#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 7:27 GMT TreeBASE (cc) 1994-2008 Study reference: Cardoso D.B., Queiroz L.P., Pennington R., Cavalcante de lima H., Fonty E., Wojciechowski M., & Lavin M. 2012. Revisiting the phylogeny of papilionoid legumes: New insights from comprehensively sampled early-branching lineages. American Journal of Botany, 99(12): 1991–2013. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S12998] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=263; TAXLABELS Acosmium_cardenasii_JX124460 Acosmium_diffusissimum_JX124463 Acosmium_lentiscifolium_JX124466 Acrocarpus_fraxinifolius_AY899683 Adesmia_lanata_AF208901 Aeschynomene_indica_AF208927 Airyantha_schweinfurthii_AF310997 Aldina_insignis_JN168670 Aldina_latifolia_JX275891 Alexa_bauhiniiflora_JX295858 Alexa_canaracunensis_AF311376 Alexa_grandiflora_JX275892 Amburana_acreana_JX275890 Amburana_cearensis_AF309846 Amburana_cearensis_JX275950 Amicia_glandulosa_AF208902 Amorpha_fruticosa_AF208899 Amphimas_pterocarpoides_JX275961 Anarthrophyllum_cumingii_AY618488 Andira_anthelmia_JX275930 Andira_carvalhoi_JX275925 Andira_galeottiana_AF208893 Andira_humilis_JX275924 Andira_inermis_AF309853 Andira_legalis_JX275923 Andira_marauensis_JX275929 Andira_nitida_JX275922 Andira_ormosioides_JX275927 Andira_sp_JX275926 Andira_surinamensis_JX275928 Angylocalyx_sp_AF311366 Apoplanesia_paniculata_AF208898 Arachis_pintoi_AF208946 Arcoa_gonavensis_AY232787 Astragalus_canadensis_AF126981 Ateleia_albolutescens_EF466255 Ateleia_cubensis_EF466256 Ateleia_glazioveana_EF466257 Ateleia_herbertsmithii_AF309840 Ateleia_hexandra_EF466259 Ateleia_pterocarpa_EF466260 Austrosteenisia_blackii_AF311381 Baphia_abyssinica_GU584003 Baphia_kirkii_EF466261 Baphia_leptobotrys_EU361740 Baphia_madagascariensis_AF309859 Baphia_massaiensis_AF309860 Baphia_nitida_AF365037 Baphia_racemosa_AF309858 Baphiopsis_parviflora_AF309861 Baptisia_australis_AF309831 Bobgunnia_fistuloides_AF365038 Bobgunnia_madagascariensis_AF309845 Bocoa_viridiflora_EF466263 Bolusanthus_speciosus_AF310994 Bowdichia_nitida_JX124433 Bowdichia_virgilioides_AF309486 Brya_ebenus_AF208950 Cadia_purpurea_AF309863 Calpurnia_aurea_AF310993 Camoensia_brevicalyx_JX275959 Camoensia_scandens_JX275960 Candolleodendron_brachystachyum_EF466264 Carmichaelia_williamsii_AF127000 Castanospermum_australe_EF466265 Centrolobium_robustum_EU401425 Ceratonia_siliqua_AF365075 Chapmannia_gracilis_AF208940 Cladrastis_delavayi_AF311370 Clathrotropis_brachypetala_AF309827 Clathrotropis_macrocarpa_JX275957 Clathrotropis_nitida_JX124468 Clathrotropis_nitida_JX295859 Cordyla_haraka_EF466266 Cordyla_madagascariensis_AF309848 Coursetia_glandulosa_AF529399 Cranocarpus_martii_AF208951 Cyathostegia_mathewsii_AF309841 Cyathostegia_matthewsii_EF466267 Cyclolobium_nutans_AF309857 Cytisus_scoparius_JF338224 Dalbergia_congestiflora_AF208924 Dalhousiea_africana_AF310998 Dermatophyllum_secundiflorum_AF311374 Dicraeopetalum_capuronianum_JX275958 Dicraeopetalum_stipulare_AF310995 Diplotropis_incexis_JX124440 Diplotropis_martiusii_JX124438 Dipteryx_alata_AF208896 Dipteryx_magnifica_JX275901 Dipteryx_odorata_EF466268 Dipteryx_oleifera_AF309856 Dipteryx_polyphylla_JX275900 Dipteryx_punctata_JX275899 Discolobium_psoraleifolium_AF208964 Dussia_lehmannii_AF309849 Dussia_tessmannii_JX275896 Etaballia_guianensis_AF208960 Exostyles_aff_venusta_JX187642 Exostyles_amazonica_AY438093 Exostyles_godoyensis_JX187640 Exostyles_venusta_JX187641 Fiebrigiella_gracilis_AF208939 Genista_monspessulana_JF338274 Gleditsia_sinensis_AY899686 Glycine_microphylla_EF543429 Glycyrrhiza_lepidota_AF124238 Grazielodendron_riodocense_AF208952 Guianodendron_praeclarum_JX124443 Gymnocladus_chinensis_EU361814 Harleyodendron_unifoliolatum_JX187643 Holocalyx_balansae_AF310999 Holocalyx_balansae_AF524881 Holocalyx_balansae_EF466269 Holocalyx_balansae_JX187644 Hymenolobium_alagoanum_JX275936 Hymenolobium_grazielanum_JX275937 Hymenolobium_heringeranum_JX275940 Hymenolobium_heterocarpum_JX275931 Hymenolobium_janeirense_var_janeirense_JX275934 Hymenolobium_janeirense_var_stipulatum_JX275935 Hymenolobium_mesoamericanum_AF309852 Hymenolobium_modestum_JX275938 Hymenolobium_petraeum_JX275939 Hymenolobium_sericeum_JX275932 Hymenolobium_sericeum_JX275933 Indigastrum_argyraeum_AF274364 Indigofera_ammoxylum_AF274371 Inocarpus_fagifer_AF208965 Isotropis_foliosa_AF518145 Lablab_purpureus_EU717339 Lathyrus_sativus_DQ311696 Lecointea_amazonica_AF524879 Lecointea_hatschbachii_JX187645 Lecointea_peruviana_AF365039 Leptolobium_bijugum_JX124444 Leptolobium_brachystachyum_JX124447 Leptolobium_dasycarpum_JX124450 Leptolobium_panamense_AF208891 Leucomphalos_callicarpus_AF309862 Leucomphalos_mildbraedii_AF310996 Lonchocarpus_lanceolatus_AF311382 Luetzelburgia_amazonica_JX187674 Luetzelburgia_andina_JX187676 Luetzelburgia_andradelimae_JX187680 Luetzelburgia_auriculata_JX187683 Luetzelburgia_bahiensis_JX187687 Luetzelburgia_guaissara_JX187691 Luetzelburgia_guianensis_JX187694 Luetzelburgia_harleyi_JX187697 Luetzelburgia_neurocarpa_JX187700 Luetzelburgia_praecox_JX187701 Luetzelburgia_purpurea_JX187704 Luetzelburgia_sotoi_JX187707 Luetzelburgia_trialata_JX187709 Lupinus_argenteus_DQ417088 Maackia_amurensis_AB127033 Mildbraediodendron_excelsum_AF309847 Millettia_grandis_AF311377 Monopteryx_inpae_JX275905 Monopteryx_inpae_JX275906 Myrocarpus_aff_venezuelensis_JX275893 Myrocarpus_emarginatus_JX275894 Myrocarpus_fastigiatus_JX275895 Myrocarpus_frondosus_AF311002 Myrospermum_frutescens_AF208892 Myrospermum_sousanum_AF265559 Myroxylon_balsamum_AF309850 Myroxylon_peruiferum_JX275949 Nissolia_hirsuta_AF208908 Ormocarpopsis_itremoensis_AF208918 Ormosia_aff_fastigiata_JX275915 Ormosia_amazonica_AF309484 Ormosia_bahiensis_JX275916 Ormosia_costulata_JX275917 Ormosia_coutinhoi_JX275910 Ormosia_excelsa_JX275914 Ormosia_holerythra_JX275919 Ormosia_limae_JX275909 Ormosia_minor_JX275920 Ormosia_nitida_JX275911 Ormosia_paraensis_JX275918 Ormosia_smithii_JX275913 Ormosia_sp_nov_JX275907 Ormosia_sp_nov_JX275921 Ormosia_stipularis_JX275912 Ormosia_timboensis_JX275908 Oxytropis_lambertii_AF126991 Panurea_longifolia_JX275951 Panurea_longifolia_JX275952 Phylloxylon_spinosa_AF274358 Pictetia_marginata_AF208910 Platymiscium_stipulare_EU736036 Platypodium_elegans_AF208961 Poecilanthe_parviflora_AF208897 Poiretia_angustifolia_AF208904 Psoralidium_junceum_EF543399 Pterocarpus_indicus_AF208953 Pterodon_abruptus_JX275903 Pterodon_emarginatus_JX275904 Pterodon_pubescens_AF208895 Ramorinoa_girolae_AF208957 Riedeliella_graciliflora_AF208949 Robinia_pseudoacacia_AF529391 Rupertia_physodes_EF543414 Sophora_davidii_AF309829 Spartium_junceum_DQ417002 Spirotropis_longifolia_JX275953 Spirotropis_longifolia_JX275954 Spirotropis_longifolia_JX275955 Spirotropis_longifolia_JX275956 Staminodianthus_duckei_JX124473 Staminodianthus_rosae_JX124434 Styphnolobium_japonicum_EF466270 Swartzia_apetala_EF466276 Swartzia_benthamiana_EF466285 Swartzia_cardiosperma_EF466288 Swartzia_jorori_EF466302 Swartzia_panamensis_EF466326 Swartzia_pinheiroana_EF466331 Swartzia_polita_EF466333 Swartzia_simplex_AF309843 Sweetia_fruticosa_AF309832 Sweetia_fruticosa_AF524883 Sweetia_fruticosa_JX187671 Sweetia_fruticosa_JX187672 Taralea_cordata_JX275902 Taralea_oppositifolia_AF309855 Taralea_rigida_JX275948 Thermopsis_rhombifolia_AY618487 Tipuana_tipu_AF208956 Trifolium_repens_DQ311961 Trischidium_alternum_EF466361 Trischidium_decipiens_JX275897 Trischidium_molle_JX275898 Ulex_europaeus_AF385427 Umtiza_listeriana_AF365126 Uribea_tamarindoides_AF311000 Vatairea_erythrocarpa_JX187649 Vatairea_fusca_JX187651 Vatairea_guianensis_JX187652 Vatairea_heteroptera_JX187655 Vatairea_heteroptera_JX187656 Vatairea_lundellii_JX187657 Vatairea_macrocarpa_JX187661 Vatairea_paraensis_JX187663 Vatairea_sericea_JX187664 Vatairea_sp_nov_JX187658 Vataireopsis_araroba_JX187665 Vataireopsis_iglesiasii_JX187711 Vataireopsis_speciosa_JX187667 Vataireopsis_surinamensis_JX187670 Vigna_unguiculata_EU717348 Wisteria_frutescens_AF124239 Xanthocercis_zambesiaca_AF311365 Zollernia_aff_glabra_JX275947 Zollernia_glabra_JX275942 Zollernia_glaziovii_JX275943 Zollernia_ilicifolia_JX187648 Zollernia_latifolia_JX275944 Zollernia_magnifica_JX187646 Zollernia_modesta_JX275941 Zollernia_splendens_JX275945 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=459; TAXLABELS Acacia_cochliacantha_AF274133 Acacia_myrtifolia_AF274160 Acosmium_cardenasii_JX124425 Acosmium_diffusissimum_JX124415 Acosmium_lentiscifolium_JX124417 Acrocarpus_fraxinifolius_EU361843 Adenanthera_pavonina_AF521808 Adenolobus_garipensis_EU361844 Adesmia_lanata_AF270863 Aeschynomene_indica_AF272084 Aeschynomene_purpusii_AF270870 Afzelia_bella_EU361846 Airyantha_schweinfurthii_JX295897 Albizia_versicolor_AF274210 Aldina_heterophylla_JX295956 Aldina_insignis_JN168674 Aldina_latifolia_JX295861 Alexa_bauhiniiflora_JX295931 Alexa_canaracunensis_JQ669613 Alexa_grandiflora_JX295968 Amblygonocarpus_andongensis_AF521812 Amburana_acreana_JX295866 Amburana_cearensis_AY553712 Amburana_cearensis_JX846614 Amherstia_nobilis_EU361849 Amicia_glandulosa_AF203583 Ammodendron_argenteum_AY386957 Amorpha_apiculata_AY391784 Amorpha_fruticosa_AY391785 Amphimas_pterocarpoides_JX295894 Anarthrophyllum_desideratum_AY386923 Andira_carvalhoi_JX295958 Andira_galeottiana_AF142681 Andira_humilis_JX295960 Andira_inermis_JF501102 Andira_legalis_JX295893 Andira_marauensis_JX295899 Andira_ormosioides_JX295962 Andira_sp_JX295896 Angylocalyx_sp_AY553715 Angylocalyx_talbotii_JQ669611 Aotus_ericoides_AY386884 Aphanocalyx_cynometroides_EU361855 Apoplanesia_paniculata_AF270860 Apuleia_leiocarpa_EU361858 Arachis_pintoi_AF203596 Arapatiella_psilophylla_EU361859 Archidendron_hirsutum_EU361860 Arcoa_gonavensis_EU361861 Astragalus_canadensis_AY386875 Ateleia_arsenii_GU220019 Ateleia_glazioveana_GU220020 Ateleia_guaraya_JX295883 Ateleia_herbertsmithii_AY386953 Ateleia_mcvaughii_GU220021 Ateleia_popenoei_GU220022 Ateleia_pterocarpa_GU220023 Austrosteenisia_blackii_AF142707 Baphia_madagascariensis_AY553718 Baphia_massaiensis_AF142683 Baphiopsis_parviflora_JX295895 Baptisia_australis_AY386900 Barnebydendron_riedelii_EU361868 Batesia_floribunda_EU361869 Bauhinia_galpinii_EU361875 Berlinia_congolensis_EU361881 Bobgunnia_fistuloides_EU361885 Bobgunnia_madagascariensis_AY386940 Bolusanthus_speciosus_AF142685 Bossiaea_cordigera_AY386888 Bowdichia_nitida_JX124395 Bowdichia_virgiloides_AY386937 Brandzeia_filicifolia_EU361870 Brodriguesia_santosii_EU361890 Brongniartia_alamosana_AF142688 Brongniartia_peninsularis_GQ246148 Brownea_coccinea_EU361891 Brya_ebenus_AF270876 Cadia_purpurea_JX295932 Caesalpinia_pulcherrima_EU361906 Calliandra_juzepczukii_EU812063 Calpurnia_aurea_AY386951 Camoensia_brevicalyx_JX295946 Camoensia_scandens_JX295919 Candolleodendron_brachystachyum_JX295890 Candolleodendron_brachystachyum_JX295929 Carmichaelia_williamsii_AY386873 Cassia_grandis_EU361909 Castanospermum_australe_JX295891 Centrolobium_robustum_EU401414 Ceratonia_siliqua_EU361911 Cercis_canadensis_AY386908 Cercis_gigantea_AY386948 Cercis_occidentalis_AY386853 Chamaecrista_nictitans_EU361914 Chapmannia_gracilis_AF203592 Chloroleucon_manganse_AY386921 Cicer_canariense_AF522079 Cladrastis_delavayi_AY386861 Cladrastis_lutea_AF142694 Cladrastis_platycarpa_AY386935 Clathrotropis_macrocarpa_JX295930 Clathrotropis_nitida_JX295951 Cojoba_catenata_AY944554 Colophospermum_mopane_EU361915 Conzattia_multiflora_AY386918 Copaifera_officinalis_EU361918 Cordeauxia_edulis_EU361920 Cordyla_africana_JX295923 Coursetia_glandulosa_AF543852 Cranocarpus_martii_AF270875 Crotalaria_incana_GQ246141 Crudia_choussyana_EU361921 Cyathostegia_mathewsii_HM347482 Cyathostegia_mathewsii_HM347483 Cyathostegia_mathewsii_HM347486 Cyclolobium_brasiliense_GQ246152 Cyclolobium_nutans_AF142686 Cytisus_scoparius_AY386902 Dalbergia_congestiflora_AF142696 Dalea_mollissima_AY391794 Dalea_pulchra_AY386860 Daniellia_klainei_EU361927 Daviesia_latifolia_AY386887 Delonix_elata_EU361928 Dermatophyllum_arizonicum_AY386864 Dermatophyllum_secundiflorum_AF142693 Derris_laxiflora_AF142715 Desmanthus_cooleyi_AY386916 Desmodium_barbatum_EU717420 Detarium_macrocarpum_EU361929 Dialium_guianense_EU361930 Dichrostachys_richardiana_AF521823 Dicraeopetalum_stipulare_GQ246142 Dicymbe_altsonii_EU361932 Dimorphandra_conjugata_EU361934 Dinizia_excelsa_JX295860 Dioclea_grandiflora_JX295862 Diphysa_floribunda_AF203575 Diplotropis_brasiliensis_AY386939 Diplotropis_ferruginea_JX124397 Diplotropis_incexis_JX124401 Diplotropis_martiusii_AY386938 Diplotropis_purpurea_JX124418 Diplotropis_triloba_JX124398 Dipteryx_alata_AY553717 Dipteryx_magnifica_JX295871 Dipteryx_odorata_JX295898 Dipteryx_oleifera_JX295933 Dipteryx_polyphylla_JX295870 Dipteryx_punctata_JX295869 Diptychandra_aurantiaca_EU361935 Discolobium_psoraleifolium_AF270874 Distemonanthus_benthamianus_EU361936 Disynstemon_paullenoides_GU951670 Dolichos_trilobus_AY582976 Dussia_lanata_JX295925 Dussia_lehmannii_JX295924 Dussia_macroprophyllata_AY386903 Ebenopsis_ebano_AF274123 Endertia_spectabilis_EU361943 Entada_abyssinica_AF521829 Enterolobium_cyclocarpum_AY650277 Eperua_rubiginosa_EU361947 Errazurizia_benthamii_AY391803 Errazurizia_megacarpa_AY391804 Erythrina_cristagalli_AY386869 Erythrophleum_suaveolens_EU361949 Etaballia_guianensis_AF272074 Eurypetalum_tessmannii_EU361950 Exostyles_aff_venusta_JX152591 Exostyles_godoyensis_JX152589 Exostyles_venusta_JX152590 Eysenhardtia_orthocarpa_AY386909 Eysenhardtia_polystachya_EU025905 Faidherbia_albida_AF274129 Fiebrigiella_gracilis_AF203590 Gagnebina_commersoniana_AF521836 Galactia_striata_AF142704 Gastrolobium_punctatum_AY386885 Genista_monspessulana_AY386862 Geoffroea_spinosa_AF270879 Gilletiodendron_pierreanum_EU361957 Gleditsia_sinensis_AY386930 Gleditsia_triacanthos_AY386849 Gliricidia_brenningii_AF547199 Glycine_microphylla_EF550008 Glycyrrhiza_lepidota_AY386883 Goniorrhachis_marginata_EU361959 Gossweilerodendron_balsamiferum_EU361960 Grazielodendron_riodocense_AF270862 Guianodendron_praeclarum_JX124402 Guianodendron_praeclarum_JX124403 Guilfoylia_monostylis_EU604031 Gymnocladus_chinensis_AY386928 Harleyodendron_unifoliolatum_JX152592 Harpalyce_arborescens_AF142689 Harpalyce_brasiliana_GQ246153 Harpalyce_formosa_GQ246154 Havardia_albicans_AF523085 Hebestigma_cubense_AF543850 Hoffmannseggia_glauca_EU361969 Holocalyx_balansae_AY553714 Holocalyx_balansae_JX152593 Hovea_purpurea_AY386889 Hymenaea_courbaril_AY386906 Hymenaea_verrucosa_EU361974 Hymenolobium_alagoanum_JX295906 Hymenolobium_grazielanum_JX295907 Hymenolobium_heringeranum_JX295910 Hymenolobium_heterocarpum_JX295901 Hymenolobium_heterocarpum_JX295902 Hymenolobium_janeirense_var_janeirense_JX295904 Hymenolobium_mesoamericanum_AY386934 Hymenolobium_petraeum_JX295909 Hymenolobium_sericeum_JX275933 Indigofera_suffruticosa_AF142697 Inga_edulis_AF523078 Inocarpus_fagifer_AF270878 Intsia_bijuga_EU361981 Isotropis_foliosa_AY386890 Koompassia_excelsa_EU361988 Labichea_punctata_EU361989 Lamprolobium_fruticosum_GQ246159 Lathyrus_sativus_AF522086 Lecointea_hatschbachii_JX152594 Lecointea_peruviana_EU361990 Lecointea_peruviana_JX295927 Leonardoxa_africana_EU361992 Leptolobium_bijugum_JX124404 Leptolobium_brachystachyum_JX124407 Leptolobium_dasycarpum_JX124408 Leptolobium_elegans_JX124410 Leptolobium_nitens_JX124409 Leptolobium_panamense_AF142684 Leptolobium_parvifolium_JX124411 Leptolobium_tenuifolium_JX124413 Leucaena_leucocephala_AF523094 Leucomphalos_brachycarpus_JX295864 Leucomphalos_mildbraedii_JX295865 Libidibia_ferrea_EU361901 Lonchocarpus_lanceolatus_AF142717 Lotus_purshianus_AF142729 Luetzelburgia_amazonica_JX152622 Luetzelburgia_andina_JX152624 Luetzelburgia_andradelimae_JX152627 Luetzelburgia_auriculata_JX152630 Luetzelburgia_bahiensis_JX152634 Luetzelburgia_guaissara_JX152636 Luetzelburgia_guianensis_JX152639 Luetzelburgia_harleyi_JX152642 Luetzelburgia_neurocarpa_JX152645 Luetzelburgia_praecox_JX152646 Luetzelburgia_purpurea_JX152648 Luetzelburgia_sotoi_JX152652 Luetzelburgia_trialata_JX152617 Lupinus_argenteus_AY386956 Lysidice_rhodostegia_EU361995 Lysiloma_acapulcensis_AF274126 Lysiphyllum_gilvum_EU361876 Maackia_amurensis_AY386944 Machaerium_falciforme_AF142692 Macroptilium_longipedunculatum_AY509939 Maraniona_lavinii_AY247263 Marina_parryi_AY386859 Marina_scopa_AY391811 Mariosousa_dolichostachya_EU812056 Martiodendron_parviflorum_EU361999 Melanoxylon_brauna_EU362000 Mendoravia_dumaziana_EU362001 Mezoneuron_angolense_EU361897 Microlobium_foetidus_AF523095 Millettia_grandis_AF142724 Mimosa_tenuiflora_AF274120 Mimozyganthus_carinatus_AY944557 Moldenhawera_brasiliensis_EU362004 Monnina_phytolaccifolia_EU596519 Monopteryx_inpae_JX295875 Monopteryx_inpae_JX295876 Mora_gonggrijpii_EU362005 Myrocarpus_emarginatus_JX295863 Myrocarpus_fastigiatus_JX295966 Myrocarpus_frondosus_AY386925 Myrospermum_frutescens_AF142679 Myrospermum_sousanum_AY386959 Myrospermum_sousanum_JX295922 Myrospermum_sousanum_JX295938 Myroxylon_balsamum_FJ151488 Myroxylon_balsamum_JX295912 Myroxylon_balsamum_JX295935 Myroxylon_balsamum_JX295936 Myroxylon_balsamum_JX295937 Myroxylon_peruiferum_JX295911 Mysanthus_uleanus_AY509941 Neochevalierodendron_stephanii_EU362006 Neptunia_monosperma_AF523090 Nissolia_hirsuta_AF270868 Ormocarpopsis_itremoensis_AF203567 Ormosia_aff_bahiensis_JX295944 Ormosia_aff_fastigiata_JX295885 Ormosia_aff_fastigiata_JX295940 Ormosia_arborea_JX295939 Ormosia_bahiensis_JX295886 Ormosia_colombiana_AY386960 Ormosia_costulata_JX295887 Ormosia_coutinhoi_JX295880 Ormosia_excelsa_JX295884 Ormosia_fastigiata_JX295941 Ormosia_fastigiata_JX295942 Ormosia_formosana_AF142682 Ormosia_limae_JX295879 Ormosia_nitida_JX295881 Ormosia_paraensis_JX295888 Ormosia_smithii_JX295954 Ormosia_sp_nov_JX295877 Ormosia_sp_nov_JX295945 Ormosia_stipularis_JX295882 Ormosia_timboensis_JX295878 Ormosia_timboensis_JX295943 Oxystigma_oxyphyllum_EU362012 Oxytropis_lambertii_AY386915 Panurea_longifolia_JX295947 Parapiptadenia_pterosperma_DQ790608 Pararchidendron_pruinosum_AF274127 Paraserianthes_lophantha_AF274128 Parkia_multijuga_EU362018 Parkinsonia_aculeata_AY386917 Parryella_filifolia_AY391812 Peltogyne_floribunda_EU362022 Peltophorum_dubium_AY386846 Pentaclethra_macroloba_AY386904 Petalostylis_labicheoides_AY386895 Phanera_outimouta_EU361877 Phaseolus_vulgaris_AY582987 Phylloxylon_spinosa_AY650280 Pickeringia_montana_AY386863 Pictetia_marginata_AF203578 Piptadenia_adiantoides_DQ790611 Piptadenia_viridiflora_AF521856 Piptadeniastrum_africanum_AF521857 Piptadeniopsis_lomentifera_AY944559 Piptanthus_nepalensis_AY386924 Platycyamus_regnellii_AF142709 Platymiscium_stipulare_AF270872 Platypodium_elegans_AF270877 Poecilanthe_effusa_JX295892 Poecilanthe_falcata_GQ246155 Poecilanthe_parviflora_AF142687 Poecilanthe_subcordata_GQ246156 Poeppigia_procera_AY386907 Poiretia_angustifolia_AF270864 Poissonia_hypoleuca_AF547193 Poitea_glyciphylla_AY650278 Polygala_californica_AY386842 Prioria_copaifera_EU362030 Prosopidastrum_mexicanum_AY386919 Prosopis_glandulosa_AY386851 Pseudoprosopis_gilletii_AF521861 Psorothamnus_arborescens_AY391814 Psorothamnus_spinosus_AY391822 Pterocarpus_indicus_AF142691 Pterodon_abruptus_JX295873 Pterodon_emarginatus_JX295874 Pterodon_pubescens_AF272095 Pterogyne_nitens_EU362031 Quillaja_saponaria_AY386843 Ramorinoa_girolae_AF270881 Riedeliella_graciliflora_AH009910 Robinia_pseudoacacia_AF142728 Rupertia_physodes_AY386868 Samanea_saman_AF523073 Saraca_indica_EU362034 Schizolobium_parahyba_EU362036 Senna_alata_EU362042 Senna_covesii_AY386850 Sesbania_tomentosa_JX295926 Sindora_klaineana_EU362045 Sophora_davidii_AY386958 Spartium_junceum_AY386901 Sphenostylis_angustifolia_AY582978 Sphinctospermum_constrictum_AF547191 Spirotropis_longifolia_JX295948 Spirotropis_longifolia_JX295949 Spirotropis_longifolia_JX295950 Staminodianthus_duckei_JX124405 Staminodianthus_racemosus_JX124420 Staminodianthus_rosae_JX124396 Storckiella_australiensis_EU362052 Strophostyles_helvola_AY509949 Stryphnodendron_rotundifolium_DQ790643 Stylobasium_spathulatum_EU604032 Stylosanthes_capitata_AF203595 Styphnolobium_japonicum_AY386962 Suriana_maritima_AY386950 Swartzia_apetala_JX295908 Swartzia_arborescens_JX295964 Swartzia_cardiosperma_EU362053 Swartzia_flaemingii_AY386941 Swartzia_jorori_AY386942 Swartzia_pickelii_JX295905 Swartzia_pinheiroana_JX295914 Swartzia_polita_JX295913 Swartzia_simplex_AF142678 Sweetia_fruticosa_AY386911 Sweetia_fruticosa_JX152619 Sweetia_fruticosa_JX152620 Sweetia_fruticosa_JX152621 Tabaroa_caatingicola_GQ246161 Tabaroa_caatingicola_GQ246162 Talbotiella_gentii_EU362055 Taralea_cordata_JX295872 Taralea_oppositifolia_JX295900 Taralea_rigida_JX295934 Templetonia_hookeri_GQ246157 Templetonia_retusa_GQ246158 Tetraberlinia_bifoliolata_EU362060 Thermopsis_rhombifolia_AY386866 Tipuana_tipu_AF270882 Trifolium_repens_AF522131 Trigonella_foenumgraecum_AF522147 Trischidium_alternum_JX295928 Trischidium_decipiens_JX295867 Trischidium_molle_JX295868 Ulex_europaeus_JQ669586 Umtiza_listeriana_EU362062 Uribea_tamarindoides_AY553719 Vachellia_farnesiana_HM020715 Vatairea_erythrocarpa_JX152597 Vatairea_fusca_JX152599 Vatairea_guianensis_JX152600 Vatairea_heteroptera_JX152603 Vatairea_heteroptera_JX152604 Vatairea_lundellii_JX152605 Vatairea_macrocarpa_JX152609 Vatairea_paraensis_JX152611 Vatairea_sericea_JX152612 Vatairea_sp_nov_AF270859 Vataireopsis_araroba_JX152613 Vataireopsis_sp_JX295921 Vataireopsis_speciosa_JX152615 Vataireopsis_surinamensis_JX152618 Vauquelinia_californica_AY386949 Vicia_sativa_AF522160 Vigna_adenantha_AY582983 Vouacapoua_macropetala_EU362063 Weberbauerella_brongniartioides_AF272075 Wisteria_frutescens_AF142731 Xanthocercis_zambesiaca_JF270996 Xerocladia_viridiramis_EU000438 Xeroderris_stuhlmannii_AF142708 Zenia_insignis_EU362065 Zollernia_aff_glabra_JX295916 Zollernia_glabra_JX295915 Zollernia_glaziovii_JX295952 Zollernia_ilicifolia_JX152654 Zollernia_latifolia_JX295918 Zollernia_magnifica_JX152595 Zollernia_modesta_JX295917 Zygia_lathetica_AY944566 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=248; TAXLABELS Acosmium_cardenasii_JX124425 Acosmium_diffusissimum_JX124415 Acosmium_lentiscifolium_JX124417 Acrocarpus_fraxinifolius_EU361843 Adesmia_lanata_AF270863 Aeschynomene_indica_AF272084 Airyantha_schweinfurthii_JX295897 Aldina_insignis_JN168674 Aldina_latifolia_JX295861 Alexa_bauhiniiflora_JX295931 Alexa_canaracunensis_JQ669613 Alexa_grandiflora_JX295968 Amburana_acreana_JX295866 Amburana_cearensis_AY553712 Amburana_cearensis_JX846614 Amicia_glandulosa_AF203583 Ammodendron_argenteum_AY386957 Amorpha_fruticosa_AY391785 Amphimas_pterocarpoides_JX295894 Anarthrophyllum_desideratum_AY386923 Andira_carvalhoi_JX295958 Andira_galeottiana_AF142681 Andira_humilis_JX295960 Andira_inermis_JF501102 Andira_legalis_JX295893 Andira_marauensis_JX295899 Andira_ormosioides_JX295962 Andira_sp_JX295896 Angylocalyx_sp_AY553715 Aotus_ericoides_AY386884 Apoplanesia_paniculata_AF270860 Arachis_pintoi_AF203596 Arcoa_gonavensis_EU361861 Astragalus_canadensis_AY386875 Ateleia_glazioveana_GU220020 Ateleia_herbertsmithii_AY386953 Ateleia_pterocarpa_GU220023 Austrosteenisia_blackii_AF142707 Baphia_madagascariensis_AY553718 Baphia_massaiensis_AF142683 Baphiopsis_parviflora_JX295895 Baptisia_australis_AY386900 Bobgunnia_fistuloides_EU361885 Bobgunnia_madagascariensis_AY386940 Bolusanthus_speciosus_AF142685 Bowdichia_nitida_JX124395 Bowdichia_virgiloides_AY386937 Brongniartia_alamosana_AF142688 Brya_ebenus_AF270876 Cadia_purpurea_JX295932 Calpurnia_aurea_AY386951 Camoensia_brevicalyx_JX295946 Camoensia_scandens_JX295919 Candolleodendron_brachystachyum_JX295890 Carmichaelia_williamsii_AY386873 Castanospermum_australe_JX295891 Centrolobium_robustum_EU401414 Ceratonia_siliqua_EU361911 Chapmannia_gracilis_AF203592 Cladrastis_delavayi_AY386861 Clathrotropis_macrocarpa_JX295930 Clathrotropis_nitida_JX295951 Cordyla_africana_JX295923 Coursetia_glandulosa_AF543852 Cranocarpus_martii_AF270875 Crotalaria_incana_GQ246141 Cyathostegia_mathewsii_HM347482 Cyathostegia_mathewsii_HM347483 Cyclolobium_nutans_AF142686 Cytisus_scoparius_AY386902 Dalbergia_congestiflora_AF142696 Dalea_pulchra_AY386860 Daviesia_latifolia_AY386887 Dermatophyllum_secundiflorum_AF142693 Dicraeopetalum_stipulare_GQ246142 Diplotropis_ferruginea_JX124397 Diplotropis_incexis_JX124401 Diplotropis_martiusii_AY386938 Diplotropis_purpurea_JX124418 Diplotropis_triloba_JX124398 Dipteryx_alata_AY553717 Dipteryx_magnifica_JX295871 Dipteryx_odorata_JX295898 Dipteryx_oleifera_JX295933 Dipteryx_polyphylla_JX295870 Dipteryx_punctata_JX295869 Discolobium_psoraleifolium_AF270874 Dussia_lehmannii_JX295924 Errazurizia_megacarpa_AY391804 Etaballia_guianensis_AF272074 Exostyles_aff_venusta_JX152591 Exostyles_godoyensis_JX152589 Exostyles_venusta_JX152590 Eysenhardtia_polystachya_EU025905 Fiebrigiella_gracilis_AF203590 Gastrolobium_punctatum_AY386885 Genista_monspessulana_AY386862 Gleditsia_sinensis_AY386930 Glycine_microphylla_EF550008 Glycyrrhiza_lepidota_AY386883 Grazielodendron_riodocense_AF270862 Guianodendron_praeclarum_JX124402 Guianodendron_praeclarum_JX124403 Gymnocladus_chinensis_AY386928 Harleyodendron_unifoliolatum_JX152592 Harpalyce_brasiliana_GQ246153 Holocalyx_balansae_AY553714 Holocalyx_balansae_JX152593 Hovea_purpurea_AY386889 Hymenolobium_alagoanum_JX295906 Hymenolobium_grazielanum_JX295907 Hymenolobium_heringeranum_JX295910 Hymenolobium_heterocarpum_JX295901 Hymenolobium_janeirense_var_janeirense_JX295904 Hymenolobium_mesoamericanum_AY386934 Hymenolobium_petraeum_JX295909 Hymenolobium_sericeum_JX275933 Indigofera_suffruticosa_AF142697 Inocarpus_fagifer_AF270878 Lamprolobium_fruticosum_GQ246159 Lathyrus_sativus_AF522086 Lecointea_hatschbachii_JX152594 Lecointea_peruviana_EU361990 Leptolobium_bijugum_JX124404 Leptolobium_brachystachyum_JX124407 Leptolobium_dasycarpum_JX124408 Leptolobium_elegans_JX124410 Leptolobium_nitens_JX124409 Leptolobium_panamense_AF142684 Leptolobium_parvifolium_JX124411 Leptolobium_tenuifolium_JX124413 Leucomphalos_mildbraedii_JX295865 Lonchocarpus_lanceolatus_AF142717 Luetzelburgia_amazonica_JX152622 Luetzelburgia_andina_Cayola2358 Luetzelburgia_andradelimae_JX152627 Luetzelburgia_auriculata_JX152630 Luetzelburgia_bahiensis_JX152634 Luetzelburgia_guaissara_JX152636 Luetzelburgia_guianensis_JX152639 Luetzelburgia_harleyi_JX152642 Luetzelburgia_neurocarpa_JX152645 Luetzelburgia_praecox_JX152646 Luetzelburgia_purpurea_JX152648 Luetzelburgia_sotoi_JX152652 Luetzelburgia_trialata_JX152617 Lupinus_argenteus_AY386956 Maackia_amurensis_AY386944 Marina_scopa_AY391811 Millettia_grandis_AF142724 Monopteryx_inpae_JX295875 Monopteryx_inpae_JX295876 Myrocarpus_emarginatus_JX295863 Myrocarpus_fastigiatus_JX295966 Myrocarpus_frondosus_AY386925 Myrospermum_frutescens_AF142679 Myrospermum_sousanum_AY386959 Myroxylon_balsamum_JX295912 Myroxylon_peruiferum_JX295911 Mysanthus_uleanus_AY509941 Nissolia_hirsuta_AF270868 Ormocarpopsis_itremoensis_AF203567 Ormosia_aff_fastigiata_JX295885 Ormosia_bahiensis_JX295886 Ormosia_costulata_JX295887 Ormosia_coutinhoi_JX295880 Ormosia_excelsa_JX295884 Ormosia_limae_JX295879 Ormosia_nitida_JX295881 Ormosia_paraensis_JX295888 Ormosia_smithii_JX295954 Ormosia_sp_nov_JX295877 Ormosia_stipularis_JX295882 Ormosia_timboensis_JX295878 Panurea_longifolia_JX295947 Parryella_filifolia_AY391812 Phylloxylon_spinosa_AY650280 Pickeringia_montana_AY386863 Pictetia_marginata_AF203578 Piptanthus_nepalensis_AY386924 Platymiscium_stipulare_AF270872 Platypodium_elegans_AF270877 Poecilanthe_effusa_JX295892 Poecilanthe_parviflora_AF142687 Poiretia_angustifolia_AF270864 Psorothamnus_arborescens_AY391814 Pterocarpus_indicus_AF142691 Pterodon_abruptus_JX295873 Pterodon_emarginatus_JX295874 Pterodon_pubescens_AF272095 Ramorinoa_girolae_AF270881 Riedeliella_graciliflora_AH009910 Robinia_pseudoacacia_AF142728 Rupertia_physodes_AY386868 Sophora_davidii_AY386958 Spartium_junceum_AY386901 Spirotropis_longifolia_JX295948 Spirotropis_longifolia_JX295949 Spirotropis_longifolia_JX295950 Staminodianthus_duckei_JX124405 Staminodianthus_racemosus_JX124420 Staminodianthus_rosae_JX124396 Styphnolobium_japonicum_AY386962 Swartzia_apetala_JX295908 Swartzia_cardiosperma_EU362053 Swartzia_jorori_AY386942 Swartzia_pinheiroana_JX295914 Swartzia_polita_JX295913 Swartzia_simplex_AF142678 Sweetia_fruticosa_AY386911 Sweetia_fruticosa_JX152619 Sweetia_fruticosa_JX152620 Sweetia_fruticosa_JX152621 Tabaroa_caatingicola_GQ246161 Taralea_cordata_JX295872 Taralea_oppositifolia_JX295900 Taralea_rigida_JX295934 Templetonia_hookeri_GQ246157 Thermopsis_rhombifolia_AY386866 Tipuana_tipu_AF270882 Trifolium_repens_AF522131 Trischidium_alternum_JX295928 Trischidium_decipiens_JX295867 Trischidium_molle_JX295868 Ulex_europaeus_JQ669586 Umtiza_listeriana_EU362062 Uribea_tamarindoides_AY553719 Vatairea_erythrocarpa_JX152597 Vatairea_fusca_JX152599 Vatairea_guianensis_JX152600 Vatairea_heteroptera_JX152603 Vatairea_heteroptera_JX152604 Vatairea_lundellii_JX152605 Vatairea_macrocarpa_JX152609 Vatairea_paraensis_JX152611 Vatairea_sericea_JX152612 Vataireopsis_araroba_JX152613 Vataireopsis_speciosa_JX152615 Vataireopsis_surinamensis_JX152618 Wisteria_frutescens_AF142731 Xanthocercis_zambesiaca_JF270996 Zollernia_aff_glabra_JX295916 Zollernia_glabra_JX295915 Zollernia_glaziovii_JX295952 Zollernia_ilicifolia_JX152654 Zollernia_latifolia_JX295918 Zollernia_magnifica_JX152595 Zollernia_modesta_JX295917 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14630] TITLE matK_trnL_combined_Character_Matrix; LINK TAXA = Taxa3; DIMENSIONS NCHAR=2575; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acosmium_cardenasii_JX124425 ATGAAAGAATATCCAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTAAAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCTTATCCTATCCATCTGGAAATCTTAG?????????????????????????????????????????????????????????????????------???TATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTTCTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGACCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTGGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGTAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCAAAAGC-AAA---------GAAAAGTAAAGTTAAGAAAGC-------------GAGACTAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG-----------------------------------------------------------------------------------------------------ATATACG----------TATATATGTATATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------A----------------------------------------------TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Acosmium_diffusissimum_JX124415 ATGAAAGAATATCCAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTATAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTCTGTTTGCTAACGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCTCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTTCTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGACCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAAGTAAAGTTAAGAAAGC-------------GAGACTAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG-----------------------------------------------------------------------------------------------------ATATACG----------TATATATGTATATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------ATTCCAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Acosmium_lentiscifolium_JX124417 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTATAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCTCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTTCTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGACCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAAGTAAAGTTAAGAAAGC-------------GAGACTAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG-----------------------------------------------------------------------------------------------------ATATACG----------TATATATGTATATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------ATTCCAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Acrocarpus_fraxinifolius_EU361843 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGACTTCCTGTACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGCGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA---TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTTC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCCTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAGTGGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTGCCGTCCACCTTATGGTTC------TTCAAGGACCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTATCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGTAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTAGAAGAATTCTTTACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------CATCAA---------------------------TGA?????????????????????????ACCTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-CAA---------GAAGA-----GTTCAGAAAGC-------------GCGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACGTACTGAAATACTAT-----TTCAA--------TTGATTTTGATT--------A------------GA-----CCCCAAA----TCTCTATTT-----TTTAATA-----TTTCT------------------------ATGACAAATGAAA-----------GATGTGAATC---GA--------TTCCAA----GTCGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGAT{AC}GA---------TCTTTTGAAAAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATT{CT}ATAGTAAGAGGAA{AG}ATCCGTCGACTTTAGAAATCGTGAGGG Adesmia_lanata_AF270863 ATGGAGGAATATCAAATA---------TATTTAGAAATCGATGGATCTTGCCAAGAAAACTTCCTATACCCACTTAGTTTTCAGGAGTATATTTATGGACTTGCCTATGGTCATGATTTAAATAGAAAAGTATCCATTTTGGTGGAAAATGTGGAT------TCTGATAAGAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATGATTCTAAA------AAAAATCTA---TTTTTGGGGTATAACAAGAATTTTTATTCTCAAATAATATCAGATGCTTTTGCCGTCATTGTGGAAATTCCATTTTCCCGACAATTC------ATTTCTTCC---------TTAGAGGACGCGGAAACCATAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------ACTTTTATTACTCAA------------AAAAAACGTATTTCTACCTTATCA------AAAAGTAATCCAAGATTTTATATATTCCTATATAATTTTTATGTATGTGAACATGAATCCATCTTCCTTTTTCTACGTAAAAACTCCTCTCATTTGCGATTAAATTCCTTTAGCCTTCTTTTTGAGCGAATACATTTCTATGCAAAACTAGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCATGTACCTTAGCATTC------TTCAAGGATCCTATGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTGAATAAATGGAAATACTATCTCATCTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAAGAAGGAACGATCCGTATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATATTTCAAATGTACGGCTAAATTTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCCAATCGAAATTGGTATGAAAAGGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAAAGGATCCTCAAAAAAAAAAGGTTTATATCGAATAAAATATATACTACGGCTTTCTTGTATTAAAACCTTGGCTCGTAAACATAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTTTTGACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGTTTATATAGAGATCAGATTTGGTATTTGGATATTCTT---TTCAGCCATGATCTGTTCAAT---TACGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAACCTTCCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCTAAA-------------------------GTAAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACG------CCATTTCCTTG--CGAATT----------AGGAAAGG----AATCCTT------TCATCGAAA------------TTTCAG-------------------------------------AAAGG---------------ATATATATATCTA----TATATA---------------TAGATA---TATCTATTTGTACTGAAATACTATA----TTCAA--------------TTTCTTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATC-----TTTCT------------------------ATCACAAAGGAAA-----------GATGTGAAAA---AAAGAAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCCTA----------GTCTGATAGG---------TCTTTTGAAGAA--CTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGATAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGATTTAAGAAATCGTGAGGG Aeschynomene_indica_AF272084 ATGGAGGAATATCAAATC---------TATTTAGAACTAAATGGATCTCGCCAACATAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCACCTATGGTCATGATTTAAATATAAATCGATCCTTTTTGGTGGAACATATGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAACGATTCTAAC------AAAAACCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCTATTTTCCCGACAATTT------CCTTCCGCT---------TTAGAGGAGTCAGAAATAATTCAATCTTTGAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAGGATAAATTGACATATTTGAATTTTGTTTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTCTTCGATACTGGGTGAAAGATCCCCCCCTCGTTCATTTATTAAGATTATTTCTTTTT------GAATATTGTAATTGGACT------------AGTCTTATTACTAAA------------AAAAAACGTATTTCGACTATCTCA------AAAAATAATCCAAGAATTTTTTTGTTCCTATATAATTTTTATGTATGGGAACACGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCCTTTACGATTTCACTCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGCAAAAATCGAACAT------CTTGCGGAACTCTTTTCT------AAGAATTTTAGGTTTCCCTTCTCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------ACGCCTCTGTTGCTGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTAATTTTTATGTTTGGTCTCAACCGGGAACGATCCAGATAAAC---CAATTATTATCCGAGCATTTATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGCTAGAAAATTCATTTCTACTCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCGAATTATTCCTTTAATTAGATCTTTAGCTAAAGCGAAATTTTGTAATATCTTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCTTCAAAAAAAAAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTCTTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCCTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATACAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAGGATCTCGTCAATGTAAATGGA---------------------------TAAAATTGTATTGAGCCTTGGTATGGAAACGTACCAAGTGACAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCAA------AA---------GAAAA-----GTAAACAAAAA----------------AA-----------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACA------ACATTTCCTTT--CGTGTT----------AGGAAAGG----AATCCTT------CCATAGAAA------------TTCTAC--------------------------ATCTACAAAGGAAAGG---------------ATATACATAGAAA----TATATA------------------------GACGTATTTGTACTGAAATACTAT-----TTCAC--------------TTGATTAA---TGAA------------GA-----TTCCCAA----TCTCTATTT-----GTGAATC-----------------------------------------------------------------------AAACAAA---TTCTAA----ATTGAA--------GAAAGAATGGAATA---------TTTACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAAAAATCGTGAGG? Airyantha_schweinfurthii_JX295897 ATGGAGGAATATCAAGCA---------TATTTAGAACTAGATAGATCTCACCAACCGGACTTCCTATACCCATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGGGGAAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTACTAGTTGTAAAACGTTTAATTACTCGACTGTATCAACAGAATCATTTGATTATTTATGCTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCGTTCTTTCATTTACTAAGGTTGTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTGATCCAAGATTTTTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------ATTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACTTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATATCATTTTGAGGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCGAAATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCCTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGAAATTTTTGACCGCTTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAATCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGA?????????????CTTGGTA-GGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAA-CCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCAGTTTT-------CCGAAAAC-AAA---------GAAA------GTTCAGAAAGC-------------AAGAATAACAAA----------------GGATAGGTGCAGAGATTCAATGGAAGCTGTTCGAACAAA-----TGGAGTTGAAG------ACATTTCCTTT--CGCATT----------AGGAAATG----AATCCTT------CCATCCAAA------------TTTCCG--------------------------------AAAGGAAAGGATCAAGG--------AAAACCA----------TATATA------------------------TACGTGTATGTAATGAAATACTAT-----TTCAA--------------TTGATTCA---TGAA------------GA-----CTCTAAA----TTTCTATTT-----GTGAATA-----TTTCT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAAAATGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------ATCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTTTACATGTCAATACCGACAACAA--------------------TGAA-TTTAT??????????????????????????????????????? Aldina_insignis_JN168674 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGAAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGGGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCATTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAACCCTGAGCCAAATCCTGTTTT-------CCAAAAAC-AAA---------GAAAA-----GTTCAGAAAGCGAGAATAGAAAGCGAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTTCGCGCGTT----------AGGAAAGG----AATCCTT------CCATCAAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----TTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGGTAGA---------TCTTTTGAAGAA--CTTATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAATATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Aldina_latifolia_JX295861 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTAGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGGGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCATTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCGAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGCGAGAATAGAAAGCGAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTTAA--------------TTGATTAA---TGAA------------GA-----TTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGGTAGA---------TCTTTTGAAGAA--CTTATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAATATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Alexa_bauhiniiflora_JX295931 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTGTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTATACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGCGTTTCTTCTCCTTTGCAG------AAGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAACTAAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACG------ACATTTCCTTT--CGCGTT----------AGGAAAGT----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATTGTGAGGG Alexa_canaracunensis_JQ669613 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTATGTTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTCAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGCGTTTCTTCTCCTTTGCAG------AAGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACG------ACATTTCCTTT--CGCGTT----------AGGAAAGT----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAGAATCCGTCGACTTTAGAAAT--TG???? Alexa_grandiflora_JX295968 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTATGTTAATGATTCTAAC------AAAAAT?AA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTCAATTATGTGTCAGATGTACGAATACCCTATCC???????????????????????????????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCAAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACA------ACATTTCCTTT--CGCGTT----------AGGAAAGT----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------TATATATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGA?????????????????? Amburana_acreana_JX295866 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGG?????????????????????????????????????TCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTATTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTATCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTTATTC------TTCAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGTGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----TTTCAGAAAGA----------------AA-----------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAATTGATG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----A----------------------------------------------------------------------------------TCAAGG--------ATAAACA----------TATATG--------------------------CATATATGGACTTAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT-------------------------CCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGACGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTAGAGTAAGAGGAAAATCCGTCGATTTTCGAAATCGTGAGGG Amburana_cearensis_AY553712 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTAGTAAGGTTGTTTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTATTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTTATTC------TTCAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGG-AAC{AC}TACCAAGTGTGAA-CTCTCAAATTCAGAGAAATCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----TTTCAGAAAGA----------------AA-----------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAATTGATG------ACAT{AT}TCCTTT--CGCGTT----------AGGAAAGG----A----------------------------------------------------------------------------------TCAAGG--------ATAAACA----------TATATG--------------------------CATATATGGACTTAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT-------------------------CCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGACGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTCGAGTAAGAGGAAA-TCGGTCGATTT-CGAAAT???????? Amburana_cearensis_JX846614 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTAGTAAGGTTGTTTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTATTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTTATTC------TTCAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGTGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----TTTCAGAAAGA----------------AA-----------------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAATTGATG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----A----------------------------------------------------------------------------------TCAAGG--------ATAAACA----------TATATG--------------------------CATATATGGACTTAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT-------------------------CCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGACGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTAGAGTAAGAGGAAAATCCGTCGATTTTCGAAATCGTGAGGG Amicia_glandulosa_AF203583 ATGGAGGAATATCAAATC---------TATTTAGAACTAGATGGATCTTGCCACCGGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGTCTATGGTCATGATTTAACTAAAAATAGATCTATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATAATTCTAAA------AAAAATATA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTTGGGGAAATTCCATTTTCCCGACAATTG------AGTTCCTCC---------TTAGAGGAGGTCGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTTTCAAATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACC????????????????????????CCCTTCTTTCATTTTTTAAGATTGTTTCTTTAT------GAGTATGACTATTCGAAT------TGGAATAGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTATCA------AGAAGTAATCCAAGATTTTTCTTATTCCTATATAATTTTTTTGTATGTGAACACGAATCCATCTTTCTTTTTCTACGTAATAACTCCTCTCATTTACGATTAAATTCTTTTAGCCTTCTTTTTGAGCGAATCCAATTATATTCAAAAATTGAACAT------CTTGTCGAAGTCTTTGTT------AAGGATTTTTCATCTACTTTATTATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTCAATAAATGGCAATACTATCTCATCTATTTCTGGCAATGTCATTTTAATGTTTGGTCTCAAGCAGGAACGATCCATATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTCAATTTTTCACTGGTACGGAGTCAAATGTTAGAAAATTCATTTCCAATCGAAATAGGTAGGAAAAGGCTTGATACAATAGTTCCTATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAGCCCGTTTGGACTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAGGTTTGTATCAACTAAAATATATACTTCGGCTTTCTTGCATTAAAACATTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGACGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAACGATCTAGTCAAT---CAGGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATAAACAATGGG-CAATCCTGAGCCAAATCCCATTTT-------CCGAAAGC-AAA---------GAAAG-----GTAAAGAAACT-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACG------ACATTTCCTTT--CTCGTT----------ACGAAAGG----AATCCTT------TCATCGAAA------------TTTCAG-------------------------------------AAAGG---------------ATATATG----------TATA---------------CAT-C------TATTTATTTGTACTAAAATAGTATA----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGCAAA----TCTCTATTT-----GTGAATC-----CTTAT------------------------ACCACAAACGAAA-----------GA-----------AAAA------TTCCAA----GTTGAA--------GAAAGAATTGAACA---------TTCACTAATCAAATCATTCACTCC--ATCAAA----------ATCTGAGAGG---------TCTTTTGAATAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGA??? Ammodendron_argenteum_AY386957 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATACCGCGCCAACAGGACTTCTTATACCCACTTATTTTTCGTGAATATATTTATGGACTTGCTTATGGTCATGATTTT------AATGGATCCATTTTTACAGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTGATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGTTATAACAAGAATTTATATTCTCAAATAATATCAGAAGGTTTTACCACCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTTCTCC---------TTAGAGGGGGCAGAAGTCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGTACGAATCCCCTATCCTATCCATCTGGAAATTTTGGTTC????????????????????????????CCCCTTTCTTCATTTATTAAGGTTGTTTCTTTAT------GAGTGTTGT---------------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTATTCCTATATCATTTTTATGTATGTGAATATGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAATGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGGT------TTTGTCGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTT------TTCACAGATACTTTAATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAATGATCCAAATAAAC---AAATTC---TCCGAACATTCATTTCACATTTTG------GGCTATTTTTCAAGTGTGCGGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAAAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAACGATCTGGTCAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Amorpha_fruticosa_AY391785 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTT?GCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTTCGTCTACCTCTACCT---TATCATGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGG?ACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAT?CAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAA?CAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAA?TTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACTGAGTGAGAA-TTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAA--AAA-------------------GTTCAAAAAGC-------------GAGAATAATAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGCTGACG------ACATTTCCTTT--CGTGTTAGAAATAGAAAAGAAAGG----AATCCTT------CCATCGAAA------------TTCAAG--------------------------------AAAGGAAAGG---------------ATAAACA--------AATATATA------------------------TACGTGTATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCCA----TCTCTATTT-----GTGAATA-----TTTAT------------------------GCCACAAATGATA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAAAACTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAA--------------------AGAAATTTATAGTAAGAGG?????????????????????????????? Amphimas_pterocarpoides_JX295894 ATGGAGGAATATCAAGTA---------TATTTAAAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGGTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------ATAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTCTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCAAAAATTACTCCAAAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------CGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATAGGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATCATT---TTCAGCAATGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTG-GAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG-------------------------------------AAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGGACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAATATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Anarthrophyllum_desideratum_AY386923 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTCGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATTATTCTAAA------AAAAATCAA---TTTTTGGGGTATAATAAGAATTTGTATTCTGAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAAGGGACAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTTCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCCATCCATCTCGAAATCTTGGTTCAAGTCTTTCGATATTGGGCGAAAGATGCCCCTTTGTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------AAAAGTAATCTAAGAGTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTATAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCACAGAAT------GCGTCCCTTTTGATGTATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCAGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTTTTTGATCTTTCAA------AGGGCTTCTTCTACTTTGAAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAC-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-TAATCCTGAGCCAAATCCCGTTTTT-----CGCAAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTTGGGTT-----AGTAAAGG----AATCCTT------TCGTCGAAA------------TTGCGG-------------------------------------AAAGGATCAAGA--------ATAAACG----------TATATA----------------CA--TATATACCTATATGGAGTGAAATATTAT-----TTCAA--------------TTGATTAA---TAAA------------GA-----CTTAAAA----TCTCTATTT-------------------------------------------------------------------------------------------------------GTTGAA--------GCAGGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATGATA----------ATCTGATAGA---------TCTTTTTAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Andira_carvalhoi_JX295958 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTT????????????????????????????????TTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCT{CT}CCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCTTTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGA????????????CCTTGGTATGGAAACCAACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Andira_galeottiana_AF142681 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGGGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAAAAAAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTAAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCAT------AGTCAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA---TTGATTAACAATTGATTAA---TGAA------------GA-----CTCCAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG? Andira_humilis_JX295960 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAA?????????------???????????????????????????------???????????????