473' 'Erysiphe asiatica ex_Castanopsis_diversifolia_JQ220157' 'Erysiphe asiatica ex_Castanopsis_echinocarpa_JQ220158' 'Erysiphe australiana ex_Lagerstroemia_indica_AB022407' 'Erysiphe carpini-cordatae ex_Carpinus_cordata_AB252465' 'Erysiphe carpini-cordatae ex_Carpinus_cordata_AB252466' 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_AB252470' 'Erysiphe carpinicola ex_Carpinus_japonica_AB252467' 'Erysiphe carpinicola ex_Carpinus_japonica_AB252469' 'Erysiphe epigena ex_Quercus_AB292720' 'Erysiphe epigena ex_Quercus_AB292722' 'Erysiphe fimbriata ex_Carpinus_laxiflora_AB333839' 'Erysiphe friesii ex_Rhamnus_AB022382' 'Erysiphe friesii var. dahurica_ex_Rhamnus_japonica_AB022382' 'Erysiphe glycines var. glycines ex_Desmodium_podocarpum_AB022397' 'Erysiphe gracilis var. gracilis_ex_Quercus_glauca_AB022357' 'Erysiphe heraclei ex_Bifora_testiculata_AB103066' 'Erysiphe heraclei ex_Daucus_carrota_AB103069' 'Erysiphe hypophylla ex_Quercus_AB292715' 'Erysiphe hypophylla ex_Quercus_AB292716' 'Erysiphe japonica ex_Quercus_AB022415' 'Erysiphe javanica ex_Castanopsis_javanica_JQ220159' 'Erysiphe javanica ex_Castanopsis_javanica_JQ220160' 'Erysiphe monoperidiata ex_Castanopsis_calathiformis_JQ220153' 'Erysiphe monoperidiata ex_Castanopsis_indica_JQ220154' 'Erysiphe mori ex_Morus_australis_AB022418' 'Erysiphe paeoniae ex_Paeonia_AB257438' 'Erysiphe paracarpinicola ex_Carpinus_cordata_AB252464' 'Erysiphe pisi ex_Medicago_AB102942' 'Erysiphe pulchra ex_Swida_controversa_AB022389' 'Erysiphe quercicola ex_Quercus_AB197135' 'Erysiphe quercicola ex_Quercus_AB292691' 'Erysiphe simulans ex_Rosa_AB022395' 'Erysiphe trinae ex_Quercus_agrifolia_AB022350' 'Erysphe carpini-laxiflorae ex_Carpinus_laxiflora_AB252471' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42761] TITLE Erysiphe_Fig._2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1817; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] 'Erysiphe arcuata ex_Carpinus_betulus_MUMH3197' GGGGGAAGCCACTGCTGGTAGCCGCCGTACGGCGTGATCTAGCGGATGGTATCCTCCTCTTGCGGAACGCATGGCACACGCG-AGCACCGACCTCACCAGGGCGGGACTCGATG-----TGTGGCGGACCGTTCTGTGGGGAACTCAGTGGGGGCAAATGGATAGTGGGTACGGGCACCGGTGAGACGTCAGTCACGCCGCGCTCTGTAGCCACTGTGCTGGATCACTGTATGGTGGTCTGGCGCTGCCCAGTGTAACATTCGGCCTCGTTCGCGAGGTGTC---GAGGGAGCGTGCTCCTTCGGTACGATAGATACCTGGTTGATTCTGCCAGTAGTCATATGCTTGTCTCCAGAGCGTAAGGTCCAGC-CATGGCATCTGTCGTGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTATATCTTGTTGCTTTGGCGGACCGGGTACGCGCACGA-----------------------CG-CCCGCAAGG-GCGGGTGAGCAGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACTCATCCCAAACTC--AAGTTGT-CTTGCAGTCTAAGGTTTAT---TATGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCCTCGAGCTACT-------TTGATGTGGCTCTGGTGTTGGGGCT-CGCCGCGATTCGCGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CGAGGCCCTGCCAACAA-----CT--CTTAT-----------------------------------------------------------------------------CGGGTCCCTTCACACGGA------TTCATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGC-CTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GCTGATCATCCA-GAGTTC-TCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCCATTTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGA 'Erysiphe arcuata