#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 22, 2022; 6:09 GMT TreeBASE (cc) 1994-2008 Study reference: Forrest L., Hughes M., & Hollingsworth P. 2004. A phylogeny of Begonia using nuclear ribosomal sequence data and non-molecular characters. Systematic Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1300] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=69; TAXLABELS Begonia_aequata Begonia_angularis Begonia_ankaranensis Begonia_annobonensis Begonia_aspleniifolia Begonia_balansana Begonia_bogneri Begonia_capillipes Begonia_cinnabarina Begonia_convolvulacea Begonia_crassirostris Begonia_dewildei Begonia_dipetala Begonia_dregei Begonia_dregei_partita Begonia_dregei_ssp_homonyma Begonia_duncanthomasii Begonia_edmondoi Begonia_engleri Begonia_floccifera Begonia_francoisii Begonia_gabonensis Begonia_geranioides Begonia_goegoensis Begonia_grandis Begonia_holtonis Begonia_horticola Begonia_incarnata Begonia_integerrima Begonia_iucunda Begonia_johnstonii Begonia_kisuluana Begonia_letouzeyi Begonia_lobata Begonia_longipetiolata Begonia_loranthoides Begonia_luxurians Begonia_madecassa Begonia_malabarica Begonia_mananjebensis Begonia_mannii Begonia_masoniana Begonia_meyerijohannis Begonia_molleri Begonia_nossibea Begonia_obliqua Begonia_olbia Begonia_palmata Begonia_poculifera Begonia_potamophila Begonia_prismatocarpa Begonia_quadrialata Begonia_roxburghii Begonia_salaziensis Begonia_samhaensis Begonia_scapigera Begonia_scutifolia Begonia_sericoneura Begonia_socotrana Begonia_sp._Pritzelia Begonia_staudtii Begonia_subscutata Begonia_sutherlandii Begonia_symsanguinea Begonia_thomeana Begonia_violifolia Datisca_cannabina Datisca_glomerata Hillebrandia_sandwicensis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2659] TITLE 'nr ITS, 5.8S and 26S DNA'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1541; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Begonia_aequata TCATTGT-CGATTCCTG-C-A{AG}AAT---GCAG-AACAACCTGCG-AACAAGTTTTG----CCAATG---TCTCGCTG----CA{CT}GC----GGGAA-TGGCGCGGG-GCGCGTCAG-AGTTGTAGCC--TGC-GTTT--------GCGCG{AG}AGCCCA--GCC--TCGCG-CGCCTTGTGCCCCC----------------TAACGAACCCC--GGCGCAATTTGCGTCAAGGAA--TCTAAAA-CTT---AGAAC{GT}TTGA---TGCCCT-GCCCCAAATTTTGG-GATGC----AGGGG--TCC-TCTGATCTT-----GATCACATATATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCTCTC-------GCACCCAAAAAAAAA-------------CCAAGTA--CAA---TTCCTC--------GATC--GAAGTA---GACTC---GTGCT-GCTTT--GTTGTC------GTTTT----GTT-GGCCTTT----------GGGTTGTC----GGGGAGGCGGTGTTGGCCTCCCGTGCGGGT----AACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CCAGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--TTTGCGCTTGCGAGACGCGTGCTTGA-GTA-CTCC-TCATC-------GACCC--------TAAATGCGTCGACTC-GTT---------GGACAACACC------AGCGAGAAGGCGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG-----------------------------------------------ATTCCGTCCAA{CG}GCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGAACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGCCTTTGCTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-ATGGCGTGCTTCGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGTTTGCACCGCCGACCGACCTTGATCTTTTGAGAAGGGTTCGAGTGTGAGCATGCTTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGAAG-- Begonia_angularis TCATTGT-CGATTCCTG-C-AGAAT---GCAG-AACAACCCGCG-AAC-TAGTTTGG----CCAATG--TCCCGTTT----CGCAC----GGGA--CGGCGCGAG-GCGTGTTGG-TGCTGTGGCC---GC-CTCT---------GTGCGCGCCCT--GCC--TGGC-AGGCCTCGCGCTCCCC--------------CTAACAAACCCC--GGCGCGAGTAGCGTCAAGGAA--TCTCGAA-CTT---AGAACGCGCC---TCTCTC-GCCCC-GATTTTGG-GACGC----AGGAG--TGT-AGCGAACTT-----GATCATA--CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------ACACCAAAAATAA----------------GAGG------------------------------------------------------------------------------------------------------------TG----GTGGCGGCGACATTGGCTTCCCGTGGGGGC----GACC-TCGC--GGTTGGCCTAAATTTGAGTCCTTGGCGTTATTGCGGCGCGATCGACGGTGGTTTCCAT--GCCCTCGACGAATCAC--ATTGCGCTTGCGAGATGCGTGCTATT-GAA-CTCT-TGGAC-------GACCCTCA------AAT----GTTCC------------------------------------TCAAATGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG--------------------------------CAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGAG-TAGCCGGTCTGCCGATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-ATGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_ankaranensis TCATTTT-CGATTCCTG-C-AAAAA---GCAG-AACAACCCGTG-AACTAGTTAA-----CCATCG---TCCC--------CATGC----GGGAA-TTGCGAGGC--ATGTTCG--AGCTACGACACA----GCTT---------TTGCGTGCCTT--GCC--TTGC-ATGCCTCGCGA----------------ACCATAACGAACCCC--GGCGCGAGTTGCGTCAAGGAC--TCTTTAA-CTG---AGAACGCCGC---TCTCCTAGCCC--GACTTTCG-GATGC----AGGAG--TGC-TGCGAACTT-----GCTTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTC{GT}GCCTGGGCGTCACGCATCG-TAGC-------------CACCCACACCAAAGCTTTGCACACGCTCAATCTCCCGGTTGAGATAGACCTATGCTAT{AC}TTTCTC----------------------------GGGTTTG------------GGCT-GGCAAT----------GGGTTCGAT----GAGGTGGTAGTGTTGGCCTCCCGTGCATGG----AAGT-GGAC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-TGCGCAATGCGATCGACGGTGGTTGCCAT--GCCCTCGGCGAATTAC--ATTGCATTTGCGGGATGCATGTGCGA-GAA-CTCC-TTTGC-------GACCC--------AAT-TGTGCTGCCTC-GTTGGTT----CCTTCGAGAAC------AATGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGG{AC}GGGATCACCCG----------------------------CAGCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGCGTC-TAGCCGGTCTGCCAATCGACTCAGGGCGTGGACCGACGCGGATTGTAGTGGTGGCCCAAGCCTGAGCCTTCGTTGTGCTTGTGGAGACGTCATCACCGCGATCGTGGCTGGCAGCGCGCGCCT-CTGGCGTGCTTCGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGG-------------------------------------------------------------------------------------------------------------------- Begonia_annobonensis GATCATTGTCGATTCCTGCAAAGA----GCAG-AACAACCCGGG-AACTTATTAAAA----CATCGT--CCCC--------TACAA--GGGGGAA-TGGTGCGGT-GCGTGCCA--A-----GGCT---GT-G-TT---------GTGTGTACGC---------GCCCAGCTTTGGCAAGC-------CCCGCGCGCCCTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--ACTTGAA-CTT---AGAACGCATG---TCCTTTTGCCCC-GGCTTCGG-GATGC----AGGGGG--CCTTGTGAACTT-----GATGAAATATCAAAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------CCACCAAAAACCCCT---TGCGG------------------------------------------------------------------------------------------------GATTTGGAT-------GGTC--------GAGGTGGCGACATTGATCTCCCGTGTGG--------C{CT}-TCGC--GGTTGGTCTAAATTAGATTCCTCAGCAT-CGCACCACGCGATGGACGGTGGTTGCAAT--GCCCTTGGTGGATCAC--ATTGCGCTTGTGAGATGCGGATACGAGGAA-ATCC-TTTGC-------GACCC--------TAT-TGTGTCAATTC-GTTGCTAA--CCGTTAGGTGCA------GCGGC{CT}TCGACATCAT-----CGAAGC--GACCCCAGGTC------------------------------------------------AAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGG{CT}GAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTCGGTCGGATGTGGAACGGCGTT-GAGCCGGTCTGCCAATTGACTCGGGGCGTGGACCGACGCGGATTGTGGTGGCGGCCCAAGCCTGGGCCTTTGTTGTGCTCGTGGAGACGTCGTCGCCGCAATTGTGGCTGGCAGCGCGCGCCC-TAGGCGTGCTTCGGCATCAGCGCGCTCCTGGCGTCGGCCTGTGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCTTT-GGGGGT-TGCACCGCCGACCGACCTTGATCTT{CT}TGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_aspleniifolia GATCATTGCCGATTCCTGC-AAAAA---GCAG-AACGACCCGCG-AACTCGTTGGA----CCC------TCTTCCCCACT---------GGGGAG-AGGCGGCGG-TTCCGC{AG}GA-A-----------CGC-GCCCT--------GCGCGAGCCCG--GCG--CCGC-ACGCCTCGCGC----------------ACCCTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TATGTAA-CTG---AGAGCGCGGT---TCCCCC-GCCCC-GGCCCCGG-GAAGC-----GGGG--GTCTCGCGTACTT-----GCTCG----ACACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGC{CT}TTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGGCCCCC-------GCAGCAAAGAGGCCAAGCCCGAGAT-----------------------CCCGAAGCATGCAGGCG-------TC-----TCTGT-------TT-GCG-TCGGGGA--------GCGG--GC-TGGCATCCG----GTTTGGC-----GAGGCGG{AC}{AC}AGGTTGGCCTCCCGCGC{AC}AGC----AGCG-GCGC--GGTTGGTCTAAAGTAGAGTACTCGGCAT-CGCGCGGTGCGATCGGCGGTGGTTCA{CG}TC--ACCCTCGGCGGATCGC--G{AG}TGCACTCGCGGGATGCG-ACGCGGAGAA-CTCC-ATGCG-------GACCC--------TGC-TGATGCCTGCT-----------CGCGGAGATCT--------GCGAGATGGCGCTGC-----CGAAGC--GACCCCAGGTCAGGCG{AG}GATTACCCG---------------------------CAGC{CT}CAAATCGGGCGGTAAATTCCGTC{CT}AAGGCTAAATA-{CT}TGGCGAGAGACCGATAGCAAACAAGTACCG{CT}GAGGGAAAGATGAAAAG{CG}ACTTTGA{AG}AA{AG}AGAGTCAAA{CG}AGTACTTGAAATTGTCGGGAGGGAAGCG{ACG}ATGGGG{GT}CCG{AG}CG{GT}{GT}{GT}C{GT}CCTCGGTC{CG}{CG}AT{CG}TG{GT}A{AT}CGGC{AG}{ACT}--GAG{CT}CGGTCCGCCA{AG}TCGAC{GT}CG-G{CG}C{GT}{CT}GG{AT}CCG{AC}{CT}G{CG}G{CG}ATTG{CT}{AG}{AG}CGG{CG}GGCCCAA{AG}CC{CT}{AG}A{CG}CCT{CT}CG{CT}{CT}GA{AGT}CT{CT}G{CT}{GT}{AG}A{AG}AC-TC{GT}TCGC----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_balansana GATCATTGTCGATTCCTGC-AAAAT---GCAG-AACAACCCGCG-AACTAGTTT-G----CCAACG---TCCCGCCT----CGTGC----GGGAA-CGGCGCGGA-GCGTGTCGG-AGCTGTGGAC--AAC-GCTT---------TCGCGCGGCCT--GCC--TCGCA-TGCCCCGCGCCCCT----------------TAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TCTGAAA-CTT---AGAACGCGGCT-CTCCCCT-GCCCC-GTTTTCGG-GATGC----AGGGG--TCC-TGCGAACTT-----GATCA----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCCAAACAAAAAAA-----------GCAACAC--CGA---TCCATC--------GATC--GTAGCA---GACTG---GTGCT-GCTTC--GTTTGGG-----GTTTTGGTTGCT-GTCCTTT----------GGGCGGTC----GGGGAGGCGACGTTGGCCTCCCGTATGGGC----AACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--ATTG{CT}GCCTGCGAGGCG{GT}GCCGTGGG-GAA-CTCC-TCGAC-------GACCC--------TAA-{CT}GCGTCGACT{CG}-GTC---------GGACAA-ACC------GGCGAGAA-A-G{CT}{CT}AT-----CGAAGC--GA--------------------------------------------------------CAAATCG{AG}GCG-A{AT}A--T{CT}CGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCC-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCT-ACGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTTAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTG-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_bogneri TCATTGT-CGATTCCTG-C-AGAAA---GCAG-AACAACCCGCG-AACTAGTTAA-----CCATCG---TCCC--------CATGT----GGGAA-TTGTGAGGC--GTGTTGG--AGCTGCGACACAA---GCTT---------GCGCGTGCCCT--GCC--TTGC-ATGCCTCGCAA----------------ACCATAACGAACCCC--GGCGCGAGTTGCGTCAAGGAA--TCTTTAA-CTG---AGAACGCCGC---TCTCCTACCCC--GACTTCGG-GATG{CT}----AGGGG--TGC-TGCGAACTT-----GCTTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATCG-TAGC-------------CACCCACACCAAAGCTT-{CG}CAAGCT-------------------------------------------------------------------------------------------------------------------AT----GAGGTGGTAATGTTGACCTCCCGTGAGAGC----AAGT-GCAC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-TGCGCAGTGCGATCGGCGGTGGTTGCCAT--GCCCTCGGCGAATTAC--ATTGCACTTGCGGGACGCATGTTCGG-GAA-CTCC-TTTGC-------GACCC--------TAT-TGTGCTGCCTC-GTTGGTT----CCT{CT}CGAGAAC------CATGAGAAGACGTCAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGATCACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_capillipes --TT-GT-CGATTCCTG-C-{AC}{AC}A{AT}A---GCAG-AACAACCCGCG-AATCCGTTGTG-----CAACGA--ACCC--------CGCAA---GGGGAG-CGGCGAGGA--GTGTTGGGG------------------------------------------------CGC-AAGCCCCGCATTT-------CGCGCGCACCTTAACGAACCCCCCGGCGCGAGTCGCGTCAAGGAA--TATTTAA-CTG---AGAACGCGGC---TCCTCT-GCCCC-GCCTGCGG-GATGC----AGGGGG-CGC-TGCGAGCTT-----GAGAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCGCCAAAAAAA------TGC----------------TCGA--TCTC-TTC----------------------------------------TT-GGGGTGG------------GGCT-GGACTTT----------GGTGGGAC----GAGGGGGCGATGTTGGCCTCCCGTGCGAGC----GATC-GCGC--GGTTGGCCTAAAGTCGAGTCCTCGGCGT-CGCGCAGTGCGACCGGCGGTGGTTTTTA---GCCCTCGGCGAAACAC--GTTGCACGTGCGAGACGCGGTATCGG-GAA-CTCC-CACGC-------GACCC--------TGC-TGCGCTGCCCG-GTC-GTT-----CTCC--GAAC------GACGGGGAGGCGCTAT-----CGAAGC--GACCCCAG-TCAGG{CT}GGGAT-ACC-----CTTAGATCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGTG-C-AAGCCGGTCTGCCAATCGACTCAGGGCGCGGACCGACGCGGATTGCGGCGGCGGCCCAAGCCTGAGCCTTTGTTGTGCTTGCGGAGACGTCGTCGGCGCGATCGTGGCTGGCAGCGCGCGCCATTAGGCGTGCTTCGGCATCGGCGCGCTCCGGGCGTCGGCCTGCGGGTTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTA-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGG-TTCGAGTGAGAGCATGCCTGTCGGGACC-GAAAGATGGTGAACTATGCCTGAGCG------ Begonia_cinnabarina ---TTGT-CGATGCCTG-C-{AC}-A{AG}T---GCAG-AACAACCCGCG-AACTAGTTTG-----CCAACT---TCCCGCTT----CGCGC----GGGAA-CGGCGCGGG-GCGCGTCGG-A{AG}CTGTGGCA--CGC-TGTT---------TTGCGCGCCCT--GCC--TCGC-ACGCCTCGTGCCGCC----------------TAACGAACCCC--GGCGCGAGTTGCGTCAAGGAA--TCTAAAA-CAT---AGAACGCGGC---TCCCTT-GCCCC-GATTTCGG-GATGC----AGGGG--TACCTGCGAACTT-----GATCA----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCAAAAAAGAAAAAA----------CCAAGA--TCAA---TCCCTC--------GATC--CAAGTA---GACTC---GTGCT-GCTTT--GTTGGGG-----GTT-----GGCT-GGCCTTT----------GGGTGATC----GGGGCGGCGACATTGGCCTCCCGTGGGGGC----AACC-TCGC--GGTTGGTCTAAATTCGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCAAT--GCCCTCGACGAATTAC--GTTGCGCATGCAAGATGCACGCTCGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGGCCA-GTCGG---------ACAACACC------GGCTTGCTAACGTTAT-----CGAAGC--GACCCCAGGTCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_convolvulacea ---TTGT-CGATTCCTG-C-{AC}{AG}AAT---GCAG-AACAACCCGCG-AACTAGTTTTG----CCAATG---TCTCGTCT----CGCAC----GTGA--CAGCGCGGG-GCGTGTTGG-TGCTGTGGCT--TAC-CTA{CT}---------GTGTGAGCTCT--GCC--TGGC-ATGCCTCGTGCCCCC----------------TAACAAACCCC--GGCGCGAGTAGCGTCAAGGAA--TATCAAA-CTT---AGAACGCGCC---TCCCTT-TTCCC-TATTTTGG-GATTG----AGGGT--CGT-TGCGTACTT-----GATCAAA--TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGCCCCTCC------ACACAAGTCATAG---------------AGAGGTGGTCAA---GGTCGC--------GATG--AAAGCA---GACTT---GCGCT-GCAAC--GTCGGGA-----CTT-----GGCTTGCTCTT-----------GGGTGATG----GTGGTGGCGACATTGGCTTCCTGTGGGTTC----AATC-TCGC--GGTTGGTCTAAATTTGAGTCTTTGGCGTTCTTGCAGCGCGATCGACGGTGGTTTCCAT--GCCCTCGACGAATCAC--ATTGCGCTTGCGAGTTGCATGCTAGT-GGA-CTGC-TCAAC-------GACCCTCA-----TAA---CGTTA--------------------------------------TGAAACGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG-------------------------------CCA-ATCGGGTGGTA{AT}ATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCTAG-TAGCCGGTCTGCCGATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGATGGCAGCGCGCGCCA-ACGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTAGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_crassirostris ----------------------------GCA--A{AT}CAACCCGCG-AA-TAGTTT-G----CCAACG---TCCC{AG}CCC----CGTGC----GGGAA-CAG{CT}GCGGA-GCACGTCAG-AGTTGTGGA{CT}--AGC-GCTT---------TCGCGCCCC{CT}T--GCC--CTGCA-TGCCC{CT}GCGC--TTC---------------TAACGAACCCC--GGCGCAAGTCGCGTCAAGGAA--TCTGAAA-CTT---AGAACGCGGC---TCCCCT-GCCCC-GATTT{CT}GG-AACGC----AGGGG--TTC-TGCGAACTT-----GATCA----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCCAAACAAAAAAAA----------CCA------------TCCATC--------TATCC-GAAGCT---GACTC---GTGTC-GACTC--GTT-GGG-----GTTTTGGTGGCT-GGCCTTT----------GGGCAGTC----GGGGAGGCGACGTTGGCCTCCCGTACGGGC----AACC-TTGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTCGCAGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--ATTGTGCCTGCGAGGTGCGTCGTGGG-GAA-CTCC-TTCAC-------GACCC--------TAA-TGCGTTGACTC-GTC---------GGACGACAAC------GGCGAGAAGATGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------CCCAAATCGGGCGGT{CG}CATTTCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGTGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGATCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCT-ACGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTTAGGCGCAAGGAAGCTGACTGGCGGGATCCCGTG-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_dewildei GATCATTGTCGATTCCTGCGAAAAAAGAGCAG-AAAAACCCGCG-AACT-GGTTTT-TAAGCACGCGC-TTTCCCAGCCC-GCGGT---GGGGAA-AGGCGGGGC-GTGCTGCG--A--CGAGTTC--CGC-GCCCA--------GCGCGCGGCCG--TTC--GAGC-GCGCCTCGCGC----------------ACCGTCACGAACCCC--GGCGCGAGTCGCGTCAAGGAAA-GATGTAA-CCG---AGAGCGCGTA---TCCCCT-GCCCC-GGACCCGG-GAAGC----AGGGG--TGT-AGCGCGCTT-----GCTAA----CGACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGAAGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGGCCCCC-------GCACCGAAGAGGCCAA---------------------GTTC--CAGCTCC-AGAGGGGGCGGGCG------GTTTG---TCCGC-------TT-GCG-TCGTCG---------GCTG-GGATTTGCGTCTC----GTTCGGA-----GAGGCGGCAAGGTTGGCCTCCCGCGCGAGC----AAGA-GCGC--GGTTGGTCTAAAGTAGAGTGATCGGCAT-CGCGCGGTGCGATCGACGGTGGTTTCCAT--TCCCTCGGCGAATCAC--GTCGCACGCGCGGGATGCG-GCGCGGAGAACACTCCATGGG-------CACCC--------TGC--TGATGA-CGCC-TTCC-----CGCGGGTTCCCC-------CCG{AT}GGAGGCGCTGC-----CGAAGC--GACCCCAGGTCAGG{CT}GGG----------------------------------------CAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTCGGTCGGATGTGGAACGGCGG--GAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATCGCGGCGGCGGCCCAAGCCCGAGCCTTGGTTGAGCTCGCGGAGACGTCGTCGCGGCGATCGTGGGCGGCAGCGCGCGCCA-GCGGCGTGCTCAGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCAGCGGGCCAGCAAACCCGCGAGGCGCAAGGAAGCTGA{AG}TGGCGGGATCCCC{AG}A-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGCGAGC------------------------------------------------ Begonia_dipetala TCATTGT-CGATTCTTG-C-AAAAT---GCAG-AACAACCCGCG-AACTAGTTTTG----CCAACT---TCCCGCCGCCG-CGCGCGCGCGGGAA-CGGCAGGGG-GCGCGTCGG-AGCTGTGGTCCGCGCTGCTTTGCTT----GCGCGCGCCCT--GCC--TCGCG-CGCCTTGTGCCCCC---------------TTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TCTGGAA-CTT---AGAACGTGGC---TCCCCT-GCCCC-GGTTTCGG-GACGC----GGGGG--TCC-TGCGGACTTTT---GATCATAT-AATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------TCACCCAAAAAACACAACC---------CAAAGAT--CAA---TCCCTC--------GAACGAAAAGCA---GACTC---GTGCT-GCCTC--GTTTGGG----GTTTTGTGTTGCTGGGCCTTT----------GGGTGGTTT---GGGGAGGCGACGTTGGCCTCCCGTGCGGGC----AACC-TCGC--CGTTGGTCTAAATTTGAGTCCTCGGCGTCTTTGCGGGGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--GTCGCGCCTGCGGGACGCGCGCTCGG-GAG-CTCC-TCGAC-------GACCC--------TCA-CGCGTCTATTC-GTC---------GGACATTATAT--GCCGGCGGGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGATTACCCG----------------------------CACCCAAA{CT}TGGGCGGTAAATTCCATCCAAGGCTAAATA-TTGGCGAGAG{AG}CC{GT}ATAGCAAACAAGTT{CT}CGCGAGAGAAAGATGAAAAGGACTTTGAGAAATGAGTCAAAGAGTCACT{AG}GAATTTTCG{GT}AGAGAGAAGCGTGATTGGGGCTCGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_dregei TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGCG-AATTAGTTTG-----CCAAAG---TCCCGCCC----CGTGC----GGGAA-CGGCGCGGG-GCGCTTCGG-AGCCGTGGCT--CGT-GCTT---------GCGCGTGCCCT--GCC--TGGA-ACGCCTCGCGCCCC----------------TTAACGAACCCC--GACGCCAGTCGCGTCAAGGAA--TGTATAA-CTC---AGAACGCGGC---TCCCCT-GCCCC-GATTTCGG-GACGC----ATGGGT-GTCTTGCGAACTT-----GATAA----CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATAG-TAGCCCCCC-------GCACCACAAAAAAA-------------CAAGGCCGAGATCG--TTCCTC----GATC-ATC----------------------------------------------------GGCT-GGCCTTT----------GGGTGGTC----GGGGCGGCAATGTTGGCCTCCCGTGCGGGC----AACC-ACGC--GGATGGCCTAAATTTGAGTCCTAGGCGT-CTTGCGGCGCGATCGACGGTGGTTGTCAT--GCCCTCGACGAATTAC--GTTGCGCCTGCGAGACGCGCGCTTGG-GAA-CTCC-TCGAA-------GACCC--------TAA-TGCGTCGGCTC-GTCGG---------AAAAAGCC------GGCGAGCGGGCGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_dregei_partita TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGCG-AACTAGTTTG-----CCAAAG---TCCCGCCC----CGCGC----GGGAA-CGGCGCGGG-GCGCTTCGG-AGCCGTGGCT--CGT-GCTT---------GCGCGCGCCCT--GCC--TGGA-ACGCCTCGCGCCCC----------------TTAACGAACCCC--GACGCCAGTCGCGTCAAGGAA--TGTATAA-CTC---AGAACGCGGC---TCCCCT-GCCCC-GATTTCGG-GACGC----AGGGGTGTCT-TGCGAACTT-----GATAA----CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGT{CT}TGCCTGGGCGTCACGCATGG-TAGCCCCCC-------GCACCACAAAAAAAA------------CAAGGCCGAGATCG--TTCCTC----GGTC-ATC----------------------------------------------------GGCT-GGCCTTT----------GGGTGGTC----GGGGCGGCAATGTTGGCCTCCCGTGCGGGC----AACC-GCGC--GGATGGCCTAAATTTGAGTCCTAGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--GTTGCGCCTGCGAGACGCGCGCTTGG-GAA-CTCC-TCGAA-------GACCC--------TAA-TGCGTCGGCTC-GTCGG---------AAAAAGCC------GGCGAGTGGGCGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_dregei_ssp_homonyma TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGCG-AA{CT}TAGTTTG-----CCAAAG---TCCCGCCC----CGTGC----GGGAA-CGGCGCGGG-GCGCTTCGG-AGCCGTGGCT--CGT-GCTT---------GCGCGTGCCCT--GCC--TGGA-ACGCCTCGCGCCCC----------------TTAACGAACCCC--GACGCCAGTCGCGTCAAGGAA--TGTATAA-CTC---AGAACGCGGC---TCCCCT-GCCCC-GATTTCGG-GACGC----ATGGGTGTCT-TGCGAACTT-----GATAA----CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGC{CT}TT{ACT}TGGCGGAGGGCACGT{CT}TGCCTGGGCGTCACGCATGG-TAGCCCCCC-------GCACCACAAAAAAA-------------CAAGGCCGAGATCG--TTCCTC----GATC-ATC----------------------------------------------------GGCT-GGCCTTT----------GGGTGGTC----GGGGCGGCAATGTTGGCCTCCCGTGCGGGC----AACC-ACGC--GGATGGCCTAAATTTGAGTCCTAGGCGT-CTTGCGGCGCGATCGACGGTGGTTGTCAT--GCCCTCGACGAATTAC--GTTGCGCCTGCGAGACGCGCGCTTGG-GAA-CTCC-TCGAA-------GACCC--------TAA-TGCGTCGGCTC-GTCGG---------AAAAAGCC------GGCGAGCGGGCGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG-----------------------------------------------------------GCTAAATA-TTGGCGAGAGACCGATA{CG}C{AG}{AG}ACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAA{GT}AGTCAAA{GT}AGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCG{GT}T{GT}CGTCC{CT}GGTCGGATGTGGAA{CT}G{GT}C{GT}CG{CT}-------------------------------------------------------------------------------------------------------------------------------------------ATCAGCGTGCTCCAGGC{AG}T{CGT}GG{CG}CTG{CT}GGGCTCCCCATTCGG{CT}CCGTC{AT}TGAAACA{CT}GGACCAAGGAGTCTGACATGTGTGCGAGT{CT}AACGGGCCAGAAAA{AC}{CT}CGTGAGGCGCAAGGAAGCTGACTGGCGGGAT{CG}CCCT{CT}-G{AC}GGGT-TGCACCGCCGAC-GACCTTGATC{GT}TCTGAGAAGGG{AT}TCGAGTG{AT}GAGCA{CT}GCCTGTCGG-ACCCGAAAG--------------------------- Begonia_duncanthomasii TGCGGAAGGATCATTGTCGATTCCT---ACAG-AACGACCCGCG-AACT-GGTTAT-CAACCACACGA-TTCCCCAGCTA-GCGCT---GGGGAA-AGGCGGGGC-ACGCTGGTC-C--CGCATTG--CGC-GCTCC--------GCGCG---------------------CCTCGCCG----------------ACCGCAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--CATAAAA-CTG---AGAGCGCGGA---TCCCCT-GCCCC-GGCTTCGG-GAAGC----AGGGA--TCT-CGCGCGCTT-----GCTCA----CGACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCAGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGTCCCCC-------TCACCGAAGAGGCCAA---------------------ATTC--GAGCACCCAGAGC---AGTGCAG------TC-----TCTGCAC-----TT-GCG-TCGGGC---------GCTT-GGATTTGCAGCTC----GTTTGGA-----GGGGCGTCAACGTTGGCCTCCCGCG-GAGC----AACC-TCGC--GGTTGGTCTAAAGTAGAGTGCTCGGCAT-CGCGCGGTGCGATCGACGGTGGTTTCGTA--GCCCTCGGCGAATTAC--GTCGCAC-----AGATGCG-GCGCGGAGAA-CTCC-ATACG-------GACCC--------TGC--TGATGATTGCC-GGCT-----CGCGGGTTCCCC-------GCGAGAAGGCACTGC-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_edmondoi -CATTGT-CGATGCCTG-C-AGAAT---GCAG-AACAACCCGCG-AACTAGTCTG-----CCACCG---TCCCGCTT----CGCGC----GGGAA-AGGCGCGGG-GCGCGTTGG-TGCATCGGCC---GC-CTCT---------GCGCGCGCCCT--GCC--TCGC-GCGGCCCGCGCCCCC----------------TAACGAACCCC--GGCGCGAGTTGCGTCAAGGAA--TATCAAA-TTC---AGAACGCGGT---TCCCCT-GCCCC-GATTTCGG-GATGC----AGGGG--TCC-TGCGAACTC-----GATCGTCA-TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-CAGCCCCCC-------GCACCCAACAAGAAAGA-------------------CCAA----GTCTC--------GATC--GAAGCG---GACTC---GTGCT-GCTTC--GTCGGGG-----CTC-----GGCC-GGCCCAT----------GGGCGGTC----GGGGTGGAGACATTGGCCTCCCGTGGGGGC----AACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTTCAAT--GCCCTCGACGAACTAC--GTTGCGCTCGCGAGGCGCGCGCTCGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGCCGGCTG-GTCGG---------CTAACGCC------GGCGAGCAGACGCTAT-----CGAAGC--GACCCCAGGTC-----------------------------------------------CAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCCCGGTCGGATGTGGAACGGCGTC-GAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGCGGCGGCGGCCCAAGCCTGGGCCTTTGTTGTGCTCGTGGAGACGTCGTCGCCGCGATCGTGGCTGGCAGC{AG}CGCGCCC-CTGGCGTGCTTCGGCATCGGCGCGCTCCTGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAACTGACTGGC{CG}GGATCCCCTT-G-GGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGCGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCG------ Begonia_engleri GATCATTGTCGATTCCTGC-AAATA---GCAG-AAAAACCCGCG-AATTGGTTAAA-----CATCG---TCCCTCAC-----TTGG----GGGAACGGCGCGGTGAGCACTAA---GGCCGAGGCA--CGT-GCAC---------GCACAAGCTCT--GCC--TGGC-GAGCACCGCGTG----------------CCCTAACAAATCCT--AGCGCGAGTCACGTCAAAGAA--TCTTGAA-CTT---AGAACGCGCA---TCATCT-GCCCT-GGTTTCAG-GATGC----AGGGG--ACC-TGCAAACTT-----GATCAAATATCAGAC-ACGACTCTC{AG}GAAATGGATATCTCGGCTCTCATATCGATGAAGAATGTAGTGAAATGGGATACTTGGTGTGAATTGCAGAATCCCGTAAACCATCAAGTTTTTGAACGCAAGTTACGCCTTAAGCCTTCTGGCC{GT}AGGGCACGTCTACCTGGGCATCACGAATTG-TAGCCCCCC--------CACCAAAAACCCT----TGC-------------------------------------------------------------------------------------------------GGGCTTT----------GGCTGGCC----GAGGTGGCGATGTTGGCCTCCCGTGAGGGG----AACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCAGCAT-CGCGCAACACGATCGATGGTGGTTGGAAT--GCCCTCGGTGGATCAC--GTTTCCCTCACGAGACGCGCCTACGAGGAA-CTCT-TT{CT}GC-------AACCC-----------------------------------------------------------------------------------------------------TACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_floccifera -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCTGGGTGTCACGCATCG-CGGCCCCCC-------CCATCCATCCATCCATCCG--------------------------------------------------------------------CCAG-CCTCCCG-T-------------GCTGGGCCCT-----------GGGTGTTT----GGGGAGGCGACGTTGGCCTCCCGTGCGCGC----AGCC-TCGC--GGTTGGCCTAAATTTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATCGC--GTCGCGCCCGCGAGACGCGCGGCGGG-GAA-CTCC-TTCAC-------GACCC--------TCA-CGCGTCGACCC-CCC---------GGACGAC-TCGT-CCCGGCGGGAAGACGTCAT-----CGGAGC--GACCCCAGGTCAGGCGGGATTACCCG---------------------------------AAATCGGGCGGTAAATTCCGTCCAAG-CTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCTTTGGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGCTGTGCTCGCGGAGACGTCGTCGCCCCGATCGTGGCTGGCAGCGCGCGCCTCACGGCGTGCTTCGGCATCAGCGCGCTCC{AG}GGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGCGAGGCGCAAGGAA{AG}CTGACTGGCGGGATCCCCT{CGT}-G-GGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGA--------- Begonia_francoisii -----T{CT}-CGATTCCTGAC--GAAA---GCAG-AACAACCCGTG-AACTAGTTAA-----CCATCG---TCCC--------CATGT----GGGAA-TTGCGAGGC--ATGTTCA--AGGTACGGCATA----GCTT---------TCGCGTGCCTT--GCC--TTGC-ATGCCTCGCGA----------------ACCATAACGAACCCC--GGCGCTAGTTGCGTCAAGGAC--TCTTTAA-CTG---AGAACGCTGC---TCTCCTAGCCC--GACTTCGG-GATGC----AGGGG--TGC-TGCGAACTT-----GCTTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGC-------------CACCCACACCAAAGCTTTGAACGCTCAATCTCTCGGTTTA--AATAGACCTATGCTATTTTTCTA----------------------------GGGGTTG------------GGCT-GGCAAT----------GGGTTCGAT----GAGGTGGTCATGTTGACCTCCCTTGCAAGC----AAGT-GCAT--GGTTGGTCTAAATTTGAGTCCTCAGCGT-TGCGCAGTGCGATCGACGGTGGTTGCCAT--GCCCTCGGCGAATTAC--ATTGCACTTGCGGGATGCATGTTTGA-GAA-CTCC-TTTGC-------TACCC--------AAT-TGTGCTGCCTT-GTTGGTT----CCTTCGAGAAC------AATGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGTGGGATCAC{AC}CG---------------------------------ACATCGGGCGGTAAATTCCGTCCAA{AG}GCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGCGTA-TAGCCGGTCTGCCAATCGACTCAGGGCGTGGACCGACGCGGATTGTAGTGGTGGCCCAAGCCTGAGCCTTTGTTGTGCTTGTGGAGACGTCATCACCGCGATCGTGGCTGGCAGCGCGCGCCT-CTGGCGTGCTTCGGCATCAGCGTGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GTGGGT-TGCACCGCCGACCGACCTTGATCTTTTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGC------------- Begonia_gabonensis -----TTGTCGATTCCTGC{AC}{AC}A{AT}A----GCAG-AACAACCCGCG-AACCCGTTGTG-----CAACGA--ACCC--------CGCAA---GGGGAG-CGGCGAGGA--GTGTTGGGG------------------------------------------------CGC-AAGCCCCGCATTT-------CGCGCGCACCTTAACGAACCCCCCGGCGCGAGTCGCGTCAAGGAA--TATTTAA-CTG---AGAACGCGGC---TCCTCT-GCCCC-GCCTGCGG-GATGC----AGGGG--CGC-TGCGAGCTT-----GAGAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCGCCAAAAAA-------TGC----------------TCGA--TCTC-TCC----------------------------------------TT-GGGGTCG------------GGCT-GGACTTT----------GGTGGGAC----GAGGGGGCGATGTTGGCCTCCCGTGCGAGC----GATT-GCGC--GGTTGGCCTAAAGTCGAGTCCTCGGCGT-CGCGCAGTGCGACCGACGGTGGTTTTTATTAGCCCTCGGCGAAACAC--GTTGCACGTGCGAGACGCGGTATCGA-GAA-CTCC-CACGC-------GACCC--------TGC-TGCGCTGCCCG-GTC-GTT-----CTCC-GGAAC------GACGGGGAGGCGCCAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_geranioides TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGTG-AACTAGTTTG-----CCAATG---TCCTGCCC----CGCGC----GGGAT-TGGCGCGGG-GCGCTTCGG-AGCTGTGGCT--CGT-GCTT---------GCGCGCGCCCT--GCC--TCGA-ACGCCTCGCGTCCCC----------------TAACGAACCCC--GGCGCTAGACGCGTCAAGGAA--TCTCGAA-CTT---AGAACGCGGC---TCCCCT-GTCCC-GATTTTGG-GACGC----AGGGGTGTCC-TGCGAACTT-----GAACA----CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC----ACCGCACCCAAAAAGAAA-----------CCAA------GATCT--TCCCTC----GATC-ATCGGG-------------GGTAG--GTT--------------------------GGCT-GGCCTTT----------GGGTGCTC----GGGGCGGCAAAGTTGGCCTCCCGTGTGGGC----AACC-TCGC--GGATGGTCTAAATTTGAGTCCTCAGCGT-CTCGCGGCGCGATCGACGGTGGTTTCCAT--GCCCTCGACGAATTAC--ATTGCGCCTGCGAGATGTGCGCTCGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGACTC-GTCGG---------AAAACGCC------GGCGAGTGGATGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG----------------------------AGCCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGTT-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-ATGGCGTGCTTCGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGAGTGGCGGGATCCCCTC-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCG------ Begonia_goegoensis TCATTGT-CGTTTCCTG-CAAAAAT---GCAG-AACAACCCGTG-AACTAGTT-TG----CCAACG---TCCCGCTG----CGTGC----GGGAA-CGGCGTGGA-GCGCGTCGG-AGTTGCGGCT--CGC--ATT--------CGTGTGCGCCCT--GCC--TTGCA-CGCCTCCCGCCCCC----------------TAACGAAACCC--GGCGCGAGTTGCGTCAAGGAA--TCTGGAA-CTT---AGAATGCAGC---TCCCCT-GCCCC-GATTTCGG-GACG-----AGGGA--TCT-TGCAAACTT-----GATCG----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACC-AAACAAAATAGAAA--------CCAGCAT{AC}GAC{CT}---TCTC-C--------GACC--GAGGCAA--GATTC---GTTCTCGCTTC--GTTGGGGGG---GTCTT----GTT-GGCCTTT----------GG{AC}TGGTTG---GGGGAGG{AC}GACGTTGGCCTCCCGTGCGGGC---AAAC{CT}-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTG{CT}TGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAA--GTTGTGCTGGCGAGATGCGGGGTGGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGACTC-GTC---------GGACGATAAT---GCCGGCGAGTAGACGTCAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_grandis --TCATTGTCGATTCCTGC-A{AG}AAT---GCAG-AACAACCCGCG-AACTAGTTT-G----CCAACG---TCCCGCCT----CGTGC----GGGAA-CGGCGTTGG-GCGCGTCGG-AACTGCGGCC--TGC-GCTT---------GCGCGCGCCCT--GCC--TCGCG-CGCCTCGTGCCCCC----------------TAACGAACCCC--GGCGCGAGTTGCGTCAAGGAA--TCTGTAA-CTT---AGAACGTGGC---TCCCCT-GCCCC-GATTTTGG-GACGC----AGGGG--TCC-TGCGAACTT-----GATCA----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCCAAAAAAACA-------------CCAGGAT--CAA---GACCTC--------GATC--GAAGAAGTAGACTC---GTGCT-GCTC---GACGTTGTG---GTTTT----GCT-GGCCTTT----------GGGCGGTC----GGGGAGGCGACGTTGGCCTCCCGTGAGGGC----GACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--ATTGTGCCTGCGAGACGTGCGCTCGA-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGACTC-GTC---------GGGCAACACC------{AG}GCGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGC-GGATTACCCG--------------------------------CAAATCGGGCGGTAAATTTCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAATAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCT-ACGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTT{AC}GGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAAC------- Begonia_holtonis TCATTGC-CGATTCCTG-C-AAAAT---GCAG-AACAACCAGCG-AACTAGTTTGT----{AG}GAAT----TCCCGCAC----TGCGC----GGGA--CGGTGCGGG-GCGTGACGG-A{AG}GTGGTGGC--CGC-TTTT---------GCGCG-GCCCA--GCC--TCGC-ACGCCTCTCGCCCCC----------------TAACGAACCCC--GGCGCGAGTTGCGTCAAGGAA--TGTGTAA-CGT---AGAACGCTTG----CCCTC-GTCCC-GATCTTGG-GATGC----AGGTG--TAGTTGCGAACTT-----GATGAAAA-TATCGA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTGCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGCCCCC--------GCACCAAAAGAAAAA-------------CCAC---GTCAGT--GGCGTG--------CAAG--GAAGTA---GACTT---GTGCT-GCGTC--TTTG--------CTC----GGGCT-GGTTGGGA--------GAGGTGGTC----GGGGCGCAGACATTGGCCTCCCGTGCGA------AATCGTCGT--GGTTGGTCTAAAACGGAGTCCTCGGCGT-CTCGCGGCGCGATCGACGGTGGTTGACAT--GCCCTCGACGAAT-AC--GTTGCGCTCGCAAGATGCGGTTTGGA-GAA-CTC--TTGAC-------GACCC--------TAG-TGCGTCGGCGA-GTC---------GGAGAAGAAC------GACGAGCAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGAT-ACCCG------------------------------{CG}CTAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATAATTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGAT-GAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTGGCCTCGATCGTGGCTGGCAGCGCGCGCCG-TTGGCGTGCTCAGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGAGTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGA--------- Begonia_horticola ---TTGT-CGATTCCTG-C-{AC}GAAA---GCAG-AACAACCCGCG-AACCCGTTGTG-----CAACGA--ACCC--------CGCAA--GGGGGAT-CGGCAAGGA--TTGTTGGGG------------------------------------------------CGC-AAGCCCCGCATT{CT}-------CGCGCGCACCTTAACAAACCCCCCGGCGCGACTCGCGTCAAAGAA--TATTTAA-CTG---AGAACGCGGC---TCCTCT-GCCCC-GCCTGCGG-GATGC----AGGGG--CGC-TGCGAGCTT-----GAGAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCGCCAAAAAA-------TGC----------------TCGA--TCTC-TTC----------------------------------------TT-GGGGTCG------------GGGA-GGACTTT----------GGTCGGAC----GAGGGGGCGATGTTGGCCTCCCGTGCGAGC----GATC-GCGC--GGTTGGCCTAAAGTCGAGT{CT}CTCGGCGT-GGCGCAGTGCGACCGACGGTGGTTTTTAT-AGCC{CT}TCGGCGAAATAC--GTTGCACGCGCGAGACGCGGTATCGG-GAA-CTCC-CACGC-------GACCC--------TGC-TGCGCTGCCCT-G{CT}C-GTT-----CTCC--GAAC------GACGGGGAGGCGCTAT-----CGAAGC--GACCCCAGGTCAGG{ACT}GGGAT-ACCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_incarnata --------CGATTCCTG-C-A{AG}AAT---GCAG-AACAACCCGCG-AACACGTTT-G----CCAACT---TCCTGCTT----TGCGC----GGGAA-TGGTGCGGG-GCGCGTCGG-AGTTGTGGCT--TGC-TTTT---------GCGCGCTCACT--GCC--TCGC-ACGCCTCGTGCCCCC----------------TAACGAACCCC--GGCGCGAGTCGCGCCAAGGAA--GCTTATA-CTT---AGAACGCGGC---TCCCTT-GCCCC-GATTATGG-GATGC----AGGGG--TCC-TGTGAACTT-----TATCA----TATTGA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCAAAAAAAAA--------------CCAACAC--CAA---ACTATC--------GATC--GGAGTA---GTCTC---GTGCT-GCTTC--GTCGGGG-----CTT-----GGCT-GGCCTTT----------GGGTGGTC----GGGGTGGCAACATTGGCCTCCCGTTGGGGC----AACC-TCGC--GGTTGGTCTAAATCTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCTTCGACGAATTAC--ATTGCGCTGGCGAGACGCGCGCTCGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGGCTA-GCCGG---------ACAACACT------GGCGAGCAGACGTTAT-----AGAAGC--GACCCCAGGTCAGG{CT}GGGAT-ACCC-------------------------------CCCAAATCGGGC--TAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-ACGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGGAAACCCGTGAGGCGCAAGGAA{AG}CTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_integerrima ---TTGT-CGATGCCGG-C-AGAAT---GCAG-AACAACCCGCG-AACTAGTTT-G----CCAACG---TCCCGCTG----CGCGC----GGGAA-CGGCGCCTG-GCGCGTCGG-AGCTGCGGCC--CGC-GTTC---------GCGCGCGCCCT--GCC--TCGC-GCGCCTCGCGCCCCCC---------------TAACGAACCCC--GGCGCGAGTCGCGCCAAGGAA--TCTCAAA-CTTTAAAGAACGCGGCGGCTCCCTT-GCCCC-GATTTTGG-GATGC---AAGGGG--TCC-TGCGGACTT--GACGATCGTCG-TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACAAAAG----------------------TCATC{CG}G-----TCCCTC--------GATC--GAAGCA---GACCC---GTGCT-GCTTC--GTCGGGG-----CTC-----GGCC-GGCGTCT----------TGGTGGCA----GGGGCGGCGACATTGGCTTCCCGTGGGGGC----AACC-TCGC--GGTTGGTCTAAATTCGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATCAC--GTTGCGCTTGCGAGGCGCGCGCTCGG-GAA-CTCA-TGCAC-------GACCC--------TAAAAGCGTCTGGCA-GCC---------GGACAACACC------GGCGAGCAGGC-TTAT-----GGAAGG--GACCCCAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_iucunda ------TGTCGATTCCTG{AC}C{ACG}AAA----GCAG-AACAACCCGCG-AACTCGTT----AATAATCGCG--TTCCCCACGCA-----------GGAA-CGGCGGGTCGTGCCGGGGC-TGCGGATCGCC-------------GCTGTGCGCTCCACGCC------TGGC-ACGCCTCGCAC----------------ACCCTAACGAACACC--GGCGCAGGTCGCGTCAAGGAG--CATTTAA-TTG---AGAACGCAAT---TCCTCTTGCCCT-ACCACGGG-GAT-----AAGGGG---TT-TGCGAACCC-----TCTAA----AAACAC-ACAACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTCTTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCAAACAACAA-----------------------GT-C--ACGCTCCACATGTCAGTAGGCTAGT----TCTA---CTTGCG------TT-GGAGTT-------------GGCT-GGCATATT---------GCTTGGT-----GGGGTGGTAACGTTGGCCTCCCGCGCGAC-----GAAATGCAC--GGTTGGCCTAAAAATGAGTACTCG-CAT-CGCGCAGTGCGATCGGCGGTGGTTTCCAT--GCCCTCGGCGTATTTC--ATTGCACCTGCCAGATGCATGTTTTGAGTA-GTCC-----G-------GACCC-------TTGC-GCGCGTGCTGCTCGATTT-----CATT-GAGAAC------GAGGAGAAG-CGCTAT-----CGAAGC--GACCCCAGGTCAGGCGGGACTACCCG--ACTTAGATCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTCGGTCGGATGTGGAACGGCGTC--AGCCGGTCTGCCAATCGACTCGGGGCGTGGTCCGACGCGGATTG{AC}GATGGCGGCCCAAGCCCGAGCCTTTGTTG{AT}GCT{AC}GTGGAGA{AT}GTCGTCGGCGCGAT{AT}GTGGCTGGCAGCGCGCGCCC-CTGGCGTGCTTCGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGCGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCAC{AC}GCCGACCGACCTTGAT{CGT}TTCTGAGAAGGGTTCGAGTG----------------------------------------------------- Begonia_johnstonii GATCATTTTCG-TTCCAGC-AAAAA---GCAG-AACAACCCACG-AACTGATTAAA-----CAACG---TCTCTCGC-----TCGG----GGGAACGGAACGGTGCATGCTAA---GATAGAGGCA----T-GCAC-------GTGCACGCACCCT--CCC--TGGC-GAGCCCCGCG----------------GACCCTAACAAAGCCT--GGCGAGAGTCGCGTCAAGGAA--TCTTGAA-CTT---ATAACGCAAT---TCCTTT-TCCCT-GGCTTCGG-GACGC----GGGGG--CTA-TGCAAACTT-----GATCAAGTATCAAAC-ACGACTCTCGACAATGAATATCTCGGCTCTCGGATAGATTAAGAACGTAGTGAAATGCGGTACTTGGTGTGAATTTCATAATCCAGTGAACCATCGAGTTTTTGAATGCAAGTTGCGCCCGAAGCCTTCTGGCTAAGGGCACGTCTGC{CT}TGCGCGTCACGCATCG-TAGCCCCCC---------ACCAAAAACCACTCGC----------------------------------------------------------------------------------------------------GGGCTTTT---------GCTG{AC}TT-----GAGATGGCGACGTTGGCCTCTCGTGAGGGG----AACC-TCAC--AGTTTGTCTAAATTAGAGTCCTCAACTT-CACACAGCTCGATCGACGGTGGTTGCAAT--TCCCTCAGTAAATCAC--ATTGCGCTCGCGAGACGTGCCTACAAGGAA-ATCG-TTCGC-------GACCC--------TAC-TGCGTAGAGTCGCTGCTAC----CTCTAGGTGCGGT{CG}{CG}{AC}GTC------GGCGTCA------TCAAGC--GACCC{CT}TG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_kisuluana ----TGT-CGATTCCTG-{AC}-CGAA{AT}---GCAG-AACAACCCGCG-AACC{CT}GTTGTG-----CAACGA--ACCC--------CGCAA---GGGGAG-CGGCGAGGA--GTGTTGGGG------------------------------------------------CGC-ATGCCCCGCATTT-------CGCGCACACCTTAACGAACCCCCCGGCGCGAGTCGCGTCAAGGAA--TATTTAA-CTG---AGAACGCGGC---TCCTCT-GCCCC-GCCTGCGG-GATGC----AGGGG--TGC-TGCGAGCTT-----GAGAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCGCCAAAAAA-------TGC----------------TCGA--TCTC-TTC----------------------------------------TT-GGGGTTG------------GGCT-GGACTTT----------GGTCGGAC----GAGGGGGCGATGTTGGCCTCCCGTGAGAGC----GATC-GCGC--GGTTGGCCTAAAGTCGAGTCCTCGGCGT-CGCGCAGTGCGACCGACGGTGGTTTTTA---GCCCTCGGCGAAATAC--GTTGCACGTGCGCGACGCGGTATCGG-GAA-CTCC-CACGC-------GACCC--------TGC-TGCGCTGCCCT-GTC-GTT-----CTCC--GAAC------GACGGGGAGGCGCTAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGA-TACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_letouzeyi -------GT{AC}GATGCTA------------CAG-AACGACC-GCG-AACT-GGTTAT-CAACCACACGA-TTCCCCAGCCA-GCGCT---GGGGAA-AGGCGGGGC-ACGCTGGTC-T--CGCATTG--CGC-GCTCT--------GCGGG---------------------CCTCGCCG----------------ACCGCAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--CATGAAA-CTG---AGAGCGCGGA---TCCCCT-GCCCC-GGCTCCGG-G{CT}AGC----AGGGA--TCT-CGCGCGCTT-----GCTCA----CGACGC-ACGACTCTCGACGACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGTCCCCC-------TCACCGAAGAGGCCAA---------------------ATTC--GAGCACCCAGAGC---AGTGCAG------TC-----TCTGCAC-----TT-GCA-TCGGGC---------GCTT-GGATATGGAGCTC----GTTTGGA-----GAGGCGTCAAGGTTGGCCTCCCGCG-GAGC----AACC-TCGC--GGTTGGTCTAAAGTAGAGTGCTCGGCAT-CGCGCAGTGCGATCGACGGTGGTTTCGTA--GCCCTCGGCGAATTAC--GTCGCAC-----AGATGCG-GCGCGGAGAA-CTCC-ATACA-------GACCC--------TGC--TGATGAT{CG}GCC-GGCT-----CGTGGGTTCCCC-------GCGAGAAGGCACTGC-----CGAAGC--GACC{CT}CAG-TCAGG-GG-ATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_lobata -----GT-CGATTCCGG-C-CGAAT---GCAA-AACAACCCGCG-AAC-TAGTTTGG----CCAATG--TCCCGTTT----CGCAC----GGGA--CGGCGCGGG-GCGTGTTGG-TGCTGTGGCC---GC-CTCT---------GTGCGCGCCCT--GCC--TGGC-AGGCCTCGCGCTCCCC--------------TTAACAAACCCC--GGCGCGAGTAGCGTCAAGGAA--TCTCGAA-CTT---AGAACGCACC---TCCCTC-GCCCC-AATTTTGG-GACGC----AGGAG--TGT-AGCGAACTT-----GATCATA--CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------ACACCAAAAATAA----------------GAGGAGGTCAA---TGTCTC--------GATC--GAAGCA---GACTC---GCGCT-GCATC--GTTGCGA-----CTT-----GGCTC-GCCCTT----------TGGCGGTG----GTGGCGGCGACATTGGCTTCCCGTGGGGGC----GACC-TCGC--GGTTGGCCTAAATTTGAGTCCTTGGCGTTATTGCGGCGCGATCGACGGTGGTTTCCAT--GCCCTCGACGAATCAC--ATTGCGCTTGCGAGATGCGTGCTATT-GAA-CTCT-TGGAC-------GACCCTCT------AAT----GTTCC------------------------------------TCAAATGTTAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGAT-ACCC----------------------------------AAATCGGGC--TAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGAG-TAGCCGGTCTGCCGATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-TTGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCATAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGC------- Begonia_longipetiolata ------TGTCGATTCCTGCCGAAA----GCAG-AACAACCCGCG-AACTCGTAGTG-----CAACGA--ACCC--------CGCAA---GGGGAT--GGCGAGGC--GTGATGGGG----------------------------CGCTC---------------GCCCGCTCCTCACGCTC-------CCCGCCCACCTTAACGAACCCCC-GGCGCGAGTCGCGTCAAGGAA{AG}ATCTT{CT}AA-TTG---AGAACACGGC---TCCTCT-GC{AT}CCCGGCTGCGG-GATGC---{AT}AGGGG--CGT-TGCGAGCTT-----GAGAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAAC{CG}TAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCT{GT}GCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TGGCCCCCC-------GCGCCAACAAAAAAAACC-----------CGAGT---CCAA--TCCC-TTA-TTATTA-------------------------------TTTT-GGGGTTG------------{CG}ACC-GGACTTTT---------GGTTGGAC----GAGGGGGCAATGTTGGCCTCCCGTGCGAGC----GATC-GCGC--GGTTGGCCTAAAGTTGAGTCCTCGGCGT-CGCGCGGTGCGATCGACGGTGGCCTGTAT-AGCCCTCGGCGAGATAC--ATTGCACGTGCGAGACGCGGTATCGG-GAG-CTCC-CACGC-------GACCC--------TAC-TGCGCTGCCTC-GACCCTT----CTTGAGGGAAGGG--AAAGAGAAGGCGCGCTAT-----CGAAGC--GACCCCAGGTCAGG-GGGAT-ACCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_loranthoides ------TGTCGATTCCTGC-A{AG}AAA---GCAG-AACAACCCGCG-AACTTGTCGTG-----CAACGA--ACCC--------CGCAA----GGGAA-TGGCGGGGGCGTGATGGGG---------------------------------------CG--CTC--GCGC-GCTCCTTGCGCTC-------CCCGCGCACCTTAACGAACCCCC-GGCGCGAGTCGCGTCAAGGAA--TCTTTAA-CTG---AGAACGCGGC---TCCCCT-GCCCCCGGTTGCGG-GATGC----AGGGG--TGT-TGTGAGCTT-----GAAAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TGGCCCCCC-------GCGCCAAAAAAAAAAAC-T-----------GAGT---TCAA--TCTC-TTC----------------------------------------TT-GGGGTTG------------GGCC-AGACTTT----------GGTCGGAC----GAGGGGGCAATGTTGGCCTCCCGTGCGAGC----GATC-GCGC--GGTTGGCCTAAAGTTGAGTCCTCGGCGT-CGCGCAGTGCGATCGACGGTGGTTTTTT---GCCCTCGGCGAGATAC--ATTGCACGTGCGAGACGCGGTATCGAGAGCGCTCC-CACGC-------GACCC--------TGC-TGCGTTGCCTC-GTTGATT----CCTCGGAGAAG------GACGAGGAGGCGCTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_luxurians TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGCG-AACTAGATTGG----CCAATG---TCCCGTTT----CGCAC----GGGA--CGGCGCGGG-GCGTGCTGG-TGCTGTGGCC---GC-CTCT---------GTGCGCGCCCT--GCC--TAGC-AGGCCTCGCGCTCCCC--------------TTAACAAACCCC--GGCGCGAGTAGCGTCAAGGAA--TCTCGAA-CTT---AGAACGCGCC---TCCCTC-GCCCC-AATTTCGG-GGTGC----AGGAG--TGT-CGCGAACTT-----GATCATA--CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------ACACCAAAAATAA----------------GAAGGGGTCAA---CGTCTC--------GATC--GAAGCA---GACTC---GCGCT-GCACC--GTCGCGA-----CTT-----GGCTCGCCCTT-----------GGGCGGTG----GTGGTGGCGACATTGGCTTCCCGTGGGGGC----GAC--TCGC--GGTTGGCCTAAATTTGAGTCCTTGGCGTTCTTGCGGCGCGATCGACGGTGGTTTCCAT--GCCCTCGACGAATCAC--ATTGCGCTTGCGAGATGCGTGCTACT-GAA-CTCT-TGGAC-------GACCCTC---------------------------------------------------------AAATGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG-------------------------------CCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGAG-TAGCCGGTCTGCCGATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGACTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-TTGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCATAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_madecassa TCATTGT-CGATTCCTG-C-AAAAA---GCAG-AACAACCTGCG-AACTAGTTAA-----CCATTG---TTCC--------CACGC----GGGAACTTGCGAGGC--ATGTAAT--TGCT-TGGCACAA---GCTT---------GCGAGTGCCTT--GCC--TTGC-ATGCCTTGCGA----------------ACCATAACGAACCCC--GACGCGAGTTGCGTCAAGGAA--TCTTTAA-CTG---AGAACGCCGC---TCTCTTAGCCC--GACTTCGG-GATGC----AGGG---TGT-TGCGAACTT-----GCTTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATCG-TAGC-------------CACCCACACCAAAGCTT-GCACGCTCAATCTCTA-----------------------------------------------------------GGGGTTG------------GGTT-GGCATT----------GGGTTCAAT----GAGGTGGTAATGTTGGCCTCCCGTGCGAGC----AAGT-GCAT--GGTTGGTCTAAATTTGAGTCCTCGGCGT-TGCGCAGTGCGATCGGCGGTGGTTGTCAT--GCCCTCGGCGAATTAC--ATTGCACTTGCGGGATGCATGTTCGG-GAA-CTCC-TTTGT-------GACCC--------TAT-TGCGTTGCCTC-GTTGGTT----CCTCGAAGAAC------AACGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATCACCCG---------------------------------AAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGCGTC-TAGCCGGTCTGCCAATCGACTCAGGGCGTGGACCGACGCGGATTGCAGTGGTGGCCCAAGCCTGAGCCTTCGTTGTGCTTGTGGAGACGTCATCACCGCGATCGTGGCTGGCAGCGCGCGCCT-CTGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACT---------------------------------------------------------------------------------------------------------------------- Begonia_malabarica --ATTGT-CGATTCCTG-C-A{AG}AAT---GCAG-AACAACCCGCG-AAC-TAGTTTTG----CCAACG--TCCCGCCG----CGAGC----GGGAA-CGGCGCGGG-GCGGGTCGG-{AT}ACTAAGGGC--CGC-GCTC---------GCGCGCGCCCTGTGCCC-CGGCG-AGCCTCGCGCCCCCC---------------TAACGAACCCC--GGCGCAAGTCGCGCCAAGGAA--TCC-GAA-CTC---AGAACGCGGC---TCCCCT-GCCCC-GGCTTCGG-GCTGC----GGGGG--TCC-TGCGAACTC-----GATCATT--ATACTAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGCCCCTCC------CCACCCACCCACCCACCCA---------CAAA------------------------------------------------------------GGGTGTT------------------------------------GGTCGGTC----GGGGAGGCGACGTTGGCCTCCCGTGCGGGC----AACC-GCGC--GGTTGGCCTAAATTTGAGTCCCCGGCGT-CTTGCGGCGCGATCGACGGTGGTAGCCATATGCCCTCGACGACTTAC--GTTGCGCCTGCTCGACGCGCGCTCGG-GAG-CTCC-TCGAC-------GACCCTC------TAA-TGCGTCGACTC-GCT---------GGGCAATGCC------AGCGAGCGGACGTCAT-----CGAAGC--GACCCCAGGTCAGGAGGGACTACCCG---------------------------------AAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCCCGGTCGGATGTGGAACGGCGCT-CAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTCGTTGTGCTCGCGGAGACGTCGTCGCCCCGATCGTGGCTGGCAGCGCGCGCCTCAGGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCT{CG}-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGA---- Begonia_mananjebensis --------CGATTCCTG{AC}C--GAA{AT}---GCAG-AACAACCCGTG-AACTAGTTAA-----CCATCG---TCCC--------CATGC----GGGAA-TTGCGAGGC--ATGTTCG--AGCTACGACACA----GCAT---------TCGCGTGCCTT--GCC--TTGC-ATGCCTCGTAA----------------ACCATAACGAACCCC--GGCGCGAGTTGCGTCAAGGAC--TCTTTAA-CTG---AGAACGCCGC---TCTCCTAGCCC--GACTTCGG-GATGC----AGGGT--TGC-TGCGAACTT-----GATTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGC-------------CACCCACACCAAAGC-----ACGCTCAATCTCTCGGTTGA--AATAGACCAATGCTATTTTTCTA----------------------------GGGGTTG------------GGCT-TGCAAT----------GGGTTCGAT----GAGGTGGTAATGTTGGCCTCCCGTGCAAGC----AAGT-GCAC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-TGCGCAGTGCGATCGACGGTGGTTGCCAT--GCCCTCGGCGAATTAC--ATTGCACTTGCGGGATGCATGTTCGA-GAA-CTCC-CTTGC-------GACCC--------AAT-TGTGCTGCCTC-GTTGGTT----CCTTCGAGAAC------AATGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGG-GGG-TCACCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_mannii -----GT-CGATTC{CT}CG-C{AT}AGAA----GCAG-AACAACCCGCG-AACTCGTTGTG-----CAACGA--ACCC--------CGCAA---GGGGAG-TGGCGAGGA--GTGTTGGGG------------------------------------------------CGC-AGGCCCTGCATTT-------CGCGCGCACCTTAACGAACCCCC-GGCGCGAGTCGCGTCAAGGAA--TATATAA-CTG---AGAACGCGGT---TCCTCT-GCCTC-GCCTGCGG-GATGC----AGGGG--CGC-TGTGAGCTT-----GCGAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCAAAAAAA------TGC----------------TCGA--TCTC-TTC----------------------------------------TT-GGGGTTG------------GGTT-GGACTTT----------GGTCGGAC----GAGGGGGCGATGTTGGCCTCCCGTGCGAGC----GATT-GCGC--GGTTGGCCTAAAGTTGAGTCCTCGGCGT-CGCGCAGTGCGACCGACGGTGGTTTTTA---GCCCTCGGCGAAATAC--GTTGCACGTGCGAGATGCGGTATCGG-GAA-CTCCCTTTGC-------GACCC--------TGC-TGCGCTGCCCC-GTC-GTT-----CTAC--GAAC------GATGGGGAGGCGCTAT-----CGAAGC--GACCCCAGGTCAGGCGGGA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_masoniana --------------------AGAGA---TC-G-AAC-----GCG-AAC-TAGTTT-GCCTGCCTTCG--TCGCGCCG----CGCG{AC}----GGGAA-CGGTGCGGG-GCGCGTC{AT}G-AGCTGCCAAC--CGC-GCTT---------GCGCGTTTTGAT-GCC--TCGC{GT}-TGCCTCGCGCCCCC----------------TAAC{AG}AACCCC--GACGCGAGTTGCGTCAAGGAA--TCTTGAA-CTT---AGAACGCGGC---TCCCCT-GCCCC-GATTTCGG-GACCC----AGGGG--TTCCTGCGAACT------GAACA----CATCAA-{AGT}CGACTCTCGACTACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGC{AT}CGTCTGCCTGGGCGTC{AT}CGCATCG-T{AT}GCCCCCCG-------CACCACTTA{AT}{AT}AGAA{AT}A{AT}----------GAA-AC--CTA---TGCCTCGC-----TGCTC--GAA{AG}TG---GACAC---TGGCTCGCGCCTCCTACTTC-AAATCAGGGTTTTGTT--GGCCT{AT}TT-----GGGTGGTGGTC----GGGGAGGCCACTTTGGCCTCCCGTGCGGGT----AACC-TCGC--GGTTGGTCTAAATTCGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCAGCATGCCCT{CT}GACGAATTAC--GTTGCGCCCGCGAGAAGCGCGATCGG-GAA-CTCC-TGGT{CT}-------GACCC--------TAA-TGCGCCGACT{CT}-GTT---------GGACA{AG}CACC------AGCGAGAGGACGTTAT-----CGAAG{CT}--GACCCCAG-TC{AT}GGT{GT}{CT}ATGT{CGT}CACT-----------------------------------------------ATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCTCGGTCGGATGTGTAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGAACC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_meyerijohannis --TCATTGTCGATTCCTG{AC}-GAAA----GCAG-AACAACCCGTG-AACTTGTTGA------CACCG---TCCC-------ACGC------GGGAA-CGGCGGGGCGCGTCTGGG---------------------------CTGCGCACAC{GT}CTC{GT}CG---------TGCGCCCGGCCTCGCACGCCTCGC-CG--CTTTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TCTTTAA-CTG---AGAACGCGGC---TCCCCT-GCCCC-GGCTCCGG-GATGC----ACGGG--TGC-TGCGAACTT-----ACTTACTA-T-ACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCG-TATCCCCCCC------GCACCAAACAAG----------------------------------------------------------------------------------------------------------CAAGTTT----------GGCCAGAC----GGGGCGGTAATGTTGGCCTCCCGTGCGA-C---TGCTC-GCAC--GGTTGGCCTAAAGTCGAGTCCTCGGCAT-CGCGCGGTGCGATCGACGGTGGTTGCCAT--ACCCTCGGCGAATTAC--ATTGCACTTGCGAGTTGCGCGTTGGG-GAA-CTCT-GCCAA-------GACCC--------TGC-TGCGTCGTCTC-GTCGGTT----CCTCGGGGATC------GACGGGG{AG}GACGTCAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGAT-ACC-------------------------------GCCCAAATCGGGC{CG}{CG}TAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGCGTC-GAGCCGGTCTGCCAATCGACTCAGGGCGTGGACCGACGCGGATTGCGGTGGTGGCCCAAGCCTGAGCCTTTGTTGTGCTTGTGGAGACGTCGTCACCGCGATCGTGGCTGGCAGCGCGCGCCT-TCGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCTAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_molleri -----TTGTCGATTCCTGC{AC}--AA----GCAG-AACAACCCGCG-AACCCGTTGTG-----CAACGA--ACCC--------CGCAA---GGGGAG-CGGCGAGGA--GTGTTGGG-------------------------------------------------CGC-ACGCCCCGCATTC-------CGCGCGCACCTTAACGAACCCCCCGGCGCGAGTCGCGTCAAGGAA--TCTTTAA-TTG---AGAACGCGGT---GCCTCT-ACCCCCGTTTGCGG-GATGC----AGGGG--CAC-TGTGAGCTT-----GCCAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-CAGCCCCCC-------GCGCCAAAAAAA-------GC----------------TCAA--TCTC-TTCTTCCGG----------------------------------TT-GGGGTTG------------GGCC-GGACTTT----------GGTCGGAC----GAGGGGGCAATGTTGGCCTCCCGTGCGAGC----GATC-GCGC--GGTTGGCCTAAAGTCGAGTCCTCGGCGT-CGCGCAGTGCGACCGACGGTGGTTTTTG---GCCCTCGGCGAAATAC--GTTGCACGTGCGAGACGCGGTATCGG-GAA-CTCC-CACGC-------GACCC--------TGC-TGCGCTGCCCC-GTC------------GGAGAAC------GACGAGGGGGCGCTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATCACCCG---------------------------------AAATCGGGCGGTAAATTCC-TCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGTGT--TAGCCGGTCTGCCAATCGACTCAGGGCGCGGACCGACGCGGATTGCGGCGGCGGCCCAAGCCTGAGCCTTTGTTGTGCTTGCGGAGACGTCGTCGGCGCGATCGTGGCTGGCAGCGCGCGCCAGTAGGCGTGCTTCGGCATCGGCGCGCTCCGGGCGTCGGCCTGCGGGTTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTA-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGA--------- Begonia_nossibea ------T-CGATTCCTG{AC}C--GAAA---GCAG-AACAACCCGTG-AACTAGTTAA-----CCATCG---TCCC--------CATGT----GGGAA-TTGCGAGGC--ATGTTCG--AGGTACGGCATA----GCTT---------CCGCGTGCCTT--GCC--TTGC-ATGCCTCGGGA----------------ACCATAACGAACCCC--GGCGCTAGTTGCGTCAAGGAC--TCTTTAA-CTG---AGAACGCTGC---TCTCCTAGCCC--GACTTCGG-GATGC----AGGGG--TGC-TGCGAACTT-----GCTTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACACATCG-TAGC-------------CACCCACACCAAAGCTTTGAACGCTCAATATCTCTGTTTA--AATAGACCTATGCTATTTTTCTA----------------------------GGGGTTG------------GGCT-GGCAAT----------GGGTTCGAT----GAGGTGGTCATGTTGACCTCCCTTGCAAGC----AAGT-GCAT--GGTTGGTCTAAATTTGAGTCCTCAGCGT-TGCGCAGTGCGATCGACGGTGGTTGCCAT--GCCCTCGGCGAATTAC--ATTGCACTTGCGGGATGCATGTTTGA-GAA-CTCC-TTTGC-------GACCC--------AAT-TGTGCTGCCTT-GTTGGTT----CCTTCGAGAAC------AATGAGAATACGTTAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGATCACCC------------------------------------ATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGCGTC-TAGCCGGTCTGCCAATCGACTCAGGGCGTGGACCGACGCGGATTGTAGTGGTGGCCCAAGCCTGAGCCTTTGTTGTGCTTGTGGAGACGTCATCACCGCGATCGTGGCTGGCAGCGCGCGCCT-ATGGCGTGCTTCGGCATCAGCGTGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GTGGGT-TGCACCGCCGACCGACCTTGATCTTTTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAA-ATGGTGAACTATGCCTGA--------- Begonia_obliqua TCATTGC-CGATTCCTG-C-AAAAT---GCAG-AACAACCAGCG-AACTAGTT-GC----CGAAT----TCCCGCAT----TGCGC----GGGA-------------CGCGTGGG-AGGTCGTGGT--CAC-TTTT---------GTGCGCCCACG--GCC---GGC-ACGCCTCTCGCCCCC----------------TAACGAACCCC--GGCGCGAGCTGCGTCAAGGAA--TGTGTAA-CTT---AGAACGCTCA----CCCTT-GTCCG-GATTTTCG-GATGC----AGGGT--TAGTTGCGAACTG-----GATCAAA--TATTGA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-GAGCCCCCC-------GCACCAAAAGAAAAAA------------CCAA---GTCAGT--TCCGTG--------CGTC--GAAGTA---GACTT---GTGCT-GCTGC--TTTG--------CTC---GGGGCA-GA-TGGGA--------GAA-TGGTC----GGGGCGTAGAGAATGGCCTCCCGTGCGAA-----ATCCATCGC--GGTTGGTCTAAAACTGAGTCCTCGGCGT-CTTGCGGCGCAATCG{AG}CGGTGGTTGACAT--GCCTTCGACGAAT-AC--ATTGCGCTGGGAAGGCGCGGTTCCGG-GAA-CTC--TGGAG-------GACCCC--------AG-TGCGTCGGCGA-GTC---------GGACAGGAAC------GATGAGCAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------CCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGAT-GAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCCCGATCGTGGCTGGCAGCGTGCGCCC-TCGGCGTGCTCAGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGAGTGGCGGGATCCCCTC-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_olbia TCATTGT-CGAC-{CT}CTG-C-AAAAT---GCAC-AACAACCCGTG-AACTAGTATG-----CCAACG---TCTCGCTT----CGCGC----GGGTA-{AT}GGCGCGGG-GTGCGTC{GT}G-AGCTGCGGCT--CGC-TTTT---------GCGCGGGCCCA--GCC--TC{GT}C-GCGCCATGCGCCCAC----------------TAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TCTCAAA-CTT-ATAGAACGCACT---TCCCT--GCCCC-AAATTTGG-GATGC----AAGGG--TCC-TGCGAACTT-----GATCA----TACCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCAAAGGAAAAAA------------CCATGA--{CT}CGA---TCCCTC---------TTC--GAAGTA---GACTG---GTGCT-GCTTT--GTTGGGG-----CTT-----GGCT-GGCCTTT----------GGGTGGTC----GGGGTGGCAAAATTGGCCTCCCGTG-GAGC----AACC-TCGC--GGTTGGTTTAAATTCGAGTCCTCGGCGT-CTTGGGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--ATTGCGCTTACGAGACGCGTGCTGGG-GAA-CTCC-TGGAC-------GACCC--------TAA-TGCGTCGGCTA-GCCGG---------ACAACGCC------GGCGAGCAGGCGTTAT-----CGAAGC--GACCCCAGGTCAGGCGGGAT-ACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_palmata -CATTGT-CGATTCCTG-C-AGAAT---GCAG-AACAACCCGTG-AACTAGTTT-G----CCAACG---TCCCGCCC----CGTGC----GGGAA-CGGCGCAGA-GCACGTTGG-AACTGTGGAA--AGC-GCTT---------TTGCGCGACCT--AAG--AGACA-TGCTCTGCGCCCCC----------------TAACGAACCCC--GGCGCAAGTCGCGTCAAGGAA--TCTGAAA-CTT---AGAACGCGGA---TCCCCT-GCCCT-GATTTCGG-GATGC----AGGGG--TGA-CGTGGACTT-----GATCA----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCCAAACCAAAAAAA----------CCAATAC--CAA---TCCATC--------GATC--GAAGCA---CACTC---GTGCT-GCTTC--GTTGGTG-----GTTTTGGTGGCT-GGTCTTT-----------GGGGGTC----GGGGAGGCGACGTTGGCCTCCCGTATGGGC----AACC-TCCC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGCCAT--GCCCTCGACGAATTAC--ATTGTGCTTGCGAGGCGCGCCGTGGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGACTC-GTC---------GGACAACACC------GACGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGTGGGATTACCCG-------------------------------CCAAATCGGGCGGTAA-TTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGTGCG-TAACCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCT-ACGGCGTGCTTCGGCATCAGCGTGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTTAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTG-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_poculifera ---TCTTGTTGATTCCTGC-A{AG}AAA---GCAG-AACAACCCGCG-AACTTGTCGTG-----CAACGA--ACCC--------CGCAA----GGGAA-TGGCGGGG-GCGTGCTGGGG----------------------------CGCTA---------------GCGCGCTCCTCGCGCTC-------CCCGCGCACCTTAACGAACCCCC-GGCGCGAGTTGCGCCAAGGAA--TCTTTAACTTG---AGAATGTGGC---TCCTCT-GCCCCCGGTTGCGG-GATGC----AGGGG--CGC-TGCGAGCTT-----GAAAA----TCACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TGGCCCCCCACGCTCC-CGCCAAAAAATC-----------------GAGT---TCAA--TCTCCTAC-----------------------------------------T-GGGGTTT------------GGCC-GGACTTT--------GGTTGGGGAC----GAGGGGGCAATGTTGGCCTCCCGTGCGAGC----GATT-GCGC--GGTTGGCCTAAAGTTGAGCCCTCGGCGT-CGCGCAGTGCGATCGACGGTGGTTTTTA---GCCCTCGGCGAGATAC--ATTGCACGTGCGAGATGCGGTATCGG-GAG-CTCC-CACG{CT}-------GACCC--------TGC-TGCGCTGCCTC-GTCGGTT----CCTCGGAGAAG------GACGAGGAGGCGCTAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGATTACCCG-------------------------------CCA{AG}ATCGGGCGGTAAATCCTGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAAGAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGTGCCTTGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCAGGGCGCGGACCGACGCGGATTGCGGCGGCGGCCCAAGCCTGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGGCGCGATCGTGGCTGGCAGCGCGCGCCAAGAGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGTTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTA-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_potamophila --------TCGATGACTGCA--------GCAG-AACAA-CCGCG-AACTGGTTAAA--AACCATCTGC-TTCCCCAGCCA-GCAAAT--GGGGAA-AGGCGGGGC-GCGCTGGTG-A--CGTT{GT}AC--CGC-GCCCC--------GCGCGCGGCCG--GCC--CAGC-GCACCTCGCGG----------------ACCGTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--GATGTAA-TCG---AGAGTGCGGA---TCCCAT-GCCCC-GGCCCCGG-GAAGC----AGGGGG-TCT-AGCGCGCTT-----GCTCA----CGACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCG-TAGGCCCCC-------GGACCGAAGAGGCCAA---------------------GTTC--GAGCTCCCAAAGCGT-CGGGCAG------TTTC---TCTGC-------TT-GCG-TCGGCGGCG------GTTG-GGATTTGCATCTC----GTTCGGA-----GGGGCGGCAAGGTTGGCCTCCCGCGCGGGC----AGTG-GCGC--GGTTGGTCTAAAGTAGAGTGCTCGGCAT-CGCGCGGTGCGATCGACG-TGGTTTCCTT--ACCCTCGGCGAATTAC--GTCGCACGCGCGGGATGCG-GCGCGGAGAA-CTCC-ATTCG-------GACCC--------TTCTTTTACGA-TGCCTTTCT-----CGCGGTTTCCCC-------GCGTG{AG}AGG{CT}GCTGC-----CGAAGC--GACCCCAGGTC{AC}GG-GG-ATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_prismatocarpa ---TCTTGTCGATGACTG{ACG}{CG}{AC}AAA{GT}---ACAG-AACGACCCGCG-AACTGGTTAAA--AACCATCTGC-TTCCCCAGCCA-GAAAAT--GGGGAA-AGGTGGGGC-GTGCTGGTG-A--CGGGTTA--CGC-GCCCC--------GCGCGCGGCCG--GTC--TATC-ATGCCTCGCGG----------------ACCGTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--GATGTAA-CTG---AGAGCGCGGA---TTCCCT-GCCCC-GGCCCCGG-GAAGC----AGGGGG-TCT-AGCGCGCTT-----GCTCA----C{AG}ATGC-ACAACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCG-TAGGCCCCCC-----AGCACCGAAGAGGCAAA---------------------GGTC--GAGCTCC{CT}GAAGCGG-CGGGCAA-----TTTTG---TCTGC-------TT-GCG-CGGGCG---------GCTG-GGATTTGCATCTC----GTTTGGA-----GAGGCGGCAAGGTTGGCCTCCCGCGCGGGC----AACA-GCGC--GGTTGGTCTAAAGTAGAGTGCTTGGCAT-CGCGCGGTGTGATCGACGGTGGTTTCCTT--ACCCTCGGCGAATAAC--ATCGCACGCGCGGGATGCT-GAGCGGAGAA-CTCC-ATTGG-------GACCC--------TTCC-TTGTGA-TGCCTTTCT-----CGCGGTTCCCCT-------GCGTGGAGGCGTTGC-----CGAAGC--GACCCCAG-TCAGG{ACT}GG-AT-ACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_quadrialata -----------------------------------------------------------------TGC-TTCCCCA{AG}CCA-GC--AT--GGGGAA-AGGCGGGGC-GTGCTGGTG-A--CGGTTAC--CGC-GCCCC--------GCGCGCGGCCG--GCC--CAGC-GCACCTCGCGG----------------ACCGTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--GATGTAA-CCG---AGAGTGCGGA---TCCCCT-GCCCC-GGCCCCGG-GAAGC----AGGGGG-TCT-AGCGCGCTT-----GCTCA----CGACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCG-TAGGCCCCC-------GGACCGAAGAGGCCAA---------------------GTTC--GAGCTCCCAAAGCGG-CGGGCAG------TTTC---TCAGC-------TT-GCG-TCGGCTGCG------GTTG-GGATTTGCATCTC----GTTCGGA-----GGGGCGGCAAGGTTGGCCTCCCGCGCGGGC----AATG-GCGC--GGTTGGTCTAAAGTAGAGTGCTCGGCAT-CGCGCGGTGCGATCGACG-TGGTTTCCTT--ACCGTCGGCGAATTAC--GTCGCACGCGCGGGATGCG-GCGCGGAGAA-CTCC-ATTCG-------GACCC--------TTCTTTTACGA-TGCCTTTCT-----CGCGGGTTCCCC-------GCGTG-AGGCGCTGC-----CGAAAC--GACCCCAGGTC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_roxburghii --TCATTGTCGAGTCCTGC-A{AG}AAT---GCAC-AACAACCCGCG-AACTAGTTT-G----CCAATG---TCCCGCCT----TGTGC----GGGAG-CAGTGCGGA-GCACGTTGG-AGCTGTGGAC--AGC-GCTT---------TTGCGCCCCTT--GCC--CTGCG-TGCCCCGCGCCCCC----------------TAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TCTAAAA-CTT---AGAATGCGGT---TCCCTT-GCCCC-GATTTCGG-GATGC----AGGGG--TCC-TGCAAACTT-----GATCG----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGTCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCCAAAAATAAAAAAA---------CCAACAA--CAA---TCCATC--------GATC--GAAGCA---GACCG---GCGCT-GGTTC--GTTGGGA-----GTTTTGGTTGTT-GGCCTTTT---------GGGCGATC----GGGGAGGCGACGTTGGCCTCCCGTACGGGC----AACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTGCAGCGCGATCGACGGTGGTTGCCAT--GCCTTCGACGTGTTAC--ATTGTGCATGCAAGGCGCGCCGTGGG-GAA-CTCC-TCGAC-------GACCC--------TAA-TGCGTCGACTG-GTC---------GGACAACAAC------GGCGAGAAGACGTTAT-----CGAAGC--GACCCCAGGTCAGG{CT}GGGATTACCCG------GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAAATTTCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATTGTGGCTGGCAGCGCGCGCCT-ACGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTTAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTG-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGC------- Begonia_salaziensis ----------------------------GCAG-AACAACCCGTG-AACTATTTAA-----CCATCG---TCCC--------CGCGC----GGGAA-TTGCGA{AG}GC--ATGTTGG--AGCTACGGCACAA---GCTT---------GCGCGTGCCCT--GCC--TTGC-ATGCCTCGCGA----------------ACCATAACGAACCCC--GGCGCGAGTTGCGTCAAGGAA--TCTTTAA-CTG---AGAACGCTGC---TCTCCTAGCCC--GACTTTGG-GATGT----AGGGG--TGC-TGCGAACTT-----GTTTAT---CATGA--ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGC-------------CACCCACACCAAAGCCTTGCACGCTCAATATCTCGGTCGA--AATAGACTTGTGCTATTTCTCTC----------------------------GGGGTTG------------GGCT-TGCATT----------GGGTTCGAT----GAGGTGGTAATGTTGGCCTCCCGCGCAAGC----AAGT-GCAC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-TGCGCAGTGCGATCGGCGGTGGTTGCCAT--GCCCTCGGCGAATTAC--ATTGCACTTGCGGGATGCATGTTCGG-GAA-CTCC-TTTGC-------GACCC--------TAT-TGCGCTGCCTC-GCTTGTT---CC{CT}TCCGAGCGC------{ACG}ATGAGAAGACG{AT}{AT}AT-----CGAAGC--GACCCCAG-TCAGG{CT}GGGA{CT}CACCC-------------------------------CCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCTTGGTCGGATGTGGAACGGCGTC-TAGCCGGTCTGCCAATCGACTCAGGGCGTGGACCGACGCGGATTGTAGTGGTGGCCCAAGCCTGAGCCTTTGTTGTGCTTGTGGAGACGTCATCGCCGCGATCGTGGCTGGCAGCGCGCGCCT-CTGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GCGGGT-TGCACCGCCGACCGACCTTGATCTTTTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGG----- Begonia_samhaensis ---TTGT-CGATTCCTG-{AC}-{AG}{AG}AAT---GCAG-AACAACCCGC{AG}-AACTGGTTTATAAATTCTA{CG}CG--TCCTGCCT----CGTGC----GGGAA-CTGTGCGTG-GTGCGTCAG-ATCCCCGGAC--AGC-GCCC--------TGCGGGCGATGCGCGG{CT}--TCGC-{CG}CGGCCCACGCCCCC----------------TAACGAACCCC--GACGCGATCAGCGTCAAGGAA--CAATTAA-CTC---AGAACATGGCT--GCCCAT-GCCCC-GATTTCGG-GACAC----AAGGG--TCC-TGTGAA{CT}TT-----GGTCATT--TATCGAAACGACTCTCGACAATGGATATCTTGGCTCTCGCATCGACGAAGAACGAAGTGAAATGCGATACTTGGTGTGAATTGCATAATCCCGTGAACCATTGAGTTTTTGAACGCAAGTTGCGTCCGAAGCCTTCTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCACCGTTTGCCCCCCTTCCC{CG}TGCACCCTAAAA------------CCAACAAGGATCAGTCGG--TCCCTC--------GAAC--CAAGCA---GACTC---GCGCT-ACTTT--GTAGGGGTGGG-CTG-----TGTC-GGCCTTGGCGGGCCGGCAGGCGGTCAGGCTGGGGGGCGAAGTTGGCCTCCCATGCGGGC----AGCC-TCCC--GGTTGGCCTAAATTTGAGTTCTCGG{CT}ATCCTTGCAGCGCGATCAACGGTGGTAGCCAT--GCCCTCGACTGATCAC--GTTGCGCATGCGGGACGCGC--GCGG-GAA-CTCC-TCCAG-------GACCC--------TAA-TGCGCCTACTC-GCCGG---------ACGAGACC------GGTGAGGAGACGTCATAT---CGAAGC--GACCCCGGGTCGGGCGGGACCACCCA--------------------------------------------------------------------------------------------------------GAAA-ATGAAAAGGACTTTGAGAA{AG}AGAGTCAA{AG}{AG}AGTACTTGAAATTGTCGGGAGGGAAGCG{CG}ATGGG{AG}GCAGAC{GT}{GT}{GT}{GT}CGTC-C{GT}GTC-{CG}AT{CG}TGTA{AT}{CT}{AC}-C{AG}{CT}{CT}-GATC-{AT}GTCTGCC{AT}{AG}T{CG}{CG}ACTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_scapigera ------TGTCGATTCCT{AC}-----------CAG-AACGACCCGCG-AACC-GGTTAT-CAACCACACGA-TTCCCCAGCCA-GCGCT---GGGGAA-AGGCGGGGC-ACGCTGGTG-C--CGCGTTG--CGC-GCTCC--------GCGCGCGGCCG--TCC--CCGC-GCGCCTCGCCG----------------ACCGCAACGAACCCC--GACGCGAGTCGCGTCAAGGAA--CATGAAA-CTG---AGAGCGCGGA---TCCCAT-GCCCC-GGCTTCGG-GAAGC----AGGGA--TCT-CGCGCGCTT-----GCTCA----CGACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGTCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGTCCCCC-------TCACCGAAGAGGCCAA---------------------ATTC--GAGCTCCTGAAGC---AGTGCAG------TC-----TCTGCGC-----TT-GCG-TCGGGC---------GCTT-GGATTTGCAGCTC----GTTTGGA-----GGGGCGTCAAGGTTGGCCTCCCGCG-AAGC----AACC-TCGC--GGTTGGTCTAAAGTAGAGTGGTCGGCAT-CGCGCGGTGCGATCGACGGTGGTTTTGTA--GCCCTCGGCGAATTAC--GTCGCATGCGCGGGATGCG-GTGCGGAGAA-CTCC-ATACG-------GACCC--------TGC--TGATGATTGCC-GCCT-----CGCGGGTTCCCT-------GCGAGAAGGCGCTG------CGAAGC--GACCCCAGGTCAGG-GGGATTACCCG---------------------------------AAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGCCCCGGTCGGATGTGGAACGGCGC--GAGCCGGTCTGCCGATCGACTCGGGGCGTGGACCGACGCGGATCGTGGCGGCGGCCCAAGCCCGAGCCTTCGTTGAGCTCGCGGAGACGTCGTCGCGGCGATCGTGGAAGGCAGCGCGCGCCT-TCGGCGTGCTTAGGCATCAGC{AG}CGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGTAAACCCGCGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGG-TTCGAGTGCGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGC------- Begonia_scutifolia ----------------------------------------CGCGTAA-TGGT----------ATCTGC-TTTCCCAGCCA-GCCCCT--GGGGAA-AGGCGGGGC-GTGCTGGTG-A--CGGGTTC--CGC-GCCCC--------GCGCGCGGCCG--GCA--TAGC-GCGCCTCGCAG----------------ACCGTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--GATGTAA-CCG---AGAGTGCGGA---TCTCCT-GCCCC-GGCCCTGG-GAAGC----AGGGGG-TCT-AGCGCGCTT-----GCTCA----CGAAGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCA-TAGGCCCCC-------GCACCGAAAAGGCCAA---------------------GTTC--GAGCTCCCCAAGCGG-CGGGCAG------TTAG---TCTGC-------TT-GCG-TCGGTG---------GTTT-GGATTTGCATCTC----GTTCGGA-----GGGGCGGCAAGGTTGGCCTCCCGCGCGGGC----AATG-GCGT--GGTTGGTCTAAAGTAGAGTGCTCGGCAT-CGCGCGGTGCGATCGACGGTGGTTTCCTT--ACCCTCGGCGAATTAC--GTCGCACGCGCGGGATGCG-GCGCGGAGAA-CTCC-ATTCG-------GACCC--------TTCTTTTATGA-TGCCTTTCT-----CGCGG-TCCCCC-------GCG---AGGCGCTGC-----CGAAGC--GACCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_sericoneura ----TGT-CGAT-CCTG-A-GC{AG}{AG}{AT}---GCA{AC}-AACAACCCGCG-AACTAGTTTT-----CCAACG---TCCCGCTT----CGTGC----GGTAA-TGGC--AGG-GCGCGTCGG-AGCTGCGGCC--TGC-TTTT---------GTGCTGGCACT--CCC--TCGC-ACGCCTCTCGCCCCC----------------TAACGAACCCC--GACGCAAGTCGCGTCAAGGAA--TCTCAAA-CTC---ATAACGCGGC---TCCCTT-GCCCC-GATTTTGG-GACGC----AAGGG--TCC-TGCGAACTT-----GATCAAA--TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCACCCAAAAAAAAAA--------------------CCAA----CTCTC--------GGTC--GAAGTA---GACTC---GTGTT-GCTTT--GTCTGGG-----CTC-----AGTT-GGCGTTT----------AGGTGGTT----GGGGTGGCAACATTGGCCTCCCGTGTGGGC----AACC-TCGC--GGTTGGTCTAAATTTGAGTCCTCAGCGT-CTTGCGGCGCGATCGACGGTGGTTGTCAT--GCCTTC-ACGAATTAC--GTTGCGCTTGCGAGGCGCACGTT-GG-GAA-CTCC-TCGAC-------GACCC--------TAA-CGCGTCAGCTA-ATCGG---------ACAAGACC------GGCGAGCAGACGTTAT-----CGAAGC--GACCCCAGGT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_socotrana TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGCG-AACCGGTT-A-AGCTTCGAGCG--TCCTGCCT----CGTGC----GGGAA-CTGTGCGGG-GCGCGTCGG-ATCCGCGGAC--AGC-GCCC--------TGCGCGC-------GCC----GC-GCGGCCCGCGCCCCC----------------TAACGAACCCC--GGCGCGATCAGCGTCAAGGAA--CACGTAA-CTG---AGAACGCGGCT--TCCCCT-GCCCC-GATTTCGG-GACGC----GGGGGG-GCA-TGCGAAGTT-----GATCACG--TATCGAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCATGCCACCCC------GCACCCCGAAA------------CCAACAAGGACCGCTGGC--TCCCCC--------GGAC--GAAGCA---GGCTC---GTGCC-GCTTC--GCAGGGGCGGG-CTG-----CGCC-GGCCTTGGCGGG-----AGGGGGTC----GGGGAGGCGAAGTTGGCCTCCCGCGCGGGC----AGCC-TCGC--GGTTGGCCTAAATTTGAGTCCTCGGCGTCTTCGCAGCGCGATCGACGGTGGTAGCCAT--GCCCTCGACGAATCGC--GTCGCGCATGCGGGACGCGCTCGCGG-GAA-CTCC-TCCAG-------GACCC--------TAA-TGCGCCTGCTC-GCCGG---------ACGAGACC------GGCGAGGAGACGTCGTAT---CGAAGC--GACCCCAGGTCAGGCGGGACTACCCG-----------------------------GCCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGGC-GAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTCGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-ACGGCGTGCTTCGGCATCGGCGCGCTCCTGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGCGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCT{CT}TGAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCG------ Begonia_sp._Pritzelia -----GT-CGATTCCTG-C-AGAAT---GCA{AG}-AACAACCCGCG-AAC-TAGTTTGG----CCAGC{GT}--TCTCGTTT----CGCAC----GGGA--CGGCGCGGG-GCGTGCTGG-TGCTGTGGCC---GC-CTTT---------GTGCGCGCCCT--GCC--TGGT-ATGCCTTGCGCTCCCC--------------TTAACAAACCCC--GGCGCGAGTAGCGTCAAGGAA--TCTCGAA-CTC---AGAACGCACC---TCCCTC-GCCCC-GATTTTGG-GATGC----AGGAG--TGT-CGCGAACTT-----GATCATA--CATGAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------ACACCAAAAATAA----------------GAGGAGGTCAA---TGTCTC--------GATC--GAAGCA---GACTC---GCGCT-GCATC--GTCGCGG-----CTT-----GGCTC-GCCCTT----------GGGCGGTG----GTGGTGGCGACATTGGCTTCCCGTGGGGGC----GACC-TCGC--GGTTGGCCTAAATTTGAGTCCTTGGCGTTCTTGCGGCGCGATCGACGGTGGTTTCCAT--GCCCTCGACGAATCAC--ATTGCGCTTGCGAGATGC-TGCTGTT-GAA-CTCT-TGGAC-------GACCCTC---------------------------------------------------------AAATGTTAT-----CGAAGC--GACCCCAG-TCAGGCGGGATTACCCG-----------------------------------ATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGAG-TAGCCGGTCTGCCGATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCA-TTGGCGTGCTTCGGCATCAGCGTGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGACCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCATAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTC-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGC------- Begonia_staudtii GATCATTGTCGATTCCT-----------GCAG-AACAACCCGCG-AATT-GGTAAA-GAACAATCTAC-TTCCCCAGTCG-TAACT---AGGGAA-GGGCGGGGC-GTGCTGGTG-C--CGCGGTG--CGC-GCTGC--------GCGCT{CT}GGCCG--GCT--CGGC-ACTCCTCGCTG----------------ACCGTAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--CATCTAA-CCG---AGAGCGCGGA---TCCTCT-GCCCC-GGACCCCGGGAAGC----AGGGT--TCT-CGCGCGCTT-----GCAAA----CGACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCG-TAGTCCCCCCC-----GTACCGAAGAAGCCAA---------------------GCTA--GGGCTCCCGAAGC---AGAGC---------------------------TT-GCG-TCGGTA---------GCTC-GGATTTGCACCTC----GTTTGGA-----GGGGCGTCAA-GTTGGCCTCCCGCGCGACC----AGCT-GCGC--GGTTGGTCTAAGTTAGAGTGCTCGGCATTCGCGTGGTGCGATCGACG-TGGT-TCCTA--GCCCTCGGCGA---------------------------------------------------------------------------------------------------TTTGCCC-------GCGAGAAGGCGCTTT-----CGAAGC--GACCCCAGGTCAGGCGGGATTACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_subscutata ------TGTCGATTCCTGC-C{AC}{AT}{AT}{AT}---GCAG-AACAACCCGCG-AACCCGTCGTG-----CAACGA--ACCC--------CGCAA---GGGGAG-CGGCGAGGA--GTGTTGGGG------------------------------------------------CGC-ACGCCCCGCATTC-------CGCGCGCACCTTAACGAACCCCCCGGCGCGAGTCGCGTCAAGGAA--TATTTAA-CTG---AGAACGCGGC---TCCTCT-GCCCC-GCCTGCGG-GATGCATGCAGGGG--CGC-TGCGAGCTT-----GAGAATC--AAACAC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCGGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCC-------GCGCCAAAAAA-------TGC----------------TCGA--TCTC-TTC----------------------------------------TT-GGGGTCG------------GGCT-GGACTTT----------GGTCGGAC----GAGGGGGCGATGTTGGCCTCCCGTGCGAGC----GATC-GCGC--GGTTGGCCTAAAGTCGAGTCCTCGGCGT-CGCGCAGTGCGACCG-CGGTGGTTTTTAT-AGCCCTCGGCGAAATAC--GTTGCACGTGCGAGACGCGGTATCGG-GAA-CTCC-CACGC-------GACCC--------TGC-TGCGCTGCCCT-GCC-GTT-----CTCC--GAAC------GACGGGGAGGCGCTAT-----CGAAGC--GACCCCAGGTCAGG-GGGATTACCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_sutherlandii TCATTGT-CGATTCTTG-C-AAAAT---GCAG-AACAACCCGCG-AACTAGTTTG-CCCA-CAACGATGTCCTGCCA----CGCGC-----AGAA--GGCGTTG--GGGCGTCTA-AATTGTGGCC--CGT-GCTT-------GCGCGTGCGCCAT--GCCC-TCGA-ATGCCCCGCGCCCTCT--------------ATAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TATCGAACTTGTAAAGAACGCGG{CT}---TACCCT-GCCCC-AGTTTTGG-GACGT----AGGGTG-TCC-TGCGAACTT-----GATCG----CATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACC{AC}TCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCGTT{CT}TGGC-------------GCCTGGGCGT{CT}AC{AG}CATCG-TA{AG}CCCCCC-------GCACCCCAAAAAAAA----------------------------TCCCTC----GATCGATC--GAAGCTA--GACTC---GTGCT-GCTTC--GTCGTAGGG-----------GGCT-GGTT-------------GGCTGGTC----GGGGCGGAGATGTTGGCCTCCCGTGTGGGC----AACC-TCGC--GGTTGGCCTAAAATT-AGTCCTCGGCGT-CTTG{CT}GGCGCGATCGACGGTGGTTGTCAT--GGCCT{ACT}GACGAATTAC--ATTGCGCACGCGAGACTTGCTGTCTG-GAA-CTC--TAGATGACGAATGACCC--------T{AC}A-{CT}GCGTCGGCTT-GTCGG---------ACAACACTC-GT{AC}AGGCGAGCGGACGTTAT-----CGAAGC--GACCCCAG-TCA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Begonia_symsanguinea TCATTGT-CGATTCCTG-C-AAAAT---GCAG-AACAACCCGCG-AACAAGTTTTT----CCAATG---TCCCGCTG----CGCGC----GGGAA-TGGCGCGGG-GCGCGTCGG-AGTTGCAGCT--CGC-GCTT---------GCTCGAGCCCA--GCC--TCGCA-CGCCTCGTGCCCCC----------------TAACGAACCCC--GGCGCGAGTCGCGTCAAGGAA--TCTAGAA-CTT---AGAATGTTGA---TGCCCT-GCCCCAAATTTTGG-GACGT----AGGGG--TCT-TCTGATCTT-----GATCACA--TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGCCCCCT-------GCACCCAAAAAAAAAA------------CCAAG-T--CAA---TCCCTC--------GATC--GAA{AC}{CT}{AC}A--GACTC---GTGCT-GCTTC--GTTGTG------GTTTT----GTT-GGCCTTT----------GGGTGGTC----GGGGAGGCGACGTTGGCCTCCCGTGCGGGT----A{AG}C{CT}-TCGC--GGTTGGTCTAAATTTGAGTCCTCGGCGT-CTTGCGGCGCGATCGACGGTGGTTGTCAT--GCCCTCGACGAATTAC--TTTGCGCTTGCGAGACGCGTGCTTGG-GTA-CTCC-TCGTC-------GACCC--------TAAATGCGTCGACTC-GTT---------GGAC{AG}-CACC------AGCGAGAAGGCGTTAT-----CGAAGC--GACCCCAGGTCAGG--------------------GTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGAGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCTCGATCGTGGCTGGCAGCGCGCGCCC-ACGGCGTGCTTCGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGC------- Begonia_thomeana TC-TTGT-CGATTCCTG-{AC}--GAGA---GCAG-AACAACCCGCG-AACTCGT-CTG----CCATCT---TCCC---------GTGC----GGGAA-CGGCGGG---GCGCACCGG-AGCCGCGGCC--CGGGAGC-----------------------------------------------------CTCGCGCACC-TAACGAACCC---GGCGCGAGTCGCGCCAAGGAA--TGTTTAA-CTG---AGA{AG}CGCGGT---TCCTCT-GCCCC-GGCCTCGG-GAAGC----AGGGG--CGC-TGCGAACTT-----GCTCG----TCACGC-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TGGCCCCCC-------GCACCGAAAAGA{AC}C----------------GAGT---CCGA--TCTCCCCGCGACGCAAGCAGGCCCGTTCTGCC-A-C-TC--------GGGGGGGGGTTC{CT}----------GGT--GGCCTTT----------GGCCGGAC----GGGGCGGTAACGCTGGCCTCCCG{CT}GCGAGC----GATC-GCGC--GGTTGGCCCAAACTCGAGCGTTCGGTGT-CGCGCGGTGCGATCGGCGGTGGTTGCCGT--ACCCTCGGCGAATTAC--GTCGCACTCGCGGG-CGCG--ATCCC-GAGAATCC-{CT}TCAC-------GACC---------TCC-TGCGCTGC-TC-GTCGGCT----C{AC}TTCG-GAAC------GACGGG-AGGCGA{CT}GT-----CGAAGC--GACCCCAG-TCAGGTGG-AT-ACCC----------------------------------AAATCGGGCGGTAAATTC{CT}GTCCAAGGCTAAATA-CTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGGCCCGGTCGGATGTGGAACGGCGG--TAGCCGGTCTGCCAATCGACTCGGGGCGCGGACCGACGCGGATTGCGGCGGCGGCCCAAGCCCGAGCCTTCGTCGTGCTCGTGGAGACGTCGTCGCCGCGATCGTGGCTGGCAGCGCGCGCCC-TCGGCGTGCTTCGGCATCAGCGCGCTCCAGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCAACGGGCCAGCAAACCCGTGAGGCGCAAGGAAGCTGA{CG}TGGCGGGATCCCCTC-GCGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGG-TTCGAGTGCGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGA---- Begonia_violifolia --------CTTTCTATG-CGGAGAT---GCAG-A-C--CCCGCG-AATTAGTTTG-----CCAACG---TCCCGCTT----CGCGC----GGGAA-CGGCGCGTT-GCGCGTCGG-GGCAGCGGCT--CGC-CTTT---------GCGCGCGCCCT--GTC--TCGC-GCGCCTCGCGCCCCC----------------TAACGAACCCC--GGCGCAAGTCGCGTCAAGGAA--TCTCAAAACTC---ATAACGCGGC---TCCCTT-GCCCC-GTTTTCGG-GATGC----AGGGG--TCC-AGCGAAATTT----GATCA----TATCAA-ACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCG-TAGTCCCCC-------GCACCAAAAAAAGAAA--------------------CCAA----CCCTC--------GGTC--GAAGTA---GACTC---GTGCT-GCTTC--GTCAGGG-----CTT-----GGGT-GGCCTTC----------GTTTGGTC----GGGGTGGCGACATTGGCCTCCCGTGGGGGC----AACC-TCGC--GGTTGGCCTAAATTCGAGTCCTCGGCGC-CTTGCTGCGCGATCGACGGTGGTTTCTAT--GCCCTCGACGAATTAC--GTTGCGCTTGCGAGGCGCGCGCTCGG-GAA-CTCC-TCGAC-------GACCC--------TAA-CGCGTCGGCTG-GTTGG---------GCAACACC------GGCGAGCAGACGTTAT-----CGAAGC--GACCCCAGGTCAGGTGGGACTAC----------GATCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-TTGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAGAAAAGAGTCAAAGAGTACTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGCGCG-TAGCCGGTCTGCCAATCGACTCGGGGCGTGGACCGACGCGGATTGGGGCGGCGTCGCAAGCCCGGGCCTTTGTTGTGCTCGCGGAGACGTCGTCGCCCCGATCGTGGCTGGCAGCGCGCGCCA-ACGGCGTGCTTCGGCATCAGCGCGCTCCGGGCGTCGGCCTGCGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTTAACGGGCCAGAAAACCCGTGAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTC-GAGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGTGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCG------ Datisca_cannabina GATCATTGTCGATGCCTT---AAA---------AACAACCCGTG-AACGTGTTTT------CAAAA---TCGAGGGGG-T-GGGTCTC-GAGAGGGCCCTCACGTTCTTGTGCAGTGAGGCGGGCGTGCTGGCACCTGTCCCTTTACGGGCGTGGTCTGGCTCGTTC-CGTTCCTTCCTG--------------CAAACTAACGAACCTCC-GGCGCGGACTGCGCCAAGGAA--CAA-TAA-CA----ATAGCGCGGC----CCCTC-GCCCC-GATAACGG-TGTGC----GGGGG--CTGACGTGACCTG----TGATAT----TCATA--ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGAGGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGT{CT}TTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTG-TTGCCCCC--------ACGAACACAACC--------------------------------ATCTCTTT--------GAGGTGACTG--------------CATC--GT-------------------------------------------------------GG-GGGCAGATATTGGTCTCCCGTGCGCAT----TGTT-GTGT--GGTTGGCCTAAAA-CAAGACCTCGGCTT-CATTCGCCGCGACAAACGGTGGTTGTCAA-AGC-CTCAGCGTCCTGT------CACGTGTGTC-TGATGAAAAACCGAGG-TC--GAATA-------GACCC--------TTC-TGTGTCGACCTT------------------------------CGA-----CACTAT-----CGACGT--GACCCCAGGTCAGGCGGGACTACCCG-----TAGATCGGGTTGTTTGGGAATGCAGCCCCAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-CAGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGTGTT-GAGCCGGTCCGCCGATCGACTCGGGACGTGGACCGACGCGGATCGTGATGGCGGCCCAAGCCCGAGCCTTTGTTACGCTCGTGGAGACGTCGTCGTCGCGATCGTGGCTTGCAGCGCGCGCCTCATGGCGTGCTTCGGCATCTGCGCGCTCCTGGCGTCGGCCTGTGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GTGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAACATGCCTGTCCGGACC-GAAAGATGGTGAACTATGCCTGAGCG------ Datisca_glomerata