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------?????????????????????????????????????????????????????????????CATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Andira_inermis_JF501102 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTTAAAGATGCCCCTTTCTCTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTAAAA------AAAAAAAATGAGAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGAGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTCTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGG-AACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAA-TCGAGA??? Andira_legalis_JX295893 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCAACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Andira_marauensis_JX295899 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGGAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTCCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGTTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAATACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Andira_ormosioides_JX295962 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGGGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAAAAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????------???????????????????????????------???????????????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------???????????????????????????????????????????????????????????????TTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTCAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Andira_sp_JX295896 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCT{CT}CCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCAACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Angylocalyx_sp_AY553715 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTCGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATACTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGCCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTAGTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATGCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA????????TGAGCCTTGGTATGGAAAC-TACCAAGTGAG-A-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTCT------------------------ATCACAAATGAAA-----------GATGTGAATC---AACTCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATT{CT}TACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGA????????????????????????????? Aotus_ericoides_AY386884 ATGGAGGAATACCCGGTA---------TATTTAGAATTTGATAGATCCCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATGTTTATGGAATCGCTTACGGACATGATTTA------AATAGATCCATTTTTGTAAAAAATGTAGGT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCCTTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---TTTTTGGCGTATAACAAGGATTTAGATTCTCGAATAATATCCGGTGGATTTGCCGTCGTTGTGGAAATTCCATTTTCCCCGCAATTC------AGCTCTTTT---------TTAGAGGAGACACAAATAGTAAAATCGTATAACAATTTGCGATCAATTCATTCAACTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATATGGGTTCAAACTCTTCGATACTGGTTGAAAGATACCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AGTAGTCTTATTACTCCA------------GAAAAATTGATTTATACTTTTTCAAAA---AGTAATCATCCAAGATTTTTCTTGTTTCTCTATAATTTTTATGTATGGGAATACGAATCTATCTTCCTTTTTCTACGTAATAAATCATCTTATTTACGATTAAAATCTTTTATCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATGGAACAT------CTTGTAGAAGTATTTTCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAAGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTACAAAGAAT------ACACCTCTTTTGATAAAAAAATGGAAATATTATTTTATACATTTCTGGCAATGTCATTTTGATGTTTGGTATCAACCGGAAATGATCCATATAAAC---CAATTC---TCCAAGCATTCATTTTATTTTTTG------GGCTATTTTTCAAACGTGCGGCTAAATCCTTCTGCAGTAAGGAGTCAAATGCTGCAAAGTTCATTTCTAATCGAAAATGTTACGAAAAAGCTTGATACAATAGTTCCAATTATTCGTCTAATTAAATCATTGGCGAAAGCGAAATTTTGTAATGGATTGGGGCATCCCATTAGTAAGTCGATCTGGGCTGATTCACCCGATTTTTTTATAATTGAGCGATTTTTGAAGATCTATAGAAATATTTCTCATTTTTACAAAGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAGTATATACTTAGGCTTTCTTGTGTGAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTCTTGAAAAGATTATCTTCGGGAGAATTTTTGGAAGAATTTGTTACAGAGGAAGAAGAGATTCTTCCTTTGATCTTTCCA------AAAACTTCTTGTACTTTGCAGTGG---GGTTTCTATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCACCAACGATCTGGTGAAT---CGTGAA---------------------------TAA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Apoplanesia_paniculata_AF270860 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCGA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAAGAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATC????????????????????????CCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAATAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTTCGTCTACCTCTACCT---TATCATGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACACCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACTGAGTGAGAA-TTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAA--AAA-------------------GTTCAAAAAGC-------------GAGAATCAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGTTAGAAATAGAAAAGAAAGG----AATCCTT------CCATCGAAATTCCCATCGAAATTCAAG--------------------------------AAAGGAAAGG---------------ATAAACA--------AATATATA------------------------TACGTGTATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCCA----TCTCTATTT-----GTGAATA-----TTTAT------------------------TCCACAAATGATA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAAAACTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Arachis_pintoi_AF203596 ATGAAAGAATATCAAAGA---------TATTTAGAACTAGATAGATCTCCTCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTTAATAGAAATCGATATATTTTGTCGGAAAATGTGGAT------TATGATAAGAAA------TCTAGCTTACTAATTGTAAAACGGTTAATTACTCGAATATATCAACAGAATCATTTGATTATTTTTGATAACGATTCAAGT------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATTGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCATAAAATCTTTTAATAATTTGCAATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAAATTTTTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAA???????????????????????????CCCTTTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTGACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTTCTACATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTTTTTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATGGAGCAT------CTTGTAGAAGTCTTTTCG------AATAATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAGATACTATCTCATTTATTTCTGGCAATGTTATTTTGATATTTGGTCTCAACCCCGAATGATCCATATAAAC---GAATTA---TTTGAGAATTCATTTCATTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTAAACTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATAGAAATTGGTATGAAAAAACTTGATACAATAGTCCCAATTATTCCCTTAATTAGATCTTTAGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCGTTTGGGCCGATTCATCTGATTTTGATATAATTGACCGGTTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGGACTTTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAAAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCGTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGTAACGATCCAATCAATGTAAAT------------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-TAATCCTGAGCCAAATCCCGTTTT-------CGGAAAGG-AAA---------TAAAC-----ATTAAGAAAGC-------------GAGAATAAAAAAG---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACCTTTCCTTT--CGCGTG----------AGGAAAGG----AATCCTT------CTGTACAAA------------TGAAAT---------------------------TC--TC---GAAAGG---------------CTATACA--GAAATATGTATATA---------------GACTTGTT-TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------TACACTACTCGAAA----TCCCTATTT-----TTGAATC-----CTTAT---ATCACAAATGGAAAGATGTGTATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTAAA--------TAAATAATTGAATATTCATA---TTCACTGATCAATTTATTCACTCC--ATCCTA----------GTCTGATAGA---------TCCTCTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATCTCGACAACAA--------------------TGAAATTTATAGGAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGG? Arcoa_gonavensis_EU361861 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCAATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCTTTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTCAAAGATGCCTCTTCTTTTCACTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAATATCTTCTGGAGTCCTTTTTGAGCGATTCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCCACCCTATGGTTC------TTCAAGGACCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCTTATAAAC---AAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTTAAATGTGCGACTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATTTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAACGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTCTATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------CATCAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAG-A-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-CAA---------GAAGA-----GTTCAGAAA-T-------------GAGAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TAGAGTTGACG------ACATTTCGTTT--CGTT------------AGTAAAGG----AATCCTT------CTATCGAAA------------CTCCAG--------------------------------AAAAGAAAGGATCAAGG--------ATGAACA----------TATATA------------------------------TACGTACTGAAATACTAT-----TTCAA--------------TTGATT--------A------------GA-----CCCCAAT----TCTTTCTTT-----TTTCATA-----TTTAT------------------------ATGACAAATGAAA-----------GATGTGAATC---GA--------TTCCAA----GTTGAA--------AAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTCAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCG--AGG? Astragalus_canadensis_AY386875 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATATCCACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAAAATGTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATCACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCGAATGATTCTAAG------AAAAATCCA---TTTTTGGGGTATAATAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATTCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTCTTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------AAAAATAATCCGAGATTATTCTTATTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCTACCTTAACATTC------TTCAAGGATCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCCTTTTACCTTTTA------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATCGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTACATGGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGTAATGATTTGGTCAAT---CATGAA---------------------------TGA??TTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCTGCTTT-------CCGAAAAC-AAAAAAA-----TAAAA-----GTTCAGAAAGT-------------TCAAATTAAACAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTAACAAA-----TGGAGTTGACA------ACATTTCCTTT--CGCAGTA----------GGAAATG----AATCCTT------CTATCAAAA------------TTCCAG-------------------------------------AAAGGATCAAGG--------ATAAACA----------TATATA---------------TTTA-----TATATATATTTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------AA-----TTACAAACT--TAT--ATTT-----GGAAATA-TT--TCGAT---------------TCGATTTCGATCACAAA--A-------------GATGTGAATC---AAATGAA---TTCCAA----CTTGAAGA--------AAAAATGTAATA---------TTCATTAATCAAATCAGTCACTCC--AACATA----------GTCTGATGGA---------TCTTTTGAAGAA--ATGATTAATCAGACAAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACACCAA--------------------TGAAATTTTTAGTAAGAGG?????????????????????????????? Ateleia_glazioveana_GU220020 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATCGATCTCGCCAACAGGATTTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACA------AAAAATCCA---TTTTTGGGGTATAACAAAAATTTGTATTCGAAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTGATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTTTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA----GGC-TA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGGAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCGAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------CA-----CTCCAAA----TCGCTATTT-----TTGAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCAAGCC--ATCATA----------GTCTGATGGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ateleia_herbertsmithii_AY386953 ATGGAGGAATATAAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGATTTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA---TTTTGGGGGTATAACAAAAATTTGTATTCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTC????????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTCTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAGAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAAACTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA----GGC-TA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGGAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCGAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------CA-----CTCCAAA----TCGCTATTT-----TTTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACGCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ateleia_pterocarpa_GU220023 ATGGAGGAATCTCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGATTTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA---TTTTGGGGGTATAACAAAAATTTGTATTCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTCAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA----GGC-TA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGGAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCGAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------CA-----CTCCAAA----TCGCTATTT-----TTTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACGCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Austrosteenisia_blackii_AF142707 ATGGATGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTAACCATGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCGTTTTTGTAGAAAATATAAGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTTATTTGATCATTTTTCCTAATGATTCTAAC------AAAAATCCT---TTTTGGGGATATAACAACAATTTTTATTCTCAAATAATATCCGAGGGTTTTGTTATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGTTCTTCT---------TTAGAGGAGACAAAAATCGTAAAATATTATAAAAATTTGCGATCCATTCATTCTATTTTCCCTCTTTTCGAGGATAAATTTACATATTTAAATCATGAGTCCGATATACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATCAAAGATGTACCTTTCTTGCATTTATTAAGATTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------CAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCCCGATTTTTCTTGTTCCTATTTAATTTTTATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAATAAATCCACTCATCTACGATTAAAATCTTTTCGTGTTCTTATTGAGAGAATTTCTTTCTATGCAAAAGTAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTATACCTTATCATTC------TTTAAGGATCCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ATGCCTCTTTTGATGAATAAATGGAAATCTTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCTAGAACTATTCATATAAAG---CAATTA---TCCAAGCATTCATTTTACTTTTTG------GGTTATTTTTTAAATGTACAACTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAACAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAAACCGGTCTGGGCCGATTTATCTGATTTTGATATTATTGACCGATTTTTGTGGATATGCAGAAATTTTTCTCAGTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGATATTTTTTCTTTGATCTTTTCA------AAAACTTCTTCCACTTTACAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATCTTCTT---TTCAGCAATGATCTAATCAAT---TATTCA---------------------------TAAAATTGAATTGAGTCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAAAGGG-CAATCCTGAGCCAAATCCGGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGT-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACTTTTCCTT---------------------GAAATA----AATCCTT------TCATCAAAA------------TTCTAG------------------------------------GAATGGAGCAAGT--------ATAAACA----------TATATA--------------TACA------CACATATATGTATTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCTAAATC--TCC--A-TTT----GTGAATA-T---TTCTA-------------------------TCACAAATGAAA-----------GATGTAAATC---AAATCCAA--GTTGAA------------------GAAAAAATGAAATA---------TTCATTGATCAAATCATTCATTTC--ATCATA--------------G-TAGT---------TCCTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGA??? Baphia_madagascariensis_AY553718 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTGACCAACCGGACTTCCTATACCCATTACTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATGGATCCATTTTTTTGGGAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTATTAGTTATAAAACGTTTAATTATTCAAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATAAA---TTTTTGGGGTATAACAAGAATTCTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCCATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATATGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------AAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGTGATCCAAGATTTTTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATACATATAAAC---CAATTA---TCCAAACATTCATTTCACTCTTTG------GGCTATTTTTCAAATGTGCGTCTAAATCTTTCAGTGGTATGGAGTCAAATGCTACAAGATTCATTTCTAATCGAAATCTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGTTAAAGCGAAATTTTGTAATGTATCAGGACATCCCATTAGTAAGCCGGTCTGGGCTGATTCATCCAATTTTGAAATTTTTGACCGATTCTTTCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAGACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTCTGATCTTCCCA------AAAACTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAATAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAATG----AATCCTT------CCATCCAAA------------TATCCG--------------------------------AAAGGAAAGGATCAAGG--------AGAACCA----------TATATA------------------------TACGTATATGTAATGAAATACTCT-----TTCAA--------------TTGATTCA---TAAA------------AA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTGT--------------GAATATTTCTATCACAAATAAAA--TAAAA----GATCTGAATC---AAATCAA---TTTCAA---AGGTGAA--------TAAAAAATAGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATG----------ATCTGATAGA---------TCTTTTGAAGAA--CTGATTAATTGAACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Baphia_massaiensis_AF142683 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACCGGACTTACTATACCCATTAATGTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTACTAGTTATAAAACGTTTAATTATTCAAATGCATCAACAGAATCATTTGATTCTTTATGTTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAAAATCTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCTATTCATTCAATCTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATGCCCTATCCTATCCATCTGGAAATATTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATCATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGCCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGT---TTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCAACCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTTCGTCTAAATCTTTCAGTGGTATGGAGTCAAATTCTACAAAATTCATTTCTAATTGAATTTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCAT??????AGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTTTTGACCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTCCAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTTTAATCTTTCCA------AAAGTTTCTTCTACTTTACAG------AGATTATATAGAGGTCGGATTTGGCATTTGGATATTCTT---TTCGGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGAAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAATG----AATCCTT------CCATCTAAA------------TTTCCG--------------------------------AAAGGAAAGGATCAAGG--------AGAACCA----------TATATA------------------------TACGTATATGTAATGAAATACTAT-----TTCAA--------------TTGATTAA---TAAA------------AA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTCT------------------------ATCACAAATAAATAAAAAAGAAAAGATCTGAATC---AACTAAA---TTCCAA----GTTGAA--------TAAAGAATGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------ATCTGATAGA---------TCTTTTGAAGAA--CTTATTCATTTGACGAGAATAAAGATAGAGTCCCATTTTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Baphiopsis_parviflora_JX295895 ATGGAGGAATATCAAGTA---TA?TTTAATTTAGAACTAGATAGATCTCACCAACCGGACTTCCTATACCCATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTACTAGTTATAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAGAATCAA---ATCTTGGGGTATAACAAGAATTCTTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAAAAATCGTAAAATCTTATAAGAATTTGCGATCCATTCATTCCGTTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAATCGATTTCTATTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------ATTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCGAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAATGATCCATATAAAC---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGTCTAAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCAATATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCGTCTAATTAGAGCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGCGATTTTTGACCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCTAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAAATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAACGATCTGGTCAAT---AATGAA---------------------------TGA?????????????C--GGTATGG-AACGGTC?AAGTGAG?A-CTTTCACATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAAC-AAAAAA------GAAA------GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAATG----AATCCTT------CCATCCAAA------------TCTCCG--------------------------------AAAGGAAAGAATCAAGG--------AGAACCA----------TATATA------------------------TATGTATATGTAATGAAATACTCT-----TTCAA--------------TTTATTTA---TGAA------------AA-----CTCCAAA----TTTATATTT-----GTGAATA-----TTTCT------------------------ATCACAAATAAAA-----------GATCTGAATC---AAATCAA---TTCCAA----GTTGAA--------TAAAAGATGGAATA---------TTC{AC}TTGATCAAATCATTCACTCC--ATAATA----------ATCTGATAGA---------TCTTTTGAAGAA--CTTATGAATCGGACGAGAATAAAGATAGAGTCCCATTTTACATGTCAATACGGACCACAA--------------------TGAAAT{GT}A{AC}TAGTAAGA{CG}GAAA-T????????????????????????? Baptisia_australis_AY386900 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGACTTCTTATACCCACTTATTTTTCGTGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTGCGGAAAATGCAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTCATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCCTCC---------TTAGAGGGGGTAGAAATCATAAAATATTATAATAATTTGCGATCAATTCACTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCGATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTCTGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCGCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTACAGATCCTTTCATTCATTATGTTAGATATCACGGAAAATACATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCCGAACATTCATTTCACCTTTGG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCGGCAGTACGGAGTCAAATGTTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAACTTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGGCAGAGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA???????????GCATTGGTATGGAAACTTACCGTGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGATAAAAC-AAA---------GAAAAGT---GTTCATAAAGC-------------GAGCATAAA------GCGAGAATAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAATTAACG------ACATTTCCTTT--CGCATT--------------AAGG----AA-----------------------------------GGT------------------------------------------ATCAAGG--------ATAAACG----------TATATA----------------------TATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CCTAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---CAATCTC---TTCCAA----GTTGAAGAGAGA--GAAAGAATTTAATA---------TTCATTGATCAAATCATTGATTCC--ATCATA----------GTCTGATCGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Bobgunnia_fistuloides_EU361885 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCCCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTATTGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCTTCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGGTTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGA????????????CCTTGGTATCGAAACCTACCAAGTGAGA--CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------A-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCAAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAAG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------AA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTCT------------------------ATCACAAATGAAA-----------GATTTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TG{AG}AATTTATCGTAAGAGGAAAATCCGTCGA?????????????????? Bobgunnia_madagascariensis_AY386940 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAAGCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCCCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCTTCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGGTTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGA?ATTGGATTGAG-C?TGGGATCGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------A-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCAAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAAG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------AA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTCT------------------------ATCACAAATGAAA-----------GATTTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCG-CTTTAGAAATCGTGAGGG Bolusanthus_speciosus_AF142685 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATATCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCAGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTG------AGCTCTTCC---------TTAGAAGAGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGGGTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTAATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTTATGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCG??TTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTAAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAG------AGGTTGTATAGGGGCGGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGATCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGGTAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAAC-AAAAAAA-----GAAAA-----GTTCATAAAGC-------------GAG------------ACGAGAATAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACGTTGACGACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT--CTATCCATCGAAA------------TTTCGG-------------------------------------AAAGGATCAAGG--------ATAAACG----------TATATA--------------------TATATATGTATATGTACTGAAATATTAT-----TTCAA--------------TTGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACTGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Bowdichia_nitida_JX124395 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAAGAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------GGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTCCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CTATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Bowdichia_virgiloides_AY386937 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAAGAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------GGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA?????????????????????GG-AACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTCCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CTATCGAAA------------TTCCGG--------------------------------AAAAG--------------------------A----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----T-CA{AC}--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAA{AC}TCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATC{AC}TACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGA????????????????????????????? Brongniartia_alamosana_AF142688 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTAGCCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTG------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA------AAAAATCCA---TTTTGGGGGTCTAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTGAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGGAATCCAGGATTCTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGGTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGAATTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAC------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTAGTCAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Brya_ebenus_AF270876 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAAAATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTCTATTTAAATCGATCCATTTTTGTCGAAAATGTGGATGTGGATTATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTTCTAACGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAAAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTCCCCGAAAATTA------ACTTCTTCT---------TTAGAGAAGGTGGAAATCGTCAAATTTTTTAATAATTTGAGATCAATTCATTCCATTTTTTGCTTTTTCGAGGAAAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTTA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGCGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAGCTCTTTTAGCATTCTTTTTGAACGAATCTATTTCTATGCGAAAATAGAACAT------CTTGTAAAAGTATTTTCT------AAGAATTTTTCGTCCACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTGATCTATTTTAGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCGGAGCATTCATTTCACTTTTTGGGGGGAGGCTATCTTTCAAATGTTCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAACTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCCTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTATAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAGAGTACTGTACGCACTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTAGATATTCTT---TTCAGTAACGATTTGATCAATGTAAATGGA---------------------------TAA????????????CCTTGGTAGGGAGACTTACCAAGTGAGAA--TTTCAAATTCAGAGAA-CCCCGGAATTAACAAAGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAGTC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGT----AATCCTT------CCATAGAAA------------TTCTAG-----------------------------AATAGAAAAAAGG---------------ATATAAA----------TATATA------------------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GAGAATC-----TTTAT------------------------ACCACCAATGGAAA----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTTACTCC--ATCATA----------GTCTGATAGA---------TTTTTTGAAGAA--CTGCTTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAA----AAA----G?????????????????????? Cadia_purpurea_JX295932 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATACATTTTTGCGGAAAGTGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTACTGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAAGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAAACGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCTTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAATATCTTTTAACATTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTTTGGCAATGTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCAAAATAAAC---CAATTC---CCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA??????????A?????GGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAAC-AAA---------GAAAA-----GTTCATAAAGC-------------GAGAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAA-------------------------------------------------------------------------------------AAAA------------TTGCGG-------------------------------------AAAGGATCAAGG--------ATATACG------------TA--------------------------TATGTATATGTACTCAAATAGTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----TTTTATA-----TTTAT------------------------ATCACAAACGAAA-----------GATGTGAATA---AAATCATTTTTTCCAAATAAATGGAA--------GAAAGAATGGAATA---------TTCATTGAGCAAATCATTCATTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Calpurnia_aurea_AY386951 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGACGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACCTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAGAAATCCTCTTATTTACGATTAATATCTTTTAACGTTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTGCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATCTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCCAAATAAAC---CAATTC---CCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGATAC?ATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACACCCCATTAGTAAGCTGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTGTACTTTACAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAAC-AAA---------GAAAA-----GTTCATAAAGC-------------GAGAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTTACG------ACATTTCCTTT--CGCATTAGGAAT----AGGAAAGG----AATCCTT------TTATCAAAA------------TTGCGG-------------------------------------AAAGGATCAAGG--------ATAAACG----------TATATA--TATATACGTATA------------TGTATATGTACTGAAATAGTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCAAAA----TCTCTATTT-----TTTTATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCATTTTTTCCAA----ATTGAA--------GAAAGAATGGAATA---------TTCATTGAGCAAATCATTCATTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATAGCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Camoensia_brevicalyx_JX295946 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATCTT------AATGGATCAATTCTTGTGGAAAATGTAGGT------TATGAAAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAA------AAAGATCAA---TTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCAATCAATTCATTCAATTTTTCCGTTTTTTGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAGAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGT------GCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAAC---CAATTC---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCGGTGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCGTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAG------AGGTTATATAAAGGTCGGATTTGGCATTTGGATATTATT---TTCAGCAACGATCTGATCAAT---CATCAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGGGCAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATCTCCTTT--CGCATT----------AAGAAGGG----GATCCTT------CCATCGAAA------------TTCCGC-------------------------------------AAAAGATCAAGG--------ATAAACA----------TATATA--------------------TATATAC-TATATGTACTGAAATACTCT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAGAA----TCTCCATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATAAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTTATTCC--ATCATAGTCTGACATAGTCTGATAGA---------TCTTTTGAACAG--TTGATTAATCAGCCGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Camoensia_scandens_JX295919 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTCATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATCTT------AATGGATCAATTCTTGTGGAAAATGTAGGT------TATGAAAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAA------AAAGATCAA---TTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAGAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGT------GCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAAC---CAATTC---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCAGTGGTACGGAGTCAAATGTTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAG------AGGTTATATAAAGGTCGGATTTGGCATTTGGATATTATT---TTCAGCAACGATCTGATCAAT---CATCAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGGGCAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATCTCCTTT--CGCATT----------AAGAAAGG----GATCCTT------CCATCGAAA------------TTCCGC-------------------------------------AAAAGATCAAGG--------ATAAACA------------------------------------TATGTAC-TATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAGAA----TCTCCATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATAAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTTATTCC--ATCATAGTCTGACATAGTCTGATAGA---------TCTTTTGAACAG--TTGATTAATCAGCCGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Candolleodendron_brachystachyum_JX295890 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATAAA---TTTTTGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATCTTAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAAT??????????????????????????????????GCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------CTTTTCGAAGTATTTGCT------AAGAATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCCTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGTAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAT---------------------------TGA??????????????TTGGTATAGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------A-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTTAGGAGTT---AGGAAAGG--------------------------------------------------------------------------------------ATCCAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCCTTATTT-----TTAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCCACATGTCAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Carmichaelia_williamsii_AY386873 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTTAATTTTAAGAGATCTACATTTGTGGAAAATTTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAATAAGAATTTTTATTCTAAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTCTAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAATTTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCGAGATTATTCTTATTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTACTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTCCGTCTACCTTAACATTC------TTCAAGGATCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATTCATTTATGGGAATGTTTTTTTGACGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCAATTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGGCGGTATGGGCCGATTCATCCGATTTTGATATTATTGACAGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATCTGGTTCAGAAGAATTATTGGCAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCGACTTTGCAG------AAGTTAAATGGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGA????????????CCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCTGCTTT-------CCGAAAAC-AAAAAAA-----TAAAA-----GTTCAGAAAGT-------------GAAAATTAAACAAAAGA-----------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTAACAAA-----TGGAGTTGACA------ACATTTCCTTT--CTCAGTT-----------G--ATT----AAT------------------------------------G-------------------------------------AAA--ATTA--C----------AAACT------------------------------------------TATATTTGTA----AATA---T-----TTCGA--------------TTC----------------------------------------------------------------------GAT--------------------TTCGATCACAAA--A-------------GATGTGAATC---AAATAAA---TGCCAA----CTTGAAGA--------AAAAATGGAATA---------TTCATT-----AATCAGTCACTCC--ACCATA----------GTCTGATGTA---------TCTTTTGAAGAA--ATGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACACCAA--------------------TGAAATTTTTAGTAAGAGG?????????????????????????????? Castanospermum_australe_JX295891 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCT?????????????????????????????????CCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTTTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGA???????TTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGT----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTT??????????????? Centrolobium_robustum_EU401414 ATGAAACAATATCAAATA---------TATTTAGAACTAGATGGATCTCGCCAACAGAGCTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAAAGAAGGCGGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATACCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATTTTCCTTTTTCTACGTAATAAATCCTCTGATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATACATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTAAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAA?GTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATTCTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGAAAGG---------------ATATACA----------TATATATGTATATA----------------TACGTATTTGTATTGAAATACTAT-----TTCAA--------------TTGAGTAA---TGAA------------GA-----CTCCA---------CTATTT-----GTTACTC-----TTTAT------------------------ATCACAAATGACAAATGAAA----AATGTGAATC---AAATCAA---ATCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Ceratonia_siliqua_EU361911 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGCTAGATCTCGCCAACATGACTTCCTGTACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAAGAGA---TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAAGCAAAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTATTTAT------GAGTATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCCACCCTATGGTTC------TTCAAGGACCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATACATTTATGGCAATGTAATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTACGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGTTAAATTTTGTAATGGATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTATTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------CATCAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-CAA---------GAAGA-----GTTCAGAAAGC-------------GCGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACGTACTGAAATACTAT-----TTCAA--------------TTGATT--------A------------GA-----CCCCAAA----TCTCTATTT-----TTTAATA-----TTTAT------------------------ATGACAAATGAAA-----------GATGTGAATC---GA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAAAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAG?? Chapmannia_gracilis_AF203592 ATGAAAGACTATCAAAGA---------TATTTCGAACTAGCTAGATCTCGTCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTGACTAGAAATCGATATATTTTGGCGGAAAATGTGGAT------TATGATAAGAAA------TCTAGCTTACTAATTGTAAAACGTTTAATTACTCGAATATATCAACAGAATCATTTGATTCTTTTTGATAACGATTCAAAT------AAAAATAAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCATTGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGCAATCGTAAAATCGTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAAATTATTTTCCGATGTACGAATACCCTATCCTATCCATCT??????????????????????????????????????????CCCCCTCTATCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTCTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTAT------AAAAATTTTGCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATCTCATTTATTTCTGGCAATGTTATTTTGATATTTGGTCTCAACCCCGAATGATCCATATAAAC---GAATTA---TTCGAGAATTCATTTCATTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCGAAACTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAACTTGATACAATAGTCCCAATTATTCCCGTAATTAGGTCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGGTATTTGCGGATATACAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGGACTTTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCGG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGTAACGATCCAATCAATGTAAAT------------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-TAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------TAAAC-----ATTAAGAAAGC-------------GAGAATAAAAAAG---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACCTTTCCTTT--CTCATG----------AGGAAAGG----AATCCTT-CTGTACAAATGAAA------------TTCTCG-------------------------------------AAAGG---------------CTATACA----------GAAATATG--TATA-----TGTACGTATT-TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------TACACTACTCGAAA----TCTCTATTT-----TTGAATC-----CTTAT---ATCACAAATGGAAAGATGTGTAGCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTAAA--------GAAATAATTGAATATTTACA---TTTACTGATCAATTTATTCACTCC--ATCCTA----------GTCTGATAGATCTGATAGATCCTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATCCCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGG? Cladrastis_delavayi_AY386861 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTGCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTTGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCGTTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA???????????????????????????????CAGGTGAGAA-CTTTCACATTCAGAGAAACC-TGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGCATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACCACCA--------------------TGAA????????????????????????????????????????????? Clathrotropis_macrocarpa_JX295930 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTTCCCACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATCAATTTACATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTTGAAT------------AGTCTTATTACTCTA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTCTATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTGCAGAGGAAAAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTCCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAAA-----TTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------GCATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCAAAA------------TTCCGG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCGAATCATTCATTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Clathrotropis_nitida_JX295951 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCTTTTGGGTGGAAAATGGGGGT------TATAACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGAC------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTAACATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTCCTCTT{AT}ATG------GG{AT}TATTTTTCAAATGTGCGGTT{AT}AATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTAGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTAGTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGCCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACGATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAAAA-------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTTTATTT-----GTGAATATTTTATTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAACAA--------------------TGAAATTTAGAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Cordyla_africana_JX295923 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGATGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTTGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTATTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATTCAAGATTATTCTTGTTCTTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CGATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAACATTCATTTATAATCGAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACCGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Coursetia_glandulosa_AF543852 ATGGAGGAGCATCAAGTA---------TATTTAAAACTGGATAGATCTTGCCAACAGGACTTCCTATACCCACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTTGCGGAAAATGTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATCTCTGCTAATGATTCTAAA------AAAAATCCA---TTTTTGAGGTATAATAAGAATATTTATTCTCAAATAATCTCAGAAGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTTGCATTTTTTGAGGATAAATTTACATATTTAAATTATTTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTCTTTCTTTAT------GATTATTGTAATTCGAAT------------AGTCTTATTACTCCG------------AAAAAATGGATTTCGACTTTTTCA------AAAAGGAATCCAAGATTTTTCTTCTTCCTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTACTGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGCCGTTGCT------AAGGATTTTTTGTCTACCTTAACATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCAGTGGTACGTAGTCAAATGCTGCAAAATGCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTCGATCATTGGCTAAAGCGAATTTTTGTAATGTATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTTTACGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTGTTGGAAGAATTTTTTATAGAAGAACAAGAGATTGTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACATAGAAATCGGATTTGGTATTTGGATATTCTTTTTTTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGAAAACTTACCAAGTGAAAA-CTTTCAAACTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCCGCTTT-------CTGAAAAT-AAA---------GAAAA-----GTTCCGGAAGC-------------GAGAAAAA--------------------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGTGATA----------GGAAAGG----AATCCTT------CTATCAAAA------------TTCCAG--------------------------------AAAGGAAGGGATCAAGG--------ATAAACA----------TATATA-------------TGTTTATA---TACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTTAAATAT--TCT--AGTTT----GTAAATA-T---TTCTT-------------------------TCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTACAA----GTTGAGG-------AAAAAAATCGAATA---------TTCATTGATCAAATCATTCACTCTCCATCATA----------GTCTGATAGA---------TCTTTGGAAGAA--CAAATTAATCAGACGAGAATAAAGATAGAGTCCTATTCTACATGTCAATAACGACACTAA--------------------TGAAATTTTGAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Cranocarpus_martii_AF270875 ATGAAAGAATATCAATTA---------TATTTAGAACTAGATAGATCTCGCCAACAAAATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTATATTTAAATCGATCCATTTTTGTCGAAAATGTGGATGTAGATTATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTGTTTCTAACGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAAAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTCCCCGAAAATTA------ACTTCTTCT---------TTAGAGAAGGTGGAAATCGTCAAATTTTTTAATAATTTGAGATCAATTCATTCCATTTTTTGCTTTTTCGAGGAAAAATTTACATATTTAAATTTTGTTTTAGATGTACGAATACCCTATCCTATCCATCT???????????????????????????????????????????????????????????TAAGATTGTTTCTTTAT------GAGTATTGTAATCGGAAT------------AGTCTTAGTACTCAA------------AAAAAACTGATTTATACTTTTTTA------AAAAGTAATCCAAGATTTTTCTTGTTTCTATATAATTTTTATGTATGCGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCAATTACGATTAAGCTCTTTTAGCATTCTTTTTGAACGAATCTATTTCTATGCGAAAATCGAACAT------CTTGTAAAAGTATTTTCT------AAGAATTTTTCGTCCACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTATTTTGATGAATAAATGGAAATATTATCTGATCTATTTCAGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCGAAGCATTCATTTCACTTTTTTGGGGGAGGCTATCTTTCAAATGTTCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAACTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCTATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAGAGTACTGTACGCACTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGTAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAGACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAAAGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAGTC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGATGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG-----------------------------AATAGAAAAAAGG-----------------------------AAATATATA------------------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GAGAATC-----TTTAT------------------------ACCACCAATGGAAA----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTTACTCC--ATCATA----------GTCTGATAGA---------TTTTTTGAAGAA--CTGCTTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Crotalaria_incana_GQ246141 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGGTATATCTCGCCAACTGGACTTCCTATACCCCCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCTTTTTTGCAGAACATGTAAAT------TATGACAATAAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAAAATTTGTACTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAAAAATTTGCGATCAGTTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGAAAAAATAGAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAAT------GCGCTCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCAAAATAAGC---CAATTC---TCCGAGCATTCATTTCATCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACACTAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTTGATATTATTGACCGATTTTTGCGCATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGTGCTTTTGTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAACGATCTAGTCAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Cyathostegia_mathewsii_HM347482 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGTCAACAGGATTTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA---TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTGATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAACGACCTGGTCAAT---CATGAA---------------------------TGA???????????G????GGTATGGAATTTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAA-----GG-ATA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGAAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TGTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGA----G-GATAG Cyathostegia_mathewsii_HM347483 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGTCAACAGGATTTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA---TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTGATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAACGACCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGG-AACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAA-----GG-ATA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGAAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TGTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Cyclolobium_nutans_AF142686 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGATTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAA------AAAAATCCA---TTTTTGGGGTATAACAAGGATTTGTATTCTCAAATAATAGCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGTCGAAAATGATAAAATCCTATAAGAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTAGTTCAAATC????????????????????????CCCTTCTTTCATTTCTTAAGGTTGTTTTTTTAT------GAGTATTGGAATTGCAAT------------AGTCTTATTACTCCT---------------------------------TCA------AAAAGGAATCCAAGATTTTTTTTGTTCCTATCTAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATGTTTGGTATCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------GGAGCTTCTTCTATTTTGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTAGTCAAT---TATGAA---------------------------TGA???????????????????ATGG-AACTTAC-AA-TGAT-A-CTTTCAA-TTCAGAGAAACCC-GGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCAAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAATAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAGA-----TGGAGTTGATG------ACAACTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCCTCGAAA------------TTCCAG-------------------------------------AAAGGATCAAGGATAACCATATAACCA----------TATATA-----ATAATAGAATACA--TATATACATATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAGA----TCTCTATTT-----GTGAATA-----TTTA-------------------------------------------------GGTGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GGAAGGATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATAACGACAACAA--------------------TGAAATTGATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Cytisus_scoparius_AY386902 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACCCACTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCA------AAAAGTAATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTAGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATTTGATCAAT---CATGAA---------------------------TGAAATTGCATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCATTTTT-----CGCAAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------AAAAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAATTGACG------ACATTTCCTTT--CGCGTTGGGTT-----AGGAAAGG----AATCCTT------TCGTCGAAA------------TTGTGG-------------------------------------AAAGGATCAAGA--------ATAAACG----------TATATA----------------CATATATATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TAAA------------GA-----CTGAAAA----TCTCTATTT-------------------------------------------------------------------------------------------------------GTTGAA--------GGAGGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATGATA----------ATCTGATAGA---------TCTTTTTAAGAG--CTGATTAATTAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGA????????????????????????????? Dalbergia_congestiflora_AF142696 ATGGAGGACTATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTACGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC---AAAAAAAACCCA---TTTGGGGGTTATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGCGGAAATTCCATTTTCCAGACAATTACAATTTCGTTCTTCT---------TTAGAAGAGTCGGAAATCATAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTTAATTTTGTTTCAGATGTACAAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGT????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTGATTTCTACTTTTTCA------AAAAGTAATCCAAGAATTCTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAAGAGATCCTCTTATTTACGATTAAACTCTTTTATCGTTATTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTCATTTTTATGTTTGGTCTCAACCTGGAACGATCCATATAAAT---CCATTATTATCCGAGAATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTCAATTTTTCAGTGGTCCGGAATCAAATGCTAGAAAATTCATTTCTAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTAACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATTAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCACTTTTTTAAAAAGATTATATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAGGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAA------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACGTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CTGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGGGTTGACG------ATATTTCCTTT--CGTGTT----------AGGAAAGG----AATCGTT------CCATCGAAA------------TTATAT-------------------------------------AAAGG-------------------------------ATATATA------------------------TACGGATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAG------------GA-----CTCCAAA----TTTCTATTT-----GTGAATC-----GTTAT------------------------ATCACAATTGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----ATTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACTGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGG? Dalea_pulchra_AY386860 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAAAATGTGGAT------TATGATAACAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAACAATTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTAAGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------AAAAGTAATCCAAGATTTTTCTTCTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCCACCTTATCATTG------TTCAAGGATCCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGAAAGAATTTTTTACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATGGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGTAACGATCTGGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Daviesia_latifolia_AY386887 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATAGATCCCTCCAACAATATTTCTTATACCCACTCACTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCCTTTTTGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCCCTTGATTATTTCTGTTAATGATTATAAT------CAAAATCCA---TTATTGGGCTATAATGACAATATTGATTATCAAAGAATATCGGGGGTTTTTGCCGTCGTCGCGGAAATTCCATTTTCCCTACAATTA------AACTCTTAC---------TTAGAGGAGGCCGAAATCTTTAAATCTTATAAGAATTTCCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCCATCCATTTGGAAATCTTGATTCAAACCCTTCGATACTGGATTAAAGATGCCCCTTTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATAGTTTT------------------ATTAATCCA------------AAAAAATATATTTATACTTTTTCA------AAACCTAATCCAAGATTTTTCTTGTTCCTATATAATTCATATATATGGGAATATGAATTTATCTTCCTTTTTCTACGTAACAAATCCTCTAATTTACGATTCAAATCTTTTTCCGTTATTTTTGAGCGAATCGATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTTTCTACCCTATCATTC------TTCAAAGGCCACTTTATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCTCTATTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGCCTAAACCAGGAACGATCCATATAAAC---CAATTA---TCCAAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATATTTCCGCGGTACGGAGTCAAATGATGCAAAATTCATTTCTAATCCAAAAGGTTATGAAAAAGTTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTTGGGCATCCCATTAGTAAGCCGGTTTGGTCCGATTCATCCGATTTTTATATTATTGATCAATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATAGAATAAAGTATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTCTACGCATTTTTTTGAAACGATCAGGTTCGGAAAAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAAATTATTTCTTTCATCTTTTCA------AAACCTTCTTCGACTTTTAAG------GGTTTCTATAGAGGTAGGATTTGGTATTTAGATATTCTT---TCTCGCAATGATCTGGTCAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Dermatophyllum_secundiflorum_AF142693 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACAGGACTTCTTATACCCACTTCTTTTTCAGGAGTATATTTATGGACTCGCTTATGATCATGATTTA------AATAGATCAATTTTAGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTT?GGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCGTTTTCCCTACAATTT------AGCTCTTCC---------TTAGAGCAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACACATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTTGTTCAAACTCTTCGATACTGGGTCAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AAGGATTTGTTGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTAGGAAAAAGCTTGAT??AATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGGGAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCA?CCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGA??????????AGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-----T-------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACG----------TATCTA--------------------TCTATACATATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----ATGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTCT----ATTCATTGATCAAATCATTCATTTC--ATCATA----------GTCTGATATA---------TCTTTTGAAGAA--CTTATGAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATGGTAAGAGGAAAATCCGTCG??????????????????? Dicraeopetalum_stipulare_GQ246142 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATATCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGTTCATGATTTT------AATGGATCCATTTTTGCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTG------AGCTCTTCC---------TTAGAAGAGGCAGAAATCGTAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATTCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AACAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGCGGATATATAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGTATTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTTCTTTTTTAAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAG------AGGTTGTATAAGGGCGGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGATCAAT---CATGAA---------------------------TGA???????????????????ATGGAAA-TTACCC-GTGGTAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCGAAAAC-AAAAAAAAAAAAGAAAA-----GTTCATAAAGC-------------GAG-AT-----------AAGAATAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTT{CT}TAACAAA-----TGGAGTTGACGTTGACGACATTTC{CT}TTT--CGCATT----------AGGAAAGG----AATCTTT--CTATCCATCGAAA------------TTTCGG-------------------------------------AAAGGATCAAGG--------ATAAACG----------TATATA----------TATA----TATATATATGTATATGTACTGAAATATTAT-----TTCAA--------------TTGA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGA{AG}G?????????????????????????????? Diplotropis_ferruginea_JX124397 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA---TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGG??????????????????????????????GGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCA{GT}AGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCT--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Diplotropis_incexis_JX124401 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA---TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????CCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCT--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Diplotropis_martiusii_AY386938 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA---TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCT--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Diplotropis_purpurea_JX124418 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA---TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA????????????????GGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCT--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Diplotropis_triloba_JX124398 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAAGAAA---TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCT--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Dipteryx_alata_AY553717 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATC?????????????????????????????????????????????????????????------??????????????????------------???????????????------------???????????????????????A------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGAAATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCGAACAAA-----TGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GCCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATAAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCG?????? Dipteryx_magnifica_JX295871 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAAAAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATATTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------???AATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCGAACAAA-----TGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA----------------------TATACGTATATGTACTGAAATACTATTTTATTTC--------------------TTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTCT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GCCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Dipteryx_odorata_JX295898 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGA????????????CCTTGGTATGG-AACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCGAACAAA-----TGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA------------------TATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GCCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Dipteryx_oleifera_JX295933 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATGTTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-????????????????????????????AACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCGAACAAA-----TGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GCCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGG?????????????????????????????? Dipteryx_polyphylla_JX295870 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------???AATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCGAACAAA-----TGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------ACATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA---TATATAAAATATATATATATATACGTATATGTACTGAAATACTATTTTATTTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GCCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Dipteryx_punctata_JX295869 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGAAATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAA-----------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCGAACAAA-----TGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GCCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATAAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCG?????????????????????? Discolobium_psoraleifolium_AF270874 ATGAAGGAATATCAAATA---------GATTTAGAACTAGATAGATCCCGCCAACCGAACCTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCCATGGTCATGATTTAAATTTAAATCGACCCATTTTGGTGGAAAATGTAGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTTTGCTAACGATTCGAAC------AAAAATCAA---TTTAGAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCATTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCCTCT---------TTCGAGGAGGCAGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCGATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCT??????????????????????????????????????????????????????????????????????CTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTTTTACTCAA------------AAAAAACTGTTTTCTAATTTTACA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTTA------AAGAATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATGCATTTTGGCTTCAAAGAAT------GCGCTTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTATGGCAATGTCATTTTGATGTGTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGAGAGGTTATCTTTCAAATGTGCGGTTAAATTTTTTAGTGGTACGTAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAAAAGTTCCAATTATTCCTTTAATTCGATTTTTGGCTAAAGTGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAACCCGTTTGGACCGATTCATCCGATTTTTTTATTATTCCCCGATTTTTGCAGATATACAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAATGTAAAAGGA---------------------------TAA????????????CCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAACC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACATA-----TGGGGTTGACG------ACATTTCCTTT--CTCGTT----------AGGAAAGG----AATCTTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGAAA------------------TA--CG------TG-ATATATGTG--TATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------AA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TCCACTGATCAAATCATTCACTCC--ATCATT----------GTCGGATAGA---------TCTTTTGAAGAA--TTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Dussia_lehmannii_JX295924 ??????????????????---------????????????????????????????????????????????????????????GGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA???????????????????ATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCAGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------TAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTTC-----CCA-----------------------G-------------------------------------AAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCAAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCAAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGA??? Errazurizia_megacarpa_AY391804 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATATA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTACCTACAATTA------CGTTCTTCC---------TTAGAGGGGTCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCAA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATCGCACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTTCGTCTACCTCTACCT---TATCATGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------AACCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGTATCCCGTTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTACGTAAACACAAAAGTACTTTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTAGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGTATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Etaballia_guianensis_AF272074 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGA???????????????????????????????????????????????????????????????????????????------??????????????????????????????------????????????------?????????????????????????????????????????????????????????????????????????????????------?????????---???????????????????????????????????????????????????????????????????????????????????????------?????????---------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAAGGTATTTCCACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTATAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AATAATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAACC---CAATTATTATCCGAGCATTCATTTAACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCCATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATT???????CCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAA?GTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAGGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTG?ATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAG---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------ACATCGAAA------------TTCTAG--------------------------------AAAGGAAAGG---------------ATATACA--------TATATATATGTATATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGAGTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGACTC-----TTTAT------------------------ATCACAAATGACAAATGAAA----AATGTGAATC---AAATTAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACACCAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCCACTTAAGAAATCGTGAGGG Exostyles_aff_venusta_JX152591 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGAAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAATCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Exostyles_godoyensis_JX152589 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATACA-----------TATATAATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Exostyles_venusta_JX152590 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAATCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAAAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Eysenhardtia_polystachya_EU025905 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCTA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCCGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCATACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAAGAATCCCAGATTTTTCTTGTTCCTATATAATTTTTATGCATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTTCGTCTACCTCTACCT---TATCATGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTGTCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTACGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGCCTTTCTTGTATTAAAACCTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Fiebrigiella_gracilis_AF203590 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGTCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TCTGATAAGAAA------TCTAGCTTACTAATTGTAAAACGTTTAATTACTCGAATATGTCAACAGAATCATTTGATTCTTTTTGATAACGATTCTAAT------AAAAATCAA---TTTTGGGGGTATAACAAGATATTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCATGGAAATTCAATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTTTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC?????????????????????????CCCTCTTTCATTTATTAAGATTGT?TATTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTTCCTTTTTCA------AAAAGTAATCCGAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTTATTTACGATTAAACTCTTTTAGAGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AATAATTTTTCGTCTACCTTATCTTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTAATCTATTTTTGGCAATGTAATTTTGATGTTTGGTCTCAACCCGGAACGATCTATATAAAC---CAATTA---TTCGAGAATTCATTTCATTCTTTTTGGGGGGGCTATCTTTCAAATGTACAGCTAAACTTTTCCGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTCGATACAATAGTCCCAATTATTCCTTTAATAAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAACCCCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGATATTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTCGAAGAATTCTTTGCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATTTGATCAATGTCAAT------------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAC-----CTTAAGAAAGC-------------GAGAATAAACAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCGAACAAA-----TGGAGTTGACG------ACCTTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCGTACAAA------------TGAATT--------------------------------TGT?GAAAGG---------------ATATACA----------TAAATATG--TATA-----TGTACGGATT-TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAC------------TA-----CTCCAAA----TCTCTATTT-----TTTAATC-----CTTATTATATCAT----------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTAAA--------GAAAGAATTGAATA---------TTCACTAATCAAATTATTCACTCC--ATCCTA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCACTACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGATTTAAGAAATCGTGAGGG Gastrolobium_punctatum_AY386885 ATGGAGGAATACCCAGTA---------TATTTAGAATTTGATAGATCCCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGAATCGCTTACGGACATGATTTA------AATAGATCCATTTTTGTAAAAAATGTAGGT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCAAAAGATTCTTTTTGCTAATGATTTTTAC------AAAAATCAA---TTTTTGGCGTATAACAAGGATTTAGATTCTCGAATAATATCAGGGGGATTTACCGTCGTTGTGGAAATTCCATTTTCCCCACAATTA------AGTTCTTTT---------TTAGAGGAAACACAAATAGTAAAATCGTATAAAAATTTGCGATCAATTCATTCCATTTTCCCCGTTTTCGAGGATAAATTTTCATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAACTCTTCGATACTGGTTGAAAGATACCCCTTTCTTTCATTTATTACGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AGTAGTCTTATTACTCCA------------GAAAAATTGATTTTTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTTCTGTATAATTTGTATGTATGGGAATACGAATCGATCTTCCTTTTTCTACGTAATAAATCATCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATGGAACAT------CTTGTAGAAGTATTTTCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAAGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTACAAAGAAT------ACACCTATTTTGATTAAAAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTATCAACCGGAAACAATCAATATAAAC---CAATTA---TACAAGCATTCATTTTATTTTTTG------GGCTATTTTTCAAACGTGCGGCTAAATCCTTCTGCAGTAAGGAGTCAAATGCTGCGAAGTTCATTTCTAATCGAAAATGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGGTCATTGGCAAAAGCTAAATTTTGTAATGGATTGGGGCATCCCATTAGTAAGTCGATCTGGGCTGATTCACCCGATTTTTTTATAATTGAGCGATTTTTTAAGATCTATAGAAATATTTCTCATTTTTACAACGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAGTATATACTTAGGCTTTCTTGTGTGAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTCTTAAAAAGATTTTATTCGGGAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTCCTTTGCTCTTTCCA------AAAGCTTCTTGTACTTTTCATGGG---GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCACCAACGATATGGTTAAT---CTTGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Genista_monspessulana_AY386862 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACCCACTAATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCGGCTAATGATTCTAAC------AAAAATCAA---TTATGGGGTTATAATAAAAATTTGTACTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AACCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCG------AAAAGTCATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTACTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATAGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTATCATTCTTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGCTTTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTATACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGCGATAA-TTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CCCAAAAAC-AAA---------GAAAA-----GTTCAGAAATC-------------GAAAATAAAAA-----------------GGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACAAA-----TGGAATTGACG------ACATTTCCTTT--CGCGTTGGGTT-----AGGAAAGT----AATCCTT------TCGTCGAAA------------TTGCGG-------------------------------------AAAGGATCAAGA--------ATAAACG----------TATATA----------------CATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TAAA------AATAAAGA-----CTGAAAA----TCTCTATTT-------------------------------------------------------------------------------------------------------GTTGAA--------GGAGGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATGAAA----------ATCTGATAGA---------TCTTTTTAAGAG--CTGACTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGATAACAA--------------------TGAAATTTATAGTAAGAGGA????????????????????????????? Gleditsia_sinensis_AY386930 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCTTCAACATGACTTCCTATACCCACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAACTCAATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAAGCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA---TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCCTTATTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCTACCCTATGGTTC------TTCAAGGACCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAAAA---TTTTTGGAAGAATTTTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTTTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------CATCAA---------------------------TGA???????????????????????????CTACCAAGTGCGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-CAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAACAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCGTTT--CGTT------------AGTAAAGG----AATCCTT------CCATCTAAA------------TTCCAG--------------------------------AAAAGAAAGGATCAAGG--------ATGAACA----------TATATA------------------------TACGTATACGTACTGAAATACTAT-----TTCAA--------------TTGATT--------A------------GA-----CCCCAAA----TCTCTATTT-----TTTCATA-----TTTAT------------------------ATGACAAATGAAA-----------GATGTGAATC---GA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Glycine_microphylla_EF550008 ATGGAGGAATCTCGAGCA---------TATTTAGAACTCCATAGATCTCGACATCAGGACACCCTATACCCTCTTTTTTTCCGGGAATATATTTATGGACTAGCTTGTGGTCAT---------------GGGTCCATTTTTGTAGAAAATGTCGGT------TATAACAATAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT---TTTAAGGGTTATAACAATCATTTTTATTCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAAGGGAATTCGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATTCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTCT------TATTATTATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAAAGTATTTCTACTTTTTTT---TCAAAAAGTAATCCAAGATTTTTCTTGTTCTTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACGGTTAAAATATTTTCACGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATATACCTTATCATTC------TTTAAGGATACTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGAGCAGGAACGATCCATATAAAC---CAATTA---TCCCAACATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCCCAATCTTTCAGTGGTACGGAGTCAAATGTTACAAAATTCATTTCTAATAAAAATTGTTATAAAAAGGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCAAAATTTTGTAATGTATTTGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGCGCGTACTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---GTCAGAAACGATTTCGTCAAT---CATTTA---------------------------TAA?????????????????????GG-AACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAAAGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGT-------------GATAATAAAAAAG---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----AGGAGTTGACG------ATTTTTCCTTTT-TGCATTA----------GGAAAAG----AATCCTT------CCGTCAAAA------------TTCCAG------------------------------------GAATGGATCAAAG--------ATAAACA--------------------------------------------TATATATACTGAAATAGTAT-----TTCAA--------------TTGATTAA---TGAA------------GA----------------TCC--ATTT-----GTGATAA-A---AATAT-------------------------TCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAAGATGGAATA---------TTCATTGATCAAATTATTCACTCC--ATCATA----------ATCTGAAAAA---------TCCCTTGAAGAA--CTGATCAATCAGACGAGAATAAAGATAGAGTCCTATTCTACATGTCAATCCCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGATTTAAGAAATCGTGAGGG Glycyrrhiza_lepidota_AY386883 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAGCAGGACTTCCTATACCCACTTATTTTTCGGGAATATATTTATGGAATTGCTTATAGCCATAATTTT------AATAGATCCATTTTTGTGGAAAATGTAGGT------TATGACAATAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTCGGGGTATAATAAGAATATTTATTCTCAACTAATATCAGACGGTTTTGCCGTCGTAGTGGAAATTCCATTTTTCTTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATAAGAATACCCTATCCTATCCATTTGGAAATCTTAGTTCAAATCCTTCGACACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGATTGTTTCTTTAT------AATTTTTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGGGTTTTTTTTGAGCGAGTTTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGATGTTTTTGCT------AAGGATTATTCACCTACCTTAACTTTA------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAGGGAAAAGCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTCGAATGTGCGGCTAAATCGTTCAGTGCTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGAGCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AAAGCTTCTTCTACTTTGCAG------AAGTTACATAGAAATAGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---AATGAA---------------------------TGA???????????GCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCAGGAATTCATAATGGG-CAATCCTGAGCCAAATCCTGCTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAA-ATGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CACAGTA----------AGAAAGG----AATCCGT------CTATCAAAA------------TTCCGG-------------------------------------AAAGGATCAAGG--------AATTTCA----------------------------------------------------CTGGA-------------------------------TTGATTAA---TGAA------------GA-----CTCCAAACT--TCT--ATTT-----GTAAAT--T---TTCTA---------TCATAA---------ATCAGAAATGAAA-----------GATGTGAATA---AAATCAA---TTACAA----GTTGAAGA--------AAAAATGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATGGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGATACCAA--------------------TGAAATTTTTAGTAAGAGG?????????????????????????????? Grazielodendron_riodocense_AF270862 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGTCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTTGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA---TTT?GGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTACAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTAGAGGATAAATTTACATATTTTAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCCCTTCTTTAATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGACCAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCAAAATTGTTATGAAAAAACTTGATACCATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAGCCCGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCGCAAAAAAAAGAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAA??????????????TTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------ACGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATAGAAA------------TTCTAG-------------------------------------AAAGG---------------ATATACG----------TATATATGTATATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCAAA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGAACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAA-TCCGTC-AC????????????????? Guianodendron_praeclarum_JX124402 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATGGAGGT------TATGACAATCAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTTAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CCTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA--------------GC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCC??????????????????????? Guianodendron_praeclarum_JX124403 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTACCAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA--------------GC-------------GAGAATAAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Gymnocladus_chinensis_AY386928 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGACTTCCTATACCCACTTATTTTTAGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCAATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA---TTTTTGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGAAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATATTGGTCCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------CAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTATTTTTCTCCGTAAGAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCCTTGAT------AAGGATTTTCCGTCTACCCTATGGTTC------TTCAAGGACCCTTTCATTCATTATGTTAGATATAAAGGAAAATCCATTCTGTCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGATATTTTTCAAATGTTCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAATTTTTGTAATGTATTAGGTCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---GTTTTGGAAGAATTTTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------CATCAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-CAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAACAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCGTTT--CGTT------------AGTAAAGG----AATCCTT------CCATCGAAA------------CTCCAG--------------------------------AAAAGAAAGGATCAAGG--------ATGAACA----------TATATA----------------------TATACGTATACGTACTGAAATACTAT-----TTCAA--------------TTGATT--------A------------GA-----CCCCAAATATATATATATA------TTTCATA-----TTTAT------------------------ATGACAAATGAAA-----------GATGTGAATC---GA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTGACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGA?????????????????? Harleyodendron_unifoliolatum_JX152592 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTTGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTAGCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATAACAAATGAAA-----------GATGTGAATC---AAATC--------CAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCAGTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Harpalyce_brasiliana_GQ246153 ATGGAGGAATATCAAGTA---------TATTTAGAACTAAATAGATCTCACCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGAATCCAATCTTGTGGAAAATGTGGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTTTTCTAATGATTCTAAA------AAAAATCCA---TTTTTGGGATATAACAAGGATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGAAAATCATAAAATCCTATAATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCCTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAACAGTAACAGTAATAGTAATAATCTTATT------ACTCCCCAAAAATGGATTTCTACTTTTTCA------AAAAGGAATCCAGGATTCTTTTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCCATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGCAGAAGTGTTTGCT------AAAAATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATCTCATTTTGATGTTTGGTCTCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCTCTTTTTG------GGCTATTATTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAATTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGGAACGATCTAGTCAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Holocalyx_balansae_AY553714 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGAGTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCTTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA????????????????????????AACTT?CC?AGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGTAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACG----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGAATTAA---TGAA------------GA-----CTACAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Holocalyx_balansae_JX152593 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGAGTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCTTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACG----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGAATTAA---TGAA------------GA-----CTACAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Hovea_purpurea_AY386889 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAA------AAAAATCCA---TTTTGGGGGTATAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCTTTAGAT---TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCC------------AAAAAATCGATTTCTACTTTTTCA------AAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAAGCAGGAACGACCCATAGAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCTAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAGCTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTACAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAAAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCCATTTTACAC------CGGTTATATAGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTAGTCAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Hymenolobium_alagoanum_JX295906 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?TAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAAGA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Hymenolobium_grazielanum_JX295907 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?TAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGG?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------??????????????GCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Hymenolobium_heringeranum_JX295910 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?TAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGA???????????GCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Hymenolobium_heterocarpum_JX295901 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?GAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Hymenolobium_janeirense_var_janeirense_JX295904 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?TAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Hymenolobium_mesoamericanum_AY386934 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAATAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGG-AACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG? Hymenolobium_petraeum_JX295909 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CCAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?TAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAAT???????? Hymenolobium_sericeum_JX275933 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCTGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGTAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAA?GAATTCAACATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---TATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAG---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTCAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Indigofera_suffruticosa_AF142697 ATGGAGGAATATCAAGTA---------TATTTACAACTAAATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCTATTTTTGTAGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATTATTTCTACGAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAATAATCATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGAGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTATTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGGAATACAAGATTTTTCTTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTAATTTACGATTCAAATCTTTTAGCGTTCTTTTTGAGCGAATCTTTTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTCTTTGCT------AAGGATTTTTCGTCGACCTTATCATTCTTCAAGTTCAAGGATCCCTTCATTCATTATGTTCGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GCACCTCTTTTGATGAATAAATGGAAATACTATTTTTTCCATTTATGGCAATGTCATTTTTTTGTTTGGTTTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTTACTATTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCGTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAATGATATGGTTAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Inocarpus_fagifer_AF270878 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAGCTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATCAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTGTCAACAGAATCATTTGATCCTTTTTGCTAATGATTCGAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTGCATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC??????????????????????CCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT---------------ATTATTACTCAA------------AAAAAACGAATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCTATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCGATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAACCCCGTTCGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATAGA---------------------------TAA???????????GCCTTGGTATGGAAACTTAC-AAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGAAAGG---------------ATATACA--------TATATATATGTATATA----------------TACGTATTTGTATTGAAATACTAT-----TTCAA--------------TTGAGTAA---TGAA------------GA-----CTCCAAA----TCCCTATTT-----GTTACTC-----TTTAT------------------------ATCACAAATGACAAATGAAA----AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACGACAA--------------------TGAAATTTATA-TAAGAGGAAAATCC??????????????????????? Lamprolobium_fruticosum_GQ246159 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTCAA------AAAAATCTA---TTTTGGGGGTATAACAGGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTAGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATAATAAAATACTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTATCCTTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGTTTCAAAGAAT------GTGCCCCTTTTGATGAAGAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGACCCATATAAAT---CAATTC---TCCAAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATTTTTTAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTGGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAC------AGGTTATATAGAGGTCAGATTTGGTATTTGGATATTCTT---TTCAGCAGTGATCTAGTTAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Lathyrus_sativus_AF522086 ATGAAGGAATATAAAGTA---------TATTTAGAACGAGCTAGATCTCGCCAACAGGACTTCCTATACCCACTTCTTTTTAGGGAGTATATTTATGGACTTGCTTATAGTCATAATTTG------AATAGATCTATTTTTTTGGAAAATGTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGGTTAATTACTCGAATGTATCAACAGAATCATTTAATCATTTCGGCTAATGATTCTAAC------AAAAATCGA---TTTTGGGGATATAATAAGAATTTGGATTCTCAAATAATATCAGAGGGGTTTGCCATCGTCGTGGAAATTCCATTTTTGCGACAATTA------AGCTCCTCC---------TTAGAGGAGGCAGAAATCCTCCAATCTTATAAAAATTTGAGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTTTTTCATTTATTAAGGCTGTTTCTTTAT------AATTTTTGTAATTGGAAT------------AGTTTTATTACTACC------------AGAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTCCATAATTTTTATGTATGTGAATATGAATCTATCTTCGTTTTTCTACGTACTAAATCCTCTCATTTACGATTCAAATCTTTTAGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAGCAT------CTTGAAAAAGTTTTTTAT------AAAGATTTTTCGTATCCTTTAACATTC------TTCAAAGATCTTAACATTCATTATGTTCGATATCAAGGAAAATGCATTCTGGCTTCAAAGAAT------GCGCCTTTTTGGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAAGAATGATCAATATAAAC---CCATTA---TCCGAACATTCATTTCAGCTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCCGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTATCCAAAATTTGGATATAATAGTTCCAATTATTCCGCTAATTAGATCATTGGCTAATGCGAAATTTTGTAATATATTAGGGGAACCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATCAGGTTCAGAAGAATTATTGCAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGATTCCTCTACTTTGCAG------AGGTTACATAGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGTAACGATCTGGTCCAT---GATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGCGAAACCCTGGAATTCAAAATGGG-CAATCCTGAGCCAAATCCTTCTTT-------CCGAAAAC-AAA---------TAAAA-----GTTCAGAAAGT-------------GAAAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAA-TTGTTCTAACAAA-----TGGAGTTGACA------ACA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAA--------------TTGATTAA---TGAA------------GA-----TTTCTAACT--TCTATTT-------GTAAATA-TT--TGGAT---------------------TCTATCACAATTGAAA-----------CATTAGAATC---AAATCAA---TTACAA----CTGGAAGAAAAAATCAATGAATAGAATA---------TTCATTGCTCAAATCAGTCACTCC--AACATA----------ATCTGATGGA---------TCAGTTGAATAA--CTTATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACATCAA--------------------TGAAATTTTGAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Lecointea_hatschbachii_JX152594 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGATCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATTATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------TCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTATATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATC--------CAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Lecointea_peruviana_EU361990 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAAGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAGATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTGGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAA{AT}TTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCCTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_bijugum_JX124404 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTCCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT----ATCAATTTGTGAATATTTATATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_brachystachyum_JX124407 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA?AAAAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTTTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCT------AAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGGAAAGGAAAGGAATCCTTCCATCGAAATTCCGGAAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAGTC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_dasycarpum_JX124408 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCAACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_elegans_JX124410 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTGGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTGGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA???TGG-?TGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGT????????????????????? Leptolobium_nitens_JX124409 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATTGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_panamense_AF142684 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATG?CAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAA?????????????????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGG? Leptolobium_parvifolium_JX124411 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCGAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------ACATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leptolobium_tenuifolium_JX124413 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCCCCAACAGGACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAATAAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGG?????????????????CTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGGAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATTCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTCTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------GATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATCCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Leucomphalos_mildbraedii_JX295865 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACCGGACTTCCTATACCCATTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTCTTGTGGAAAATATAGGT---AGTTATGACAATAAA------TCTAGTTTATTAGTTATAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATCAA---TTCTTGGGGTATAACAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCCGAAATCGTCAAATCTTATAATAATTTGCGATCCATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTGACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTAACTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCGAAGAAT------GCGCTTATTTTGATGAAGAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGTCTCAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTATAATAGAAATTTTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTTTTGATCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTAGGCTTTCTTGTATAAAAACTTTAGCTCGTAAACACAAAAGTACTGTACACGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAGGAAATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCGGCAACGATCTGGTCAAT---AATTCA---------------------------TGA?????????????????????????????????????????-????????????????AACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAAC-AAA---------GAAA------C{CT}TCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTTACG------ACATTTCCTTT--CGCAT{AT}----------AGTGAATG----AATCCTT------CCATCCAAA------------TTTCCG--------------------------------AAAGGAAAGAATCAAGG--------AGAACCA----------TATATA------------------------TACGTATATGTAATGAAATACTCT-----TTCAA--------------TAGATTCA---TGAA------------AA-----TTCCAAA----TCTCTATTT-----GTGAATC-----TTTCT------------------------ATCACAAATAAAA-----------GATCTGAATC---CAATCAA---TTCCAA----GTTGAA--------TAAAAAATGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------ATCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTTTACATGTCAATA-GGACAACAA--------------------TGAA-TTTAT---------AAAAT????????????????????????? Lonchocarpus_lanceolatus_AF142717 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCATCATGGCTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGATCATGATTTA------AATAGATCCATTTTTGTAGAAAATATAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTACTGAGTCTAAC------AAAAATCCA---TTTTGGGGATATAACAATAATTTATATTCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCCCTACAATTT------AGTTTTTCT---------TTAGGGGGGGGAGAAATCATAAAATATTTTTCTAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCTTATCCATCTGGAAATCTTGATTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCCATTTCCATTTTTTCAAATTCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTATATGTATGGGAATATGAATATATCTTTTTTTTTCTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTACAAAAATAGAACAT------CTTGTACAAGTCGTTGAT------AAGAATTTTTCATATACCTTATCATTC------TTCAAGGATCCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAT---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGATATTTTTTAAATATACAGTTAAATCTTTTAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTGATTAAAGCGAAATTTTGTAATGTATTGGGGCATCCTATTAGTAAGTCGGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAGGAAGGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAACGTACTGTACGTGCTTTTTTGAAAAGATTAGGATCCGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACATAGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAATGATCTGATCAAT---CATTTA---------------------------TAAAATTTGATTGAGTCTTGGTATGGAAACTTACCAAGTAAGAA-CTTTCAAATTCAGAGAAACCCTGGAAATCACAATGGG-CAATCCTGAGCCAAATCCTATTTT-------CCAAAAA--A-----------AAAAA-----GTTCAGAAAGC-------------TCGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTAACAAA-----TGGAGTCGGCG------ATTTTT-C-CT--TTCATTC----------GAAAAGG----AATTT---------------AA------------TTCCAG------------------------------------GAATGGATCAAAG--------ATAAACA----------TATATG----------------------TATATATATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAG----------AAGA-----TTCTAAA----TCCCCATTT-----GTGAATA-----TTTTT------------------------ATCACAAATGAAA-----------GATGTGAACC---AAATTAA---TTTCAA----GTTGAA--------GAAAAAATGGAATA---------TGTATTGATCAAATCATTCACTCC--AGTATA----------GTCTGATAGA---------TCTTTTGAAAAA--CGAATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACACCAA--------------------TGAAATTTATAGTTAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Luetzelburgia_amazonica_JX152622 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_andina_Cayola2358 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCTGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_andradelimae_JX152627 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_auriculata_JX152630 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCTAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGGAATCCAAGAATTTATCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAAAA---GTTCAGAAGGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAATAATACTATTTCAATTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_bahiensis_JX152634 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_guaissara_JX152636 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ACCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_guianensis_JX152639 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTTGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGA?????????????????? Luetzelburgia_harleyi_JX152642 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTT??????????????? Luetzelburgia_neurocarpa_JX152645 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAATAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_praecox_JX152646 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGACTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACAATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_purpurea_JX152648 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAATAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_sotoi_JX152652 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAAAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTTAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Luetzelburgia_trialata_JX152617 AAGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTCTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGATTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAATGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATCTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ACCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Lupinus_argenteus_AY386956 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATCTCTCGCCAACAGCACTTACTATACCCACTCATTTTTCGGGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTTTGGAAAATCTAGAT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGGATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA---TTTTTGAGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGTCAAAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCT??????????????????????????????????????????CCCTTTGTTTCACTTATTAAGGTTGTTTTTTTAT------GAATATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTCAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTATCGTTCTTTTTGAACGGATCTATTTCTATGGAAAAATAGAACAT------TTTTTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACC------TTC------TTCAAGGAGCTTTTCATTCATTATGTTAGATATCAAGAAAAATATATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAATTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCACGAACCATCCAAATAAAC---CAATTT---TCCGAGGGTTCATTTCGCCTTTTG------GGATATTTTTCAAATGTGCGGTTGAATCGTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTCTTAGGACACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCAGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGGTCTTTCAA------AGGGTTTCTTCTACTTTGCAG------GGGTTATATAGAGGTAGGGTTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCTTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTTT----CGCAAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAAAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACA------ACATTTACTTT--CGCGTTGAGTT-----AGGAAAGG----AATCCTT------TCATCGAAA------------TTTTGT-------------------------------------AAAGGATAAAGA--------ATAAACG----------TATATA----------------CA--TATATACGTATATTTACTTAAATATTAT-----TTCAA--------------TTGATTAA---TAAA------------GA-----CTGAAAA----TCTCTATTT-------------------------------------------------------------------------------------------------------ATTGAA--------GAAGTAGTTGAATA---------TTGATTGATCAAATCATTCATTCC--ATGATA----------ATCTGATAGA---------TCTTTTTAAGAG--ATGATTAATCAGACCAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTAGAGTAAGAGGAAAATCC??????????????????????? Maackia_amurensis_AY386944 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTTGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------CTAGAGGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAGTTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTT------TTCACAGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAC------GCGCCCCATTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CCATTC---TCCGAACACTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAAACTTTCAGCAGTACGGAGTCAAATGGTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGCTTGGGCCAATTCATCTGATTTTGATATTATTGACCGATTTTTGCGTATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAACAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---TACGAA---------------------------TGA??????????????????????????CTTACCAAATGATAACTCTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTTTTTTTTCGCGAAAAT-AAA---------GAAAG-----GTTCATAAAGG-------------GAGCATAAA------GCGAGAATAAAAAGGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT--------------AAGG----AA-----------------------------------GGG---------------------------------------------------------------------------ATATA----------------CA----TATATGTATATGTACTGAAATATTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CCG-AAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGGAAA----------GATGTGAATC---AAATCAT---TTCCAA----ATTGAAGA------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCAACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTA?AAATCGTGAGGG Marina_scopa_AY391811 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATAGATCCATTTTGGTCGAAAATGTGGAT------TATGATAACAAA------TCTAGTTTAGTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTACTAATGATTCTAAC------AAAAATCAACAATTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGATGCTTTTGCCATCGTCTTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAACTCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTTTTATTAATTCA------------AAAAAATTGATTTCTAGTTTTTCA------AAAAGTAATCCAAGATTTTTCTTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATGCAAAAATAAAAAAT------CTTGTAGAAGTTTTTCCC------AAGGATTTTTTGTGCACCTTATCATTG------TTCAAGGATCCCTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCTAAGAAG------GCGCCTCTTTTGATGAATAAGTGGAAATATTATCTTATCTATTTATGGCAATGGTATTTTCATGTTTGGTCTCAACCGGGAACGATTCATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTTAAATGTGCGGCTAAATGTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCTTTTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCGATTTTGGTATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCCTTTTTGAAAAGATTGCGTTCAGAAGAATTATTGAAAGAATTTTTTACAGAGGAAGAAGATATTCTTTCGTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Millettia_grandis_AF142724 ATGGGGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCACCAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------TATAGATCCATTTTTGTAGAAACTGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTAGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGACTCTAAC------AAAAATCCA---TTTTGGGGATATAACAATAATTTTTATTCTCAAATAATATTAGATGGTTTTATTGTCGTTGTGGAAATTCCATTTTCCCTACAATTT------AGTTCTTCT---------TTAGAGGGGGCAGAAATCATAAAATATTTTAATAATTTGCAATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGTAATTGGAAT------------AGTCTTATTACCCCA------------AAGAAATCAATTTCTACTTTTTCAAATTCAAAAAGGAATCAAAGATTTTTCTTCTTCCTATATAATTTATATATATGGGAATACGAATCTATCTTTCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTTGTATATCTTATCATTC------TTCAAGCACCCTTTTATTCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAGGAAT------ACGCCTCTTTTGATGAATAAATGGAAATATTATTTTATTCATTTATGGCAGTGTCATTTTGATGTTTGGTCTGAACCAGGAACGATCTATATAAAT---CAATTA---TCCGAGCATTCATTTCGCTTTTTG------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTACAAAATTCATTTCTAATAAAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCAAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGTCTGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAGAAGGAGTTTGTATCGAATAAAATATATACTTCGCCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTCTGAAAAGATTAGCCTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGACGAAGATATTTTTTCTTTGATCTT?CAA------AGAACTTCTTCTACTTTCCAG------AGGTTATATAGAGGGCGGATTTGGTA?TTGGATATTCTT---?TCAGCAACGATTTGGTCAAT---CAT?TA---------------------------TAAAATTGGATTGAGTCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATTCTGAGCCAAATCCTATTTT-------TCAAAAAC-AAA---------GAAAA-----ATTCAGAAAGC-------------TAAAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTAACAAA-----TGGAGTTGACG------ATTTTTTCCCT--TTCGTTA----------GGAAAGG----AATCCTT------CTATCAAAA------------TTCCAG------------------------------------GAATGGATCAAGG--------ATAAACA----------TATATA--------------------------CATATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----TTCAAAA----TCTCCATTT-----GTGAATA-----TTTCT------------------------ATCACAAATAAAA-----------GATGTGAACC---AAATTAA---TTCCTA----GTTAAA--------GAAAAAATGGAATA---------TTCATTAATCAAATCATTTACTCC--ATTATA----------GTCTGATAGA---------TCCTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCATGAGGG Monopteryx_inpae_JX295875 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGTACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGAAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAATAAGAATATGCCTCTTTTGATGAATAAATGGAAATACTATCTTATTCTTTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAACGATCCATGTAAAC---CAATTA---TCCGAGCATTTATTTAACTTTTTG------GGCTATTTTTCAAATCTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAACTACTGTACGCTCTTTTTTGAAAATATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTAATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAAAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAACTATTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATATACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTT-----TTAAATA-----TTTAT------------------------ATCACAAATAAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAGTA---------TTCATTGACCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAAAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTCAGAAATCGTGAGGG Monopteryx_inpae_JX295876 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGTACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGAAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATACCTCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGTTTCAAAGAATAAGAATATGCCTCTTTTGATGAATAAATGGAAATACTATCTTATTCTTTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTTATTTAACTTTTTG------GGCTATTTTTCAAATCTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAACTACTGTACGCTCTTTTTTGAAAATATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTAATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAAAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAACTATTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA--------------------TATATACGTATATATACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTT-----TTAAATA-----TTTAT------------------------ATCACAAATAAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAGTA---------TTCATTGACCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAAAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTCAGAAATCGTGAGGG Myrocarpus_emarginatus_JX295863 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAGTCTTGGTTCAAAACCTTCGATACTGGG????????????????????????????????TTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCACATAAAC---CAATTA---TCTGAGCATTCATTTGACCTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAAGTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAACAGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCGTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGAGCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAATGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----ATTCCTTT-----CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CCCCCAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGGAAA----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTTTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Myrocarpus_fastigiatus_JX295966 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCC------------CAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCTGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTTTATGCAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCACATAAAC---CAATTA---TCTGAGCATTCATTTGACCTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAAGTCATTTATAATCGAAAGTGGTATGAAAAAGCTTGATACAATAATTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGAGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTCTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAT-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGGGTT----------AGGAAAGG----AATCCTTT-----CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAG----------------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATG---------------ATGTGAATCAACAAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTAATCAAATCATTCACTCC--ACCATA----------GTTTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGATTTTCTAAATCGTGAGGG Myrocarpus_frondosus_AY386925 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCC------------CAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCTGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTTTATGCAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAGGATTTTTCGTATACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCACATAAAC---CAATTA---TCTGAGCATTCATTTGACCTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAAGTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAATTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGAGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTCTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAATGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTTT-----CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAG----------------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATG---------------ATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ACCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAA-TCCGTCGATTTTCTAAATCGTGAGG? Myrospermum_frutescens_AF142679 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTATGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCTTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAGTCTTGGTTCAAAC????????????????????????CCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATTCGAATCTATCTTCCTTTTTCTCCGTAACCAATCCTCTAATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTTTCTGCAAAAATAAAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCCTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAC------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCAGATAAAC---CAATTA---TCTGAGCATCCATTTGACTTTTTG------GGCTATTTGTCAAACGTGCGGATAAATCCTTCAGTAGTACGGAGTCAAATGCTGGAAAAGTCATTTATAATCGAAATTGGTATGAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCGAAAGAGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGGCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA?ACCGG-TTTGGCCTTGGTATGGTGACCTACC-AGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGA-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTTT-----CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCCCAAATGAAA-----------GATGGGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Myrospermum_sousanum_AY386959 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCAATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCACATAAAC---CAATTA---TCTGAGCATTCATTTGACCTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAAGTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATAATTCTTCTAATTAGATCATTGGCTAAAGAGAAATTTTGTAATGTATTAAGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGACCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA?ACCGG-TTTGGCCTTGGTATGGTGACCTACC-AGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGA-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTTT-----CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCCCAAATGAAA-----------GATGGGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Myroxylon_balsamum_JX295912 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTGGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGGTTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTCTGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATATTTGGTCTCAACCAGGAACGATCCACATAAAC---CAATTA---TCTGAGCATTCATTTGACCTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAAGTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGAGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTATTGACCGATTTATACGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAGCACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTTGATTGAGCC-TGGTTTGGAAA?ACACCAAGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CACATT----------AGGAAAGG----AATCCTTT-----CCATTGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAATAATGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGGATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCT--ATTATA----------ATCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Myroxylon_peruiferum_JX295911 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGATGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTTTTTCTGCTAATGATTCTAAT------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTGTGAGGATAAATTTACATATTTAAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACTCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGGTTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTCTGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAGCGAATCTATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATATTTGGTCTCAACCAGGAACGATCCACATAAAC---CAATTA---TCTGAGCATTCATTTGACCTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAAGTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGAGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTATACGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAGCACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAATCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTGCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----CGGAGTTGACG------ACATTTCCTTT--CACCTT----------AGGAAAGG----AATCCTTT-----CCATTGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAATAATGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGGATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAG----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCT--ATCATA----------ATCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Mysanthus_uleanus_AY509941 ATGGAGAAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGATATCCTATACCCACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCTTTTTTATAGAAAATTTAGAT------TATA?CAATAAA------TTTAGTTTACTAATTGTAAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAATACT---TTTGTGGGTTATAACTATAATTTTGATTCTCAAATAATATTAGAAGGTTTTGGTGTCGTCGTGGAGATTTTATTTTCTCTACAATTA---TTTATCTCT---------------AGGGGCTTAGAAAGCGTAAAATCTTATCAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATAAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAA????????????????????????????CTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAATTGGAAT------------AGTCTTTTTCCTCCA------------AAAAAATGGATTTCTACTTTTTTT---TCAAAAAGGAATCTAAGAATTTTCTTGTTCCTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAAAAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAAGAAAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTGCATATACCTTATCTTTC------TTTAAGGATACTTTGATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTTAAAGAAT------ACTCCTCTTTTGATAAAGAAATGGAAATACTATTTTATATATTTATGGCAATGTCATTTTGATATTTGGGCTGGACCAGGAACGATCTATATAAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCACAAAATCTTTCAGTAGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCAAAATAGTTATCAAAAAACTTGATACAATAGTTCCCATTATTCCTATAATCAGATCATTGGCTAAAACAAAATTTTGTAATGGAATGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGCATATGCAGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTCTATCAAATAAAATATATACTTCGGTTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCACACTTTTTTTAAAAAATTAAGTTCAGAAAAATTATTGGAAGAATTTTTTACA---GAAGAGGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTGACTTTGCGG------AGGTTTTATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAACGATTTCGTCAAT---CATTTAGAATTTAAAATAGGTTATGATACTTTTTAA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Nissolia_hirsuta_AF270868 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATGGATCTTGCCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTGAAT------TATGATAAGAGA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATGATTCTAAA------AAAAATATA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCC---------TTAGAGGAGGTCGAAATCTTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTGACCTATCTAAATTTTTTTTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTAAAACC???????????????????????TCCCATCTTTCATTTTTTAAGATTGTTTCTTTAT------GACTATTCTAATTGGAAT------------AGTCTTATTGCTAAA------------AAAAAACTTATGGATACTTTATCA------AGAAGCAATCCAAGATTTTTCTTATTCCTATATAATTTTTTTGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAGATTCTTTTAGTCTTTTTTTTGAGCGAATCTATTTCTATACAAAAATAGAATAT------CTTGTTCAAGTCTTTGCT------AAGGATTTTTCATCTACCCTACCATTC------TTCAAGGATCCTTTGATTAATTATGTTAGATATCAAGGAAAATTCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGCTGAATAAATGGAAATTTTATCTCATCTATTTCTGGCAATGTCATTTTTATGTTTGGTCTCAAGCAGGAACGATCCATATAAAA---GAATTATTAGCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTACGATTCAACTTTTCAGTGGTACGGAGTCAAATGTTAGAAAATTCATTTCCAATTGAAATTGGTATGAAAAAGCTTGATACAAAAGTTCCAATTATTGATCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACCTTGGCTCGTAAACATAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAACAATTATTGGAAGAATTCTTTACAGAGGAAGACGATATTATTTCTTTTATCTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATATAGGGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAACGGTCTGGTCAAT---CACGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-TAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAG-----CTAAAGAAAGC-------------GAGAAAAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACA------ACATTTCCTTT--CGCGTT----------AGAAAAGG----AATCCTT------TCATCGAAA------------TTTTAG-------------------------------------AAAGG---------------ATATACA----------TATATA------------------------TACATATTTGTACTGAAATAATGAA----ATTTA--TTTTTTGTTTTATTAATTAA---TGAA------------GA-----TTCCGAA----TCTCTATTT-----GTGAATC-----CTTAT------------------------ATCACAAACGAAA---GAAA----GATGTGAAAA---AAAAAAAAGATTCCAA----GTTGAA--------GAAAGAATTTTATA---------TTAACTGATCAAATCATTTACTCG--ATTATA----------GTCTGA-------------TCTTTTGAAGAA--CTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTAAGAAATCGTGAGG? Ormocarpopsis_itremoensis_AF203567 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATCAATTTCGCCACCAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGGTTTAAATATAAATCGATCCATTTTGATGGACAATGTGGAT------TATGATAAGAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAACCCA---TTTTGGGGGTATAACAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTGCATTTTCCCGACAATTC------CGTTCTTCTTTAGCT---TTAGAGGAGTCAGAAATCGTAAAATCTTTTAATAAATTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTATATATTTCAATTTTGTTTCAGATTTACGAATATCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGT?????????????????????????CCTTCTTTCATTTATTAAGATTGTTTCTTTTT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------AAAAGTAATCCAAGAATTTTCTTGTTCCTATATAATTTTTATATATGTGAATATGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCTCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTGTGGCAATGTCATTTTTATGTGTGGTCTCAACCAGGAACGATTCGTATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGTTAGAAAAGTCATTTCTAATCGAAATTTTAATGAAAAAGCTTGATACAATAGTTCCAATAATTCC?TTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAA???????????????????AGTAAGCCTGTTTGGGCCGATTCATCAGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAATGATCTTGTCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGATATGGAAACGTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGA------AA---------GAAAA---------AGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGAAAGG---------------ATATACA----------TATATA------------------------TACGTATTAGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGGA------------GA-----CTTCA---------CTATTT-------------------------------------------------------------------------GTGAATC---AAATCAA---TTCCAA----GTTGA-----------AATAATTTTATA---------TTCACTGATCAAATCATTCATTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAACAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAAGACCGACAACAA--------------------TGCAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAG?? Ormosia_aff_fastigiata_JX295885 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCCGAGGTTTTTGCCGTCGTCGTGGAAATTCAATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCAATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAAT???????? Ormosia_bahiensis_JX295886 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATCAA---TTT---GGGTATAAGAATAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCTTTATTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTT------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCCTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGGGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAAT???????? Ormosia_costulata_JX295887 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATC?????????????????????????????????????CTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCAATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTAATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAA??????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------???AATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAAT???????? Ormosia_coutinhoi_JX295880 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCC?ACAGGACTTCCTATACCCACTT?TTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATCAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGTAAT------------ACTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTTTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAATGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCGCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAAAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAAACTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_excelsa_JX295884 ATGGAAGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCAATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTGAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------ATAAA-----CATATATATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_limae_JX295879 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATCAA---TTT---GGGTATAAGAATAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCTTTATTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTT------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCCTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGGGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_nitida_JX295881 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATCAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCACTTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATG?????????????TTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCACTC------TTCAAGGATCCTTTCATCCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTTAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------???AATTGGATTGAGCCTTGGTATGTAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG-------------------------------------AAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_paraensis_JX295888 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTACTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCAAGTTTACTAATCGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTATAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAAGAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------AAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAATTGACG------ATATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GG-----CTGAGAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTTATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGT????? Ormosia_smithii_JX295954 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAAT??????????????????????????????????????????????????????????????????????------??????????????????------------???????????????------------????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????------???????????????????????????------???????????????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------????????????????????????????????????????????????????????????TCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGA??????????????????TATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_sp_nov_JX295877 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTCCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAAATGTACGAATACCCTATTCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCAATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCCCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGCTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTCTATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAAAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GCGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_stipularis_JX295882 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGCTCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGG??????????????????????ATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCAATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAATGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTTAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGT----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Ormosia_timboensis_JX295878 ATGGAAGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTAAATATAAATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATAAA---TTT---GGGTATAAGAAGAATTTGTATTCTCAAAAAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAAATGTACGAATACCCTATTCTATCTATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------ACTTTTATTACTCCA------------AAAAAATCAATTTCTACTTTTTCA------AAAAATAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATTTGAATACGAATCTATCTTACTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCATTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCGATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGATATTTTTCAAACGTACGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTATAATTAGATTATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTCTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAAAAACC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAATAAA-----TGGAGTTGACG------ATATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCCG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACATATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TATCTATTT-----GCGAATA-----TTTAT------------------------ATCACAAATGAAA-----------AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCGGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAAAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Panurea_longifolia_JX295947 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCCAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATATGAATTTATCTCCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACTTTGCAG------AGCTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAACAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TCAA------------GA-----CTGAAAA----------TTT-----GTGAATATTTTATTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAAAATGGAATA---------TTCATTGATCAAATTATTCACTCT--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATATCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Parryella_filifolia_AY391812 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAAGAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTCG---CTACCTCTACCT---TATCATGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Phylloxylon_spinosa_AY650280 ATGGAGGAATATCAAGTA---------TATTTACAACTAGATAGATCTCGTCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATGGATTCATTTTTGTAGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTACTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAAGAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCAATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTTAGATATACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTATTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAACCGATTTCTACTTTTTCA------AAAAGTAATACAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTAATTTACGATTCAAATCTTTTAGCATTCTTTTTGAGCGAATCTTTTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTCTTTGCT------AAGGATTTTTCGTCGACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGTCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAATACTTTTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTATTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTCGTACGGAGTCAAATGCTGCAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGATCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAGTGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATACATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAATGATCTGGTCAAT---CATGAACGATTGGTTCTGATATTTTGTAAA---TAG?????????GAGTCTTGGTATGGAACCTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCTATTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAACTGTTCTAACAAATCAAATGGAGTTGACG------ACATTTCCTTT--CGCGTTA---------GTAAAGGA----AATCCTT-CCATCACATCAAAA------------ATCCAG--------------------------AAAGAAAAAGGAAAGGATCAAGG--------ATAAGCA------TGTATATATA------------------------TACGTATATGTACTGAAACATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCCAA----TCTCTATTT-----GTGAATA-----TTTCT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAAA-TGGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCTTTCTACATGTCAAT???????????--------------------????????????????????????????????????????????????? Pickeringia_montana_AY386863 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCGCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCTAATGCTAAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TTCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTAAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Pictetia_marginata_AF203578 ATGGAAGAATATCAAATA---------TATTTCGAACTAGATAAATTTCGCCACCAGAACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGGTTTAAATATAAATCGATCCTTTTTGATGGACAATGGGGAT------TATGATCAGAAA------TTAAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAACCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTGCATTTTCCCGACAATTC------CGTTCTTCTTTAGCT---TTAGAGGAGTCAGAAATTGTAAAATCTTTTAATAAATTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTATATATTTAAATTTTGTTTCAGATTTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGT??????????????????????CCCTCTTCTTTCATTTATTAAGATTGTTTCTTTTT------GAGTATTGTAATCGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------AAAAGTAATCCAAGAATTTTCTTGTTCCTATATAATTTTTATGTATGTGAACATGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTCAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGCTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCTCCTCTTGTGATGAATAAATGGAAACACTATCTCATCCATTTGTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGTTAGAAAATTCATTTCTAATCGAAATTTTAATGAAAAAGCTTGATACAATAGTTCCAATAATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTCGGGCATCCCATTAGTAAGCCTGTTTGGGCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATATCCCATTATTATAATGGATCTTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGGTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAATGATCTTGTCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGATATGGAAACGTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGA------AA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGGGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG-------------------------------------AAAGG---------------ATATACA----------TATATA------------------------TACGTATTAGTACTGAAATACTAT-----TTCAA--------------TCGATTAA---TGAA------------GA-----CTCCAAA-----CTCTAGTT-----GTGAATT-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAAACAA---TCCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Piptanthus_nepalensis_AY386924 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAAGACTTCCTATATCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGACTAATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCGATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCACAGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAGTAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTA---TCCGAACATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCTGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTAATACAATAGTTCCGATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Platymiscium_stipulare_AF270872 ATGAAGGAATATCAAATC---------GATTTAGAACTAGATAGATCTCGCCAACAGAACTTCCTATATCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTATATTTAAATCGATCCATTTTTTTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAA------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTTGTCGTGGAAATCCCATTTTCCCGACAATTA------AGTCCTTCT---------TTAGAGGAGGTGGAAATCGTAAACTCTTTGAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTGACATATTTAAATTGTGTTTCAGATGTACAAATACCCTATCCCATCCATCTGGAAATCTTAGTTCAAACC????????????????????????CCCTTCTTTCATTTATTAAGATTGTGTCTTTAT------GAGTATTTTAATTGGACT------------AGTATTATTACTCAA------------AAAAAACTTTTTTCTACCTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATACAATTTTTATGTATGCGAACACGAATCCATCTTCCGTTTTCTACGTAATAAATCTTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATGTAAAAATCGAACAT------CTTGTAGAAGTCTTTTCG------AATAATTTTCCGTCTACCTTATCATTC------TTCAAGGATCCTTTGATTCATTATGTTAAATATCAAGGAAAATTCATTCTGGCTTCAAAGAAT------TCGCTTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTTTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAATGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCAATTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGAATATGCAGAAATATTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTCGAAGAATTCTTTACAGAGGAAGAAGAGATTCTATCTTTCATCTTTCCA------AGAGCTTCTTATACTTTGCGG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTAATCAATGTAAATGGA---------------------------TAA????????????????????TGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAGC-AAA---------GAAAC-----GTTAAGAAAGT-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAC-----TGGAGTTGACG------ATATTTCCTTTT-CGGGTT----------AGGGAAGG----AATCCTT------CCATAGAAA------------TTCTAG--------------------------------AAAGGAAAGG---------------ATATACGTATATATG--GATATA------------------------TACGTATTTATACTGAA-TACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCTAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------ATCACAAATAAAA-----------GATTTG---------------------------------------------------AATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATTG????????????????????????????????????? Platypodium_elegans_AF270877 ATGAAAGAATATCAAATA---------TATTTAGACCTAGATAGATCTCGCCAACAGAACTTCCTATACCCACTTCTTTTTCGGGAGTCTATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCCA---TTTTGGGGATATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCATAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC???????????????????????CTCCTTCTTTC?TTTATTAAGATTGTTTCTTTATGTTTATGAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCCTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACAATCCATATAAAC---CAATTATTATCCGAGCATTCATTTAACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATTAAAAAACTTGATACCATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAGGTTTGTATCGAATAAAATACATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACTAACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG-------------------------------------AAAGG---------------ATATA------TATG--TATATA------------------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATC-----TTTAT------------------------ATCACAAATGACAAATGAAA----GATGTGAATC---AAAT--------CCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Poecilanthe_effusa_JX295892 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACAGGACTTCCTATACCCACTTCTTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATCTTGTGGAAAATGTCGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAA------AAAAATCCA---TTTTGGGGGTATAACAAGGATTTGTACTCTCAAATGATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCGAAAATCATAAAATCCTATCATAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTAAATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAGGATGTCCCCTTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAAT------AGTAATAGTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAAGAATCCAGGATTCTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATCTTTGGTCTCAACCAGGAATGACCCAGATAAAT---CAATTC---TCCGAGCATCCATTTCACTTTTTG------GACTATTTTTCAAATGTGCGGTTAAATATTTCAGTGGTACGTAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAGTTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTCTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATAAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AGGTTCTATAGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAACGATCTAGTCAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Poecilanthe_parviflora_AF142687 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCGCTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTACT---AAAAAAAATCCA---TTTTTGGGGTATAACAAGGATTTTTATTCTCAAAGAATATCAGAGGGTTTTACCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGAAAATAATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTGTGTGTCAGATGTACGAATACTCTATCCTATCCATCTGGAAATCTTAGTTCAAATC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GGGTATTGTAATTGCAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGGAATCCGGGATTTTTTTTGTTCCTATATAATCTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGCAAAAAAAGAACAT------CTTGTAGAAGTCTTCGCT------AAAGATTTCTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCTATTTATGCCAATTTCATTTTGATGTTTGGTCTCAGCCAGGAACGACCCCTAGAAAT---CAATTC---TCCGAGCATCCATCTCATTTTTTG------AGCTATTTTTCAAATGTACGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGCCCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAATTTGTATCAAATAAATTATATACTTCGATTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACATGCTTTTTTAAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AGAACTTCTTCTATTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAACAACGATCTAGTCAAT---TATGAG---------------------------TGA?ATT-GATTGAGCCTTGGTATGGAAACTTACTAAGTGATAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCAAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAAAAAAATAGTAAAAGGAATAATAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAGA-----TGGAGTTGATG------ACATCTCCTTT--CGCATT----------AGGAAAGG----AATCCTT------CTCTCGAAA------------TTCCAG------------------------------------------------------------------------------------------------------------------------AATATTCT-----TTCAA--------------TTTATTAA---TGAA------------GA-----CTGAAGA----TCTCTATTT-----GTTAATA-----TTTAT------------------------ATCACAAATGAAA-----------GGTGTGAATT---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATAACGACAACAA--------------------TGAAATTGATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGT????? Poiretia_angustifolia_AF270864 ATGGAGGAATATAAAATC---------TATTTAGAACTAGATGGATCTTGCCAACGGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGTCTATGGTCATGATTTAAATAAAAATAGATCTATTTTGGTGGAAAATGTAGAT------TATGATAAGAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATGATTCTAAA------AAAAATCTA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGCTTTTGCCGTCGTTATGGAAATTCCATTTTCCCGACAATTG------AGTTCTTCC---------TTAGAGGAGGTCGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTAGAAATCTTGGTTC?????????????????????????????CCCTTCTTTCATTTTTTAAGATTGTTTCTTTAT------GAGTATGACTATTCGAGT------TGGAATAGTCTTATTACTCAA------------AAAAAACTTATTTCTACTTTATCA------AGAAATAATCCAAGATTTTTCTTATTCCTATATAATTTTTTTGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATCAATCCTCTCATTTACGATTCAATTATTTTAGCCTTCTTTTTGAGCGAATCCAATTATATGCAAAAATTGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCATCTACCTTATCATTC------TTCAAGAATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTGAATAAATGGCAATACTATCTGATCTATTTCTGGCAATGTCATTTTAATGTTTGGTCTCAAGCAGGAACGATTCATATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTCAATTTTTCAGTGGTACGGAGTCAAATGTTAGAAAATTCATTTCCAATCGAAATAGGTAGGAAAAAGCTTGATACAATAGTTCCAATTTTTCCTCTAATTAAATCGTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACTGATTCATCCGATTTTGAAATTATTGCCCGATTTTTGGGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAGGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGCATTAAAACCTTGGCTCGTAAACACAAGAGTACTGTACGCGCTCTTTTGAAACGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAACGATCTAGTGAAT---CACGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATAAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAG-----GTAAAGAAACT-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACG------ACATTTCCTTT--CTCGTT----------ATGAAAGG----AATCCTT------TCATCGAAA------------TTTCAG-------------------------------------AAAGG---------------ATA----------TG--TATATA-------------CATATA-----TACATATTTGTACTAAAATACTATA----TTGAA--------------TTGATTAA---TGAA------------GA-----CTGCAAA----TCTCTATTT-----GTGAATG-----CTTAT------------------------ACCACAAATGAAA-----------GATGTGAAAA---AAAA------TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTGACTCC--ATCAAA----------ATCTGAGAGG---------TCTTTTGAATAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Psorothamnus_arborescens_AY391814 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTATGGTGGAAAATGCGGAT------TATGATAACAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCCTTTCCGCTAATGATTCGAAT------AAAAATCAACAATTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGCCGTAAAATCTTATAAAAATTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATCCCCCCTTGTTTCATTTATTAAGGTCCTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATTGAACAT------CTTTTAGAAGTCTTTCCC------AAGGATTTTTTGTCCACCTTATCATTG------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGCAAAATCCATTTTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATATTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCAGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCTATTATTCCTCTAATTAAATCATTGGCTAAAGCGAAATTTTGTAATGTACTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCGATTTTGGTATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATTCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGAAAGAATTTTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAT------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGCAATGATCGGGTCAAT---CATTCA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Pterocarpus_indicus_AF142691 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACGGAGCTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTTGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCCTTTTTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCGGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTCAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAAGGGATTTCCACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTATAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AATAATTTTTCGTCTACCTTATCCTTC------TTCAAGAATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCCCCTCTTTCGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTAACTTTTTTTGGGGGGGTTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAA?????????????????????GGAAACTTACCAAGTGAGAA--TTTCAAATTCAGAGAAACCCAGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTGA--------------------------------AAGGAAAAGG---------------CTATACA------TATATATATATGTATATA----------------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGAGTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGACTC-----TTTAT------------------------ATCACAAATGACAAATGAAA----AATGTGAATC---AAATCAA---T-CCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTAAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACCACAA--------------------TGACATTTA???????????????????????????????????????? Pterodon_abruptus_JX295873 ATGGAGGAATATCAATTC---------TATTTAGGACTGGATAAATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTGAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAGTATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATACATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTCTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAAATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGGGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGAAATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAAGG-ATA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCGAACAAA-----CGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAA--------------CTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Pterodon_emarginatus_JX295874 ATGGAGGAATATCAATTC---------TATTTAGGACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTGAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAGTATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATACATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTCTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAAATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGGGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGAAATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAAGG-ATA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCGAACAAA-----CGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------CTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Pterodon_pubescens_AF272095 ATGGAGGAATATCAATTC---------TATTTAGGACTGGATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTGGAGGATCAATTTACATATTTGAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATC?????????????????????????????????????????????????????????------??????????????????------------???????????????------------????????????????????????------?????????????????????????????????????????????TGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATACATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTCTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAAATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGGGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTAGTCAAT---CATTCA---------------------------TGAAATTAGATTGAGCCTTGGTATGG-AACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCATAAAGC-------------GAGAGTAAAGTAAAAAAGG-ATA-----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCGAACAAA-----CGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAATG--------ATAAATA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------CTGATTAA---TGAA------------GA-----CTCCAAAAA--TCTATATTTTTGAATTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGATGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGCAAATCCGTCGACTTTAGAAATCGTGAGGG Ramorinoa_girolae_AF270881 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAGCTTACTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCCTTTTTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAACTAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATATTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTG????????????????????????????????????????????????????????????????????TCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATATATGTGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAACTCTTTTAGCCTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCC------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAAGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTAATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGCTTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTCTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAACCTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAG---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGAAAGG---------------ATATACA--------TATATA--TGTATATATA-------AGTA---TTTGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGAGTAA---TGAG------------GA-----CTCCAAA----TCTCTATTT-----GTGACTC-----TTTAT------------------------ATCACAAATGACAAATGAAA----AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTAAGAAATCGTGAGGG Riedeliella_graciliflora_AH009910 ATGAAGGAATATCAAATA---------TATTTAGAACTAGATAGGTCCCGCCAACAGAACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATCTAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCGAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCATTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC????????????????????????CCCTTCTTTCATTATTTAAGATCGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AA?AAACTGATTTCTAATTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCGCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTTT------AAGAATTTTTCGTCTACCTTATTATTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCCCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTAGTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGTTAAATTTTTCAGTGGTACGGA?TCAAATGTTGGAAAATTCATT?CTAATCGAAA????????????????????????????????????????????????????????????????????????????????????????????????GTAAGCCCGTTTGGACCGATTCATCCGATTTTGAGATTATTGACAGATTTTTGCGGATATGCAGAAATATTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGGAA------------------TA--CA--------TA-ATATATGTATA-------CA---------TACGTATTTGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----------TTT-----GTGAATC-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCAC-----AAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Robinia_pseudoacacia_AF142728 ATGGAGGAGCATCAAGTA---------TATTTAGAACTGGATAGATCTCGCCAACAGGACTTCCTATACCCACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTTGCGGAAAATGTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATCTCTGCTAATGATTCTAAA------AAAAATACA---TTTTTGAGGTATAATAATAATATTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAATTATTTGTCAGATATACGAATACCTTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTGTTTCTTTAT------GATTATTGTAATTCGAAT------------AGTCTTATTACTCCT------------AAAAAATGGATTTCGACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTCTTTCTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGTGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCTACCTTAACATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCAGTGGTACGTAGTCAAATGCTGCAAAATGCATTTCTAATCGAAATGGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAATTTTTGTAATGGATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTTTACGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCCTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTGTTGGAAGAATTTTTTATAGAAGAACAAGAGATTGTTTCTTTGATCTTTCCA------AGAGCTTCTT?TACTTTGCAG------AGGTTACATAGAAATCGGATTTGGTATTTGGATATTCTTTTTTTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGAAAACTTACCAAGTGAAAA-CTTTCAAACTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCCGCTTT-------CCGAAAAT-AAA---------GAAAA-----ATTCCGGAAGC-------------GAGAAAAA--------------------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGTGATA----------GGAAAGG----AATCCTT------CTATCAAAA------------TTTCAA--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA-------------TGTTTATA---TACGTATATGTACTGAAATACTAT-----TTTAA--------------TGGATTAA---TGAA------------GA-----CTTAAATAT--TCT--AGTTT----GTAAATA-T---TTCTT-------------------------TCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTACAA----GTTGAGG-------AAAAAATTCGAATA---------TTCATTGATCAAATCATTCACTCTCCATCCTA----------GTCTGATAGA---------TCTTTTGAAGAA--CTAATTAATCAGACGAGAATAAAGATAGAGTCCTATTCTACATGTCAATACCGACACTAA--------------------TGAAATTTTGAGTAAGAGGAAAATCCGTCGACTTTTGAAATCGTGAGG? Rupertia_physodes_AY386868 ATGGAGGAATATAGAGCA---------TATTTAGAACTCCATAGATCTCGACACCAGGACACCCTATACCCACTTTTTTTTCGGGAATATATTTATGGACTAGCTTGTGGTTAT---------------GGGTCCATTTTTGTAGAAAATGTAGGT------TATAACAAAAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACCCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATTCT---TTTAGGGGTTATAATAATCATTTTAATTATCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTACCTCTTCC---------TTAAGGGAATTAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTTTTTTTTTCTTACTATTATAATAATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAAAGGATTTCTACTTTTTTT---TCAAAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTACCAAATCCTCTCAGTTACGGTTAAAAAATTTTCGCCTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATATACCTTATCATTC------TTTAAGGATACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAACTACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGACCAGGAACGATCCATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCAGCTCAATCTTTCAGTGGTACGAAGTCAGATGTTGCAAAATTCATTTCTAATCCAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTTGCTAAAGCAAAATTTTGTAATGTATTTGGTCATCCTATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCAGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCACAAAAAAAAAAAGTTTATATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACCTTGGCTCGTAAGCACAAAAGTACTGCGCGCACTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGATATTTTTTCTTTGATTTTACCA------AGAACTTCTGTTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTGGGATATTCTT---TTCAGAAAAGATTTCGTCAAT---CATTTA---------------------------TAA?????????????????????GG-AACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAACGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGT-------------GATAATAAAAAAG---------------GGATAGGTGCAGAGACTCAATGGAA-CTATTCTAACAAA-----TGGAGTTGACG------ATTTTTCCTTTT-TGCATTA----------GGAAAAG----AATCCTT------CCATTAAAA------------TTCCAG------------------------------------GAATGGATCAAAG--------AGAAACA------------------------------------------TATATATATACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA----------------TCC--ATTT-----GTGATAA-A---AATAT-------------------------TCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAAGATGGAATA---------TTCATTGATCAAATTATTCATTCC--ATCATA----------ATCTGATAGA---------TCCCTTGAAGAA--CTGATCAATCAGACGAGAATAAAGATAGAGTCCTATTCTACATGTCAATATTGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGATTTAATAAATCGTGAGGG Sophora_davidii_AY386958 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATACCGCACCAACAGGACTTCTTATACCCACTTCTTTTTCGTGAGTATATTTATGGACTTGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCAGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTGATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAACAAGAATTTATATTCTCAAATAATATCAGAAGGTTTTACCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTTCTCC---------TTAGAGGGGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAACTTGACATATTTAAATTATGTGTCAGATGTACGAATCCCCTATCCTATCCATCTGGAAATTTTGGTTCAAA?????