ex_Carpinus_betulus_MUMH3237' GGGGGAAGCCACTGCTGGTAGCCGCCGTACGGCGTGATCTAGCGGATGGTATCCTCCTCTTGCGGAACGCATGGCACACGCG-AGCACCGACCTCACCAGGGCGGGACTCGATG-----TGTGGCGGACCGTTCTGTGGGGAACTCAGTGGGGGCAAATGGATAGTGGGTACGGGCACCGGTGAGACGTCAGTCACGCCGCGCTCTGTAGCCACTGTGCTGGATCACTGTATGGTGGTCTGGCGCTGCCCAGTGTAACATTCGGCCTCGTTCGCGAGGTGTC---GAGGGAGCGTGCTCCTTCGGTACGATAGATACCTGGTTGATTCTGCCAGTAGTCATATGCTTGTCTCCAGAGCGTAAGGTCCAGC-CATGGCATCTGTCGTGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTATATCTTGTTGCTTTGGCGGACCGGGTACGCGCACGA-----------------------CG-CCCGCAAGG-GCGGGTGAGCAGCCCACCGGCTTCGGCTGGGGCGTGTCCGCCAGAGACTCATCCCAAACTC--AAGTTGT-CTTGCAGTCTAAGGTTTAT---TATGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCCTCGAGCTACT-------TTGATGTGGCTCTGGTGTTGGGGCT-CGCCGCGAT{AT}CGCGGTGGCCCTTAAAGACAGTGGCGGGCTTCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGA-CGAGGCCCTGCCAACAA-----CT--CTTAT-----------------------------------------------------------------------------CGGGTCCCTTCACACGGA------TTCATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGC-CTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GCTGATCATCCA-GAGTTC-TCTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCCATTTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGA 'Erysiphe carpini ex_Carpinus_cordata_MUMH207' GGGGGAAGCTGCCGCTGATAGCCGCCTTCGGGCGTGATGCAGTGGACGGTATCCTCCTCTTGCGGGACGTATGTTACAGGCGCGGAGCGAACCCTCTCGTGGGGTGGTGACGTGGTCA-TGTGGCGGACCGTCCTGTGGGGAACTCAGTGGGGGCAATGGGAGAGTGGGCGTTGACCTCGATGCTGCGTTCGTGGCTCGGGAGTCGGCGTCCGCTGTGATT--CGACTGCTTGCGGTCGAAGCACCGTCCAGTGTAATGTTCGGCCTCGCTCGCGAGGTGCC---GAGAGAGCGTGCTCTCTCGCGACGATAGATACCTGGTTGATTCTGCCAGTAGTCATATGCTTGTCTCCAGAGCGTGATGTCCAGGCCGTAGCATCTGCTGCGGGCTGGGCCGACCCTCCCACCCGTGTCGACTTCTATCTCGTTGCTTTGGCGGACCGGACGCATC----------------------------TG-CTCCCCTGGCTCTCGTGATGAG------------GGCTGGGTCGTGTCCGCCAGAGGATGTAACAAAACACGTATGTCGTACCTGTAGTCTAAAGTTTACGCAAGCAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCCCTCGAGCCCCCATTTCTGGTGGTGTGGTTCCGGTGTTGGAGTG-CGTCAC--GCTGTGGCGCCTCTGAAAGACAGTGGC-GGTTCCGGCGTGAGCTCTACGCGTAGTACATTACTTCCCGCGACAGA?AGACGGACGGCGACTTGCCAGCAAGCGAAGC--CCCGAA-GCGAACCAATGCACACGCAAATCGAGAGGTGACACGTGCTCCGGCGCCAGCGGCCCGGTCGCGACCACTCCTTGGCTGTCGCGTTCGCGTGGG-TTTCTTTCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGGCTGATCATCCATGAGTTTGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGTCGGAGCAACGTAGCTCCCTTCGAGGAGTGTTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC-TTTGGGGCGCATCATCGACCGATCCTGA---------- 'Erysiphe carpini-cordatae ex_Carpinus_cordata_MUMH3408' ------------------------------GGCGTGATCTAGCGGCTGGTATCCTCCTCCGGCGGGGCGTATGGCGCAATCG-AAGACCAGCCTGTCATGGGCGGGAATCGAAA-----TGTGCCGGACCGTCCTGTGGGAAACTCAGTGGGGGCAAATGGATGGTGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGCGCGTTCCCAGAGCGTGAAGCTCAGT-CGTCGCATCAGCGGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATTTTGTTGCTTTGGCGGGCCGGGTACGCCCACGG-----------------------CGTCTATCATGGCGTGCGCGAGCAACCCACCGGCTTCGGCTGGAGCGTGCCCGCCAGAGACTCTA-CCAAACTC--ATGTTGT-CTTGCAGTCTAAGGTTTAT---TATGTAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA--CCCCCTCAAGCTGCC-------TTGGTGTGGCTATGGTGTTGGGGCT-CGCCGA--TTCGCGGCGGCTCTTAAAGAAAGTGGC-GATCCGAGTGTGGGCTCTACGCGTAGTAC-TTGCTTCTCGCGACAGAGTGACGC-CGAGGATCCGCCA--AAACAAACC--CTTAT--------------------------------------------------------------------------------GTCCCGTAACACGGA-------TCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGAC-TTGTGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCT-GCTGATCATCTA-GGGTTCTTCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCTGTAGGAACGTAGCTCCTCTCGGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTG----------------------------------------------- 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_MUMH3503' ------------------------------GGCGTGATCCGGCGGATAGTATCCTCCTCTTGCGGGGCGTATGGCACAGGCGTAGCGTCAGTC---CGAGAGGATGGCGATGCGGAAACTGTGGCGGACCGTCCTGTGGGGAACTCAGTGGGGGCAATGGGATAGTGGGCAGCGGCTC-GAAGGTGCCCTTGTGGCCCGGGAGTGCGCGTTCACTG----------------------------------------------------------------------------------------------------------------------------------------CAGAGCGTGAGGCCCAGT-CGTAGCACCTGCTGCGGTCGGGGCCGACCCTCCCACCCGTGTCGACTTCTATCATGTTGCTTTGGCGGACCGGACGCGTGGCCGAGTCGTATCGCGCGACAAGGTGTCTG-CTCCCTCGGCTTTCGTTATGAG------------AGCTGGGTCGCGTCCGCCAGAGACCCCCTCAAAATACGTATGTTGTCCCTGTAGTCTAAAGTTTAAATAAAGTAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCCTCAAGCTCCCACTT-TGGTGGTGTGGCTTCGGTGTTGGAGCTGCGCCAG--TTGCTGGCGGCTCTGAAAGGCAGTGGC-GGTCCCAGCTTCGGCTCTACGCGTAGTACTTTG-TTCTCGCGACAGGGTGAGGC-TGACGACTTGCCAACAAGTGAACCTTCCCTTAAGGGCGAAGACCGTAAAGAAGATAGCGATATGGGTTGTGAACAAGGCCGAATCCGGTCGTAGCGCCCCGCATCATCTGGTGTCTCAAACCCGGGAGTTCCATTATAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGGCTGATCATCCA-GAGTTT-TCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTCGGGGAGTGTTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCCTTCGGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTG-AACGCAGGTGA---------------------------------------------- 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_MUMH3640' GGGGGAAGCTGCTGCAGGTAGCCGCCCTTGGGCGTGATCCGGCGGATAGTATCCTCCTCTTGCGGGGCGTATGGCACAGGCGTAGCGTCAGTC---CGAGAGGATGGCGATGCGGAAACTGTGGCGGACCGTCCTGTGGGGAACTCAGTGGGGGCAATGGGATAGTGGGCAGCGGCTC-GAAGGTGCCCTTGTGGCCCGGGAGTGCGCGTTCACTGTGGCG--CGGCTGCAAGCAGTCGTGCCGCCGTCCAGTATCATGTTCGGCCTCGTTCGCGAGGTATCGGGGAGAGTGTACACTCTCTCGCTACGATAGATACCTGGTTGATTCTGCCAGTAGTCATATGCTTGTCTCCAGAGCGTGAGGCCCAGT-CGTAGCACCTGCTGCGGTCGGGGCCGACCCTCCCACCCGTGTCGACTTCTATCATGTTGCTTTGGCGGACCGGACGCGTGGCCGAGTCGTATCGCGCGACAAGGTGTCTG-CTCCCTCGGCTTTCGTTATGAG------------AGCTGGGTCGCGTCCGCCAGAGACCCCCTCAAAATACGTATGTTGTCCCTGTAGTCTAAAGTTTAAATAAAGTAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACA-CCCCCCTCAAGCTCCCACTT-TGGTGGTGTGGCTTCGGTGTTGGAGCTGCGCCAG--TTGCTGGCGGCTCTGAAAGGCAGTGGC-GGTCCCAGCTTCGGCTCTACGCGTAGTACTTTG-TTCTCGCGACAGGGTGAGGC-TGACGACTTGCCAACAAGTGAACCTTCCCTTAAGGGCGAAGACCGTAAAGAAGATAGCGATATGGGTTGTGAACAAGGCCGAATCCGGTCGTAGCGCCCCGCATCATCTGGTGTCTCAAACCCGGGAGTTCCATTA????TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGGCTGATCATCCA-GAGTTT-TCTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCCGGAGAAACGTAGCTCCTCTCGGGGAGTGTTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCCTTCGGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAAACCCATACGCGGAATGAAAGTGAAACG----------------------------------------------------- 'Erysiphe carpinicola ex_Carpinus_japonica_MUMH243' ------------------------------GGCGTGATGCAGTGGACGGTCTCCTCCTCTTGCGGAGCGTATGTGACAGGTGCGGAGCGCACCCCTTCGAGGGGTGGTGACGTAGCCA-TGTGGCGGACCGCTCTGTGAGGAACTCAGTGGGGGCAATAGGAGAGTGGGCGTAGGCTCTGATGATGCTCTCGTAGCTCGGGAGTCTGCGTCCGCTGTGGTT--CGACTGCGTGCAGTCGAAGCACCCTCCAGTGTAATATTCGGCCTCGCTCGCGAGGTGCC---GGGAGAGCGTGCTCTCTCGCGACGATAGATACCTGGTTGATTCTGCCAGTAGTCATATGCTTGTCT-CAGAGCGTGAGGTCCAGG-CGTGGCACCTGCCGCGATCTGGGCCGACCCTCCCACCCGTGTCGACTTCTATCTCGTTGCTTTGGCGGACCGGACGCGTCG---------------------------CG-CTCCCCTGGCTCTCGTGATGAG------------GGCTGGGTCGCGTCCGCCAGAGACCGTATCAAAACACGTATGTTGTTCCTGTAGTCTAAAGTTTACGCAAGCAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCCTCGAGCCCCCATTTCTGATGGTGTGGTTCCGGCGTTGGAGTG-CGTCCC--CGCGGGGCGCCTCTGAAAACCAGTGGC-GGTTCCGGCGTGAGCTCTACGCGTAGTACAATACTCCCCGCGACAGAGAGACGACCGGCGACTTGCCAGCAACCGAAAC--CCTACATGCGAAAAAGCGTACACG-AATGCGAGAGGTAG-ACGTGCTCCGGC--------------CGATACCACTCTGCTGTGACGGCTTTGGCGTGGG-TTTCTTCCACAGG-TGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGGCTGATCATCCATGAGTTCGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGGAGCAACGTAGCTCCCTTCGGGGAGTGTTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTCGGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTG-AACGTAGGTGAGAACCCC-TTTGGGGCGCATCATCGACCGATCCTGATGTCTTCGGA 'Erysiphe carpinicola