#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:31 GMT TreeBASE (cc) 1994-2008 Study reference: Bischoff J., Sullivan R., Kjer K., & Jr J. 2004. Phylogenetic placement of the anamorphic tribe Ustilaginoideae (Hypocreales, Ascomycota). Mycologia, 96: 1088-1094. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1293] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=38; TAXLABELS Atkinsonella_hypoxylon Atricordyceps_harposporifera Balansia_brunnans Balansia_henningsiana Balansia_obtecta Balansia_strangulans Claviceps_africana Claviceps_fusiformis Claviceps_paspali Claviceps_purpurea Claviceps_ranunculoides CordyCeps_takaomontana Cordycepioideus_bisporus Cordyceps_capitata Cordyceps_cochlidiicola Cordyceps_inegoensis Cordyceps_japonica Cordyceps_kanzashiana Cordyceps_militaris Cordyceps_ophioglossoides Cordyceps_prolifica Cordyceps_ramosopulvinata Cordyceps_subsessilis Cordyceps_tuberculata Dussiella_tuberiformis Epichloe_amarillans Epichloe_typhina Hyperdermium_bertonii Hypocrea_lutea Hypocrea_schweinitzii Hypomyces_armeniacus Hypomyces_odoratus Hypomyces_rosellus Myriogenospora_atramentosa Neomunkia_sydowii Torrubiella_luteorostrata Ustilaginoidea_dichromenae Ustilaginoidea_virens ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2861] TITLE LSU_rDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=837; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Atkinsonella_hypoxylon GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAGATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTACGACCAGACTTGGACC-CGGCGAATCATCCAGCGCGCCGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGG-AATGTAGGGGAGTGTTATAGCCCCTTGCGCAATGCCCTGGGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCGTCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Atricordyceps_harposporifera -CGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAGCGGCGAGCGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTCTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTCGGACGCCCAGCCTGTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACATGGGCG-CGGTGAATCACCCGGCGCGCCGGTGCACTTCGCCGGGCAGGCCAGTATCAGTTCGCCGCGGGGGACAAAGGCGG-GGG-AACGTGGGGGAGTGTTATAGCCCGCCGCG-AATGCCCTGGGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTACCC-TTGCGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_brunnans GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGGGCC-CGGCGGATCATCCGGCGCGCCGGTGCGCTCCGCCGGGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGG-AATGTAGGGGAGTGTTATAGCCCCCTGCGCAATGCCCCGGGG-CGGACTGAGGCTCG-CGCCGCAAGGATGCTGGCGTAATGGTCGTCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTTGTC-TTCGTATGCGAGTGTTCGGGTACCCCCTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_henningsiana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGGTCGGGCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGGGCC-TGGCGGATCATCCAGCGCGCTGGTGCACTCCGCCGGGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGG-AATGTAGGGGAGTGTTATAGCCCCCTGCGCAATGCCCCGGGG-CGGACTGAGGCCCG-CGCCGCAAGGATGCTGGCGTAATGGTCGTCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCCCCTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_obtecta CCGGAGGAAAAG-AACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG---AAG-TTCAAATTTGAAATGTTGTAATTTGAAGAGGATGCTTTGGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTACGACCAGACTTGGGCC-CGGCGAATCATCCGGCGCGCCGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGG-AATGTAGGGGAGTGTTATAGCCCCTTGCGCAATGCCCTGGGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCGTCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Balansia_strangulans GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGGTCGGATGCCGAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCACGACCAGACTTGGGCC-TGGCGGATCATCCGGCGCGCCGGTGCACTCCGCCGGGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAGGCTCGGGG-AATGTAGGGGAGTGTTATAGCCCCCTGCGCAATGCCCTGGGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCGTCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_africana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGGGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCC-CGGCGGATCACCCAGCGCGCTGGTGCACTCCGGCGGGCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCGGGGGG-AACGTGGGGGAGTGTTATAGCCCACCGCGCAATGCCCTGGGG-CGGGCTGAGGACCG-CGCCGCATGGATGCTGGCGTAATGGTCACCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_fusiformis CCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG---AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTACTTGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGCGCC-CGTCGGATCACCCAGCGCGCTGGTGCACTCCGGCGGGCAGGCCAGCATCAGCTCGTCTCGGGGGACAAAGGCGGCGGG-AACGTGGGGGAGTGTTATAGCCCGCCGCGCAATGCCCTGGGG-CGGGCTGAGGACCG-CGC-GCATGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_paspali GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATG?TTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATTGAGGGTGAGAGCCCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCC-CGG?GGATCACCCAGCGCGCTGGTGCACTCCGGCGGGCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCTCTGGG-AATGTGGGGGAGTGTTATAGCCCTCTGCGCAATGCCCTGGGG-CGGGCTGAGGACCG-CGCCGCAA---TGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_purpurea GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATACTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGATGCCGAGCCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTT-AAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACGTGGGCC-TGTCGGATCATCCAGCGCGCTGGTGCACTCCGGCGGGCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCAGCGGG-AATGTGGGGGAGTGTTATAGCCCGCTGTGTAATGCCCTGGGG-CGGGCTGAGGTTCG-CGCTGCATGGATGCTGGCATAATGGTTATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Claviceps_ranunculoides GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCC-CGGCGGATCACCCAGCGCGCTGGTGCACTCCGGCGGGCAGGCCAGCATCAGCTCGTCCCGGGGGACAAAGGCGGGGGG-AACGTGGGGGAGTGTTATAGCCCACCGCGCAATGCCCTGGGG-CGGGCTGAGGACCG-CGCTGCATGGATGCTGGCGTAATGGTCACCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG CordyCeps_takaomontana GCGGTGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTCGGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTCGGACACCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCC-CGGTGAATCACCCGGCGCGCCGGTGCACTTTGCCGGGCAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTCCGGG-AATGTGGGGGAGTGTTATAGCCCGCCGCGTAATACCCTGCAC-CGGACTGAGGCACG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordycepioideus_bisporus GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCG-CGGCGGATCAT-CGGCGCGCCGGTGCACTCCGCCGGGCAGGCCAGCATCGGTTCGCGGCGGGGGACAAAGGCGTCGGG-AACGTGGGGGAGTGTTATAGCCCGTCGCGCAATGCCCCGCCAGCGGACCGAGGTACG-C-C-GCAAGGATGCTGGCGTAATGGTCACCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGT----- Cordyceps_capitata GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AGG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTTGGGCC-CGGTGAATCATCCAGCGCGCTGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGG-AACGTGGGGGAGTGTTATAGCCCGCTGCACAATGCCCTGCGGGTGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGCAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_cochlidiicola GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCCAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTCGGGCG-TGGCGGATCATCCGGCGCGCCGGTGCACTCCGCCCCGCGGGCCAGCATCAGCTCGCCGCGGGGGATAAAGGCGTCGGG-AACGTGGGGGAGTGTTATAGCCCGGCGCGCAATGCCCCGTGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCACCAGTGA-CCCGTCTTGAAACAC-GGACCGAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTACCC-CTACGCGAAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_inegoensis GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCC-CGGTGAATCACCCGGCGCGCCGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCCGCGGGGGACAAAAGCTTCGGG-AACGTGGGGGAGTGTTATAGCCCGTTGCACAATGCCCTGCGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_japonica GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTCGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTCGGACGCCAAGCCGGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAACGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACTTGGGCG-CGGTGGATCACCCAGCGCGCTGGTGCACTCCGCCGGGCAGGCCAGCATCAGCTCGCCGCGGGGGACAAAGGCCGCGGG-AACGTGGGGGAGTGTTATAGCCCGTTGCGCAATGCCCCGCGG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGCCC-CTACGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAACATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_kanzashiana GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTCTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGGTCGGACGCCTAGCCTGTGTGAAGCACCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCCCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCC-CGGGGGATCACCCGGCGCGCCGGGGCACTTCGCCGGCCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAGGCTTCGGG-AACGTGGGGGAGTGTTATAGCCCGCTGCGCAATGCCCTGCCG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGCAATG-AAAGTGAA-CGGGTGAGAGCCGCATCACCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_militaris GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCG--C-AAG-CTCAAATTTG????GTTGTAATTTGTAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGGGCC-CGGTGAATCACCCAGCGCGCTGGTGCACTTCG-CGGGCAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGTTTCGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCGCAATACCCTGCGC-TGGACTGAGGTACG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGC-- Cordyceps_ophioglossoides GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCC-CGGTGAATCATCCAGCGCGCTGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAAGCTTCGGG-AACGTGGGGGAGTGTTATAGCCCGTTGCACAATACCCTGCGG-TGGACTGAGGTTCG-CGCCGCAAGGATGCTG?CGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTA?TATCTG Cordyceps_prolifica GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTCTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGACGCCTAGCCTCTGTGAAGCACCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCC-CCGCGCATCACCCGGCGCGCCGGGGCACTTCGCAGGGCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAGGCTTCGGG-AACGTAGGGGAGTGTTACAGCCCGCTGCGCAATGCCCTGCCG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGACGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_ramosopulvinata GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTCTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGGTCGGACGCCTAGCCTGTGTGAAGCACCTTCGACGAGTCGGGTAGTTTGGGAATGCTGCCCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCC-CGGGGGATCACCCGGCGCGCCGGGGCACTTCGCCGGCCAGGCCAGCATCAGTTCGCGGCGGGGGACAAAGGCTTCGGG-AACGTAGGGGAGTGTTATAGCCCGCTGCGCAATGCCCTGCCG-CGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCACCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_subsessilis ------AGAACGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACGCCAAGCCAGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCACTTGTGACCAGACTTGGGCC-CGGTGAATCATCCAGCGCGCTGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAAGCTTCGGG-AACGTAGGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGG-TGGACTGAGGTTCG-CGCCGCAAGGATGCTGGCGTAATGGTCACCAGTGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTCTTTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Cordyceps_tuberculata GCGGAGGAAAAGAAACCAACAGG-ATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACA-GTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTG--GC--GGCGAATCA---GGC-CGCCGGTGCACTTCGCCGG-CAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTCTGGG-AATGTGGGGGAGTGTTATAGCCCACCGCGTAATACCCTGCGC-CGGACTGAGGTACGACTCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAACCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGGAATG-TAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Dussiella_tuberiformis GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTATGACCAGACTTGGACC-CGGTGAATCATCCAGCGCGCCGGTGCACTTTGCCGGGCAGGCCAGCATCAGTTTCCCCCGGGGGATAAAGGCTCCGGG-AATGTGGGGGAGTGTTATAGCCCGCCGCGCAATACCCTGGGG-CGGACTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTTGGGTACCC-CTGCGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Epichloe_amarillans GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTCGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCC-CGGTGAATCATCCAGCGCGCTGGTGCACTTTGCCGGGCAGGCCAGCATCAGTTTGCCCCGGGGGATAAAGGCTCTGGG-AATGTGGGGGAGTGTTATAGCCCTCTGCGCAATGCCCTGGGG-CGGACTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Epichloe_typhina -----GGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-A-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGC-TTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATCCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCC-CGGTGAATCATCCAGCGCGCTGGTGCACTTTGCCGGGCAGGCCAGCATCAGTTCGCCCCGGGGGACAAAGGCTCTGGG-AATGTGGGGGAGTGTTATAGCCCTCTGCTGCATGCCCTGGGG-CGGACTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-CTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hyperdermium_bertonii GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTCGGACACCAAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCCTGTGACCAGACTTGGGCC-CGGTGAATCACCCAGCGCGCTGGTGCACTTTGCCGGGCAGGCCAGCATCAGTTTGGCGCGGGGGACAAAGGCTGTGGG-AATGTGGGGGAGTGTTATAGCCCACTGCGCAATACCCTGCGC-CGGACTGAGGTACG-CGCCGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCGAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypocrea_lutea GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTTTGGGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCG-CGGCGGATCATCCGGGGCCCCGGTGCACTTCGCCGCGCAGGCCAGCATCAGTTCGTCGCGGGGGATAAAGGCTTCGGG-AACGTGGGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGG-TGGACTGAGGACCG-CGCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGACGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypocrea_schweinitzii GCGGAGGAAAAGAAACCAACAGGGATTGCCCCGATAACGGCGAGTGAAGC-G-C-AAG-CTCAAATTTG?AACGTTGTAATTTGTAGAGGATG?TTTTGGGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCG-CGGCGGATCATCCGGGGCCCCGGTGCACTTCGCCGTGCAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGG-AACGTGGGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGG-TGGACTGAGGACCG-CGCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGA?CTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAG--- Hypomyces_armeniacus ----------------------------CCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTTTGGGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGCTGGCCGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCT-TGGCGGATCATCCGGCGCGCCGGTGCACTTCGCCTCGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCATAATACCCTGGTG-CGGACTGAGGTCCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_odoratus --------------------------------AGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTTTGGGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCT-TGGCGAATCATCCGGCGCGCCGGTGCACTTCGCCTCGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCATAATACCCTGGGG-CGGACTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Hypomyces_rosellus ----------------------------CCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTTTGGGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCT-TGGCGAATCATCCGGCGCGCCGGTGCACTTCGCCTCGCAGGCCAGCATCAGTTCGCGCCGGGGGACAAAAGCTTCGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCATAATACCCTGGTG-CGGACTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Myriogenospora_atramentosa GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGACGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCTGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACATGGGCC-CCGGGAATCATCCGGCGCGCCGGTGCACTTCACGGGGCAGGCCAGCATCAGCTCGCGCCGGGGGGTAAAGGCGGGGGGGAA-GTGGGGGAGTGTTATAACCCCCCGCGTAATGCCCTGGGG-CGGGCTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCGTCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGTAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGAAG--TTCTTCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Neomunkia_sydowii GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGCGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCT-CGGCGAATCATCCAGCGCGCCGGTGCACTTCGCCGGGCAGGCCAGCATCAGTTCGCCGCGGGGGATAAAGGCTTTGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCACAATACCCCGGGG-CGGACTGAGGTTCG-CGCTGCTAGGATGCTGGCGTAATGGTTATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA-G-GAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Torrubiella_luteorostrata GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTTTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGTTGGATACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATCAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGGCCCGGTGAATCATC-AGCGCGCTGGTGCACTTTGCCGGCCAGGCCAGCATCAGTTTGCCTCGGGGGATAAAGGCTCTGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCTCAATGCCCTGGGG-CGGACTGAGGTTCG-CGCTGCAAGGATGCTGGCGTAATGGTCATCAGCGG-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTGCCC-CTACGCGGC-TGAAAAGTGAAACGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGAGGTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Ustilaginoidea_dichromenae GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGCAGAGGATGCTTCTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCTGGTTGGACGCCGAGCCTCTATGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCATGACCAGACTTGGGCC-CGGCGAATCATCCAGCGCGCTGGTGCACTTCTCCGGGCAGGCCAGCATCAGTTCGCCCCGGGGGATAAAGGCTTCGGG-AATGTGGGGGAGTGTTATAGCCCGTTGCATAATACCCTGGGG-CGGACTGAGGTTCG-CGCTGCTAGGATGCTGGCGTAATGGTTATCAGCGA-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTA--AGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG Ustilaginoidea_virens GCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGG-C-AAG-CTCAAATTTGAAATGTTGTAATTTGTAGAGGATGCTTCTGGGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCTGGCTGGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTT-AAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTCGTGACCAGACGTGGGCCTCGGCGGATCATCCAGCGCGCTGGTGCACTCCGCCGGGCAGGCCAGCATCAGTTTGCCCTGGGGGATAAAGGCTCCGGG-AACGTGGGGGAGTGTTATAGCCCGCCGCGCAATACCCTGGGG-CGGACTGAGGTTCG-CGCTGCTAGGATGCTGGCGTAATGGTTATCAGCGG-CCCGTCTTGAAACAC-GGACCAAGGAGTCGTC-TTCGTATGCGAGTGTTCGGGTACCC-CTACGCGGAATG-AAAGTGAA-CGGGTGAGAGCCGCATCATCGACCGATCCGATG--TTC-TCGGATGGATTTGA-GTAAGAGAGCATACGGGGCCGGACCCGAAAGAAGGTGAACTATGCCTGTATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATATGGGCATGGGGGCGAAAGACTAATCGAACCTTCTAGTAGCTG ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = LSU_rDNA) = N: 1-837; CODONPOSSET CodonPositions (CHARACTERS = LSU_rDNA) = N: 1-837; END; BEGIN TREES; TITLE Tb7178; LINK TAXA = Taxa1; TRANSLATE 1 CordyCeps_takaomontana, 2 Cordyceps_tuberculata, 3 Torrubiella_luteorostrata, 4 Neomunkia_sydowii, 5 Cordyceps_subsessilis, 6 Hypomyces_armeniacus, 7 Hypomyces_odoratus, 8 Hypomyces_rosellus, 9 Hypocrea_lutea, 10 Claviceps_ranunculoides, 11 Cordyceps_cochlidiicola, 12 Cordyceps_japonica, 13 Cordyceps_inegoensis, 14 Cordyceps_prolifica, 15 Cordyceps_ramosopulvinata, 16 Cordyceps_kanzashiana, 17 Ustilaginoidea_dichromenae, 18 Balansia_brunnans, 19 Ustilaginoidea_virens, 20 Cordycepioideus_bisporus, 21 Balansia_obtecta, 22 Epichloe_typhina, 23 Dussiella_tuberiformis, 24 Epichloe_amarillans, 25 Claviceps_purpurea, 26 Claviceps_fusiformis, 27 Claviceps_paspali, 28 Claviceps_africana, 29 Balansia_strangulans, 30 Balansia_henningsiana, 31 Atkinsonella_hypoxylon, 32 Cordyceps_militaris, 33 Hyperdermium_bertonii, 34 Cordyceps_ophioglossoides, 35 Cordyceps_capitata, 36 Hypocrea_schweinitzii, 37 Atricordyceps_harposporifera, 38 Myriogenospora_atramentosa; TREE Fig._2 = [&R] ((((((38,((30,18),29),21),31),(((((37,(20,11)),((16,15),14)),(33,(32,(2,1)))),(((35,(34,5)),13),12)),(((28,10),(26,25)),27))),((24,22),(23,3))),((19,17),4)),((36,9),((8,6),7))); END;