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTATTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGTGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGGT------TTTGTCGAAATCTTTACT------AAGGATTTTTCGTCTACCTTATCATTC------TTCACAGATACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAATGATCCAAATAAAC---AAATTC---TCCGAACATTCATTTCACCTTTTG------GGCTATTTTTCAAGTGTGCGGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACGGTACGTGCTTTTTTGAAAAGATTAGGTTCAAAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAATAATGGG-CAATCCTGAGCCAAATCCTATTTTT-----CGCGAAACC-GAA---------GAAAA-----GTTCATAAAGC-------------GAGAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AG-------------------------------A------------TTGGGG-------------------------------------AGGGGATCAAAG--------ATAAA------------TATATATATATATAA-------TATATCTATATGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTGA---TTAA--------TGAAGA-----CCGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------CTCACAAATGAAAA----------GATGTGAAGC---AAATCAT---TTCCAA----GTTGAA--------GAAA-AA--GAATT-CAATA---TTCATTGATCAAATCATTCATTCC--ATCACA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATTGACAACAA--------------------GGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Spartium_junceum_AY386901 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACCCACTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATTATTTT------AATGGATCTATTTTTTCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGGAATTGGAAT------------AATCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCA------AAAAGTCATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCCTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAACTAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGATACGGAGTCAAATGCTGGAAAATGCATTTCTAATCAAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGCTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATATTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGCAAAAAC-AAA---------GAAAA-----GTTGAGAAAGC-------------GAAAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAATTGACG------ATATTTCCTTT--TGCGTTGGGTT-----AGAAAAGG----AATCCTT------TCGTCGAAA------------TTGTGG-------------------------------------AAAGGATCAAGA--------ATAAACG----------TATATACATATATACGTATATACA--TATATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TAAA------------GA-----CTGAAAA----TCTCTATTT-------------------------------------------------------------------------------------------------------GTTGAA--------GAATGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATGAAA----------ATCTGATAGA---------TCTTTTTAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCC??????????????????????? Spirotropis_longifolia_JX295948 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCTTTTTGGTGGAAAATGGGGGT------TATAACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGAC------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTTCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCCTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAAGTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACGTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGCCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACGATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATGAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTTTATTT-----GTGAATATTTTATTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Spirotropis_longifolia_JX295949 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCTTTTTGGTGGAAAATGGGGGT------TATAACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGAC------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTTCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCCTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAAGTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACGTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGCCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACGATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATGAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTTTATTT-----GTGAATATTTTATTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Spirotropis_longifolia_JX295950 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCTTTTTGGTGGAAAATGGGGGT------TATAACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAAC------AAAAATCAA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGAC------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTTCGGTTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCCTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAAGTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACGTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGCCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACGATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATGAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------AGATTTCCTTT--CGCGTT----------AGGAAAGG----AGTCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGG---------------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTTTATTT-----GTGAATATTTTATTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAG--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCCACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Staminodianthus_duckei_JX124405 GTGGGGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAAATCCATTTTTGTAGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTGCTGCTAATGATTCTAAA---AAAAAAAATCAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTTAATTATGTGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGGAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCCTTCA------AGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCACGTAAACACAAAAGTACTGTACGTTCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-TTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGGGATGAATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------CATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Staminodianthus_racemosus_JX124420 GTGGGGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAAATCCATTTTTGTGGAAAATGTGGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATCAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTGAATTATGTGTCAGATATCCAAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATAAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTGTTTTTGGGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------???AATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------CCATTTCCTTT--CGCATT----------AGGAAAGGGATGAATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTCT------------------------ATCACAAATAAAA-----------CATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Staminodianthus_rosae_JX124396 GTGGGGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAAATCCATTTTTGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATCAA---TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTTAATTATGTGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAGGTGATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTATCATTC------TTTAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTTCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAAA--------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCATT----------AGGAAAGGGATGAATCCTT------CCATCGAAA------------TTCCGG--------------------------------AAAAGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTGAAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATAAAA-----------CATGTGAATC---AAATCAT---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATCAGA----------GTCTGATAGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTAAATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTCGAAATCGTGAGGG Styphnolobium_japonicum_AY386962 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATATATTTCTACTTTTTCA------AAAAGGAATACAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTACTTTTTCTCCGTAACAAATCCGCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATATCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCTATTCATCCGATTTTTATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATGAA---------------------------TGA???????TTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----TTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGCATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA------CATAGTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTT??????????????? Swartzia_apetala_JX295908 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------ACTAGCCCAATTTTGGTGGAAAATGTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTTTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTTTCGAAGTCTTTGCG------AATAATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAAACGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAGGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCGA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGA?ATTGGATTGAGCCTTGGTATAGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTTAGGAGTT---AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCTTTATTT-----TTAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCC??????????????????????? Swartzia_cardiosperma_EU362053 ATGAAAGAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTGTGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTTTCGAAGTCTTTGCT------AAGAATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAAACGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACCCAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACTGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTTTTTTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGGATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGA????????????????GGTATAGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTTAGGAGTT---AGGAAAGG----AATCCTT------CCATAAAAA------------TTCTAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCTTTATTT-----TTAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAAT????????????????????????? Swartzia_jorori_AY386942 ATGGAACAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTTCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTTTCGAAGTCTTTGCT------AAGAATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAAACGATACATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTAATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGTTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTTAGGAGTT---AGGAAAGG----A----------------------------------------------------------------------------------TCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCTTTATTT-----TTAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Swartzia_pinheiroana_JX295914 ATGGAAGAATATCAAGTA---------TATTTAGAACTAAATGGATCTCGCCAACAGGACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCAATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTTTCGAAGTCTTTGCT------AAGAATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAAACGATTCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGA????????????CCTTGGTATAGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGCTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTTAGGAGTT---AGGAAAGG----AATCCTT------CCATGGAAA------------TTCTAG--------------------------------AAAGGAACGGATCAAGG--------ATAAACA----------TATATA--------------------TATATACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCTTTATTT-----TTAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCCACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCC??????????????????????? Swartzia_polita_JX295913 ATGGAAGAATATCAAGTA---------TATTTAGAACTAAATGGATCTCGCCAACAGGACTTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTTAATTATGTGTCAAATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTTTCGAAGTCTTTGCT------AAGAATTTTTTGTCTACCTTATCATTC------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAAACGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATGGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTCATCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGCTTT-------CCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTTAGGAGTT---AGGAAAGG----AATCCTT------CCATCGAAA------------CTCTAG--------------------------------AAAGGA-----TCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCTTTATTT-----TTAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCCACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGG Swartzia_simplex_AF142678 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATTGGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATACTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATATTCCTTTTTCTCCGTAACAAATCCTCTCATTTAAGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAAGAGAACAT------CTTTTCGAAGTCTTTGCT------AAGAATTTTTTGTCTACTTTATCATTT------TTCAGGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACTAAAAACGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGTGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGATCAAT---CATGAA---------------------------TGA??????????AGCCTTGGTATAGTAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCAAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCTTTT--CGCGTT---------------AGG----AATCCTT------CCATCAAAA------------TTCGAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTACAAA----TCTTTATTT-----ATAAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAG--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTTC--GTCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Sweetia_fruticosa_AY386911 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAAGACTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATAAAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------ACAAATCAA---TTTTTGGGATATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------ATCTATTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTTGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAG------CTTGTGGAAGTCTTTGCT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAAAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CTATTA---TCCAAGCATTCT---CACTTTTTT---GGGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCAGACAATAGTTCCAATTTTTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAATCCGGTCTGGGCAGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTCAAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATTTTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTAAGCAACGATCTGGTCAAT---CGTGAA---------------------------TGA???????????????TGGTATAGAAATATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAAA----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGTTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ACAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------TA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATAATATGGATTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTACTAGGAAA-TCCGT????????????????????? Sweetia_fruticosa_JX152619 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAAGACTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATAAAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------ACAAATCAA---TTTTTGGGATATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------ATCTATTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTTGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTC????????????????????????????????CTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAG------CTTGTGGAAGTCTTTGCT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAAAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCAGACAATAGTTCCAATTTTTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAATCCGGTCTGGGCAGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTCAAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATTTTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTAAGCAACGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAATATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGTTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ACAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------TA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATAATATGGATTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTACTAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Sweetia_fruticosa_JX152620 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAAGACTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATAAAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------ACAAATCAA---TTTTTGGGATATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------ATCTATTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTTGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAG------CTTGTGGAAGTCTTTGCT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAAAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCAGACAATAGTTCCAATTTTTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAATCCGGTCTGGGCAGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTCAAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATTTTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTAAGCAACGATCTGGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAATATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGTTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ACAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------TA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATAATATGGATTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTACTAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Sweetia_fruticosa_JX152621 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAAGACTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGGTGGAAAATAAAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------ACAAATCAA---TTTTTGGGATATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------ATCTATTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTTGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAG------CTTGTGGAAGTCTTTGCT------AGGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAAAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCAGACAATAGTTCCAATTTTTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAATCCGGTCTGGGCAGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTCAAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATTTTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTAAGCAACGATCTGGTCAAT---CGTGAA---------------------------TGA????????????????????????????TACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGTTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ACAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------TA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATAATATGGATTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTACTAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Tabaroa_caatingicola_GQ246161 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGTACTCGCTTATGGTCATGATTTT------ACTAGATCCAATTTTGTGGAAAATGTCGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCGAAA------AAAAATCCA---TTTTTGGGGTATAACAAGGATTTGTACTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCGAAAATCATAAAATCCTATAATAATCTGCGATCAATTCATTCAATTTTTCCATTTTTCGAAGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTCGAAATCTTAGTTCAAGTGCTTCGATACTGGGTCAAGGATGTCCCCCTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGCAAT------AGTAAGAGTCTTATTACTCTA------------AAAAAATCGATTTATACTTTTTCA------AAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTATCTTTGAGCGAATCTATTTCTATGCAAAAATACAGCAT------CTTGGAGAAGTCTTTGCT------AAAGATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTTGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTTATGTTTGGTCTCAACCAGGAATGACCCAGATAAAT---CAATTC---TCCGAGCATCCATTTCCCTTTTTG------GGCTATTTTTCAAATGTGCGATTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTTTGAAAAAATTTGATACAATAGTTCCCATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATAAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAGTTATTGGAAAAATTCTTTATAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------CGAGCTTCTTCTATTTTGCAG------AGGTTCTATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTAGTCAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Taralea_cordata_JX295872 ATGGAGGAATATAAAGTC---------TATTTAGAACTACATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTTATGATTTA------AATAGATCAATTGGGGTGGAAAATATAGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCATGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTT---TTCGATTTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATCAATTTATATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGCTGTTTCTTTAT------GAGTATTATAATTGG------------------ATTATTACTCCA------------AAAAAATCGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTATTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTT?TGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTGAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGACTTCAAAGAAT------ACGCCTTTTCTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACTAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAA?AAGAGTTTGTATCGAATAAAATATATAGTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACCGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGA??????????????????????????CCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCCGTTTT-------CCAAAAAC-AAA---------GACGA-----GTTCATAAAGC-------------AAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----CGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TT---------------------------------------GG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTAAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Taralea_oppositifolia_JX295900 ATGGAGGAATATAAAGTC---------TATTTAGAACTACATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTTATGATTTA------AATAGATCAATTGGGGTGGAAAATATAGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCATGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTT---TTCGATTTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATCAATTTATATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGCGGTTTCTTTAT------GAGTATTATAATTGG------------------ATTATTACTCCA------------AAAAAATCGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTATTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTGAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGACTTCAAAGAAT------ACGCCTTTTCTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACTAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGA????????????????GGTATGG-{AC}ACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-AAATCCTGAGCCAAATCCCGTTTT-------CCAAAAAC-AAA---------GACGA-----GTTCATAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----CGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TT---------------------------------------GG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTAAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Taralea_rigida_JX295934 ATGGAGGAATATAAAGTC---------TATTTAGAACTACATAGATCTCTCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTTATGATTTA------AATAGATCAATTGGGGTGGAAAATATAGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCATGGAAATTCCATTTTCCTTACAATTA------AGTTCTTTT---TTCGATTTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATCAATTTATATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGCTGTTTCTTTAT------GAGTATTATAATTGGAAT------------AGTTTTATTACTCCA------------AAAAAATCGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTCTTATTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTATCTTGTCATTC------TTGAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGACTTCAAAGAAT------ACGCCTTTTCTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACTAAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCAGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTAGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAACGGG-AAATCCTGAGCCAAATCCCGTTTT-------CCAAAAAC-AAA---------GACGA-----GTTCATAAAGC-------------GAGAATAAAAAA----------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----CGGAGTTGACA------ACATTTCTTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TT---------------------------------------GG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTAAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTAATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATAGTAAAAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Templetonia_hookeri_GQ246157 ATGGAGGAATATCCAGTA---------TATTTAGAACTAGCTAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------CATAGATCCAATTTTGTAGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCCA---TTTTGGGGGTATAACAAGGATTTGTATTTTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGATAAAAGATGTCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGGAATCCAGGATTTTTTTTGTTCCTATATAATTATTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACTTCTTTTAGTGTTCTCTTTGAACGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTATACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGACCCATATAAAT---CAATTC---TCCGAACATCCATTTCAATTTTTG------GGCTATTTTTCAAATGTACGGTTAAATCTTTCAGTGGTACGAAGTCAAATGCTAGAAAATTCATTTCTAATCGCAATTGTTATGAAAAAATTGGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGCAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTCTTGCGAATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTACTTTTTTGAAAAGATTGGGTTCAAAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAC------AGGTTCTATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTAGTCAAT---TATGAA---------------------------TGA?????????????????????????????????????????-??????????????????????????????????????????????????????????????-------????????-???---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????--------------------????????????????????????????????????????????????? Thermopsis_rhombifolia_AY386866 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGACTTCTTATACCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTGCGGAAAATGCAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTCATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCCTCC---------TTAGAGGGGGTAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCGATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTCTGTGAATACGAATCTATATTCCTTTTTCTACGTAACAAATCCTCGCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCACAGATCCTTTCATTCATTATGTTAGATATCACGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCAAAATAAAC---CAATTC---TCCGAACATTCATTTCACCTTTGG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCGGCAGTACGGAGTCAAATGTTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAACTTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCGAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGATAAAAC-AAA---------GAAAAGT---GTTCATAAAGC-------------GAGCATAAA------GCGAGAATAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTAACG------ACATTTCCTTT--CGCATT--------------AAGG----AA-----------------------------------GGG------------------------------------------ATCAAGG--------ATAAACG----------TATATA----------------------TATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----C-TAAAA----TATCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCTC---TTCCAA----GTTGAAGAGAGA--GAAAGAATTTAATA---------TTCATTGATCAAATCATTGATTCC--ATCATA----------GTCTGATCGA---------TCTTTTGAAGAG--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGG?????????????????????????????? Tipuana_tipu_AF270882 ATGAAACAATATCAAATA---------TATTTAGAACTAGATGGATCTCGCCAACAGAGCTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGACTATGGTCATGATTTAAATATAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCCTTTTTGCTAATGATGCGAAC------AAAAATCCA---TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTCGAAAAGTCGGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAAC?????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTATACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCTACCTTATCCTTC------TTCAAGGATCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTCCATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAAATCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCCTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAT------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGATCAATGTAAATGGA---------------------------TAAAATTGGATTGAGCCTTGGTATGG-AACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCCGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CCGAAAGC-AAA---------GAAAA-----GTTAAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAA------TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCTAG-------------------------------------AAACG---------------ATATACA----------TATATATGTATATA----------------TACGTATTTGTATTGAAATACTAT-----TTCAA--------------TTGAGTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTTACTC-----TTTAT------------------------ATTACAAATGACAAATGAAA----AATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCACTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATA-TAAGAGGAAAATCCG?????????????????????? Trifolium_repens_AF522131 ATGAAGGAATATCGAGTA---------TATTTAGAACGAGCTAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATAATTTT------AATAGATCCATTTTTATGGAAAATGGAGGT------TATGACAATAAA------TATAGTTTACTAAATGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATCATTTCGGCTAATGATTCTAAC------AAAAATCCA---TTTTTAGGATATAATAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCATCATCGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATGTAAGATCAATTCATTCCATTTTTCCATTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATAAGAATACCCTATCCTATCCATCTGGAAATCTTAATTCAAATCCTTCGATACTGGGTGAAAGATGTCCCCTTTTTTCATTTATTACGGTTGTTTCTTTCT------CATTTTTGTAATTGGAAT------------TGTTTTATTCCCACC------------AAAAAATCGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTATTCTTGTTCCTCCATAATTTTTATGTATGTGAATATGAATCTATCTTCCTATTTCTACGTAATAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAAAACAT------CTTGTAGAAGTTTTTTCT------AAGGATTTTTCGTATACTTTACCGTTC------TTCAAGGATCCTAACATTCATTATGTTAGATATCAAGGAAAATGCATTCTGGCTTCAAAGAAT------GTGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAAGAACGATCAATATAAAC---CAATTA---TCCGAACATTCATTTCAGCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGGTTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTAAAAAGATCAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGATTCTTTTTCTTTGCGT------AGGTTCCATAGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATCTGGTCAAT---GATGAA---------------------------TGAAATTAGATTGAGCCTTGGTATGGAAACTTACTAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTAAAAAGGGG-CAATCCTGAGCCAAATCCTTCTTT-------CCGAAAAC-AAAA--------TAAAA-----GTTCAGAAAGT-------------TAAAATAAAAAAG---------------GGATAGGTGCAGAGACTCGATGGAA-CTGTTCTAAGAAG-----TGGAGTTGACA------ACATTTCCCTC--GGCAGTA----------GGAAAGG----AATCGTT------CTATCCAAC------------TTCCAG--------------------------------AAAGGAAAAGATCAAGG--------ATAAACA--------TATATATA-------------TGG-TATA---TATAT-TATGTAGTCAAATACTCT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTTCTCACG--TCTATTT-------GTAAAT--TG--TAAAT------------ATTTCT-TTTCTATCACAAATGAAA-----------GATTTGAATC---AAATCAA---TTACAA----CTGGAATA--------AAAAATGAAATA---------TTCATTGATCAAATCAGTCACTCC--ACCACA----------GTCTGATGAA---------TCTTTTGAATAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACATCAA--------------------TGAAATTTTTAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Trischidium_alternum_JX295928 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGATTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATGAA---TTTTGGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCCTTTCCCTACAACTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATTCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCCACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAGTTCATTTTTTTGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCGATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAATTTTGTGATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAACGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA----GGCATA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGGAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCATATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTGTTT-----TTTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAAA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTCAAAATCGTGAGGG Trischidium_decipiens_JX295867 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGATTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTAGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATGAA---TTTTGGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCCTTTCCCTACAACTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATTCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTCTTACTCCA------------AAAAAATGGATTTCCACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAGTCCATTTTTTTGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCGATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAATTTTGTGATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTCATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAACGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA----GGCATA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGGAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTGTTT-----TTTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAAA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTCAAAATCGTGAGGG Trischidium_molle_JX295868 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGATTTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTACTAATGATTCTACC------AAAAATGAA---TTTTGGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCCTTTCCCTACAACTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATTCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCCACTTTTTCA------AAAAGTAATCCAAGATTCTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAGTCCATTTTTTTGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCGATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAATTTTGTGATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAACGATCTGGTCAAT---CATTCA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAACGGG-CAATCCTGAGCCAAATCCTGTTTT-------TCGAAAAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA----GGCATA-----GGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACAAA-----TGGAGTTGACG------ACATTTTCTTT--CGCGTTAGGAGTT---AGGAAAGA----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TGCGTATATGTACTGAAATACTAT-----TTCAG--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTGTTT-----TTTAATA-----TTTAT------------------------TT------------------------------------------------CAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAAA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTTAATACCGACAACAA--------------------TGAAATTTATCGTAAGAGGAAAATCCGTCGACTTTCAAAATCGTGAGGG Ulex_europaeus_JQ669586 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCACTTCCTATACCCACTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCGCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA---TTTTGGGGTTATAATAAAAATTTGTATTCTCAAAAAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCAAAAGATGTCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAAT------ATTGGAAT------------AATCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCA------AAAAGTCATCTAAGAGTTTTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCTACCCTATCATTC------TTCAAGGAGCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGCTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATATAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAATACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCGG------GCGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAACGATTTGATCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGGATGGAAACTTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTGACAATGGG-CAATCCTGAGCCAAATCCCGTTTTT-----CGTAAAAAC-AAA---------GAAAA-----GTTCAGAAAGA-------------GAAAATAAAAA-----------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAATTGACG------ACATTTCCTTT--CG------------------------------------------TCGAAA------------TTGCGG-------------------------------------AAAGGATCAAGA--------ATAAACT----------TATATA----------------CA--TATATACGTATATGTACTGAAATATTAT-----TTCAA--------------TTGATTAA---TAAA------------GA-----CTGAAAA----TCTCTATTT-------------------------------------------------------------------------------------------------------GTTGAA--------GGAGGAATTGAATA---------TTCATTGATCAAATCATTCATTCC--ATGAAA----------ATCTGATAGA---------TCTTTTTAAGAG--CTGATTAAGCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTAGAGTAAGAGG?????????????????????????????? Umtiza_listeriana_EU362062 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTGGTCAACATGACTTCCTATACTCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCACTTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA---TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGTCAGAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTATTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTCGAAGTCTTTGAT------AAGGATTTTCCGTCCACCCTATGGTTC------TTCAAGGACCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGATATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTTTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------CATCAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACCTACCAAGTGATAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-CAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATCTCCTTT--CGTT------------AGGAAAGG----AATCCTT------CCATCGAAA------------CTCCAG--------------------------------AAAAGAAAGGATCAAGG--------ATGAACA----------TATATA------------------------TACGTATACGTACTGAAATACTAT-----TTAAA--------------TTGATT--------A------------GA-----CCCCCAA----TCTCTATTT-----TTTAATA-----TTTAT------------------------ATGACAAATGAAA-----------GATGTGAATC---GA--------TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAG?? Uribea_tamarindoides_AY553719 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTTGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTCTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTTATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGCTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA????????TGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGA-ACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATAGA-----------------ATATATATATGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTAAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGA????????????????????????????? Vatairea_erythrocarpa_JX152597 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTT------TCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAAGAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTACGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGAATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAAG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTTAATATTGA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_fusca_JX152599 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTACGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAATATAAATCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTCTTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTTTCAGATGTACGAATATCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTATAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAAATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGAATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAAA----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCCT------CCATCCAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTAAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_guianensis_JX152600 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTT------TCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCCTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGAATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAGGG--------ATAAACA----------TATATA----------------------TATACATATATGTACTGAAATACTAT-----TTCAA--------------TTAATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ACCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTTAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_heteroptera_JX152603 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTTCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTATAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAAGTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAAAA---GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGAATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_heteroptera_JX152604 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTATAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTTTTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGA????????????????????TAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAAGTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAAA----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGAATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_lundellii_JX152605 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTTTTATTTCTGCTAATGATTCTAAC------AAAAATAAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTTTCAGATGTACGAATATCCTATCCTATCCATCTGGAAAT?????????????????????????????????????CCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTATAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGAATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAAT{AT}CAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAGCAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCCT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAACAATTTAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_macrocarpa_JX152609 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGCAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAATAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTTCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTATAT------GAGTATTGTAAT------------------AGTATTATTACTCCA------------AAAAAACCTATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TACAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACCTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAAA----GTTCACAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGAATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GGTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCAATTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_paraensis_JX152611 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTT------TCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGAATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vatairea_sericea_JX152612 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGACCAATTTTGATGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTT------TCTGCTAATGATTCTAAC------AAAAATCAA---TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGAGAAATTTTCATATTTAAAATATGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAAAAGAAAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTCTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTACT------GGGGATTATTCGTCTACCTTATCCTTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAAAAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGAATTGAGCCTTGGTATAGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------AAAAA-----GTTCAGAAAGA-------------GAGAATATAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AACCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GATGTGAATC---AAATCAA---TTCAAA----GTTGAA--------GAAAGAATTTAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--TTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vataireopsis_araroba_JX152613 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AGTAGACCAATTTCGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAAGAAA---TTTTTGGGGTATAATAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCAAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATCA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAATGGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTGCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CTGAAAAC-AAA---------GAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTAAAATACTAT-----TTCAA--------------TTGATTAA---TGAATTGATTAATGAAGA-----TTCCAAA----------TTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GA-----------------------------------AA--------GAA---------TATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGACAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vataireopsis_speciosa_JX152615 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AGTAGACCAATTTCGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTTTGATTTCTGCTAATGCTTCTAAC------AAAAAGAAA---TTTTTGGGGTATAATAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTCGGTTCAAACCCTTCGATACTGGGTGAAAGATGCTCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAATGGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTGCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CTGAAAAC-AAA---------GAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA----------------------TATACGTATATGTACTAAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----TTCCTAA----------TTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GA-----------------------------------AA--------GAA----TTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGACAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Vataireopsis_surinamensis_JX152618 ATGGAGGAATATCAAGTATTCAA?GTATATTTAGAACGAGATAGATCTCGCCAACAGTACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AGTAGACCAATTTCGGTGGAAAATATAGGC------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTTATTATTTCTGCTAATGATTCTAAC------AAAAAGAAA---TTTTTGGGGTATAATAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTATTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGAGAAATTTTCATATTTAAAATATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAAT?????????????????????????????????????CCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTATTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGAATTTTTCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGATGTCTTTGCT------AAGGATTATTCGTCTACCTTATCATTC------TTCAAGGATCTTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC??CCTATTA---TCCAAGCATTCT---CACTTTTTT---?GGGGCTATTTTTCAAATGTGCAGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGTTCCATACAATGGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACATCCCATTAGTAATCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTGCTCATTATTACAATGGATC?TCAAAAAAAA?GAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGGAAACACAAAAGTACTGTATGCGCTTTTTTGAAAATATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGGAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAACTTCTTATACTTTGAAG------AGGTTATATAGAGGTCGGATTTGGTATTTAGATATTATT---TTCAGCAACGATCTAGTCAAT---CGTGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACATACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCCGTTTT-------CTGAAAAC-AAA---------GAAAA-----GTTCAGAAAGA-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTATTCGAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGTGGT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTGCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACG----------TATATA----------------------TATACGTATATGTACTAAAATACTAT-----TTC--------------------TTAA---TGAA------------GA-----TTCCAAA----------TTT-----GTGAATA-----TTTAT------------------------ATCACAAAAAAAA-----------GA-----------------------------------AA--------GAA----TTGAATATTTA---TTTTCAATGATCAAATAATTCACTCC--ATCATA----------GTCTGACATA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAATAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Wisteria_frutescens_AF142731 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCCATTTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCCGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAATAAGAATTTTTATTCTCAAATAATATCAGACGGTTTTGCCGTCGTTGTGGAAATTCCATTTTTCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATCATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCCTTTTTTCATTTATTACGGTTTTTTCTTTAT------CATTTTTCTAATAGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACCTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCGTTTTCTACGTAACCAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAAAAGTTTTTCCT------AAGGATTTTTCGTCTACCTTAACATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCCTTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAAATCTGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAACTTCTTCTACTTTGCAG------AGATTACATAGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAACGATTTGGTCAAT---CATGAA---------------------------TGA??TTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAAAA-CTTTCAAATTCAGAGAAACCCTGGAATTCACAATGGG-CAATCCTGAGCCAAATCCTGCTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATCAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAA-CTGTTCTCAAAAA-----TGGAGTTGACG------ACATTTCCTTA--CATAGTA----------GGAAAGG----AATCCTT------ATATCAAAA------------TTTCAG--------------------------------AAAGGAAAGAATCAAGG--------ATAAATA------TCTATATATA-------------TT--TA-----TATATATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAAGT--TCT--ATTT-----GTAAATA-T---TTTT-------------------------ATCATAAAAGAAA-----------GATGTGAATA---AA-TCAA--TTTACAA----GTTGAAAA-------AAAAAATGGAATA---------TTCTTTGATCAAACCCTTCACTCC--ATCATA----------GTCTGATGGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAAGAA--------------------TGAAATTTTTAGTAAGAGG?????????????????????????????? Xanthocercis_zambesiaca_JF270996 ??????????????????---------?????????????????????????????????????????????????????????????????????????????????????????????------??????????????????????????????------????????????------?????????????????????????????????????????????????????????????????????????????????------?????????---???????????????????????????????????????????????????????????????????????????????????????------?????????---------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTATTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATGCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTAT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????????????????---??????---------------------------???????????TGAGC-TTGGTATGGACCC-TACCAAGTGAGAA-CTTTCAAATTCAGAGAAACC-TGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAACAC-AAA---------GAAGA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA------------------------TACGTATATGTACTGAAATACTAT-----TTCAA--------------TTGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----TTGAATA-----TTTCT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATCGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TTTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAA-TCCGTCGACTTTAGAA-TCGTGA??? Zollernia_aff_glabra_JX295916 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCGAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Zollernia_glabra_JX295915 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA????????????CCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCGAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Zollernia_glaziovii_JX295952 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAAT??????????????????????????????????????????????????????????????????????------??????????????????------------???????????????------------????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????------???????????????????????????------???????????????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------????????????????????????????????????????????????????????????????????????GAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCGAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Zollernia_ilicifolia_JX152654 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCG????????????????????????????------??????????????????------???????????????????????????------???????????????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------???????????????????????????????????????????????????????????????TTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCGAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Zollernia_latifolia_JX295918 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCGAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Zollernia_magnifica_JX152595 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAACTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGAAATTGGATTGAGCCTTGGTATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCAAGG--------ATAAACA----------TATATA-----------------ATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATC--------CAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG Zollernia_modesta_JX295917 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA---TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGTAGAAATCGTAAAATCTTATACTAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTTTTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCTACCTTATCATTC------TTCAAGGATCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAACGATCTGGTCAAT---CATGAA---------------------------TGA??????????????????TATGGAAACTTACCAAGTGAGAA-CTTTCAAATTCAGAGAAACCCTGGAATTAACAATGGG-CAATCCTGAGCCAAATCCTGTTTT-------CCGAAAAC-AAA---------GAAAA-----GTTCAGAAAGC-------------GAGAATAAAAAAA---------------GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAA-----TGGAGTTGACG------ACATTTCCTTT--CGCGTT----------AGGAAAGG----AATCCTT------CCATCGAAA------------TTCCAG--------------------------------AAAGGAAAGGATCGAGG--------ATAAACA----------TATACA-----------TATATAATATATATACGTATATGTACTGAAATACTAT-----TTCAA--------------TGGATTAA---TGAA------------GA-----CTCCAAA----TCTCTATTT-----GTGAATA-----TTTAT------------------------ATCACAAATGAAA-----------GATGTGAATC---AAATCAA---TTCCAA----GTTGAA--------GAAAGAATTGAATA---------TTCATTGATCAAATCATTCACTCC--ATCATA----------GTCTGATAGA---------TCTTTTGAAGAA--CTGATTAATCAGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATACCGACAACAA--------------------TGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14628] TITLE matK_Character_Matrix; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1740; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Acacia_cochliacantha_AF274133 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTGATTTTTCGGGAGTATATTTATGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATAATCAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTACCAAATCTTCTTATTTACGATTAACATCTTTTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTTTCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGTTTTTTTTGAAAAGATTAGGTTCTGAA---TTAGTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTAGATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Acacia_myrtifolia_AF274160 ATGGAGGAATTTCCAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTT?GGTGCAAAATGTAGGT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAA------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATTCTAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCGGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTAT?G?AATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTCCTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTCCTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAATTTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGGAGATATGCAGAGATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGAATATATTTTTTCTTTGATCTTCTCA------AGAACTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Acosmium_cardenasii_JX124425 ATGAAAGAATATCCAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTAAAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCTTATCCTATCCATCTGGAAATCTTAG?????????????????????????????????????????????????????????????????------???TATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTTCTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---CCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTGGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGTAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Acosmium_diffusissimum_JX124415 ATGAAAGAATATCCAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTATAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTCTGTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCTCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTTCTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---CCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Acosmium_lentiscifolium_JX124417 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCTTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAGTATAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCAGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCTCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTATACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTTCTATATAACTTTTATGTATGTGAACACGAATCCATCCTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---CCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCTATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTGACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGTCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAACCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGACGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Acrocarpus_fraxinifolius_EU361843 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTGTACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGCGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTTC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCCTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATCCTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAGTGGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTGCCGTCC---ACCTTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTATCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGTAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTAGAAGAATTCTTTACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Adenanthera_pavonina_AF521808 ??????????????????