ex_Carpinus_japonica_MUMH3547' GGGGGAAGCCGCCGCTGATAGCCGCCTTCGGGCGTGATGCAGTGGACGGTCTCCTCCTCTTGCGGAGCGTATGTGACAGGTGCGGAGCGCACCCCTTCGAGGGGTGGTGACGTAGCCA-TGTGGCGGACCGCTCTGTGAGGAACTCAGTGGGGGCAATAGGAGAGTGGGCGTAGGCTCTGATGATGCTCTCGTAGCTCGGGAGTCTGCGTCCGCTGTGGTT--CGACTGCGTGCAGTCGAAGCACCCTCCAGTGTAATATTCGGCCTCGCTCGCGAGGTGCC---GGGAGAGCGTGCTCTCTCGCGACGATAGATACCTGGTTGATTCTGCCAGTAGTCATATGCTTGTCT-CAGAGCGTGAGGCTCAGG-CGTGGCACCTGCCGCGATCTGGGCCGACCCTCCCACCCGTGTCGACTTCTATCTCGTTGCTTTGGCGGACCGGACGCGTCG---------------------------CG-CTCCCCTGGCTCTCGTGATGAG------------GGCTGGGTCGCGTCCGCCAGAGACCGTATCAAAACACGTATGTTGTTCCTGTAGTCTAAAGTTTACGCAAGCAAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCCCTCGAGCCCCCATTTCTGATGGTGTGGTTCCGG{CT}GTTGGAGTG-CGTCCC--CGCGGGGCGCCTCTGAAAACCAGTGGC-GGTTCCGGCGTGAGCTCTACGCGTAGTACAATACTCCCCGCGACAGAGAGACGACCGGCGACTTGCCAGCAACCGAAAC--CCTACATGCGAAAAAGCGTACACG-AATGCGAGAGGTAG-ACGTGCTCCGGC--------------CGATACCACTCTGCTGTGACGGCTTTGGCGTGGG-TTTCTTCCACAGGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCTCGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M42760] TITLE Erysiphe_28S_Fig._1; LINK TAXA = Taxa2; DIMENSIONS NCHAR=815; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] 'Erysiphe abbreviata ex_Quercus_AB271785' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCT-GCCGATCACCCGGA-GTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTGGCTCCCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------- 'Erysiphe adunca ex_Salix_vulpina_AB022374' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACACC-ACTGATCCGCGAGG-GTTCT-CTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCC-GAAGGAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTAAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTC-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe alphitoides ex_Quercus_AB237811' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GTCGATCACCCCGA-GTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTGGCTCCCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------- 'Erysiphe alphitoides ex_Quercus_AB257431' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GTCGATCACCCCGA-GTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTGGCTCCCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT----------------------------------------------------------------------------------------------------------- 'Erysiphe aquilegiae ex_Cimicifuga_simplex_AB022405' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCCCGA-GTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAATGTAGCTCTCTTC---GG-GGAGTG--TTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe arcuata ex_Carpinus_betulus_AB252459' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GCTGATCATCCAGA-GTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCATTT----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe arcuata ex_Carpinus_tschonoskii_AB252473' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GCTGATCATCCAGA-GTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------- 'Erysiphe asiatica ex_Castanopsis_diversifolia_JQ220157' ------------------------------------------------------------------------------------GTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGACAAAGACCGGGAGGAACGTAGCTCCCTTTCGCGG-GGAGTG--TTATAGCCTCTGGTGTCATACAGCCCAACTGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC 'Erysiphe asiatica ex_Castanopsis_echinocarpa_JQ220158' -----------------------------------------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGACAAAGACCGGGAGGAACGTAGCTCCCTTTCGCGG-GGAGTG--TTATAGCCTCTGGTGTCATACAGCCCAACTGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC 'Erysiphe australiana ex_Lagerstroemia_indica_AB022407' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACAGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGG-CTTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATC-GCTGATCATCCGGG-GGTAT-CTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCT-GTGGGAACGTGGCTCCTTTC---GA-GGAGTG--TTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe carpini-cordatae ex_Carpinus_cordata_AB252465' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGA-CTTGTGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCT-GCTGATCATCTAGG-GTTCTTCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCT-GTAGGAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGT-------------------------------------------------------------------------- 'Erysiphe carpini-cordatae ex_Carpinus_cordata_AB252466' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGGCCGAGA-CTTGTGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCT-GCTGATCATCTAGG-GTTCTTCTCTAGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCT-GTAGGAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTG------------------------------------------------------------------------- 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_AB252470' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTTAGTAAC-GGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGGCTGATCATCCAGA-GTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCC-GGAGAAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCCTTC--GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGCAGGTGA------------------------------------------------------------------------ 'Erysiphe carpinicola ex_Carpinus_japonica_AB252467' -TGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCCAACTGGGATTACCTTAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGGCTGATCATCCATGAGTTCGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGCAACGTAGCTCCCTTC---GG-GGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe carpinicola ex_Carpinus_japonica_AB252469' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACTGGGATTACCTTAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGGCTGATCATCCATGA?TTCGTCTCT?GTGCACTC?AC?GCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GGAGCAACGTAGCTCCCTTC---GG-GGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATC----------------------------------------------- 'Erysiphe epigena ex_Quercus_AB292720' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCCCGA-GTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCTCC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe epigena ex_Quercus_AB292722' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCCCGA-GTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCTCC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGCAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe fimbriata ex_Carpinus_laxiflora_AB333839' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGA---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTCCGGCCTAAGTTCCTTGGAATAGGACGTCGGAGAGGGTGAGAATCCCGTCTGTGGCCGAGG-CCTGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GCTGATCATCCAGA-GTTTA-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCCTC---GG-GGAGTG--TTATAGCCTATGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGCAGGTGA------------------------------------------------------------------------ 'Erysiphe friesii ex_Rhamnus_AB022382' TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC-------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTACGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCC--AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCT-GCTGATCACCTTGA-GTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe friesii var. dahurica_ex_Rhamnus_japonica_AB022382' TTGACCTCGAATCAGGTAGGAATACCCGCTGAAC-------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCC?T---CGGAGTCCGA{AG}TTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTACGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCG?ACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCT-GCTGATCACCTTGA-GTTCTTCTCAAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe glycines var. glycines