---------?????????????????????????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------????????????ATTGTAAA?CGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ACCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAACTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTAGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Adenolobus_garipensis_EU361844 ATGGAGGAATTTCAAGTA---------TATTTAGAAATATATAGATCTCGGCAACATGAC------TTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTGGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATT------GCTAATGATTCTATC------AAAAATAAA------------TTTTGGGGGTACAACAAAAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTATTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCACTTCACTCAATATTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTATGCTTAAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCC------AAAAGGATTCCAAGATTA------------------------TTTTTGTTCCTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCGTTTACGATTAACAACCTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGACTTTCTGTTG---ACCCTATGGTTT------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGACT------ACGTCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTGCGGCTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAACGTATTAGGTCATCCTATTAGTAATCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCACTATTACAATGGATCCTCAAAAAAAAATAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCCTTTTTTAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTTACGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATCGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATTCGGTCAAT---CATTCA---------------------------TGA Adesmia_lanata_AF270863 ATGGAGGAATATCAAATA---------TATTTAGAAATCGATGGATCTTGCCAAGAAAAC------TTCCTATACCCACTTAGTTTTCAGGAGTATATTTATGGACTTGCCTATGGTCATGATTTAAATAGAAAAGTATCCATTTTGGTGGAAAATGTGGAT------TCTGATAAGAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATGATTCTAAA------AAAAATCTA------------TTTTTGGGGTATAACAAGAATTTTTATTCTCAAATAATATCAGATGCTTTTGCCGTCATTGTGGAAATTCCATTTTCCCGACAATTC------ATTTCTTCC---------TTAGAGGACGCGGAAACCATAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------ACTTTTATTACTCAA------------AAAAAACGTATTTCTACCTTATCA------AAAAGTAATCCAAGATTT------------------------TATATATTCCTATATAATTTTTATGTATGTGAACATGAATCCATCTTCCTTTTTCTACGTAAAAACTCCTCTCATTTGCGATTAAATTCCTTTAGCCTTCTTTTTGAGCGAATACATTTCTATGCAAAACTAGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCATGT---ACCTTAGCATTC------TTCAAGGA---TCCTATGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTGAATAAATGGAAATACTATCTCATCTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAAGAAGGAACGATCCGTATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATATTTCAAATGTACGGCTAAATTTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCCAATCGAAATTGGTATGAAAAGGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAAAGGATCCTCAAAAAAAAAAGGTTTATATCGAATAAAATATATACTACGGCTTTCTTGTATTAAAACCTTGGCTCGTAAACATAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTTTTGACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGTTTATATAGAGATCAGATTTGGTATTTGGATATTCTT---TTCAGCCAT------GATCTGTTCAAT---TACGAA---------------------------TGA Aeschynomene_indica_AF272084 ATGGAGGAATATCAAATC---------TATTTAGAACTAAATGGATCTCGCCAACATAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCACCTATGGTCATGATTTAAATATAAATCGATCCTTTTTGGTGGAACATATGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAACGATTCTAAC------AAAAACCCA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCTATTTTCCCGACAATTT------CCTTCCGCT---------TTAGAGGAGTCAGAAATAATTCAATCTTTGAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAGGATAAATTGACATATTTGAATTTTGTTTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGTCTTCGATACTGGGTGAAAGATCCCCCCCTCGTTCATTTATTAAGATTATTTCTTTTT------GAATATTGTAATTGGACT------------AGTCTTATTACTAAA------------AAAAAACGTATTTCGACTATCTCA------AAAAATAATCCAAGAATT------------------------TTTTTGTTCCTATATAATTTTTATGTATGGGAACACGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCCTTTACGATTTCACTCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGCAAAAATCGAACAT------CTTGCGGAACTCTTTTCT------AAGAATTTTAGGTTT---CCCTTCTCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------ACGCCTCTGTTGCTGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTAATTTTTATGTTTGGTCTCAACCGGGAACGATCCAGATAAAC---CAATTATTATCCGAGCATTTATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGCTAGAAAATTCATTTCTACTCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCGAATTATTCCTTTAATTAGATCTTTAGCTAAAGCGAAATTTTGTAATATCTTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCTTCAAAAAAAAAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTCTTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGTGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCCTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATACAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAG------GATCTCGTCAATGTAAATGGA---------------------------TAA Aeschynomene_purpusii_AF270870 ATGGAGGCCTATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTACGGTCATGATTTAAATATAAATCGATCCATTTTAGTGGAAAATGAGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGATAATGATTCTAAA------AAAAAACCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTTCATTTTCCCGACAATTACAATTCCGTTCTTTT---------TTAGAGGAGTCGGAAATCGTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATGTGAATCTTATTTCAGATGTACAAATACCCTATCCTATTCATCTGGAAATCTTGG????????????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------AAAAGTCATCCAAGAATT------------------------CTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTTATTTACGATTAAACTCTTTTATCGTTATTTTTGAGCGAATCTATTTCTATGCAAAAATCCAACAT------CTTGTGGAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAACCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATCTAATTTTGATGTTTGGTCTCAACCTAAAACGATCCATATAAAC---CCATTATTATCTGAGCATTCATTTCATTTTTTTTTGGGGGGTTATTTTTCAAATGTCCGGCTAAATTTTTCAGTGGT?CGGAATCAAATGCTAGAAAATTCATTTCTAATTGAAATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTGTTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTAACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCACTTTTTTGAACAGATTCTATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Afzelia_bella_EU361846 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGCCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGAAAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCG{AT}TACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAAAATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ATCTTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTCTTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGACGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Airyantha_schweinfurthii_JX295897 ATGGAGGAATATCAAGCA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCCATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGGGGAAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTACTAGTTGTAAAACGTTTAATTACTCGACTGTATCAACAGAATCATTTGATTATTTATGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCGTTCTTTCATTTACTAAGGTTGTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTGATCCAAGATTT------------------------TTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------ATTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACTTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATATCATTTTGAGGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCGAAATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCCTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGAAATTTTTGACCGCTTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AAATCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Albizia_versicolor_AF274210 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGA?AGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAA?TTTATATTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCCATTTCTATGCAAAAATCGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TC?GAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTCCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATCTTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCCG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Aldina_heterophylla_JX295956 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGT??????????????????????????????????------??????????????????------------???????????????------------????????????????????????------??????????????????------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????------???????????????---????????????------??????????????????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????AAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAT------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Aldina_insignis_JN168674 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGAAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGGGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCATTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Aldina_latifolia_JX295861 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTAGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATTTTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGGGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCATTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGACTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Alexa_bauhiniiflora_JX295931 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTGTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTATACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGCGTTTCTTCTCCTTTGCAG------AAGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Alexa_canaracunensis_JQ669613 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTCAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGCGTTTCTTCTCCTTTGCAG------AAGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Alexa_grandiflora_JX295968 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTTTTATTTATGTTAATGATTCTAAC------AAAAAT?AA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTCAATTATGTGTCAGATGTACGAATACCCTATCC???????????????????????????????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATTCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Amblygonocarpus_andongensis_AF521812 ??????????????????---------?????????????????????????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------????????????ATTGTAAA?CGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ACCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAACTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAGAAT------ACGCCTTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTAGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAAAAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGTATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAAAGATCTGGTCAATCA------------TGA Amburana_acreana_JX295866 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGG?????????????????????????????????????TCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTATTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTATCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTTATTC------TTCAAGGA---TCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CGTGAA---------------------------TGA Amburana_cearensis_AY553712 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTAGTAAGGTTGTTTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTATTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTTATTC------TTCAAGGA---TCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CGTGAA---------------------------TGA Amburana_cearensis_JX846614 ATGGAGGAATATCAAGTA---------CATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCCCTTTCCTTACAATTA------AGCTCTTCC---------TTAGAGGAGGCGGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTAGTAAGGTTGTTTCTTTAT------GAGTACTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTATTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATTTTCCTTTTTCTCCGTAATAAATCCTCTCATTTACGATTACCATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACATCAACATCTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTTATTC------TTCAAGGA---TCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATTTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAGCGATTCATATAACC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATGCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CGTGAA---------------------------TGA Amherstia_nobilis_EU361849 ATGGAGGAATTGGAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTT------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTGAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGATTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAATTCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATATAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAATACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTGACTTTGCAGAGA---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGGA---------------------------TAA Amicia_glandulosa_AF203583 ATGGAGGAATATCAAATC---------TATTTAGAACTAGATGGATCTTGCCACCGGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGTCTATGGTCATGATTTAACTAAAAATAGATCTATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGCTTCTTTTTGCTAATAATTCTAAA------AAAAATATA------------TTTTTAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTTGGGGAAATTCCATTTTCCCGACAATTG------AGTTCCTCC---------TTAGAGGAGGTCGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTTTCAAATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACC????????????????????????CCCTTCTTTCATTTTTTAAGATTGTTTCTTTAT------GAGTATGACTATTCGAAT------TGGAATAGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTATCA------AGAAGTAATCCAAGATTT------------------------TTCTTATTCCTATATAATTTTTTTGTATGTGAACACGAATCCATCTTTCTTTTTCTACGTAATAACTCCTCTCATTTACGATTAAATTCTTTTAGCCTTCTTTTTGAGCGAATCCAATTATATTCAAAAATTGAACAT------CTTGTCGAAGTCTTTGTT------AAGGATTTTTCATCT---ACTTTATTATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGCTCAATAAATGGCAATACTATCTCATCTATTTCTGGCAATGTCATTTTAATGTTTGGTCTCAAGCAGGAACGATCCATATAAAA---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTCAATTTTTCACTGGTACGGAGTCAAATGTTAGAAAATTCATTTCCAATCGAAATAGGTAGGAAAAGGCTTGATACAATAGTTCCTATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAGCCCGTTTGGACTGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAGGTTTGTATCAACTAAAATATATACTTCGGCTTTCTTGCATTAAAACATTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGACGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTAGTCAAT---CAGGAA---------------------------TGA Ammodendron_argenteum_AY386957 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATACCGCGCCAACAGGAC------TTCTTATACCCACTTATTTTTCGTGAATATATTTATGGACTTGCTTATGGTCATGATTTT------AATGGATCCATTTTTACAGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTGATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGTTATAACAAGAATTTATATTCTCAAATAATATCAGAAGGTTTTACCACCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTTCTCC---------TTAGAGGGGGCAGAAGTCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGTACGAATCCCCTATCCTATCCATCTGGAAATTTTGGTTC????????????????????????????CCCCTTTCTTCATTTATTAAGGTTGTTTCTTTAT------GAGTGTTGT---------------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTATTCCTATATCATTTTTATGTATGTGAATATGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAATGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGGT------TTTGTCGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTT------TTCACAGA---TACTTTAATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAATGATCCAAATAAAC---AAATTC---TCCGAACATTCATTTCACATTTTG------GGCTATTTTTCAAGTGTGCGGTTAAATCTTTCAGCAGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATATATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTCCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAAAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Amorpha_apiculata_AY391784 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATG{AT}TTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGT{AT}ATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACA?CGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Amorpha_fruticosa_AY391785 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTT?GCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGG?ACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAT?CAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAA?CAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAA?TTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Amphimas_pterocarpoides_JX295894 ATGGAGGAATATCAAGTA---------TATTTAAAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGGTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------ATAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTCTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCAAAAATTACTCCAAAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------CGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTTCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATAGGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATCATT---TTCAGCAAT------GATCTGGTCAAT---CATGAA---------------------------TGA Anarthrophyllum_desideratum_AY386923 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCAC------TTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTCGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATTATTCTAAA------AAAAATCAA------------TTTTTGGGGTATAATAAGAATTTGTATTCTGAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAAGGGACAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTTCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCCATCCATCTCGAAATCTTGGTTCAAGTCTTTCGATATTGGGCGAAAGATGCCCCTTTGTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------AAAAGTAATCTAAGAGTT------------------------TTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTATAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---GCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCACAGAAT------GCGTCCCTTTTGATGTATAAATGGAAAAACTATCTTATCCGTTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCAGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTTTTTGATCTTTCAA------AGGGCTTCTTCTACTTTGAAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Andira_carvalhoi_JX295958 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTT????????????????????????????????TTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCT{CT}CCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCTTTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_galeottiana_AF142681 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGGGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAAAAAAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTAAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCAT------AGTCAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_humilis_JX295960 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAA?????????------???????????????---????????????------????????---???????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------?????????????????????????????????????????????????????????????CATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_inermis_JF501102 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTTAAAGATGCCCCTTTCTCTCATTTATTAAGGTTCTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTAAAA------AAAAAAAATGAGAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGAGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTCTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_legalis_JX295893 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_marauensis_JX295899 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGGAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTCCCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGTTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAATACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_ormosioides_JX295962 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTGGGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAAAAA???????------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????------???????????????---????????????------????????---???????????????????????????????????????????????????????------????????????????????????????????????????????????????????????????????????????????????????????????---??????---????????????????????????------???????????????????????????????????????????????????????????????TTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTCAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Andira_sp_JX295896 ATGGAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATCAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------TGGAATAGTCTTATTCCTCCC------------CAAAAATCGATTTCTACTTTTTCAAAAAAAAAAAAAAATTCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCT{CT}CCTTTTTCTACGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGAGGATATGCAGAAATCTTTCTTATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATACAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTATTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Angylocalyx_sp_AY553715 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTCGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATACTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGCCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTAGTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATGCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Angylocalyx_talbotii_JQ669611 ATGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTCGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATACTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGCCCTTCGATACTGGGTGAAAGATACCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATACTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATGCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTAGTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGTATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Aotus_ericoides_AY386884 ATGGAGGAATACCCGGTA---------TATTTAGAATTTGATAGATCCCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATGTTTATGGAATCGCTTACGGACATGATTTA------AATAGATCCATTTTTGTAAAAAATGTAGGT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCCTTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA------------TTTTTGGCGTATAACAAGGATTTAGATTCTCGAATAATATCCGGTGGATTTGCCGTCGTTGTGGAAATTCCATTTTCCCCGCAATTC------AGCTCTTTT---------TTAGAGGAGACACAAATAGTAAAATCGTATAACAATTTGCGATCAATTCATTCAACTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATATGGGTTCAAACTCTTCGATACTGGTTGAAAGATACCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AGTAGTCTTATTACTCCA------------GAAAAATTGATTTATACTTTTTCAAAA---AGTAATCATCCAAGATTT------------------------TTCTTGTTTCTCTATAATTTTTATGTATGGGAATACGAATCTATCTTCCTTTTTCTACGTAATAAATCATCTTATTTACGATTAAAATCTTTTATCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATGGAACAT------CTTGTAGAAGTATTTTCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTACAAAGAAT------ACACCTCTTTTGATAAAAAAATGGAAATATTATTTTATACATTTCTGGCAATGTCATTTTGATGTTTGGTATCAACCGGAAATGATCCATATAAAC---CAATTC---TCCAAGCATTCATTTTATTTTTTG------GGCTATTTTTCAAACGTGCGGCTAAATCCTTCTGCAGTAAGGAGTCAAATGCTGCAAAGTTCATTTCTAATCGAAAATGTTACGAAAAAGCTTGATACAATAGTTCCAATTATTCGTCTAATTAAATCATTGGCGAAAGCGAAATTTTGTAATGGATTGGGGCATCCCATTAGTAAGTCGATCTGGGCTGATTCACCCGATTTTTTTATAATTGAGCGATTTTTGAAGATCTATAGAAATATTTCTCATTTTTACAAAGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAGTATATACTTAGGCTTTCTTGTGTGAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTCTTGAAAAGATTATCTTCGGGAGAATTTTTGGAAGAATTTGTTACAGAGGAAGAAGAGATTCTTCCTTTGATCTTTCCA------AAAACTTCTTGTACTTTGCAGTGG---GGTTTCTATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCACCAAC------GATCTGGTGAAT---CGTGAA---------------------------TAA Aphanocalyx_cynometroides_EU361855 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATAATTCTAAC------AAAAATCCA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCGTTC---------TTAGAGGAGACAAAAATTGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCCTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGTATTCAAACCCTTCATTATTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTATCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATCGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACTCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGTTCGATATAAAGGAGAATCCATTCTGGTTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGACGGATCCATATAAGC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTCGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCCGAGA---AGGTTCTATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GCTCTGGTCAAT---GATGAA---------------------------TGA Apoplanesia_paniculata_AF270860 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCGA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTTGTAAAATCTTATAAGAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATC????????????????????????CCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAATAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACACCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---TATTCA---------------------------TGA Apuleia_leiocarpa_EU361858 ATGGAGGAATCTCAAATA---------TATTTCGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCAATTTTGGTAGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACATTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTATTCTCAAATAATATCCGAGGGGTTTGCCGTCATTGTGGAAATTCCATTATCTTTACAATTA------------TCC---------TTAGAGGAGGCAAAAATCATAAAATCTTAT---AAATTACGATCAGTTCATTCAATATTTCCTTTCTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTCCGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTCAAAGATGCCTCTTCTTTTCATTTATTAAGACTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCAAATTCAAAAAGTAATCCAAGATTT------------------------TTCTTGGTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTCTGGAGTTCTTTTTGAGCGAGTATATTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCCTATGGTTC------CTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATCCTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATTTTATCAATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTC---TCCGAGCATTCGTTTTACTTTCTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCGTTTATAATAGAAAATTTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCTGATTCATCAGATTTTTATATTATTTACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTCGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAACTTCTTCTACTTGGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TGCATCACT------GATCTGGTCAAT---CATGAA---------------------------TGA Arachis_pintoi_AF203596 ATGAAAGAATATCAAAGA---------TATTTAGAACTAGATAGATCTCCTCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTTAATAGAAATCGATATATTTTGTCGGAAAATGTGGAT------TATGATAAGAAA------TCTAGCTTACTAATTGTAAAACGGTTAATTACTCGAATATATCAACAGAATCATTTGATTATTTTTGATAACGATTCAAGT------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATTGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCATAAAATCTTTTAATAATTTGCAATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAAATTTTTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAA???????????????????????????CCCTTTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTGACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTTCTACATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTTTTTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATGGAGCAT------CTTGTAGAAGTCTTTTCG------AATAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAGATACTATCTCATTTATTTCTGGCAATGTTATTTTGATATTTGGTCTCAACCCCGAATGATCCATATAAAC---GAATTA---TTTGAGAATTCATTTCATTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCTAAACTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATAGAAATTGGTATGAAAAAACTTGATACAATAGTCCCAATTATTCCCTTAATTAGATCTTTAGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCGTTTGGGCCGATTCATCTGATTTTGATATAATTGACCGGTTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGGACTTTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAAAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCGTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCCAATCAATGTAAAT------------------------------TGA Arapatiella_psilophylla_EU361859 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAAGAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTACCAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAAGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATCTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAAATTTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACACGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Archidendron_hirsutum_EU361860 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGGTATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAATACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Arcoa_gonavensis_EU361861 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCAATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCTTTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTCAAAGATGCCTCTTCTTTTCACTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAATATCTTCTGGAGTCCTTTTTGAGCGATTCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCTTATAAAC---AAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTTAAATGTGCGACTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATTTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAACGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTCTATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Astragalus_canadensis_AY386875 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATATCCACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTT------AATAGATCTACATTTGTGGAAAATGTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATCACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCGAATGATTCTAAG------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATTCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTCTTACTCCA------------AAAAAATCGATTTCGACTTTTTCA------AAAAATAATCCGAGATTA------------------------TTCTTATTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTCT---ACCTTAACATTC------TTCAAGGA---TCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGGAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCCTTTTACCTTTTA------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGGCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATCGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCTACTTTGCAG------AAGTTACATGGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGTAAT------GATTTGGTCAAT---CATGAA---------------------------TGA Ateleia_arsenii_GU220019 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTAGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATCTTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAAAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ateleia_glazioveana_GU220020 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATCGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACA------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTATTCGAAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTGATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTTTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ateleia_guaraya_JX295883 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTGTATTCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTCAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ateleia_herbertsmithii_AY386953 ATGGAGGAATATAAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTGTATTCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTC????????????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTCGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTCTGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAGAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ateleia_mcvaughii_GU220021 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTAGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTATTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTTA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ateleia_popenoei_GU220022 ATGGAGGAATATCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAAATTTATTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTTATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ateleia_pterocarpa_GU220023 ATGGAGGAATCTCAAGTA------GTATATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTGTATTCGCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTCAAATCTTATAGTAATTTGCGATCAATTCATTCCATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGTGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TTCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTGTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTTGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Austrosteenisia_blackii_AF142707 ATGGATGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTAACCATGAT------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCGTTTTTGTAGAAAATATAAGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTTATTTGATCATTTTTCCTAATGATTCTAAC------AAAAATCCT------------TTTTGGGGATATAACAACAATTTTTATTCTCAAATAATATCCGAGGGTTTTGTTATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGTTCTTCT---------TTAGAGGAGACAAAAATCGTAAAATATTATAAAAATTTGCGATCCATTCATTCTATTTTCCCTCTTTTCGAGGATAAATTTACATATTTAAATCATGAGTCCGATATACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATCAAAGATGTACCTTTCTTGCATTTATTAAGATTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------CAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCCCGATTT------------------------TTCTTGTTCCTATTTAATTTTTATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAATAAATCCACTCATCTACGATTAAAATCTTTTCGTGTTCTTATTGAGAGAATTTCTTTCTATGCAAAAGTAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTAT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ATGCCTCTTTTGATGAATAAATGGAAATCTTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCTAGAACTATTCATATAAAG---CAATTA---TCCAAGCATTCATTTTACTTTTTG------GGTTATTTTTTAAATGTACAACTAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAACAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTGGGACATCCCATTAGTAAACCGGTCTGGGCCGATTTATCTGATTTTGATATTATTGACCGATTTTTGTGGATATGCAGAAATTTTTCTCAGTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGATATTTTTTCTTTGATCTTTTCA------AAAACTTCTTCCACTTTACAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATCTTCTT---TTCAGCAAT------GATCTAATCAAT---TATTCA---------------------------TAA Baphia_madagascariensis_AY553718 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTGACCAACCGGAC------TTCCTATACCCATTACTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATGGATCCATTTTTTTGGGAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTATTAGTTATAAAACGTTTAATTATTCAAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTATAACAAGAATTCTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCCATTCATTCAATTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATATGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------AAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGTGATCCAAGATTT------------------------TTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATACATATAAAC---CAATTA---TCCAAACATTCATTTCACTCTTTG------GGCTATTTTTCAAATGTGCGTCTAAATCTTTCAGTGGTATGGAGTCAAATGCTACAAGATTCATTTCTAATCGAAATCTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGTTAAAGCGAAATTTTGTAATGTATCAGGACATCCCATTAGTAAGCCGGTCTGGGCTGATTCATCCAATTTTGAAATTTTTGACCGATTCTTTCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAGACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTCTGATCTTCCCA------AAAACTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Baphia_massaiensis_AF142683 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCACCAACCGGAC------TTACTATACCCATTAATGTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTACTAGTTATAAAACGTTTAATTATTCAAATGCATCAACAGAATCATTTGATTCTTTATGTTAATGATTCTAAC------AAAAATCAA------------TTTTTGGGGTATAACAAAAATCTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCTATTCATTCAATCTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATGCCCTATCCTATCCATCTGGAAATATTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATCATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAAAT------CTTGTAGAAGCCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGT---TTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCAACCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTTCGTCTAAATCTTTCAGTGGTATGGAGTCAAATTCTACAAAATTCATTTCTAATTGAATTTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGAGCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCAT??????AGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTTTTGACCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAGAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTCCAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTTTAATCTTTCCA------AAAGTTTCTTCTACTTTACAG------AGATTATATAGAGGTCGGATTTGGCATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Baphiopsis_parviflora_JX295895 ATGGAGGAATATCAAGTA---TA?TTTAATTTAGAACTAGATAGATCTCACCAACCGGAC------TTCCTATACCCATTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATATAGGT---GGTTATGACAATAAA------TCTAGTTTACTAGTTATAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTATGTTAATGATTCTAAC------AAGAATCAA------------ATCTTGGGGTATAACAAGAATTCTTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCTTACAATTA------AGCTCTTTC---------TTAAAGGAGGCAAAAATCGTAAAATCTTATAAGAATTTGCGATCCATTCATTCCGTTTTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAACCCTTCGGTACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTTTTTATTTAT------GAGCATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAGAATCGATTTCTATTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATCATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAAAT------ATTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCGAAGAAT------GCGCTTATTTTGATGAATAAATGGAAATACTATTTTACCCATTTCTGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAATGATCCATATAAAC---CAATTA---TCCAAACATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGTCTAAATCTTTCAGTGGTACGGAGTCAAATGCTACAAAATTCATTTCTAATCAATATTTTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCGTCTAATTAGAGCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGCGATTTTTGACCGATTTTTTCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCTAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAAGAATTCTTGGAAGAATTCTTTACAGAGGAAGAAGAAATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCGGCAAC------GATCTGGTCAAT---AATGAA---------------------------TGA Baptisia_australis_AY386900 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCTTATACCCACTTATTTTTCGTGAGTATATTTATGGACTCGTTTATGGTCATGATTTT------AATGGATCTATTTTTGCGGAAAATGCAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTACTCATGATTCTAAA------AAAAATCAA------------TTTTGGGGTTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCCTCC---------TTAGAGGGGGTAGAAATCATAAAATATTATAATAATTTGCGATCAATTCACTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCGATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTTAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTCTGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCGCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTACAGA---TCCTTTCATTCATTATGTTAGATATCACGGAAAATACATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCCGAACATTCATTTCACCTTTGG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCGGCAGTACGGAGTCAAATGTTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCGATTATTCCTCTAATTAGATTATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAACTTCTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AAAGCTTCTTCTACTTTGCAGAGGCAGAGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Barnebydendron_riedelii_EU361868 ATGGAGGAATTTCAAGTA---------TATTTAGAATTAAATAGGTTTCAGCAATATGAC------CTGCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACGGAATCATTTTATTATTTCTGCTAATGATTGTAAC------AAAAATCCA------------TTTAGTGGGTACAACAAGAATTTTTATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCATATATACGAATCCCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTGTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCA------AACAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTTTCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATGTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATCGAATAT------CTTGTAAAAGTGTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTGT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTACAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCTAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTCTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAACATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTGTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Batesia_floribunda_EU361869 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTTTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTT------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTAATCCA------------AAAAAATGGATTTCTGCTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCTATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAACAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCATTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Bauhinia_galpinii_EU361875 ATGGAGGAATTTCAAGTA---------TATTTAGAAATATATAGATCTCGGAAACATGAC------TTCCTATACCCACTTATCTTTCGTGAATATATTTATACACTTGCTTATGATCGTGGTTTA------AATAACTCCATTTGGGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTACAACAAAAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAGGAAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCTTTTTTCGAGGATCAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTTTCGTCTCTTCATTTATTAAGGATCTTTCTTCAC------CAATATTGTAATTGGAAT------------AGTCTTATTACTCTA------------AGAAAATCGATTTCTACTTTTTCC------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTGCATGTCTTCGAATATGAATCCATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTTTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCTTATGGTTA------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCGATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTGCGACTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATGAAATTATTGGCTAAAGCGAAATTTTGTAACGTATTAGGCCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTATCATTATTACAATGGATCTTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCCTTTTTGAAAAGATTAGGTTCAGAA---TTATGGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCGA------AGAGCCTCTTCTACTTCGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTAGATATTATT---TGCATCAAT------GATTTAGTCAAT---CATGAA---------------------------TGA Berlinia_congolensis_EU361881 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATAATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAAAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCGTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTGGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTGGGATTCAACCCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATAGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGACGGATCCATATAAGC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCCGAGA---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GCTCTGGTCAAT---GATGAA---------------------------TGA Bobgunnia_fistuloides_EU361885 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAGGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCCCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTATTGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCTTCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGGTTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---CATGAA---------------------------TGA Bobgunnia_madagascariensis_AY386940 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGTTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGACAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAAGTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAAGCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAGGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCCCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCTTCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGGTTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---CATGAA---------------------------TGA Bolusanthus_speciosus_AF142685 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATATCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCAGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTG------AGCTCTTCC---------TTAGAAGAGGCAGAAATCATAAAATATTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGGGTTAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TACTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTAATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTTATGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCG??TTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTAAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAG------AGGTTGTATAGGGGCGGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---CATGAA---------------------------TGA Bossiaea_cordigera_AY386888 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCCCGCCAACGGGAC------TTCCTATACCCACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATTCGTTTTTGCGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTGATTACTCGAATGTATCAACAGAATCCTTTTCTTTTTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTTTGGATATAACAAAAATTTAGACTCTCAAATAATATCCAGGGGATTACCCGTCGCCGGGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGATGGGGCAGAAATCGTAAAATCTTATAAGAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AATAGTCTTATTACTCCA------------CAAAAATCGATTTATACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTTTTTTTCCTATATAATTTTTATGTAGGGGAATACGAATATATCTTCTTTTTTCTACGTAACAAATCATCTAATTTACGATTCAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGACGTCTTTTCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGA---TCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAAGAAT------CAACCTTTTTTGATGAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTTATTTTGATGTTTGGTCTCAAGCAGGAATGATCCATATAAAC---CAATTA---TCCAAGTATTCCTTTCACTTTTTA------GGCTATTTTTCAAATGTTCATCTAAATCTTTCCGCGTTAAGGAGTCAAACGCTACATAATTCATTTCTAATCAAAAATGTTACCAAAAAGTTTGATGCAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTATGGGCCGATTCAGCCGATTTTTATATTATTCACCGATTTTTGAGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAATAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTAAAAAGATTAGGTTCGGAAGAATTATTGGAAGAATTTTTTACAGAGGAAGACGAGATTCTTTCTTTGATATTTCAA------AGAGCTTCTTCTACTTTGTGG------GGGTTAGATCGAAGTCGGATTTGGTATTTGGATATTCTT---TTTAGCAAC------GATCTGTTCAGT---CATGAA---------------------------TGA Bowdichia_nitida_JX124395 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAAGAAA------------TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------GGAAGGAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Bowdichia_virgiloides_AY386937 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCCCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGGACTCGCTTATGGTCGTGATTTT------AATAGATCAATCTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATTATTTGATTATTTCTGCTAATGATTCTAAA---AAAAAAAAGAAA------------TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------GGAAGGAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATCTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---CCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAGTTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Brandzeia_filicifolia_EU361870 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAAATAGGTTTCAGCAATATGAT------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTGCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTCAGGGGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGTAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAATCCGTATTTGGTATTTGGATATTTTT---TGCATCAAC------GATCTGGTCAAT---GATGAA---------------------------TGA Brodriguesia_santosii_EU361890 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGAAAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTATTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAAAATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ATCTTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACTCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTCTTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCCTTCGTGTATTAAAACTTTGGGTCGTAAACCCAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGACGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Brongniartia_alamosana_AF142688 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTAGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTG------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTGGGGGTCTAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTGAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGGAATCCAGGATTC------------------------TTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGGTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGAATTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAC------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---TATGAA---------------------------TGA Brongniartia_peninsularis_GQ246148 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTAGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTG------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTGGGGGTCTAACAAGGATTTGTATTCTCAAATAATATCAAAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCGAAAATCATAAAATCCTATACTAATTTGCGATCAATTCATTCCATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATATCCCCTTCTTTCATTTATTAAGGTTATTTTTTTAT------GAGTATTGGAATTGCAAT------------ACTCTTATTACTCCA------------AAAGAATCGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTT------------------------TTTTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTTTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGGT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATTCCAATTTCATTTTGATGTTTGGTCTCAACCAGGAACGGCCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAGTAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTATTTCTTTGATCTTTCCA------AAAGCTTCTTCTATTTTACAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATCTAGTCAAT---TATGAA---------------------------TGA Brownea_coccinea_EU361891 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------ACAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCATAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAAGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGGATTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCCTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCAAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGGCGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATATTTCTCATTATTCCAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGA---AGTTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATATGGTCAAT---GATGAA---------------------------TGA Brya_ebenus_AF270876 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAAAAT------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTCTATTTAAATCGATCCATTTTTGTCGAAAATGTGGATGTGGATTATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTTCTAACGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTCCCCGAAAATTA------ACTTCTTCT---------TTAGAGAAGGTGGAAATCGTCAAATTTTTTAATAATTTGAGATCAATTCATTCCATTTTTTGCTTTTTCGAGGAAAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTTA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGCGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAGCTCTTTTAGCATTCTTTTTGAACGAATCTATTTCTATGCGAAAATAGAACAT------CTTGTAAAAGTATTTTCT------AAGAATTTTTCGTCC---ACCTTATCCTTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTGATCTATTTTAGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCGGAGCATTCATTTCACTTTTTGGGGGGAGGCTATCTTTCAAATGTTCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAACTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCCTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTATAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAGAGTACTGTACGCACTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTAGATATTCTT---TTCAGTAAC------GATTTGATCAATGTAAATGGA---------------------------TAA Cadia_purpurea_JX295932 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATACATTTTTGCGGAAAGTGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTACTGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAAGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAAACGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCTTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAACAAATCCTCTCATTTACGATTAATATCTTTTAACATTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTTTGGCAATGTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCAAAATAAAC---CAATTC---CCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Caesalpinia_pulcherrima_EU361906 ATGGATAAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTTCTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCTGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTACTTTTTTTGAGGAAAGATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTATACCTTTTCA------AAAATTAATCCAAGATTA------------------------TTCCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCTCTCTTTCTTTTTCTCCGTAACAAATCGTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCAATTTCTATGCAAAAATAGAAGAT------TTTATAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCTTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATAAAGGAAAATTAATTTTGGCTTCAAAGAAT------ATGCCCTTTTTGATGACTAAATGGAAATACTATCTTATCCTTTTATGTCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATAGAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATTTCAAATACTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGTCTAAAGCGAGATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGAACGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTGGGCTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTCCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Calliandra_juzepczukii_EU812063 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTC------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTGATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------CTCCTGTTCCTATATAAATTTTATGTATGTGAATACGA?TCCATCT??C?TTTTCTCCGTACCAAATCTTCTTATT?ACGATTAACATCTT?TGGAGTCTTTTTTGA?CGAATCTATTTCTATGCAAAAATAGA?CAT------TTTGTAGAAGTCTTTGAT------AAG?ATTT?CCGTCC---ACCCTATGGTTC------TTCAAGG?