ex_Desmodium_podocarpum_AB022397' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GTTGATCATCTAGA-GTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCTCTT---GG-GGAGTG--TTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTTT-----GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe gracilis var. gracilis_ex_Quercus_glauca_AB022357' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCACCCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACT-GCTGATCATCCAGAGGTTCC-CTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTTTCG-GG-GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe heraclei ex_Bifora_testiculata_AB103066' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA--------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCTC---TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCT-GCTGATCACCTTGA-GGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCTCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTTG---GGGGCGCATCATCGACCGATCCTGATGTCTT-------------------------- 'Erysiphe heraclei ex_Daucus_carrota_AB103069' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA--------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCTC---TGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCT-GCTGATCACCTTGA-GGTCTCCTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCTCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCTTTG---GGGGCGCATCATCGACCGATCCTGATGTCTT-------------------------- 'Erysiphe hypophylla ex_Quercus_AB292715' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCCCGA-GTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTGGGAACGTGGCTCCCCTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGT------------------------------------------------------------------------------ 'Erysiphe hypophylla ex_Quercus_AB292716' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCCCGA-GTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTGGGAACGTGGCTCCCCTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT----------------------------------------------------------------------------------------------------------- 'Erysiphe japonica ex_Quercus_AB022415' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA---------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-AGAGGAACGTAGCTACCTTTCG-GG-GGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe javanica ex_Castanopsis_javanica_JQ220159' -----------------------------------------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATGGGTTCGGGTGGCTGGACAAAGACC-GGAGGAACGTAGCTCCCTTTCGCGG-GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC 'Erysiphe javanica ex_Castanopsis_javanica_JQ220160' -----------------------------------------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATGGGTTCGGGTGGCTGGACAAAGACC-GGAGGAACGTAGCTCCCTTTCGCGG-GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC 'Erysiphe monoperidiata ex_Castanopsis_calathiformis_JQ220153' -----------------------------------------------------------------------------------AGTAACGGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGGGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGACAAAGACC-GGAGGAACGTAGCTCCCTTTCGTGG-GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC 'Erysiphe monoperidiata ex_Castanopsis_indica_JQ220154' -----------------------------------------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGGGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGACAAAGACC-GGAGGAACGTAGCTCCCTTTCGTGG-GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGC 'Erysiphe mori ex_Morus_australis_AB022418' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCTGATCATCCAGA-GTTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCTCTCG-GG-GGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGCAGGTG------------------------------------------------------------------------- 'Erysiphe paeoniae ex_Paeonia_AB257438' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGGGCACT-GCCGATCACCCTGA-GTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCCTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTA---------------------------------------------------------------------------------------------------------- 'Erysiphe paracarpinicola ex_Carpinus_cordata_AB252464' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACAGGGATTACCTTAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGACTCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGGCTGATCATCCATGAGTTTGTCTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGTC-GGAGCAACGTAGCTCCCTTC---GA-GGAGTG--TTATAGGCTTCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGA-------------------------------- 'Erysiphe pisi ex_Medicago_AB102942' --------------------------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCATGG-CCCGCGCCTCTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCCCGA-GTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGGCC-GGAGGAATGTAGCTCCCCTC---GG-GGAGTG--TTATAGCCTACGGCGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCGTTCG--GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTT--------------- 'Erysiphe pulchra ex_Swida_controversa_AB022389' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CGGAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCT-GCCGATCACCCAGA-GTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAACGTAGCTCCCCTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe quercicola ex_Quercus_AB197135' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTG---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCTTGA-GTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAATGTGGCTCTCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCC----------------------------------- 'Erysiphe quercicola ex_Quercus_AB292691' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCT-GCCGATCACCTTGA-GTTTT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCC-GTAGGAATGTGGCTCTCTTC---GG-GGAGTG--TTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGTAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTTT-----GGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe simulans ex_Rosa_AB022395' TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCA-CCGGGATTACCTCAGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CGGAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTGAGG-CCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCT-GCCGATCATTCCGA-GTTCT-CTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACC-GGAGGAACGTAGCTCCCCCCTCGGGAGGAGTG--TTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysiphe trinae ex_Quercus_agrifolia_AB022350' -----------------------------------------------------------------------------------AGTAAC-GGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCT-GCCGATCATCCCGA-GTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACC-GGAGGAACGTAGCTCCCCTTCG-GG-GCAGTG--TTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTGAAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGC 'Erysphe carpini-laxiflorae ex_Carpinus_laxiflora_AB252471' TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAA-CCAACCGGGATTACCTTAGTAAC-GGCGAGTGAAGCGGTAATAGCTCAAATTTGAAATCTGGCTCCGT---CGGAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCAAGGTCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGGCTGATCATCCAGA-GTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGATTCGGGTGGTTGGATAAAGGCC-GGAGAAACGTAGCTCCTCTC---GG-GGAGTG--TTATAGTCTACGGTGCCATGCAGCCCAGCCGGATCGAGGACCGCGCCTTC--GGGCTAGGATGTTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACG------------------------------------------------------------------------------- ; END; BEGIN TREES; TITLE Erysiphe_Fig._2; LINK