---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAGAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Calpurnia_aurea_AY386951 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCATTTTTGCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGTTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAATAAATTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGACGTGCGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACC???????????????????????CCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTCTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACCTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAGAAATCCTCTTATTTACGATTAATATCTTTTAACGTTCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTGCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATCTCATTTTGATGTTTGGTCTCAGCCAGGAACGATCCAAATAAAC---CAATTC---CCCGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGATAC?ATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGACACCCCATTAGTAAGCTGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAATGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTGTACTTTACAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Camoensia_brevicalyx_JX295946 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTCATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATCTT------AATGGATCAATTCTTGTGGAAAATGTAGGT------TATGAAAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAA------AAAGATCAA------------TTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCAATCAATTCATTCAATTTTTCCGTTTTTTGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAGAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGT------GCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAAC---CAATTC---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCGGTGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCGTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAG------AGGTTATATAAAGGTCGGATTTGGCATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---CATCAA---------------------------TGA Camoensia_scandens_JX295919 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTCATTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATCTT------AATGGATCAATTCTTGTGGAAAATGTAGGT------TATGAAAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTGTAAA------AAAGATCAA------------TTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAGTTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCTTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------AAGTATTTTAATTGGAAT------------AGTCTTATTACTCCA------------AAGAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTATGGCTTCAAAGAGT------GCGCCCCTTTTGATGAATAAATGGAAATACTATTTTCTCCATTTATGGCAATGTGATTTTGATGTTTGGTCTCAACCAGAAACCATCCATATAAAC---CAATTC---TCCGAACATTCATTTCACTTTTTG------GGTTATTTTTCAAATGTGCGGTTAAATCTCTCAGTGGTACGGAGTCAAATGTTGGAGAATTCATTTCTAATCGAGATTGTTATGAAAAAGTTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGGCCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCCCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAGATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTAATTTGCAG------AGGTTATATAAAGGTCGGATTTGGCATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---CATCAA---------------------------TGA Candolleodendron_brachystachyum_JX295890 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATGGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCCCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTTC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAGAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATCTTAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAAT??????????????????????????????????GCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------CTTTTCGAAGTATTTGCT------AAGAATTTTTTGTCT---ACCTTATCATTC------TTCAGGGA---TCCCTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGTAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---CATGAT---------------------------TGA Candolleodendron_brachystachyum_JX295929 ??????????????????---------?????????????????????????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------?????????????????????????????????????????????????????????????????????????????????------?????????------------???????????????????????????????????????????????????????????????????????????????????????------?????????---------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????TTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTATTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACCT------CTTTTCGAAGTATTTGCT------AAGAATTTTTTGTCT---ACCTTATCATTC------TTCAGGGA---TCCCTTCATCCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGTAAATACTATCTTATCCATTTATGGGAATGTCATTTTTATGTTTGGTCTCAACCAAAGATGATCCATATAAAC---CAATTA---TCCGGGTATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTAGAATTGAAATTGTTATGAAAAAGTTTGATACAATACTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCCGGGCCGATTCATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCGGAAACCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGATCAAT---CATGAT---------------------------TGA Carmichaelia_williamsii_AY386873 ATGAAGGAATATCAAGTA---------TTTTTAGAACGAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTAGGGAGTATGTTTATGGACTTGCTTATAGTCATGATTTTAATTTTAAGAGATCTACATTTGTGGAAAATTTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAATAAGAATTTTTATTCTAAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAGGGGAGGCAGAAATCGTAAAATCTTCTAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAAGATAATTTTCCATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGGTTGTTTCTTTAT------AATTTTTGTAATAGGAAT------------AGTTTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCGAGATTA------------------------TTCTTATTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTACTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTCCGTCT---ACCTTAACATTC------TTCAAGGA---TCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATTCATTTATGGGAATGTTTTTTTGACGTTTGGTCTCAACCAGGAACGATCCATATAAAA---CAATTA---TCCGAACATTCAATTTACCTTTTA------GGCTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTAGCAAAAAACTTGATATAATAGTTCCAATTATTCCAATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGGCGGTATGGGCCGATTCATCCGATTTTGATATTATTGACAGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATCTGGTTCAGAAGAATTATTGGCAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGCGTCTTCGACTTTGCAG------AAGTTAAATGGAAATAGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATTTGGTCAAT---CATGAA---------------------------TGA Cassia_grandis_EU361909 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAAATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------CAAAATACA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGACAGAAATCGTCAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAGATTTTCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTTTAATTGGAAT------AGGAATAGTCTTATTACTCCA------------AAAAATTGGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTA------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCCTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAAATGTTATGAAAAAGCTTGATACAAAAATTCCAATTATTCCACTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAACAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Castanospermum_australe_JX295891 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGATTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACCAATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCT?????????????????????????????????CCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTTTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTGTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTGGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTCCTTTGCAG------AGGTTATATAGAGGTCAGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Centrolobium_robustum_EU401414 ATGAAACAATATCAAATA---------TATTTAGAACTAGATGGATCTCGCCAACAGAGC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAAAGAAGGCGGAAATCGTAAAATCTTTTCAAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATACCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATTTTCCTTTTTCTACGTAATAAATCCTCTGATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCAATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATACATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTAAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAA?GTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Ceratonia_siliqua_EU361911 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGCTAGATCTCGCCAACATGAC------TTCCTGTACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAAGAGA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAAGCAAAAATCATAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTATTTAT------GAGTATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATACATTTATGGCAATGTAATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTACGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGTTAAATTTTGTAATGGATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTATTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCCACTTTGCAT------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Cercis_canadensis_AY386908 ATGGAGGAATTTCAAGTA---------TATTTAGAACTATATAGATCTCGGCAACACGAC------TTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTTGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCCGCTAATGATTCTACC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTATTTTCAAATAATATCAGAAGGGTTTGCCGGCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCGTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTAAATTTAAAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTTCGGCTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCTAAATTTTGTAACGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCCTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTCCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---CATGAA---------------------------TGA Cercis_gigantea_AY386948 ATGGAGGAATTTCAAGTA---------TATTTAGAACTATATAGATCTCGGCAACACGAC------TTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTTGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCCGCTAATGATTCTACC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTATTTTCAAATAATATCAGAAGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTAAATTTAAAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTTCGGCTAAATCCTTCAGTGGTACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCTAAATTTTGTAACGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAGCACAAAAGTACTGGACGCGCCTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---CATGAA---------------------------TGA Cercis_occidentalis_AY386853 ATGGAGGAATTTCAAGTA---------TATTTAGAACTATATAGATCTCGGCAACACGAC------TTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGGTTA------AATAGCTCCATTTTTGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCCGCTAATGATTCTACC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTATTTTCAAATAATATCAGAAGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCACTCAATATTTCCTTTTTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATTTGGAAATTCTGCTTCAAACCCTTCGCTATTGGTTGAAAGATGTCTCGTCTTTTCATTTATTAAGGATCTTTCTTCAC------AAATATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTAAATTTAAAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTGCATGTCTTCGAATATGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCCTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGGAAAAATAGAACAT------CTTGTAAAAGTCTTTGCT------AAAGATTTTCTGTCG---ACCCTATGGTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCTATTCTGGCTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAGAATCCATATAAAC---CAATTA---TCTGAGCATTCATTCTACTTTTTGTTTTTGGGCTATTTTTCAAGTGTTCGGCTAAATCCTTCAGTGGGACGGAGTCGAATGCTGGAAAATTCATTTATAATAGAAAATGTTAGGAAAAAGCTTAATACAATAGTTCCAATTATTCCTCTAATTAGATTATTGGCTAAAGCTAAATTTTGTAACGTATTAGGTCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTGTGCGGATATGCAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAGTAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCCTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAGGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---CATGAA---------------------------TGA Chamaecrista_nictitans_EU361914 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGCTAGATCTCGTCAATATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTT------AATAACTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACCCGAATGTATCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTGCAAAAAGAATTTGTATTCTCAACTAATATCAGAGGGGTTTGCGGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCT---------TTAGAGGGGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTGCATATTTAACTTATGTGTCCGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTGTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCCACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAACGAATCAATTTTTATGCAAAAATAGAATAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCTGTCC---ACCCTATGGTTC------TTCAAGGA---CTCTTTCATTCATTATGGTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGACTAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCACATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCAGCCGATTTTGATATTATTGACTTATTTTTGCGGAGATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAACAAAAAAGAGTTTGTATCGAATAAAACATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGCTTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAAAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Chapmannia_gracilis_AF203592 ATGAAAGACTATCAAAGA---------TATTTCGAACTAGCTAGATCTCGTCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTGACTAGAAATCGATATATTTTGGCGGAAAATGTGGAT------TATGATAAGAAA------TCTAGCTTACTAATTGTAAAACGTTTAATTACTCGAATATATCAACAGAATCATTTGATTCTTTTTGATAACGATTCAAAT------AAAAATAAA------------TTGTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCATTGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGCAATCGTAAAATCGTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAAATTATTTTCCGATGTACGAATACCCTATCCTATCCATCT??????????????????????????????????????????CCCCCTCTATCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTCTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTAT------AAAAATTTTGCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTTTTTTGATGAATAAATGGAAATACTATCTCATTTATTTCTGGCAATGTTATTTTGATATTTGGTCTCAACCCCGAATGATCCATATAAAC---GAATTA---TTCGAGAATTCATTTCATTTTTTTTGGGGGGGCTATCTTTCAAATGTACGGCGAAACTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAACTTGATACAATAGTCCCAATTATTCCCGTAATTAGGTCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCCATTAGTAAGCCCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGGTATTTGCGGATATACAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGGACTTTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCGG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCCAATCAATGTAAAT------------------------------TGA Chloroleucon_manganse_AY386921 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCTGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAGGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATACATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAGAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Cicer_canariense_AF522079 ATGAAGGAATATCCAGTA---------TATTTAGAACGAGCTAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCAAAATTGT------AATAGATCCAGTTTTGTGGAAAATCTAGGT------TATGACAGTAAA------TATAGTTTATTAATTGTAAAACGTTTAATTAGTCGAATGTATCAACAGAATCATTTGATCATTTCGGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAATCTGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATCCCATTTTTCCTACAATTT------AGCTCTTCC---------TTAAAGGAGTCAGAAAAAATAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATAAGAATACCCCATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTTTTTCCTTTATTACGGTTGTTTCTATAT------AATTTTTGTAATTGGAAT------------AGTTTTATTACTACC------------AAAAAATCGATTTATACTTTTTCA------AAAAGTCATCCAAGATTA------------------------TTCTTGTTCCTCTATAATTTTTATGTATGGGAATATGAATCTATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAAATCTTATAGCGTTTTTTTTGAGCGAATTTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGAAGGTTTTGCT------AAGGATTTTCCATAT---ACTTTAACATTC------TTCAAGGA---TCCTCTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATATTTTTTTGATGTTTGGGCTCAACCAGGAACGATTAAGATAAAC---CAATTA---TCCCAACATTCATTTCACCTTTTA------GGCTATTTTTCAAATGTACGGCTAAATCGTTCAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTCTTAGCAAAAAACTGGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTGG{AG}TATTATTGACCGATTTTTGCGAATATGCCGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATCAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AGAGATTCTTTTACTTTGCAG------AGGTTACATAGAAATCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Cladrastis_delavayi_AY386861 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTGCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTTGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCGTTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Cladrastis_lutea_AF142694 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTGCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCGCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGC?AAAATTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Cladrastis_platycarpa_AY386935 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCGAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCTCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGATAAATATTTCAGTGGTACGGAGTCAAATGCTGAAAAATTCATTTATAATCAAAATTGGTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCTGTCTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Clathrotropis_macrocarpa_JX295930 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTTTTCCCACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCCGTTTTTCGAGGATCAATTTACATATTTAAATTATGCGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTTGAAT------------AGTCTTATTACTCTA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTCTATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAGGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTGCAGAGGAAAAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTCCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Clathrotropis_nitida_JX295951 ATGGAAGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATAGTCATGATTTA------AATAGATCCTTTTGGGTGGAAAATGGGGGT------TATAACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTCCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCAATTTTTCTGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACATAACAAATCCTCTCATTTACGATTAATATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAAGAC------CTTGTAGAAGTCTTGGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTAACATTCATTATGTTAGATATCGAGGAAAATCCATTCTGGTTTCAAAGAAT------GTGTCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTCCTCTT{AT}ATG------GG{AT}TATTTTTCAAATGTGCGGTT{AT}AATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTAGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTAGTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGGTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGCCAAT---CATGAA---------------------------TGA Cojoba_catenata_AY944554 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAG?---------------CGTTT?ATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAGAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGCCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAGATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCAATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAAGAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAAATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTATAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Colophospermum_mopane_EU361915 ATGGAGGAATTTCAAGTA---------CCTTTAGAACTAAAAAAGTTTCAACAATATGAC------CTCCTATATCCATTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATAAGGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAAGGGTTTGCCGTCATTTTGGAAATCCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAAACAAAAATAGTAAAATCTTCT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAAATTCCATATTTAAATTATGTGTCAGATATACGAATACCGTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGTCTCTTCTTTTCATTTTTTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTATACTTTTTCA------AACAGGAACCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTCCAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAGGTCTTTCCT------GAGGATTCTCTGTAT---ACTCTATGGTTT------TTCAAGGA---TCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------AACCCTTTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATTCATATAAAC---CAATTA---TCCGAACATTCATTCTATTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAATGGTACGGAGTCAAATGCTGGAGAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAATACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGAAAGAATTCTTTACCGAGGAAGACGAGATTCTTTCTTTGATTTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTCATATAGAAGT------TGGTATTTGGATATTTTT---TCCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Conzattia_multiflora_AY386918 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGTTGGAAAATCTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AACTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTCAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------TTTGTAGAAGTATTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGACCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATAGAGAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCTGATATGCAGAAACCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Copaifera_officinalis_EU361918 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAAGAAA------TCTAGTTTCTTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGTAGGCACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCCATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTGTTTTTGGATTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTGTAATAGAAAATGTTATCAAAAAACTTGATACAAAAGTTCCAATTATTCCTATAATTCGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Cordeauxia_edulis_EU361920 ATGGAGGAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTACCAACAGAATCATTTGATTATTTCTACTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCCACTTTTTCA------AAAAGTAATCCAAGACTA------------------------TTCCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTTGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCTTATGGTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGGCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATAGAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATTGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTTGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTGGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTCCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Cordyla_africana_JX295923 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGATGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCT---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTTGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTATTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATTCAAGATTA------------------------TTCTTGTTCTTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATTTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTCGATATCAAGGAAAATCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CGATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAACATTCATTTATAATCGAAATTATTATGAAAAAGCTTGATACAATAGTTCCAATTATTCTTATAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACCGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Coursetia_glandulosa_AF543852 ATGGAGGAGCATCAAGTA---------TATTTAAAACTGGATAGATCTTGCCAACAGGAC------TTCCTATACCCACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCATTTTTGCGGAAAATGTAGGT------TATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATCTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTTGAGGTATAATAAGAATATTTATTCTCAAATAATCTCAGAAGGTTTTGCCGTTGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATAATAATTTGCAATCAATTCATTCCATTTTTGCATTTTTTGAGGATAAATTTACATATTTAAATTATTTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGTCCCTTTCTTTCATTTATTAAGATTCTTTCTTTAT------GATTATTGTAATTCGAAT------------AGTCTTATTACTCCG------------AAAAAATGGATTTCGACTTTTTCA------AAAAGGAATCCAAGATTT------------------------TTCTTCTTCCTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTACTGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGCCGTTGCT------AAGGATTTTTTGTCT---ACCTTAACATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTAATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATCTTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCGACTAAATCGTTCAGTGGTACGTAGTCAAATGCTGCAAAATGCATTTCTAATCGAAATTGTTATCAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTCGATCATTGGCTAAAGCGAATTTTTGTAATGTATTAGGGAATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCGGATTTTGATATTATTGACCGATTTTTACGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTGTTGGAAGAATTTTTTATAGAAGAACAAGAGATTGTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTACATAGAAATCGGATTTGGTATTTGGATATTCTTTTTTTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Cranocarpus_martii_AF270875 ATGAAAGAATATCAATTA---------TATTTAGAACTAGATAGATCTCGCCAACAAAAT------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATAGTCATGATTTATATTTAAATCGATCCATTTTTGTCGAAAATGTGGATGTAGATTATGATAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTGTTTCTAACGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTCCCCGAAAATTA------ACTTCTTCT---------TTAGAGAAGGTGGAAATCGTCAAATTTTTTAATAATTTGAGATCAATTCATTCCATTTTTTGCTTTTTCGAGGAAAAATTTACATATTTAAATTTTGTTTTAGATGTACGAATACCCTATCCTATCCATCT???????????????????????????????????????????????????????????TAAGATTGTTTCTTTAT------GAGTATTGTAATCGGAAT------------AGTCTTAGTACTCAA------------AAAAAACTGATTTATACTTTTTTA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTTCTATATAATTTTTATGTATGCGAACACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCAATTACGATTAAGCTCTTTTAGCATTCTTTTTGAACGAATCTATTTCTATGCGAAAATCGAACAT------CTTGTAAAAGTATTTTCT------AAGAATTTTTCGTCC---ACCTTATCCTTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTATTTTGATGAATAAATGGAAATATTATCTGATCTATTTCAGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCGAAGCATTCATTTCACTTTTTTGGGGGAGGCTATCTTTCAAATGTTCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAACTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGACATCCTATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTATAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAGAGTACTGTACGCACTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACGGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AAAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGTAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Crotalaria_incana_GQ246141 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGGTATATCTCGCCAACTGGAC------TTCCTATACCCCCTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCTTTTTTGCAGAACATGTAAAT------TATGACAATAAA------TCGAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTTCTTCTTTCTACTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTACTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATATTATAAAAATTTGCGATCAGTTCATTCCATTTTTCCGTTTTTCGAGGATAAATTGACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCGTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTTTTTCCTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTAAGTAATAAATCGTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGAGAATCTATTTCTATGAAAAAATAGAACAT------TTTGTAGAAGTCTTTGTT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCTTTTTGGCTTCAAGGAAT------GCGCTCCTTTTGATGAATAAATGGAAAAATTATCTTATCCATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCAGGAATGATCAAAATAAGC---CAATTC---TCCGAGCATTCATTTCATCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTCGATACACTAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGGACCCCATTAGTAAGCCAGCCTGGGCTCATTCATCCGATTTTGATATTATTGACCGATTTTTGCGCATATGTAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGTGCTTTTGTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAGGAGATTCTTTCGTTGATCTTTCAA------AGAACTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTT---TTCAGCAAC------GATCTAGTCAAT---CATGAA---------------------------TGA Crudia_choussyana_EU361921 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTGGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTTTGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTGGATTCAAATCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGAAATCCAAGATTG------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCGTTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AATAATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAGGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTTCAGTGTACGGCGAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAATTTCTTTTACTTTGCCGAGA---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GCTCTGGTCAAT---GATGAA---------------------------TGA Cyathostegia_mathewsii_HM347482 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGTCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTGATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GACCTGGTCAAT---CATGAA---------------------------TGA Cyathostegia_mathewsii_HM347483 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGTCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCCA------------TTTTTGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATCAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTAAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTGATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GACCTGGTCAAT---CATGAA---------------------------TGA Cyathostegia_mathewsii_HM347486 ATGGAGGAATATCAAGTA------GTCTATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTTCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGGCAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATAATTTTCTTATTTCTGCTAATGATTCTACC------AAAAATCAA------------TTTTGGGGGTATAACAAAAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCCTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAGTAATTTGCGATCAATTCATTCGATTTTTTCTTTTTTTGAGGATAAATTTACATATTTCAATTATGTCTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATTCATTTTTATGCAAAAATAGAATAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATATTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGAAACGATCCATATAAAC---CAATTA---TCCGAGTATTCGTTTGACTTTTTG------GGTTATTTTTCAAATGTGCGACTAAATCGTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATACTTCCAATTATTCCTCGAATTAGATCATTGGCTAAAGCGAAGTTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGTCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GACCTGGTCAAT---CATGAA---------------------------TGA Cyclolobium_brasiliense_GQ246152 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGGTATAACAAGGATTTGTATTCTCAAATAATAGCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGTCGAAAATGATAAAATCCTATAAGAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTAGTTCAAATC????????????????????????CCCTTCTTTCATTTCTTAAGGTTGTTTTTTTAT------GAGTATTGGAATTGCAAT------------AGTCTTATTACTCCT---------------------------------TCA------AAAAGGAATCCAAGATTT------------------------TTTTTGTTCCTATCTAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATGTTTGGTATCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------GGAGCTTCTTCTATTTTGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---TATGAA---------------------------TGA Cyclolobium_nutans_AF142686 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAT------TTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATAGATCCAATTTTGTGGAAAATGTAGGT------TATGGCAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAA------AAAAATCCA------------TTTTTGGGGTATAACAAGGATTTGTATTCTCAAATAATAGCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGTCGAAAATGATAAAATCCTATAAGAATTTGCGATCAATTCATTCAATTTTTCCATTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATTCATCTGGAAATCTTAGTTCAAATC????????????????????????CCCTTCTTTCATTTCTTAAGGTTGTTTTTTTAT------GAGTATTGGAATTGCAAT------------AGTCTTATTACTCCT---------------------------------TCA------AAAAGGAATCCAAGATTT------------------------TTTTTGTTCCTATCTAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACTTCTTTTAGCGTTCTCTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAAGATTTTTCGTAT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGCCAATTTCATTTTGATGTTTGGTATCAACCAGGAATGACCCATATAAAT---CAATTC---TCCGAGCATCCATTTCAGTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTATGAAAAAATTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCAAATAAGATATATACTTCGACTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTATTTCTTTGATCTTTCCA------GGAGCTTCTTCTATTTTGCAG------AGGTTATATAGAGGTCGAATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTAGTCAAT---TATGAA---------------------------TGA Cytisus_scoparius_AY386902 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCAC------TTCCTATACCCACTAATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCGGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGTTATAATAAAAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AATCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCA------AAAAGTAATCTAAGAGTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTCATTTACAATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---GCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTCGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATTAGTAAGCCGGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTAGGCTTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTGGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATTTGATCAAT---CATGAA---------------------------TGA Dalbergia_congestiflora_AF142696 ATGGAGGACTATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTACGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC---AAAAAAAACCCA------------TTTGGGGGTTATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGGTTTTGCCGTCGTCGCGGAAATTCCATTTTCCAGACAATTACAATTTCGTTCTTCT---------TTAGAAGAGTCGGAAATCATAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTTAATTTTGTTTCAGATGTACAAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGT????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTGATTTCTACTTTTTCA------AAAAGTAATCCAAGAATT------------------------CTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAAGAGATCCTCTTATTTACGATTAAACTCTTTTATCGTTATTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTCTGGCAATGTCATTTTTATGTTTGGTCTCAACCTGGAACGATCCATATAAAT---CCATTATTATCCGAGAATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTCAATTTTTCAGTGGTCCGGAATCAAATGCTAGAAAATTCATTTCTAATCGAAATTCTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTAACCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATTAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCACTTTTTTAAAAAGATTATATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAGGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAA------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAATGTAAATGGA---------------------------TAA Dalea_mollissima_AY391794 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATTTCGCCAACAGGAC------TTCCTATACCCATTTCTTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAAAATGTGGAT------TATGATAACAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTTGGGATATAACAAGAATTTGTATTCTCAAAAAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCCGAAGTCATAAAATCTTATAATAAGTTGCGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGG{AG}AATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAT------CAGTATTG{GT}AATTGGAAT------------AGTTTTATTAAAAAA------------AAAAAATCGATTTCTAGTTTTTCA------AATAGTAATCCAAGATTT------------------------TTCTTATTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCA------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGA---TCCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTATTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTGGGGGAGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTGTTCCTATAATTAGATCATTAGCTAAAGCTAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGAAAGAATTTTTTACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCCACTTTGCAG------AGGTTATATGGAGGTCGAATTTGGTATTTGGATATTATT---TTTAGCAAC------GATCTGTTCAAT---CATGAA---------------------------TGA Dalea_pulchra_AY386860 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCATTTATTTTTCAGGAGTATATTTATGGACTTGTTTATGGTCATGATTTA------AATGGATCCATTTTGGTAGAAAATGTGGAT------TATGATAACAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTTTAAC------AAAAATCAA---------CAATTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCATCGTCGTGGAAATTCCATTTTACTCACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAAGTCATAAAATCTTATAATAAGTTAAGATCAATTCATGCTATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATTTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTAAAAGATCCCCCCCTCTTTCATTTATTAAGGTCCTTTCTTTAC------CAGTATTGTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCGATTTCTAGTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTCTTCCTATATAATTTTTATGTATGTGAATACGAATCGATCTTCCTTTTTCTACGTAAAAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTGGAAGTTTTTCCC------AAGGATTTTTTGTCC---ACCTTATCATTG------TTCAAGGA---TCCCTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCTCTTTATGGCAATGTTATTTTAATGTTTGGTCTCAACCGGGAACGATCTATATAAAC---CAATTA---TCCGATCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTAGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTATAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCTGATTTTGGTATTATTGACCGATTTTTGCGGATCCACAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTGGGTTCAGAAGAATTATTGAAAGAATTTTTTACAGAGGAAGAAGATATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATGGAGGTCGAATTTGGTATTTGGATATTATT---TTCAGTAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Daniellia_klainei_EU361927 ATGGAGGAATTTCGAGTA---------TATTTAGAACTAAATAGGTTTCAGCAATATGAC------CCCCTATACCCACTTATCTTTAGGGAATACATTTATGCACTTGCTTATGATTATGATTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCCGACAATAAA------TCTAGTTTCCTAATTGTAAAACATTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTTCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCGCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCTATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCATAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCCTTTTTTGAGGATCAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAATCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAATATCTTTCTTCAC------GAGTATTGTAATCGGAAC------------ATTAGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTCTGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAAAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGAAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAATTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTGGGGCATCCCATTAGTAGGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTAACTTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAAGAAGACGAGATCCTTTCTTTGATCTTCTCA------AAAACTTCTTTTACTTTGCAGAGG---GGGTTATATAGAGTCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---AATGAA---------------------------TGA Daviesia_latifolia_AY386887 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATAGATCCCTCCAACAATAT------TTCTTATACCCACTCACTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCCCTTTTTGTGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCCCTTGATTATTTCTGTTAATGATTATAAT------CAAAATCCA------------TTATTGGGCTATAATGACAATATTGATTATCAAAGAATATCGGGGGTTTTTGCCGTCGTCGCGGAAATTCCATTTTCCCTACAATTA------AACTCTTAC---------TTAGAGGAGGCCGAAATCTTTAAATCTTATAAGAATTTCCGATCAATTCATTCCATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAACTATGTGTCAGATATACGAATACCCTATCCCATCCATTTGGAAATCTTGATTCAAACCCTTCGATACTGGATTAAAGATGCCCCTTTTTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATAGTTTT------------------ATTAATCCA------------AAAAAATATATTTATACTTTTTCA------AAACCTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTCATATATATGGGAATATGAATTTATCTTCCTTTTTCTACGTAACAAATCCTCTAATTTACGATTCAAATCTTTTTCCGTTATTTTTGAGCGAATCGATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTTTTCT---ACCCTATCATTC------TTCAAAGG---CCACTTTATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCTCTATTGATGAATAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTTATGTTTGGCCTAAACCAGGAACGATCCATATAAAC---CAATTA---TCCAAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATATTTCCGCGGTACGGAGTCAAATGATGCAAAATTCATTTCTAATCCAAAAGGTTATGAAAAAGTTTGATACAATAGTTCCAATTCTTCCTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTTGGGCATCCCATTAGTAAGCCGGTTTGGTCCGATTCATCCGATTTTTATATTATTGATCAATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAGTTTGTATAGAATAAAGTATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTCTACGCATTTTTTTGAAACGATCAGGTTCGGAAAAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAAATTATTTCTTTCATCTTTTCA------AAACCTTCTTCGACTTTTAAG------GGTTTCTATAGAGGTAGGATTTGGTATTTAGATATTCTT---TCTCGCAAT------GATCTGGTCAAT---CATGAA---------------------------TGA Delonix_elata_EU361928 ATGGAGGAATTTCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGTTGGAAAATCTAGGT------TATGACAATAAA------TATAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCAAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AACTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGATGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTATTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTCCGACTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCTGATATGCAGAAACCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAGATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Dermatophyllum_arizonicum_AY386864 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACAGGAC------TTCCTATACCCACTTCTTTTTCAGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCGTTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTTGTTCAAACCCTTCGATACTGGGTCAAAGATGCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AAGGATTTTTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCAGAATGGCTTTAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTACGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTAGTAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGGGAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTTCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Dermatophyllum_secundiflorum_AF142693 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACAGGAC------TTCTTATACCCACTTCTTTTTCAGGAGTATATTTATGGACTCGCTTATGATCATGATTTA------AATAGATCAATTTTAGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTT?GGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCGTTTTCCCTACAATTT------AGCTCTTCC---------TTAGAGCAGGCAGAAATCATAAAATCTTATAAAAATTTGCGATCAATTCATTCAATTTTTCCTTTTTTCGAGGATAAATTTACACATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTTGTTCAAACTCTTCGATACTGGGTCAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTCTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AAGGATTTGTTGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAGATTGTTAGGAAAAAGCTTGAT??AATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGGGAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCA?CCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Derris_laxiflora_AF142715 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCATGAC------TTCCTATACCCACTTCTTTTTCGGGAGTATATTTATGGACTTGCTTATGATCATAATTTA------AATAGATCCATTTTTGTAGAAAATATAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTATGCTAATGAGTTTAAC------AAAAATCCA------------TTTTTTGGATATAACAATAATTTTTATTCTCAAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCCATTTTCCCTACAATTT------CGTTTTTCT---------TTAGGGGGGGGAGAAATCATAAAATATTTTTCTAATTTGCGATCAATTCATTCCATTTTTCCCCTTTTCGAAGATAAATTTACATATTTAAATTATAAGTCAGATATACAAATACCCTATCCTATCCATCTGGAAATCTTGATTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTCATTTATTAAGATTGTTTTATTAT---------TATTGGAATTGGAAT------------AGTCTTATTAATTCA------------AAGAAATCCATTTCTATTTTTTCAAATTCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTATATGTATGGGAATATGAATATATCTTTTTTTTTCTACGTAACAAATCCTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTGTGAAAAAATAGAACAT------CTTGTACAAGTCGTTGAT------AAGAATTTTTTGTAT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTTATTTATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAT---CAATTA---TCCGAACATTCATTTCACTTTTTG------GGCTATTTGTTAAATATGCAGTTAAATCTTTCAGTGGTACGGAGTCAAATGTTTCAAAATTCATTTCTAATTGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCTTCTAATTAGATCATTGATTAAAGCGAAATTTTGTAATTTATTGGGGCATCCTATTAGTAAGTCGGTTTGGACCGATTCATCCTATTTTGATATTCTTGACCGATTTTTGTGGATATGCAGAAATTTTTCTCATTATTACAACGGATGCTCAAAAAGAAGGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCATAAACACAAAAGTACTGTGCGTGCTTTTTTGAAAAGATTAGAATCCGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTTTTTCTTTGATCTTTCAA------AGAACTTCTTCTCCTTTCCAG------AGATTACATAGAGGTCGAATTTGGTATTTAGATATTCTT---TTCAGCAAT------GATCTGATCAAT---CATTTA---------------------------TAA Desmanthus_cooleyi_AY386916 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTGAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATATCGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAAAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTACTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTCTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAAGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTCCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTTTAATTAGATCATTGTCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGATTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Desmodium_barbatum_EU717420 ATGGAGGAAGATCGAGTA---------TTTTTTGAACTCCATAGATCTCGCCACCGGGAC------ATCCTATACCCGTTTTTTTTTCGGGAGTATGTTTATGGACTCGCTTATAGTCGTGGA---------------TCCATTTTTGTAGAAAATGTAGGT------TATAACAAGAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCTTTTGATCGTTATTGGTAATGATTCTAAA------AAAAATCCT------------TTTTGGGGTTATAATAAAAATTATTATTCTCAAATAATATTAGAAGGTTTTGTTGTTGTTCTGGAGATTCTATTTTCCCTACAATTA---TATATATCTTCC---------TTAAAAGAGTTAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAAGATAAATTTATATATTTCAATCATAAGTCAGATATAAGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTTTTTCGTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTCTGACTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATCGATTTCGACTTTTTTT---TTTAAAAGTAATTCAAGATTT------------------------TTCTTACTACTATATAATTTATATGTATGGGAATACGAATCTATCTTTATTTTTCTACGTAACAAATCCTCTCCGTTACGATTAAAATATTTTCGTGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGCAGAAATATTTGTT------AAGAATTTTTCGTAT---ACCTTATTATCC------TTTAAGGA---TCCTTTCATCCATTATGTTAGATATCAAGGAAAATCTATTCTGGTTTCAAAGAAT------ACACCCCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGGCATTTTGATATTTGGTCTGAACCAGGAACGATCGATATAAAC---CAATTA---TCCCAGCATTCATTTCACTTTTTG------AGTTATTTTTTAAGTATTAGGCTAAATCTTTCAGTGGTACGAAGTCAAATGGTACAAAATTCATCTCTAATAAAAATTGTTATGAAAAAACTTGATACAATAGTTCTAATTATTCCTCTAATTAGATTATTGGCTAAAGCAAAATTTTGTAATGTATGGGGTCATCCCATTAGTAAGCCAATTTGGGCCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCGAATATGTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAAACTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTTGTAAACACAAAAGTACTGTGCGCACTTTTTTGAAAAGATTGGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAGGATATTTTTTCTTTTATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATATAGAGGTCGCATTTGGTATTTGGATATTCTT---TTCAGAAAT------GATTTGGTCAAT---CATTCA---------------------------TAA Detarium_macrocarpum_EU361929 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGCAAAATATAGGT------TCTGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGCACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCAATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATAAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTGTTTTTGGATTATTTTTCCAGTGTACGACGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATAGAAAATGTTATCAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGTCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Dialium_guianense_EU361930 ATGGGGGAATCTCAAATC---------TATTTTGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAATATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCAATTTTGGTGGAAAATGTGGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTTGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTGTGGAAATTCCATTTTCCTTACAATTA------------TCC---------TTAGAGGAGGCAAAAATCATAAAATCTTAT---AAATTACGATCAATTCATTCAATATTTCCTTTCTTCGAGGATAAATTTACATATTTAAATTATGTGGCAGATGTCCGAATACCCTATCCTATTCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTATTCCA------------AAAAAATCTTGGATTACTTTTTCAAATTCAAAAAGTAATCCAAGATTT------------------------TTCTTGGTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATATTCTGGAGTTCTTTTTGAGCGAGTATTTTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCCTATGGTTT------CTCAAGGA---CTCTAACATTCATTATGTTAGATATCAAGGAAAATCCATCCTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGATCCATATAAAC---CAATTA---TCCGAGCATTCGTTTTACTTTCTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTACAAAATTCATTTATAATAGAAAATTTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAGATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAA?GTACTGTACGCGCTTTTTTGAAA?GATTAGGTTCAGAA---TTTTTGGAAGAATTCTTT????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????------????????????---??????---------------------------??? Dichrostachys_richardiana_AF521823 ??????????????????---------?????????????????????????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------????????????ATTGTAAA?CGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGGGGATACAACAAGAATTTTGATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTTCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCTATTATTCCTCTAATTAGATCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTTCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATTAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAAGAAGAAAATCTTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGAAA------AAGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Dicraeopetalum_stipulare_GQ246142 ATGGAGGAATATCAAGTA---------GATTTAGAACTAGATATATCTCGCCAACAGGAC------TTCCTATATCCACTTATTTTTCGTGAGTATATTTATGGACTCGCTTATGTTCATGATTTT------AATGGATCCATTTTTGCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAA------AAAAATCAA------------TTTTGGGGATATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTG------AGCTCTTCC---------TTAGAAGAGGCAGAAATCGTAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTCCGTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATTCTATCCATCTGGAAATCTTGGTTCAAACCTTTCGATACTGGGTGAAAGATGCCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AACAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTCCTTTTTCTACGTAACAAATCCTCTTATTTACGATTAATATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAAGAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGCCATTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCAAATAAAC---CAATTC---TCTGAGCATTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGCGGTACGGAGTCAAATGCTAGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCGTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCGTTAGTAAATCGGTCTGGGCCGATTTATCCGATTTTGATATTATTGACCGATTTTTGCGGATATATAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGTATTTCGTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTTCTTTTTTAAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAATTTCAAAGAACTTCTTCGACTTTGCAG------AGGTTGTATAAGGGCGGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGATCAAT---CATGAA---------------------------TGA Dicymbe_altsonii_EU361932 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCGAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATTAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGATTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCTTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAATCCTTTTTGAGCGAATCTATTTTTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTGACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGACGGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCGGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGGTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGTCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTCTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTATATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTCCCCTCTTTTTTGAAAAGATTAGGTCCAGAA---TTTTTGGAA{AG}AATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAAAGA---AGGTTATATAGAGGCCGTATTTGGTATTGGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Dimorphandra_conjugata_EU361934 ATGGAGGAATTTCAAGTA---------TATTTAGGACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGTTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATAAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATACCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAATATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAGCAT------TTTGTAGAAGTCTTTGAT------AAGAATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATTCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTTATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTGCTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Dinizia_excelsa_JX295860 ATGGAAGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTTGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAT------AAAAATCCA------------TTTTGGGGATACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATAGTAAAATCTTCT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGATACTGGGCGAAAGATGCTTCTTGTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATACAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATATGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTCGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGATTCAAATGTTGGAAAATTCATTTCTAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTCATCTTCCGA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGGGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Dioclea_grandiflora_JX295862 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATGGATCTATTTTTGTAGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGGTCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTTGAGTATAACAATAATTTTTATTCTCAATTAATATTAGAGGGTTTTGTTGTTATCGCGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATATTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATTTAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTGTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATTTTTACTTTTTCAAATTCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AAGAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGA---TCCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATAAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTCTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTAGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAATTTGTATCGAATAAAATATATACTTCGATTGTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATATAAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---CATTCA---------------------------TAA Diphysa_floribunda_AF203575 ATGGAGGAATATCAAATA---------TATTTAGAACTAGATAAATTTCGCCACCAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGGTTTAAATATAAATCGATCCATTTTGATGGACAATGTGGAT------TATGATAAAAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAACCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTGCATTTTCCCGACAATTC------CGTTCTTCTTTAGCT---TTAGAGGAGTCAGAAATCGTAAAATCTTTTAATAAATTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTATATATTTAAATTTTGTTTCAGATTTACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAAGT??????????????????????CCCTCTTCTTGCATTTATTAAGATTGTTTCTTTTT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTAAA------------AAAAAACTTATTTCTACTTTTTCA------AAAAGTAATCCAAGAATT------------------------TTCTTGGTCCTATATAATTTTTATGTATGTGAACATGAATCCATCTTCCTTTTTCTACGTAAGAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCTCCTCTTTTGATGAATAAATGGAAACACTATCTCATCTATTTGTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCGTATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAATCAAATGTTAGAAAATTCATTTCTAATCGAAATTTTAATGAAAAAGCTTGATACAATAGTTCCAATAATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCTGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTTTGATTTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATCTTGTCAATGTAAATGGA---------------------------TAA Diplotropis_brasiliensis_AY386939 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAATAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Diplotropis_ferruginea_JX124397 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGG??????????????????????????????GGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Diplotropis_incexis_JX124401 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Diplotropis_martiusii_AY386938 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCTCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Diplotropis_purpurea_JX124418 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAATAAA------------TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Diplotropis_triloba_JX124398 GTGGAGGAATATCAAGTC---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCAATTTTTGTGGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAAAAAAAAAAAAAGAAA------------TTCTTGGGGTATAACAAGAGTTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATTCCATTCTCCCTCCAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTTGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTAAAAGATGCCCCCTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGGACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Dipteryx_alata_AY553717 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATC?????????????????????????????????????????????????????????