TAXA = Taxa1; TRANSLATE 1 'Erysiphe arcuata ex_Carpinus_betulus_MUMH3197', 2 'Erysiphe arcuata ex_Carpinus_betulus_MUMH3237', 3 'Erysiphe carpinicola ex_Carpinus_japonica_MUMH243', 4 'Erysiphe carpinicola ex_Carpinus_japonica_MUMH3547', 5 'Erysiphe carpini ex_Carpinus_cordata_MUMH207', 6 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_MUMH3640', 7 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_MUMH3503', 8 'Erysiphe carpini-cordatae ex_Carpinus_cordata_MUMH3408'; TREE Fig._2 = [&R] ((8:0.069208,(1:0.0,2:0.0):0.043727):0.050695,((6:0.0,7:0.0):0.10165,(5:0.03394,(3:0.0,4:0.001388):0.033592):0.075906):0.050695); END; BEGIN TREES; TITLE Erysiphe_28S_Fig._1; LINK TAXA = Taxa2; TRANSLATE 1 'Erysiphe glycines var. glycines ex_Desmodium_podocarpum_AB022397', 2 'Erysiphe carpini-laxiflorae ex_Carpinus_laxiflora_AB252470', 3 'Erysphe carpini-laxiflorae ex_Carpinus_laxiflora_AB252471', 4 'Erysiphe carpinicola ex_Carpinus_japonica_AB252469', 5 'Erysiphe carpinicola ex_Carpinus_japonica_AB252467', 6 'Erysiphe carpini-cordatae ex_Carpinus_cordata_AB252465', 7 'Erysiphe carpini-cordatae ex_Carpinus_cordata_AB252466', 8 'Erysiphe arcuata ex_Carpinus_tschonoskii_AB252473', 9 'Erysiphe arcuata ex_Carpinus_betulus_AB252459', 10 'Erysiphe adunca ex_Salix_vulpina_AB022374', 11 'Erysiphe paracarpinicola ex_Carpinus_cordata_AB252464', 12 'Erysiphe fimbriata ex_Carpinus_laxiflora_AB333839', 13 'Erysiphe pulchra ex_Swida_controversa_AB022389', 14 'Erysiphe aquilegiae ex_Cimicifuga_simplex_AB022405', 15 'Erysiphe friesii var. dahurica_ex_Rhamnus_japonica_AB022382', 16 'Erysiphe heraclei ex_Bifora_testiculata_AB103066', 17 'Erysiphe heraclei ex_Daucus_carrota_AB103069', 18 'Erysiphe gracilis var. gracilis_ex_Quercus_glauca_AB022357', 19 'Erysiphe trinae ex_Quercus_agrifolia_AB022350', 20 'Erysiphe monoperidiata ex_Castanopsis_calathiformis_JQ220153', 21 'Erysiphe monoperidiata ex_Castanopsis_indica_JQ220154', 22 'Erysiphe asiatica ex_Castanopsis_diversifolia_JQ220157', 23 'Erysiphe asiatica ex_Castanopsis_echinocarpa_JQ220158', 24 'Erysiphe javanica ex_Castanopsis_javanica_JQ220160', 25 'Erysiphe mori ex_Morus_australis_AB022418', 26 'Erysiphe javanica ex_Castanopsis_javanica_JQ220159', 27 'Erysiphe abbreviata ex_Quercus_AB271785', 28 'Erysiphe alphitoides ex_Quercus_AB237811', 29 'Erysiphe alphitoides ex_Quercus_AB257431', 30 'Erysiphe epigena ex_Quercus_AB292720', 31 'Erysiphe epigena ex_Quercus_AB292722', 32 'Erysiphe friesii ex_Rhamnus_AB022382', 33 'Erysiphe hypophylla ex_Quercus_AB292715', 34 'Erysiphe hypophylla ex_Quercus_AB292716', 35 'Erysiphe paeoniae ex_Paeonia_AB257438', 36 'Erysiphe pisi ex_Medicago_AB102942', 37 'Erysiphe quercicola ex_Quercus_AB197135', 38 'Erysiphe quercicola ex_Quercus_AB292691', 39 'Erysiphe simulans ex_Rosa_AB022395', 40 'Erysiphe japonica ex_Quercus_AB022415', 41 'Erysiphe australiana ex_Lagerstroemia_indica_AB022407'; TREE Fig._1 = [&R] (41:0.02585,(10:0.038075,((8:0.001486,9:0.0):0.005235,((35:0.007839,(13:0.014074,((14:0.002937,36:0.015337):0.006877,((15:0.0,32:0.005463):0.017346,((30:0.0,31:0.0):0.006975,(27:0.010822,((33:0.0,34:0.0):0.004585,((28:0.0,29:0.0):0.001987,((16:0.0,17:0.0):0.014702,(37:0.001423,38:0.0):0.003245):0.004593):0.001034):0.00163):0.002688):0.002174):0.003419):0.003783):0.00418):0.004355,((12:0.018152,(6:0.0,7:0.0):0.020994):3.04E-4,(1:0.021482,(((2:0.0,3:0.0):0.019569,(11:0.008275,(4:0.0,5:0.0):0.001748):0.023849):0.010814,(19:0.010686,((40:0.008892,(18:0.013102,(25:0.004311,39:0.033017):0.003218):0.0):0.001521,((22:0.0,23:0.0):0.002936,((20:0.0,21:0.0):0.002892,(24:0.0,26:0.0):0.00444):0.001375):0.004604):0.00246):0.014072):0.002598):0.001811):0.003348):0.004834):0.017009):0.02585); END;