------??????????????????------------???????????????------------???????????????????????A------AAAAGTAATCCAAGATTC------------------------TTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTAGTCAAT---CATTCA---------------------------TGA Dipteryx_magnifica_JX295871 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAAAAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATATTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????------????????????---??????---------------------------??? Dipteryx_odorata_JX295898 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTAGTCAAT---CATTCA---------------------------TGA Dipteryx_oleifera_JX295933 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATGTTATT---TTCATCAAC------GATCTAGTCAAT---CATTCA---------------------------TGA Dipteryx_polyphylla_JX295870 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------?????????????????????------???????????????????????????????????????---?????????------????????????---??????---------------------------??? Dipteryx_punctata_JX295869 ATGGAGGAATATCAATTC---------TATTTAGAACTGGATAGATCTCTCCAACAGGAC------TTCCTATACCCACTTATTTTTCAGGAGTATATTTATGCACTTGCTTATGGTCATGATTTA------AATAGCTCCATTTTGGTGGAAAATAAGGGT------TATGACAATAAA------TCTAGTTTACTAATTATAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTAATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCTACAATTA------AGATCTTTT---------TTAGAGGAGGAAGAAATCGTAAAATCTTACAATAATTTGCGATCAATTCATTCTATTTTTCCTTTTTTGGAGGATCAATTTACATATTTCAATTTTGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTTATTTATTAAGGTTGTTTCTTTAT------GAATATTATAATTGGAAT------------AGTCTTATTACTCCA------------AAAAACTTGATTGCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTTCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTTTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ATCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCTCTTTTAATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTA------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGAAGTCAAATGCTGGAAAATTCATTTATAATCGAAATTGTTATAAAAAAGCTTGATACAAGAATTCCAATTATTCTTCTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTTTTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGGTTTTTGCAGATATGCAGAAATCTTTTTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATAGTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGACTAGGTTCAGAAGACTTATTTGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTAATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTAGTCAAT---CATTCA---------------------------TGA Diptychandra_aurantiaca_EU361935 ATGGAGGAATTTCAAGTA---------TATTTAGAACCAGATAGATCGCGCCAACATGAC------TTCCTATACCCACTTTTTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGGTTA------AATGGATCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTAATCGAATGTATCAACAGAATCATTTGATTGTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCATCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCGTCC---------TTAGAGGAAGCAGAAATCGTAAAATCTTCT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAATATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGGAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGGAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTACGTAGCAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGAAAAAATAGAACAT------TTGGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTTTGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAACATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATATTTCTCATTATTACAACGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCG------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Discolobium_psoraleifolium_AF270874 ATGAAGGAATATCAAATA---------GATTTAGAACTAGATAGATCCCGCCAACCGAAC------CTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCCATGGTCATGATTTAAATTTAAATCGACCCATTTTGGTGGAAAATGTAGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTGTTTTTGCTAACGATTCGAAC------AAAAATCAA------------TTTAGAGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCATTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCCTCT---------TTCGAGGAGGCAGAAATCGTAAAATCTTTTAAAAATTTGCGATCAATTCATTCGATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCT??????????????????????????????????????????????????????????????????????CTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTTTTACTCAA------------AAAAAACTGTTTTCTAATTTTACA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTAGAAGTCTTTTTA------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATGCATTTTGGCTTCAAAGAAT------GCGCTTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTATGGCAATGTCATTTTGATGTGTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGAGAGGTTATCTTTCAAATGTGCGGTTAAATTTTTTAGTGGTACGTAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAAAAGTTCCAATTATTCCTTTAATTCGATTTTTGGCTAAAGTGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAACCCGTTTGGACCGATTCATCCGATTTTTTTATTATTCCCCGATTTTTGCAGATATACAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAATGTAAAAGGA---------------------------TAA Distemonanthus_benthamianus_EU361936 ATGGAGGAATCTCAAATA---------TATTTCGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATACACTTGCTTATGATCATGGTTTA------AATAGTTCAATTTTGGTAGAAAATGTAGGT------TATGACAAAAAA------TCTAGTTTACTAATTGTAAAACATTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATAAA------------TTTTTGGGGTACAACAAGAATTTGTATTCTCAAATAATATCCGAGGGGTTTGCCGTCATTGTGGAAATTCCATTATCTTTACAATTA------------TCC---------TTCGAGGATGCAAAAATCATAAAATCTTAT---AAATTACGATCAGTTCATTCAATATTTCCTTTCTTCGAGGATAAATTTCCATATTTAAATTATGTGTCAGATGTCCGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAAGCCTTCGCTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGACTCTTTCTTTAC------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGGTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCGTCTCATTTACGATTAACATCTTCTGGAGTTCTTTTTGAGCGAGTATATTTCTATGGAAAAAGAGAGCAT------CTTGTAGAAGTCTTTGCT------AATGATTTTCCGTCT---ACCCTATGGTTC------CTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATCCTGGCTTCAAAGAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTGTGTTTGGTCTCAACCAGGAAGGACCCATATAAAC---CAATTC---TCCGAGCATTCATTTTACTTTCTG------GGCTATTTTTCAAAAGTCCGGCTATATCCTTCAGCGGTACGGAGTCAAATGCTGGAAAATTCGTTTATAATAGAAAATTTTATGAAAAAGCTCGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCGAAATTTTGTAACGTATTAGGGCACCCCATTAGTAAGCCAGTCTGGGCTGATTCATCAGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTTTTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAAATTCGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTCCCA------AGAACTTCTTCTACTTGGCAG------AGGTTATATAGAAGTCGGATTTGGTATTTGGATATTATT---TGCATCACT------GATCTGGTCAAT---CATGAA---------------------------TGA Disynstemon_paullenoides_GU951670 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCACCAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTGTGGTCATGATTTA------AATAGATCCATTTTTGTAGAAAATGTAGGT------TATGACAATAAA------TTTAGTTTACTAAATATAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCCAAC------AAAAATCCA------------TTTTGGGGGTATAACAAAAATTTTTATTCTCAAATACTATTAGAGGGTTTTGTTGTCGTCGTGGAAATTCCTTTTTCCCTACAATTT------AGCTCTTCC---------TTAAAGGAGGTAGAAATCGTAAAATCTTATAAAAATTTGCGATCGATTCATTCCATTTTTCCCTTTTTTGAGGATAAATTTACATATTTAAATTATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTTTCTTTCTTTCATTTATTAAGGTTGTTTTTTTAT------TACTATTGTAATTGGAAT------------AGTCTTATTACTCCC------------CAAAAATTAATTTATACTTTTTCA---TCAAAAAGTAATCCGAGATTT------------------------TTTTTGTTCCTATATAATTTATATGTATGGGAATACGAATATATCTTTCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTTGCGTTCTTTTTGAGCGAATTTATTTCTATACAAAAATAGAATAT------CTTGTAGAAGTTTTTGCT------AAGGATTTTTCGTAT---CCCTTATCATTT------TTCAAAGA---TCCTTTCATCCATTATGTTAGATATCAAGAAAAATCTATTCTGGTTTCAAAAAAT------ACGCCTCTTTTGATCAATAAATGGAAATACTATTTTATCCATTTTTGGCAATGTCATTTTGATGTTTGGTCTCAATCAGAAACGATCCATATAAAC---CAATTA---TCAAAGCATCCATTTCACTTTTTG------GGCTATTTTTTAAATGTGCGGATAAATCTTTCAGTGGTACGGAGTCAAATGTTGCAAAATTCATTTCTAATCGAACTTGTTATGAAAAAGCTTGATACAAGAGTTCCAATTATTCTTTTAATTAGATCATTAGCTAAAGCGAAATTTTGTAATGTATTCGGGCATCCCATTAGTAAGTCGATCTGGGCCGATTTATCCGATTTTGATATTATTGATCGATTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAAAGGATCCTCAAAAAAAAAGAGTTTGTATCGGATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTCCGCGCTTGTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACCGAAGAAGAACAGATTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTAGTTTACAG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTCTT---TTAAGCAAC------GAATTAGTCAAT---CATTCA---------------------------TAA Dolichos_trilobus_AY582976 ATGGAGCAATATCAAGCA---------TATTTAGAACTCCGTAGATCTCGATACCAGGAC------ATCCTATACCCACTTTTTTTTCGGGAATCTATTTATGGACTAGCTTATGGTCATGAG---------------TCCATTTTTATAGAAAATGTAGAT------TATAACAATAAA------TTTAGTTTACTAATTGTCAAACGTTTAAGTACTCGAATGTATCAACAGACTCATTTCATTCTTTTTGCTAACGATTCTAAC------AAAAATATT------------TTTGTGGGTTATAACTATAATTGGGTTTCTCAAAAAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCTCTACAATTA---TTTAACTCTTCC---------TTAAGGGGATTAGAAATCGTAAAATCTTATAAAAATTTGCAATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTTATATATTTAAATCATAAGTCAGATATACGAGTACCTTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTAATAAGGTTGTTTTTTTAT------TACTATTATAGTTGGAAT------------AGTCTTTTTACTCCA------------AAAAAATTGATTTCTACTTTTTTT---TCAAAAAGGAATCTAAGAATT------------------------TTCTTGTTCCTATATAATTTCTATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAATAAATCCTCTCAGTTACAGTTAAAACATTTTCGCGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTACT------AAGAATTGTTCATAT---ACCTTATCATTC------TTTAAGGA---TACTTTCATCCATTATGTTAGATATCAAGGAAAATCAATTCTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAAGAAATGCAAATACTATTTTATCTATTTATGGCAATATCATTTTGATATTTGGGCTGGACCGGAAACGATCCATATCAAC---CAATTA---TCTCAGTATTCATTTCACTTTTTA------GGCTATTTTTTAAGTATTCCGCTAAATCTTTCAGTAGTACGAAGTCGAATGTTGCAAAATTCATTTCTAATAAAAATTTTTATCAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATGAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTGGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTCTCTGATTTTGATATTCTTGACCGGTTTTTGCGGATATGCAGAAATTTTTCTCATTATTACAAAGGATCCGCAAAAAAAAAGAGTTTCTTTCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGTGCGCACTTTTTTGAAAAAATTAAGTTCAGAAAAATTATTGGAAGAATTTTTTACA---GAAGAAGATCTTTTTTCTTTGATTTTACCA------AGAACTTCTTTTACTTTGCAG------AGGTTTTATAGAGGTCGGGTTTGGTATTTGGATATTTTT---TTCAGAAAC------GATTTCGTCAAT---CATTTC---------------------------TAA Dussia_lanata_JX295925 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Dussia_lehmannii_JX295924 ??????????????????---------?????????????????????????????????------???????????????????????GGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Dussia_macroprophyllata_AY386903 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGCTCAATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTTTTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATCATTTTCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTGTCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCTTTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATGGAAATTGTTATGAAAAAGCTTGATACAATAGTTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGTTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCATCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Ebenopsis_ebano_AF274123 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTG?AAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGTTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTGCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACTCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTACGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGTTTTTTTTGAAAAGATTAGGTTCTGAA---TTACTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGGGGTCGTATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Endertia_spectabilis_EU361943 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTATTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGTTAATGATTCGAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGATTTGCCGTCATTCTGGAAATTCCATTTTACCTACGATTA------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTA---ATT---CTTCAT------GAGTATTGTAATTGGAAC------------ATTATTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCTTATATAATTTTTATCTATGTGAATACGAATCGATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTCCT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCTATTCTGGCTTCTAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCGTATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTCTTTTTCCAGTGTACGGCGAAATACTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGAGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCCGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGATGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Entada_abyssinica_AF521829 ??????????????????---------?????????????????????????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------????????????ATTGTAAA?CGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGCTTGCCGTCACTGTGGAAATTCCATTTTCCCCACAATTA------ATCTCTTCT---------TTAGAGAAGGCCGAAATAATAAAATCTTAT---AATTTACGATCAGTTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCCGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTGTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATACATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGTGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCGTTTATACTGGAAAATTGGATGAAAAAGCTTGATACAATAATTCCCATTATTCCTCTAATTAGATCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGTCCGATTCATCCGATTTGGATATTATTGAAAGATTTTTGCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGACGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCGG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Enterolobium_cyclocarpum_AY650277 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTAAAAATACCCTACCCTATACATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGTTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTCTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTTTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Eperua_rubiginosa_EU361947 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAACTCC---------GAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTCTCAACAAAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGGCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTTGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTGATCTATGTGAATACGAATCTATCTTACTTTTTTTTCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTATTTACT------AAGGATTTTATGTCT---ACCCTATGGTTT------TTCAACGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATTTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATATTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTAATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Errazurizia_benthamii_AY391803 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATATA------------TTTTTGGGGTATAACAAGAATTTTTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTACCTACAATTA------CGTTCTTCC---------TTAGATGGGTCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCAA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATCGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------AACCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCAGTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGTATCCCGTTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTCCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAACAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Errazurizia_megacarpa_AY391804 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATATA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTACCTACAATTA------CGTTCTTCC---------TTAGAGGGGTCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCAA------------AAAAAATCTATTTCTACTTTTTCA------AAAAATAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTTTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATCGCACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------AACCCTCTTTTGATGAATAAGTGGAAATACTATCTTATCCATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTTGGGGGGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGTATCCCGTTAGTAAACCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGGCTTTCTTGTATTAAAACTTTGGTACGTAAACACAAAAGTACTTTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTAGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGTATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Erythrina_cristagalli_AY386869 ATGGAGGAATATCAAGTA---------TATTTAAAACTCCATAGATCTCGCCATCAGGAC------CTCCTATACCCACTTTTTTTTCGGGAGTCTATTTATAGACTCGCTTATGGTCATGGG---------------TCCTTTTTTGTAGAAAATGTAGGT------TATAATAAAAAA------TGGAGTTTACTAATTGTAAAACGCTTAATTACTCGAATGTATCAACAGATTGATTTGATCATTTTTGCTAATGATTCTAAC------AAAAATCCT------------TTTGGGGATTCTAATAAAAATTTTTATTCTCTAATAATATTAGAAGGTTTTGTTGTTGTCGTGGAAATTCGATTTTCCTTACAATTT---TGGATCTCTTCC---------TTAAAGGAATTAGAAATCGTAAAATCTTATAATACTTTGAGATCAATTTCTTCCATTTTTCCCTTTTTCGAAGATAAATTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATTCATCTGGAAATCTTGGTTCAAATCCTTCGATATTGGATAAAAGATGTCTTTTTCTTTCATTTTTTAAGGTTGTTTTTTTAT------TACTATTTTAATTCGACT------------AGTGTTTTTACTCCA------------AAAAAAGATATTTCTATTTCTTTT---TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTTTACGTAACAAATCCTCTCAGTTACGGTTCAAATATTTTCGTGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTTTAGAAATATCTGCT------AAGGATTGTTTATAT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATCCATTATGTTAGATATCAAGGAAAATCCATTTTTGTTTCAAAGAAT------ACCCCTCTTTTGATAAAGAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGATCAGAAACAATCTATCTAAAC---CAATTA---TCCCAGCATTCATTTAACTTTTTG------GGTTATTTTTTAAGTATTCGACTAAATGTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATTCAAATTTTTATAAAAAAGCTTGATACAATAGTTCGAATTCTTCCTCTAATTAGATTATTGGCTAAAGAAAAATTTTGTAATATATTGGGTCATCCCATTAGTAAGCCGGTTTGGGTCAATTTATCTGATTTTGATATTATTGACCGATTTTTGCAGATATGTAGAAATTTTTCTCATTATTACAATGGATCTGAAAAAAAAAAGAGTTTGTATCAAATAAAATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGGAAGCATAAAAGTACTGTGCGCACTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACA---GAAGAAGATATTTTTTCGTTGATTTTTCCA------AGAACTTCTTTTACTTTACAG------AGGTTATATAGAGATCGGATTTGGTATTTGGATATTCTT---TTCAGAAAC------GATTTGGTGAAT---CATTCA---------------------------TAA Erythrophleum_suaveolens_EU361949 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATTGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTATCAGATGTACGAATACCCTACCCTATCCATCTGGAAATATTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------TTTTTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGTCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAATCAAATGTTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTTCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCTATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTTTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACATAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAAAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTTTTTCTTTGATCTTCCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Etaballia_guianensis_AF272074 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGA???????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------?????????????????????????????????????????????????????????????????????????????????------?????????------------???????????????????????????????????????????????????????????????????????????????????????------?????????---------????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CCCCCTTCTTTCATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAAGGTATTTCCACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTATAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGAACAT------CTTGTGGAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAACC---CAATTATTATCCGAGCATTCATTTAACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATACAATAGTTCCCATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATT???????CCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATGCTCAAAAAAAAAA?GTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAGGATTAGATTCCGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGATTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Eurypetalum_tessmannii_EU361950 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTCTCAACAAAATCATTTGATTATTTATGCTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATCTATATTCTCAAATAGTATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTCAATTATGTGGCAGATGTACGAATACCTTACCCTATCCATCTGGAAATTTGGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTTGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCAAATTCAAACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTACTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAATATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTATTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAACGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCGACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCGAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTGGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCA{AC}AAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTAGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTAATCTTATCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Exostyles_aff_venusta_JX152591 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGAAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAATCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Exostyles_godoyensis_JX152589 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCCTAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTTA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Exostyles_venusta_JX152590 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCATCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCATAAAATCTTATACTAATTTGCGATCAATTCATTCCATTTTTCCTTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAACCCTTAGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTAGGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGTAAAAATAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAATCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGTCGGTCTGGGCCGATTCGTCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAAAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTTGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATGAA---------------------------TGA Eysenhardtia_orthocarpa_AY386909 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCCGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCATACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAAGAATCCCAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGCATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTGTCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTACGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGCCTTTCTTGTATTAAAACCTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Eysenhardtia_polystachya_EU025905 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGTTTATGATCATGATTTA------AATAGATCCATTTTGGTGGAAAATGTGGAT------TATGACAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTTTGCTAATGATTCTAAC------AAAAATCTA------------TTTTGGGGGTATAACAAGAATTTGTATTCTCAAATAATATCCGAGGCTTTTGCCGTCGTCGTGGAAATTCCATTTTCCATACAATTA------CGTTCTTCC---------TTAGAGGGGGCAGAGGTTGTAAAATCTTATAATAATTTGCGATCAATTCATGCTATTTTTCCCTTTTTCGAGGATAAATTTACATATTTAAATTATGTGTCAGATGTACAAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATCCTTCGATACTGGTTGAAAGATCCCCCCTTCTTTCATTTATTAAGGTTGTTTCTTTAT------CAGTATTTTAATTGGAAT------------AGTTTTATTAATCCA------------AAAAAATCTATTTCTACTTTTTCA------AAAAAGAATCCCAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGCATGTGAATACGAATCTATCTTCCTTTTTCTACGTAAAAAATCCTCTCAGTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTCCT------AAGGATTTTTTTTTT---CGTCTACCTCTACCT---TATCATGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCCTCAAAGAGT------ACCCCTCTTTTGATGAATAAGTGGAAATACTATCTTGTCCATTTATGGCAATGTTATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATTTTTCAAATGTACGGCTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCCATTATTCCTCTAATTAGATCATTAGCTAAAGCGAGATTTTGTAATGTATTAGGGCATCCCGTTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATCCTTCGCCTTTCTTGTATTAAAACCTTGGTTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTTTTTTCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CATTCA---------------------------TGA Faidherbia_albida_AF274129 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCGTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTTTGCACTTGCTTACGATCATGGTTTA------AATAGTTCCATTTTGGTGCAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATAATTCTAAC------AAAAATCCA------------TTTTTGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGACTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTCCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCTTTTTTGAACGAATCTATTTCTATGCAAAAATAGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCTATTTATGGCAATGTTATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTGACTTTTTG------GGCTATTTTTCAAATGTGCAGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATAAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCAAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGAGCGATTTTTGCAGATATGCAGAGATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAACAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAACACAAAAGTACTGTACGGGTTTTTTTGAAAAAATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAGATATTTTTTCTTTGATCTTCTCA------AGAGCTTCTTCTACTTTGCAG------AAGTTATATAGAGGTCGGATTTGGTATTTTGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Fiebrigiella_gracilis_AF203590 ATGAAACAATATCAAATA---------TATTTAGAACTAGATAGATCTCGTCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTCTGGTCATGATTTAAATAGAAATCGATCCATTTTGGTGGAAAATGTGGAT------TCTGATAAGAAA------TCTAGCTTACTAATTGTAAAACGTTTAATTACTCGAATATGTCAACAGAATCATTTGATTCTTTTTGATAACGATTCTAAT------AAAAATCAA------------TTTTGGGGGTATAACAAGATATTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTTGTCATGGAAATTCAATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTAATAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTTTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC?????????????????????????CCCTCTTTCATTTATTAAGATTGT?TATTTAT------CAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTTATTTTTCCTTTTTCA------AAAAGTAATCCGAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTTATTTACGATTAAACTCTTTTAGAGTTCTTTTTGAGCGAATCTATTTCTATACAAAAATAGAACAT------CTTGTAGAAGTCTTTTCT------AATAATTTTTCGTCT---ACCTTATCTTTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAAAAT------GTGCCTCTTTTGATGAATAAATGGAAATACTATCTAATCTATTTTTGGCAATGTAATTTTGATGTTTGGTCTCAACCCGGAACGATCTATATAAAC---CAATTA---TTCGAGAATTCATTTCATTCTTTTTGGGGGGGCTATCTTTCAAATGTACAGCTAAACTTTTCCGTGGTACGGAGTCAAATGCTAGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTCGATACAATAGTCCCAATTATTCCTTTAATAAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAACCCCGTTTGGACCGATTCATCTGATTTTGATATTATTGACCGATATTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAA---AGTTTGTATCGAATAAAATATATAATTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTCGAAGAATTCTTTGCAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGATCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATTTGATCAATGTCAAT------------------------------TGA Gagnebina_commersoniana_AF521836 ??????????????????---------?????????????????????????????????------????????????????????????????????????????????????????????????------??????????????????????????????------????????????------????????????ATTGTAAA?CGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTGGGGGTACAACAAGAATTTTTATTCTCAAATAATATCAGAGGGGCTTGCCGTCAGTGTGCAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGAAGGCAGAAATCATAAAATCCTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACAAATACCCTACCCTATCCATCTGGAAATCTTGATTCAAACCCTTCGATACTGGGTGAAAGATGCCTCCTCCTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAAAGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCCTGTTTCTATATAATTTTTATGTATGTGAATACGAATCCATCTTTCTTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATCTATTTCTATGCAAAAATGGAACAT------TTTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCC---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATAAAGGAAAATCCATTCTGGCTTCAAAGAAT------ACGCCCTTTTTGATGAAAAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTTTGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGTTGGAAAAGTCATTTATAATGGAAAATCTTATGAAAAAGCTTGATACAATAATTCCTATTATTCCTCTAATTAGATCATTGGCTAAAGCTAAATTTTGTAATGTATTAGGACATCCCATTAGTAAGCCGGTCTGGGCGGATTCATCCGATTTTGATATTATTGACCGATTTTTTCAGATATGCAGAAATCTTTCTCATTATTACAACGGATCCTCAAAAAAAAAGAGTTTGTATCGAATCAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCGCGTAAAC?CAAAAGTACTGTACGGGTTTTTTTGAAAAGATTAGGTTCTGAA---TTATTGGAAGAATTCTTTACAGAGGAAGAAAATCTTTTTTCTTTGATCTTCTCA------AGAACTTCTTCTATTTTGCAA------AAGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTGATTTT---------------------------CATCAA---------------------------TGA Galactia_striata_AF142704 ATGGGAGAATATGAAGTA---------TACTTAGAATTAGATAGATCTCGCCACCAGGAT------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGAACTAGCTTATAGTCATGATTTA------AATAGATCCATTTTTGTAGAAAATGTGGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTGTTGAGTATAACAGTAATTTTTATTCTCAATTAATATTAGAGGGTTTTGTTGTTATCGTGGAAATTCCATTTTACCTACAATTT------AGCTCTTCT---------TTTGAGGGGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCTATTTTTTCCTTTTTCGAAGATAAATTTACATATATAAATTATGAGTCATATATACGAATACCCTATCCTATCCATCTTGAAATCTTGGTTCAAATCCTTCGATACTGGATGAAAGATGTCTCTTTCTTTTATTTATTTAGGTTTTTTTTTTAT---------TATTATAATTGGAAT------------AGTTTTATTACGTCA------------AAGAAATCCATTTCTACTTTTTCAAATTCAAAAAGGAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTATATGTATGGGAATACGAATCTATCTTTCTTTTTCTACGTAACAAATCTTCTCATTTACGATTAGAATCTTTTTGCGTTCTTTTTGAACGAATTTATTTCTATGTAAAAATAGAACAT------CTTGTACAAGTCGTTGCT------AATAATTTTTCGTAT---ACTTTATCATTC------TTCAAGGA---TCCTTTCATCCATTATGTTAGATATCAAGAAAAATCAATTCTGGTTTCAAAGAAT------ACGCCTCTTTTGATGAATAAATGGAAATACTATTTGATTCATTTATGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTCACTTTTTA------GGCTATTTTTTAAATGTGCAGTTAAATCTTTCAGTGGTACGAAGTCAAATGTTGCAAAATTCATTTTTAATCGAAATTGTTATAAAAAAGTTTGATACAATAGTTCCAATTATTCTTCTAATTCGATCATTGGTTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAATCGGTCTGGTCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATCTAGAAATTTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGGGTTTGTATCGAATAAAATATATACTTCGATTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTGGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGAGGTTTTTTCTTTGATCTTTCCA------AGAACTTCTTCTACTTTGCAG------AGGTTATATAAAGGTCGGATTTGGTATTTAGATATTCTT---TTCAGCAAC------GATCTGGTTAAT---CATTCA---------------------------TAA Gastrolobium_punctatum_AY386885 ATGGAGGAATACCCAGTA---------TATTTAGAATTTGATAGATCCCGTCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGAATCGCTTACGGACATGATTTA------AATAGATCCATTTTTGTAAAAAATGTAGGT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCAAAAGATTCTTTTTGCTAATGATTTTTAC------AAAAATCAA------------TTTTTGGCGTATAACAAGGATTTAGATTCTCGAATAATATCAGGGGGATTTACCGTCGTTGTGGAAATTCCATTTTCCCCACAATTA------AGTTCTTTT---------TTAGAGGAAACACAAATAGTAAAATCGTATAAAAATTTGCGATCAATTCATTCCATTTTCCCCGTTTTCGAGGATAAATTTTCATATTTAAACTATGTGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATATTGGTTCAAACTCTTCGATACTGGTTGAAAGATACCCCTTTCTTTCATTTATTACGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT---------AGTAGTCTTATTACTCCA------------GAAAAATTGATTTTTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTTCTGTATAATTTGTATGTATGGGAATACGAATCGATCTTCCTTTTTCTACGTAATAAATCATCTCATTTACGATTAAAATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATGGAACAT------CTTGTAGAAGTATTTTCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTCAAAGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTAGCTACAAAGAAT------ACACCTATTTTGATTAAAAAATGGAAATACTATTTTATCCATTTATGGCAATGTCATTTTGATGTTTGGTATCAACCGGAAACAATCAATATAAAC---CAATTA---TACAAGCATTCATTTTATTTTTTG------GGCTATTTTTCAAACGTGCGGCTAAATCCTTCTGCAGTAAGGAGTCAAATGCTGCGAAGTTCATTTCTAATCGAAAATGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGGTCATTGGCAAAAGCTAAATTTTGTAATGGATTGGGGCATCCCATTAGTAAGTCGATCTGGGCTGATTCACCCGATTTTTTTATAATTGAGCGATTTTTTAAGATCTATAGAAATATTTCTCATTTTTACAACGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAGTATATACTTAGGCTTTCTTGTGTGAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGCTTTCTTAAAAAGATTTTATTCGGGAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTCCTTTGCTCTTTCCA------AAAGCTTCTTGTACTTTTCATGGG---GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCACCAAC------GATATGGTTAAT---CTTGAA---------------------------TGA Genista_monspessulana_AY386862 ATGGAGGAATATCAAGTA---------TATTTAGAACTAGATATATCTCGCCAACAGCAC------TTCCTATACCCACTAATTTTTCGGGAATATATTTATGGACTCGCTTATGGTCATGATTTT------AATGGATCTATTTTTTCGGAAAATGTAGAT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTTTTTCGGCTAATGATTCTAAC------AAAAATCAA------------TTATGGGGTTATAATAAAAATTTGTACTCTCAAATAATATCAGAAGGTTTTGCCATCGTCGTGGAAATTCCACTTTCCCTACAATTA------AACTCTTCC---------TCAGAGGAGGCAGAAATCATAAAATATTATAAAAATTTGCGATCAATTCATTCCATTTTTCCGTTTTTTGAAGATAAATTAACATATTTAAATTATGTGTCAGATGCACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAGTCTTTCGATACTGGGCGAAAGATGCCCCTTTGTTTCACTTATTAAGGTTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AACCTGATTACTCCA------------AAAAAATTGATTTCTACTTTTTCG------AAAAGTCATCTAAGAGTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATTTTACTTTTTCTACGTAACAAATCCTCTTATTTACGATTAACATCTTTTAGCGTTCTTTTTGAACGAATCTATTTCTATAGAAAAATAGAACAT------TTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTATCATTCTTCAAGGA---GCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTTTGGCTTCAAAGAAT------GCGTCTCTTTTGATGAATAAATGGAAAAACTATCTTATCCATTTATGGCAATATCATTTTGATGTTTGGTCTCAACCAAGAACAATCCAAATAAAC---CAATTC---TCCGAGCGTTCATTTCACCTTTTG------GGCTATTTTTCAAATGTGCGGTTGAATCTTTCAGCGGTACGGAGTCAAATGCTGGAAAATGCATTTCTAATCGAAATTGTTATGAAAAAGCTTGAGACAATAGTTCCAATTATTCCTCTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCACCCCATCAGTAAGCCGCTTTGGGCCGATTCATCTGATTTTGATATTATTGACCGATTTTTGCGGATATGTAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGTCTCGTAAACACAAAAGTACTATACGTGCTTTTTTGAAAAGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGGTATTTCAA------AGGGCTTCTTCTACTTTGCAG------GGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATTTGGTCAAT---CATGAA---------------------------TGA Geoffroea_spinosa_AF270879 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGCCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTGGTGGAAAATGTGAAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAACTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAT------AAAAATCAA------------TTTTGGGGGTATAACAAGAATTTTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCATGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGGAGGCGGAAATCGTAAAATCTTTTACAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTCGAGGATAAATTTACATATTTAAATTTTGTTTCCGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACC????????????????????????CCCTTCTTTCATTTATTAAGATTGTTTATTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTCA------AAAAGTAATTCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTTTACGTAAAAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCCATTTCTATGCAAAAATGAAACAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAAGCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCCGGAACGATCCATATAAAC---CAATTATTATTCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAACTTGATTCCATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCCATTAGTAAGCCCGTTTGGACCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCTCAAAAAAAAAAGGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTAGAAGAATTCTTTACAGAGGAAGAAGAAATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTTTATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Gilletiodendron_pierreanum_EU361957 ATGGAGGAATTTCAAGTA---------TATTTAGAACGAAATAGGTTTCAGCAATATGAC------CTCCTATACCCACTTCTCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTATTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCGTCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATCAATTTCCATATTTAAATTCTGTGGCAGATATACGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCACACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTCGTATTACTTCA------------AAAAAATCGATTTCTACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGGGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATTCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GATTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Gleditsia_sinensis_AY386930 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCTTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAACTCAATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAAGCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCCTTATTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCT---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAAGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGACTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAATAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTTATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAAAA---TTTTTGGAAGAATTTTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTTTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAA---------------------------TGA Gleditsia_triacanthos_AY386849 ATGAAGGAATTTCAAGTA---------TATTTAGAACTAGATAGATCTCTTCAACATGAC------TTCCTATACCCACTTATTTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCGATTTTGGTGGAAAATCTAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCGAAC------AAAAATCAA------------TTTTGGGGGTACAACAAGAATTTGTATTCTCAAATAATATCAGAGGGGTTTGCCGTCAGTGTGGAAATTCCATTTTCCCTACAATTA------ATCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTAT---AATTTACGATCAATTCATTCAATATTTCCTTTTTTTGAGGAAAAATTTCCATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATCTTGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAGGCTCTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATGGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATATGAATCTATCCTTATTTTTCTCCGTAACAAATCTTCTTATTTACGATTAACATCTTCTGGAGTCCTTTTTGAGCGAATATATTTCTATGCAAAAATAGAACAT------CGTGTAGAAGTCTTTGAT------AAGGATTTTCCGTCT---ACCCTATGGTTC------TTCAAGGA---CCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGTCTTCAAGGAAT------ACGCCATTTTTTATGAATAAATGGAAATACTATCTTATCCATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGAAAGATCCATATAAAC---CAATTA---TCCGAGCATTCATTTTACTTTTTG------GGCTATTTTTCAAATGTGCGGCTAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTATAATCGAAAATGTTATGAAAAAGCTTGATACAACAATTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAACAAAAAGAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCGTTTTTTTGAAAAGATTAGGTTCAAAA---TTTTTGGAAGAATTTTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTACCA------AGAGCTTCTTTTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTTTTTATTTT---------------------------CATCAC---------------------------TGA Gliricidia_brenningii_AF547199 ATGGAGGAGCATCGAGTA---------TATTTAGAACTGGATAGATCTCGCCAACAAGAC------TTCCTATACCCACTTGTTTTTCGGGAGTATATTTATGGACTTGCTTATGGTCATGATTTA------AATAGATCCGTTTTTGTGGAAAATGTAGGT------TATGATAAAAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCAAATGTATCAACAGAATCATTTGATCATTTCGGCTAATGATTCTAAA------AAAAACACA------------TTATTGAGGTATAATAAGAATATTTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTCGTGGAAATTCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATTCTAAAATCTTATAATAATTTGCAATCAATTCATTCTATTTTTCCCTTTTTTGAGGATCAATTTATATATTTAAATTGTGTGTCAGATATACGAATACCCTATCCTATCCATCT??????????????????????????????????????????????????????????????????????GTTTAT------GATTATTGGAATTGGAAT------------AGTCTTATTACTCCTCTTATTACTCCAAAAAAATGGATTTCGACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTCTTCCTATATAATTTTTATGTATGTGAATATGAATCTATCTTCTATTTTCTATGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTCTATGCAAAAAGAAAACAT------CTTGTAGAAGTCGTTGCT------AAGGATTTTTTGTCT---ACCTTAACATTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GTGCCTCTTTTAATGAATAAATGGCAATACTATTTTATCCATTTATGGCAATCTCATTTTGATATTTGGGCTCAACCAGGAACGATCCACATAAAC---CTATTA---TCCGAACATTCATTTTACCTTTTG------GGCTATTTTTTAAATGTGCGGCTAAATCGTTCAGTAGTACGTAGTCAAATGCTGCAAAATACATTTCTAATTGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGAATCCCATCAGTAAGCCGGTCTGGGCCGATTCATCAGATTTCGATATTATTGACCGATTTTTACGGATATGTAGAAATCTTTCTCATTATTATAATGGATCTTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCATTTTTGAAAAGATTAGGTTCAGAAAAATTGTTGGAAGAATTTTTTATAGAAGAACAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTTCAG------AGGTTACATAGAAATCGGATTTGGTATTTGGATATTCTT---TTCAGCAAT------GATCTGGTCAAT---CATGAA---------------------------TGA Glycine_microphylla_EF550008 ATGGAGGAATCTCGAGCA---------TATTTAGAACTCCATAGATCTCGACATCAGGAC------ACCCTATACCCTCTTTTTTTCCGGGAATATATTTATGGACTAGCTTGTGGTCATGGG---------------TCCATTTTTGTAGAAAATGTCGGT------TATAACAATAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGACTCATTTCATCATTTTTGCTAACGATTCTAAC------AAAAATCCT------------TTTAAGGGTTATAACAATCATTTTTATTCTCAAATAATATTAGAAGGTTTTGTTGTCGTCGTGGAGATTCTATTTTCCCTACAATTA---TTTATCTCTTCC---------TTAAGGGAATTCGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTCGAAGATAAACTGATATATTTAAATCATGAGTCAGATATACGAATACCCTATCCTATCCATCTGGAAATCTTGGTTCAAATTCTTCGATATTGGATAAAAGATGTCTCTTTCTTTCATTTATTAAGGTTGTTTTTTTCT------TATTATTATAATTGGAAT------------AGTCTTTTTACTCCA------------AAAAAAAGTATTTCTACTTTTTTT---TCAAAAAGTAATCCAAGATTT------------------------TTCTTGTTCTTATATAATTTATATGTATGGGAATATGAATCTATCTTTCTTTTTCTACGTAACAAATCCTCTCAGTTACGGTTAAAATATTTTCACGTTTTTTTTGAGCGAATTTTTTTCTATGAAAAAATAGAACAT------CTTGTAGAAGTATCTGTT------AAGGATTGTTCATAT---ACCTTATCATTC------TTTAAGGA---TACTTTCATGCATTATGTTAGATATCAAGGAAAATCCATTTTGGTTTCAAAGAAT------ACTCCTCTTTTGATAAATAAATGGAAATACTATTTTATCTATTTATGGCAATGTCATTTTGATATTTGGTCTCGAGCAGGAACGATCCATATAAAC---CAATTA---TCCCAACATTCATTTCACTTTTTG------GGCTATTTTTTAAGTATTCGGCCCAATCTTTCAGTGGTACGGAGTCAAATGTTACAAAATTCATTTCTAATAAAAATTGTTATAAAAAGGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCGAAAGCAAAATTTTGTAATGTATTTGGTCATCCCATTAGTAAGCCGGTTTGGGCCAATTTATCTGATTTTGATATTATTGACCGGTTTTTGCGGATATGCCGAAATTTTTCTCATTATTACAATGGATCCGCAAAAAAAAAGAGTTTGTATCAAATAAGATATATACTTCGGCTTTCTTGTATAAAAACTTTGGCTCGTAAGCACAAAAGTACTGCGCGTACTTTTTTAAAAAGATTAGGGTCAGAAAAATTATTGGAAGAATTCTTTACAGAAGAAGAAGATATTTTTTCTTTGATTTTTCCA------AGAACTTCTTTTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---GTCAGAAAC------GATTTCGTCAAT---CATTTA---------------------------TAA Glycyrrhiza_lepidota_AY386883 ATGAAGGAATATCAAGTA---------TATTTAGAACGAGATAGATCTCGCCAGCAGGAC------TTCCTATACCCACTTATTTTTCGGGAATATATTTATGGAATTGCTTATAGCCATAATTTT------AATAGATCCATTTTTGTGGAAAATGTAGGT------TATGACAATAAA------TTTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATCATTTCTGCTAATGATTCTAAC------AAAAATCCA------------TTTTCGGGGTATAATAAGAATATTTATTCTCAACTAATATCAGACGGTTTTGCCGTCGTAGTGGAAATTCCATTTTTCTTACAATTT------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATAAGAATACCCTATCCTATCCATTTGGAAATCTTAGTTCAAATCCTTCGACACTGGGTGAAAGATGCCCCTTTTTTTCATTTATTACGATTGTTTCTTTAT------AATTTTTGTAATTGGAAT------------AGTCTTATTACTCCA------------AAAAAATCGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTA------------------------TTCTTGTTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAAAATCTTTTAGGGTTTTTTTTGAGCGAGTTTTTTTTTATGCAAAAAGAGAACAT------CTTGTAGATGTTTTTGCT------AAGGATTATTCACCT---ACCTTAACTTTA------TTCAAGGA---TCCTTTCATTCATTATGTTAGATATCAGGGAAAAGCCATTCTGGCTTCAAGGAAT------GCGCCTCTTTTGATGAATAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTA---TCCGAACATTCATTTCACTTTTTA------GGCTATTTTTCGAATGTGCGGCTAAATCGTTCAGTGCTACGGAGTCAAATGCTGCCAAATACATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGAGATTATTGAGCGATTTTTGCGAATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAAAAAAAAAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAGATTAGGTTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCA------AAAGCTTCTTCTACTTTGCAG------AAGTTACATAGAAATAGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGGTCAAT---AATGAA---------------------------TGA Goniorrhachis_marginata_EU361959 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAAATAGGTTTCGGCAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTCCTAATTGTAAAACGTTTAATTACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAT------AAAAAGAAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTT------ATCTCTTTC---------TTAGAGGAGGCAAAAATCGTAAAATCTTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATAAATTTCCATATTTAAATTATGTGTCATATATAAGAATACCTTACCCTATCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAC------------ATTTTTATTACTTCA------------AAAAAATCTATTTCTACTTTTTCAAATTCAAAGAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATTTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCGATTTCTATGGAAAAATGGAATAT------CTTGTAAAAGTCTTTACT------AAGGATTTTCTGTCT---ACCCTATGGTGT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTTATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGGTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAGTATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACAGAGGAAGACGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCATATTTGGTATTTGGATATTATT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Gossweilerodendron_balsamiferum_EU361960 ATGGAGGAATTTCAAGTA---------TATTTAGAACTAAATAGGTTTCAACAATATGAC------CTCCTATACCCACTTATCTTTCGGGAATATATTTATGCACTTGCTTATGATCATGGTTTA------AATAGCTCCATTTTGATGGAAAATATAGGT------TCTGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATCACTCGAATGTCTCAACAGAATCATTTGATTATTTCTGCTAATGATTCTAAC------AAAAATCAA------------TTTTGTGGGTACAACAAGAATTTATATTCTCAAATAATATCAGAGGGGTTTGCCATCATTCTGGAAATTCCATTTTCCCTACGATTA------ATCTCTTTC---------TTAGAGGAGACAAAAATCGTAAAATCGTAT---AATTTACAATCAATTCATTCAATATTTCCTTTTTTTGAGGATCAATTTCCATATTTAAATTATGTGTCAGATATACGAATACCTTACCCTACCCATCTGGAAATTTTGGTTCAAACCCTTCGTTACTGGGTGAAAGATGCCTCTTCTTTTCATTTATTAAAGCTCTTTCTTCAC------GAGTATTGTAATTGGAAA------------ATTCTTATTACTTCA------------AAAAAATCTATTTATACTTTTTCA------AACAGGAATCCAAGATTC------------------------TTCTTGTTCCTATATAATTTTTATCTATGTGAATACGAATCTATCTTCCTTTTTCTCCGTAACAAATCTTCTCATTTACAATTAACATCTTCGGTAGTCCTTTTTGAGCGAATCTATTTCTATGGAAAAATGGAATAT------TTTGTAAAAGTCTTTACT------AAGGATTCTCTGTCT---ACTCTATGGTTT------TTCAAGGA---CCCTTTCATTCATTATGCTCGATATAAAGGAGAATCCATTCTGGCTTCAAAGAAT------ACCCCTCTTGTGATGAATAAATGGAAATACTATCTTATCAATTTATGGCAATGTCATTTTTATGTTTGGTCTCAACCAGGACGGATCCATATAAAC---CAATTA---TCCGAGCATTCATTCTACTTTTTG------GGTTATTTTTCCAGTGTACGGCGAAATCCTTCAGTAGTACGAAGTCAAATGCTGGAAAATTCATTTCTAATAGAAAATGTTATGAAAAAGCTTGATACAAAAGTTCCAATTATTCCTATAATTAGATCATTGGCTAAAGCGAAATTTTGTACCATATTAGGGCATCCCATTAGTAAGCCGGTCTGGGCCCATTTATCCAATTTTGATATTATTGACCTATTTGTGCGAATATGCAGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGAATAAAATATATATTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCTCTTTTTTGAAAAGATTAGGTTCAGAA---TTTTTGGAAGAATTCTTTACCGAGGAAGCCGAGATTCTTTCTTTGATCTTCTCA------AGAACTTCTTTTACTTTGCAGAGG---AGGTTATATAGAGGCCGTATTTGGTATTTGGATATTTTT---TGCATCAAT------GATCTGGTCAAT---GATGAA---------------------------TGA Grazielodendron_riodocense_AF270862 ATGAAAGAATATCAAATA---------TATTTAGAACTAGATAGATCTCGTCAACAGAAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCCTATGGTCATGATTTAAATATAAATCGATCCATTTTTGTGGAAAATGTGGAT------TATGATAAGAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTTTGCTAACGATTCTAAC------AAAAATCAA------------TTT?GGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAGGGTTTTGCCGTCGTTGTGGAAATTCCATTTTCCCGACAATTA------AGTTCTTCT---------TTAGAGAAGGCGGAAATCGTAAAATCTTTTACAAATTTGCGATCAATTCATTCCATTTTTTCCTTTTTAGAGGATAAATTTACATATTTTAATTTTGTTTCAGATGTACGAATACCCTATCCTATCCATCTGGAAATCTTAGTTCAAACCCTTCGATACTGGGTGAAAGATCCCCCCTTCTTTAATTTATTAAGATTGTTTCTTTAT------GAGTATTGTAATTGGAAT------------AGTCTTATTACTCAA------------AAAAAACTGATTTCTACTTTTTCA------AAAAGTAATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAACACGAATCCATCTTCCTTTTTCTACGTAATAAATCCTCTCATTTACGATTAAACTCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAATCGACCAT------CTTGTAGAAGTCTTTTCT------AAGAATTTTTCGTCT---ACCTTATCCTTC------TTCAAGGA---TCCTTTGATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCTCTTTTGATGAATAAATGGAAATACTATCTCATCCATTTCTGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTATTATCCGAGCATTCATTTCACTTTTTTTGGGGGGGCTATCTTTCAAATGTGCGGCTAAATTTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCAAAATTGTTATGAAAAAACTTGATACCATAGTTCCAATTATTCCTTTAATTAGATCTTTGGCTAAAGCGAAATTTTGTAATATATTAGGGCATCCTATTAGTAAGCCCGTTTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCAGAAATCTTTCTCATTATTATAATGGATCCGCAAAAAAAAGAAGTTTGTATCGAATAAAATATATACTTCGGCTTTCTTGTATTAAAACTTTGGCTCGTAAACACAAGAGTACTGTACGCGCTTTTTTGAAAAGATTAGATTCAGAAGAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCCA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTCTT---TTCAGCAAC------GATCTGATCAATGTAAATGGA---------------------------TAA Guianodendron_praeclarum_JX124402 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATGGAGGT------TATGACAATCAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTTAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTGATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTAACAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATGTATTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGTGCTTTTTTGAAAGGATTAGGTTCAGAAAAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATCTTTCAA------AGAGCTTCTTCTACTTTGCAG------AGGTTATATAGAGGTCGGATTTGGTATTTGGATATTATT---TTCAGCAAC------GATCTGGTCAAT---CCTGAA---------------------------TGA Guianodendron_praeclarum_JX124403 GTGGAGGAATATCAAGTA---------TATTTAGAACTAGATAGATCTCGCCAACAGGAC------TTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTCGCTTATGGTCATGATTTA------AATAGATCCATTTTTGTGGAAAATGGAGGT------TATGACAATAAA------TCTAGTTTACTAATTGTAAAACGTTTAATTACTCGAATGTATCAACAGAATCATTTGATTCTTTCTGCTAATGATTCTAAA---AAAAAAAATAAA------------TTCTTGGGGTATAACAAGAATTTGTATTCTCAAATAATATCAGAAGGTTTTGCCGTCGTCGTGGAAATCCCATTTTCCCTACAATTA------AGCTCTTCC---------TTAGAGGAGGCAGAAATCGTAAAATCTTATAATAATTTGCGATCAATTCATTCCATTTTTCCATTTTTGGAGGATCAATTTACATATTTAAATTATGTGTCAGATGTACGAATACCCTACCCTATCCATCTGGAAATTGGGGTTCAAACCCTTCGATACTGGGTGAAAGATGCCCCTTTCTTTCATTTATTAAGGGTGTTTCTTTAT------GAATATTGTAATTGGAAT------------AGTCTTATTACTCCA---------AAAAAAAAATCGATTTCTACCCTTTCA------AGAAGTGATCCAAGATTT------------------------TTCTTGTTCCTATATAATTTTTATGTATGTGAATACGAATCTATCTTCCTTTTTCTACGTACCAAATCCTCTCATTTACGATTAACATCTTTTAGCGTTCTTTTTGAGCGAATCTATTTCTATGCAAAAACAGAACAT------CTTGTAGAAGTCTTTGCT------AAGGATTTTTCGTCT---ACCTTATCATTC------TTTAAGGA---TCCTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAAT------GCGCCCCTTTTGATGAATAAATGGAAATACTATCTTATCCATTTACGGCAATGTCATTTTGATGTTTGGTCTCAACCAGGAACGATCCATATAAAC---CAATTC---TCCGAGCATTCATTTCACTTTTTG------GGCTATTTTTCAAATGTGCGGTTAAATCTTTCAGTGGTACGGAGTCAAATGCTGGAAAATTCATTTCTAATCGAAATTGTTATGAAAAAGCTTGATACAATAGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTGGGGCATCCCATTAGTAAGCCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGGATATGCGGAAATCTTTCTCATTATTACAATGGATCCTCAAAAAAAAAGAGTTTGTATCGATTAAAATATATACTTCGGCTTTCATG