GATCATTGTCGATGCCTT--AAAA---------AACAACCCGTG-AACGTGTTTT------CAATC---TCGGGTGTGCG-CGGGCTC-GAAAGAGCCCTCGCGCTCCCGCGCGGGGAGGCGGGCGTGCTAGCACCTATCCCTTTACGGGCGCGGTCTGGCTCGTTG-CGTTCCTTCTTG--------------CAAACTAACGAACCTCC-GGCGCGGACTGCGCCAAGGAA--CAA-TAA-CA----ATAGCGCGGC----CCCTC-GCCCC-GATACCGG-TGCGC----GTGGGG-TTGACGTGACATG----TGATAT----TCATA--ACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTG-TTGCCCCC--------ACGAACACAACC--------------------------------ATCTCTTT--------GAGGTGACTG--------------TATC--GT-------------------------------------------------------GG-GAGCAGACATTGGTCTCCCGTGCGCAT----TGCC-GTGT--GGTTGGCCTAAAA-CACGACCTCGGCTT-CATTCGCCGTGACAAACGGTGGTTGTCAA-AGC-CTCGGCGTCCTGT------CGCGTGCGTT-TGATGAAACATCGAGG-TC--TAATA-------GACCC--------TTC-TGCGTCGACCCT------------------------------CGA-----CGCTAT-----CGACGC--GACCCCAGGTCAGGCGGGACTACCCG------------------------------{CG}CCTAATCGGGCGGTAAATTCCGTCCAAGGCTAAATA-CGGGCGAGAGACCGATAGCAAACAAGTACCGCGAGGGAAAGATGAAAAGGACTTTGAAAAGAGAGTCAAAGAGTGCTTGAAATTGTCGGGAGGGAAGCGGATGGGGGCCGGCGGTGCGTCCCGGTCGGATGTGGAACGGTGTT-GAGCCGGTCCGCCGATCGACTCGGGACGTGGACCGACGCGGATCGCGATGGCGGCCCAAGCCCGGGCCTTTGTTACGCTCGTGGAGACGTCGTCGTCGCGATCGTGGCTTGCAGCGCGCGCCTCATGGCGTGCTTCGGCAACTGCGCGCTCCTGGCGTCGGCCTGTGGGCTCCCCATTCGGCCCGTCTTGAAACACGGACCAAGGAGTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTT-GTGGGT-TGCACCGCCGACCGACCTTGATCTTCTGAGAAGGGTTCGAGTGAGAGCATGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCG------ Hillebrandia_sandwicensis GATCATTGTCGATTCCTGC--AAAA---GCAG-AAAAACTCGCG-AACTCGGTTA--AAAACAAC----AC---TGTGGC-CCGTCGGCAAAAAAGT-CGGGGCGCGTCCGTGC--CGAGCACTT------------------TGCTTGCCCGGCC------GCGGC-GCCCCTCGCAAC--------------TC----AACGAACCCC--GGCGCAAGTCGCGCCAAGGAAACTC-TTAA-CTTTTCTTAA---GGC----ACGTT-GCCCC-GTTTTCGG-GACGAAC----GCTG-GTCTTGCGAAAGTGCTAGTATTATCACGCTCA--ACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACACATCG-TTGCCCCCC--------CGAAAAAAGATTT----------------------AAGGA--AAAATAGTTCGAATCCCGA---CTCCGACCGGGT-CGGCGGGATGCG---------CGCTGTTG----------------------------------------GAGGTGCTGAAGTTGGCCTCCCGTGCGTCG------TT-CGAC--GGTTGGCCTAAATTAGAGATCTCGGCGT-CGCGCGGTGCGATCGACGGTGGTTGCGAT--GCCCTCGGCGAAAAACAAGTTGCACTCGCGCGTCGCATCTCCGA-GAAGCTCCC-CGAT-------GACCC--------TCT-TGTTGTGCCGCGTCGCTTCCGGCTCCG-------------GACGACGCGCGCCTGCACCATCGAAGCGCGACCCCAGGTCAGGCGGGATCACCCG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET exclusion2 (CHARACTERS = 'nr ITS, 5.8S and 26S DNA') = 243-349 505-516 525-663 690-708 840-868; CHARSET ITS (CHARACTERS = 'nr ITS, 5.8S and 26S DNA') = 1-946; CHARSET exclusion (CHARACTERS = 'nr ITS, 5.8S and 26S DNA') = 1-28 49-194 529-651 869-891 934-990 1531-1541; CHARSET 26S (CHARACTERS = 'nr ITS, 5.8S and 26S DNA') = 947-1541; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2612] TITLE Morphology; LINK TAXA = Taxa1; DIMENSIONS NCHAR=45; FORMAT DATATYPE=Standard SYMBOLS= "0 1 2 3 4 5 6" MISSING=? GAP= -; CHARSTATELABELS 1 Tubers_derived_from_stem / absent present, 2 Tubers_derived_from_root / absent present, 3 Bulbils_derived_from_buds / absent present, 4 Tuberciles / absent present, 5 Caudex / absent present, 6 Leaf_shape / simple compound, 7 Peltateness / not_peltate peltate, 8 Trichome_ring / absent 'present - hairs' 'present - ridge', 9 Stipule_edge / entire fringed, 10 Fuzzy_hairs / absent present, 11 Stellate_hairs / absent present, 12 Lifestyle / perennial monocarpic, 13 Inflorescence_position / axile terminal 'pseudo-terminal', 14 Sexual_separation / dioecious monoecious, 15 Inflorescence_type / monochasial_cyme dichasial_cyme raceme, 16 Dichasia / symmetric asymmetric, 17 'Flowers - Inflorescence' / less_than_70 over_100, 18 'Inflorescence - sexual separati' / staminate_and_pistillate_interspersed pistillate_basal separate_inflorescences, 19 Flower_size / male_and_female_similar female_distinctly_larger, 20 'Flower colour - base' / white_or_pink yellow red orange, 21 'Flower colour - pattern' / all_one_colour with_red_veins_or_patches tepals_different, 22 Scent / imperceptible strong, 23 Perianth_tube / absent present, 24 'Male - tepal no.' / 2_tepals 4_tepals 0_tepals 10_tepals, 25 Male_tepal_fusion / free partly_fused, 26 Androecium / anthers_face_all_ways anthers_face_2_ways anthers_face_one_way anthers_face_inwards, 27 Stamen_no. / less_than_10 10_or_more, 28 Stamen_colour / yellow orange red, 29 Stamen_fusion / free fused_in_centre fused_at_one_side on_a_column, 30 Female_tepal_no. / 2_tepals 3_tepals 4_tepals 5_tepals 6_tepals 0_tepals 10_tepals, 31 Female_tepal_fusion / free 2_tepals_partly_fused all_tepals_partly_fused, 32 Style_no. / 2_styles 3_styles 4_styles '(5-) 6 (-7) styles' 5_styles, 33 Style_colour / yellow greenish white pink red, 34 Style_fusion / free fused, 35 Ovary_position / inferior 'semi-inferior', 36 Locule_number / 1_locular 2_locular 3_locular 4_locular '5- 6 -7 locular', 37 Placentation / parietal septal axile, 38 'Placentation - dividedness' / '1-fid' '2-fid', 39 Wing_no. / absent 2_wings 3_wings 4_wings ca._6, 40 Wing_symmetry / equal_to_subequal one_larger, 41 'Fruit dry-fleshy' / dry fleshy, 42 Fruit_orientation / upright pendant_to_nodding recurved, 43 Beaked_fruit / absent present, 44 Dehiscence / not_between_styles between_styles, 45 Bracteole_subtending_ovary / absent 2_bracteoles 3_bracteoles, ; MATRIX [ 10 20 30 40 50 ] [ . . . . . ] Begonia_aequata 000000000000012?0??0?00??????001010221200?000 Begonia_angularis 000000000000011010000001001003010102202101001 Begonia_ankaranensis 00000000?0?0?1100??0??0000????????0?2?2???00? Begonia_annobonensis 00000001000101?00000000100000{34}0100022{01}2101001 Begonia_aspleniifolia 000000001000010?00?010000?00300101022020?1000 Begonia_balansana 0000000?1000011000000?0100100203010421401?00? Begonia_bogneri 00000000000001??000000010000{23}4010102{02}1{25}111000 Begonia_capillipes 000000000010011002000001000?32004101010?1?000 Begonia_cinnabarina 01000000110001??0??3??0?0?????????02212?0100? Begonia_convolvulacea 000000000000011010000001001003010002202101001 Begonia_crassirostris 00000000000001?000000001001004011002212011000 Begonia_dewildei 000000101000010?00000000020020020103203000000 Begonia_dipetala 000000000000011000000000021010010{01}02202001000 Begonia_dregei 0000?0000000011000000000001013010002202001000 Begonia_dregei_partita 0000?00000000110000000000?10?3010?022?200100? Begonia_dregei_ssp_homonyma 0?00100000000110000000000?10{01}3010?022?200100? Begonia_duncanthomasii 000000101000010?000110000210200201032?30?000? Begonia_edmondoi 0?000000???0?11?00?0??010?10?3010?022?2001001 Begonia_engleri 00000001000001100000000100101401010221210100{12} Begonia_floccifera 000000000000011000000000001032?1?102202??100? Begonia_francoisii 000000000000?1100??0??00??????????022?200?00? Begonia_gabonensis 000000000010011000000001020032010102010?1?000 Begonia_geranioides 0100?00????001100000??01???????1??0220200100? Begonia_goegoensis 000000100000011000002001001032000101202101000 Begonia_grandis 1001000{01}000001100000010100103301010221200?000 Begonia_holtonis 00000000000021101??0000100100?01??022{01}210100? Begonia_horticola 00000000001001100200?001001?320{12}?10{23}0?0?1?00? Begonia_incarnata 0000000000000110000000010?1?{01}3011102212101000 Begonia_integerrima 000000000000011????0??0100???301?00221210?00? Begonia_iucunda 1001000?10?001??0{02}01?00002101001010220210100? Begonia_johnstonii 000000010000011000000001001013010002212101001 Begonia_kisuluana 00000000?01001100200?001021?320{12}{04}10{23}0?0?1?00? Begonia_letouzeyi 000000101000010?0001{01}0000210300201032?301{01}000 Begonia_lobata 000000000100?11???????0???????????0????????0? Begonia_longipetiolata 00000000001001?00200100102102202{04}1030?0?1?000 Begonia_loranthoides 00000000001001100200?00101102202?1030?0?1?00? Begonia_luxurians 000001?10100011010000001001003010002202001001 Begonia_madecassa 00000000000001100??0??0??????????1022?2101000 Begonia_malabarica 000000000000011000000001001011010002212101000 Begonia_mananjebensis 00000000???001100??0??00?0????????022?200?00? Begonia_mannii 000000000010011002001001001{02}12024003110?1?001 Begonia_masoniana 000000000000011000?0000100101101010001210100? Begonia_meyerijohannis 0000000000000{01}100200?10100100{02}040005{01}00?1?001 Begonia_molleri 000000000010011002000001001032020103010?1?00? Begonia_nossibea 00000000?0?001100??0??00?0???2???0022?200?00? Begonia_obliqua 000000000100011000000001001003010102212101001 Begonia_olbia 000000010000?110???0??0???????????02212?0100? Begonia_palmata 000000000000011000000{01}01001033000101212102000 Begonia_poculifera 00000000001001?002001010021020020103010?1?00? Begonia_potamophila 00000010100001??0001{01}?000210?00{12}?10{23}2?{23}00000? Begonia_prismatocarpa 000000001000010?0001100002103002010320{03}01{01}00? Begonia_quadrialata 000000101000010?0001100002103002010320300000? Begonia_roxburghii 00000000000000?00200010100100?????0???????00? Begonia_salaziensis 00000000001001100000??010?101201{02}00???0?1?000 Begonia_samhaensis 0?1000100000111000000001001004010002202001001 Begonia_scapigera 000000101000010?00011000001020020103200?0000? Begonia_scutifolia 000000101000010?0001100002102002010320300?000 Begonia_sericoneura 000000000100011000000000001002010002212101001 Begonia_socotrana 001000100000111000000001011004010?0220210100? Begonia_sp._Pritzelia 000000000000?11???????0???????????0????????0? Begonia_staudtii 000000100000010?0001100002103002010320300000? Begonia_subscutata 00000000001001??0{02}001001030032010102010?1?00? Begonia_sutherlandii 100?000010000110000{13}0001001003010102202001000 Begonia_symsanguinea 000000000000012001020000101213213102212001000 Begonia_thomeana 00000000100001100001??00021020010102202101000 Begonia_violifolia 0000000000000110001000000?1030010101212101000 Datisca_cannabina 00000100?000102???0??002?00005?1?000000?0?010 Datisca_glomerata 00000100?000?02???0??002?0?005?1?000000?0?010 Hillebrandia_sandwicensis 000000010?0001100000??03?0??06?4?01?010???01? ; END; BEGIN SETS; CHARSET poor_morphology (CHARACTERS = Morphology) = 21 25 27 45; CHARSET exclusion (CHARACTERS = Morphology) = 45; CHARSET morphology (CHARACTERS = Morphology) = 1-45; END; BEGIN TREES; TITLE Tb7191; LINK TAXA = Taxa1; TRANSLATE 1 Begonia_symsanguinea, 2 Hillebrandia_sandwicensis, 3 Datisca_glomerata, 4 Datisca_cannabina, 5 Begonia_masoniana, 6 Begonia_malabarica, 7 Begonia_sp._Pritzelia, 8 Begonia_lobata, 9 Begonia_angularis, 10 Begonia_violifolia, 11 Begonia_thomeana, 12 Begonia_sutherlandii, 13 Begonia_subscutata, 14 Begonia_staudtii, 15 Begonia_socotrana, 16 Begonia_sericoneura, 17 Begonia_scutifolia, 18 Begonia_scapigera, 19 Begonia_samhaensis, 20 Begonia_salaziensis, 21 Begonia_roxburghii, 22 Begonia_quadrialata, 23 Begonia_prismatocarpa, 24 Begonia_potamophila, 25 Begonia_poculifera, 26 Begonia_palmata, 27 Begonia_olbia, 28 Begonia_obliqua, 29 Begonia_nossibea, 30 Begonia_molleri, 31 Begonia_meyerijohannis, 32 Begonia_mannii, 33 Begonia_mananjebensis, 34 Begonia_madecassa, 35 Begonia_luxurians, 36 Begonia_loranthoides, 37 Begonia_longipetiolata, 38 Begonia_letouzeyi, 39 Begonia_kisuluana, 40 Begonia_johnstonii, 41 Begonia_iucunda, 42 Begonia_integerrima, 43 Begonia_incarnata, 44 Begonia_horticola, 45 Begonia_holtonis, 46 Begonia_grandis, 47 Begonia_goegoensis, 48 Begonia_geranioides, 49 Begonia_gabonensis, 50 Begonia_francoisii, 51 Begonia_floccifera, 52 Begonia_engleri, 53 Begonia_edmondoi, 54 Begonia_duncanthomasii, 55 Begonia_dregei_partita, 56 Begonia_dregei_ssp_homonyma, 57 Begonia_dregei, 58 Begonia_dipetala, 59 Begonia_dewildei, 60 Begonia_crassirostris, 61 Begonia_convolvulacea, 62 Begonia_cinnabarina, 63 Begonia_capillipes, 64 Begonia_bogneri, 65 Begonia_balansana, 66 Begonia_aspleniifolia, 67 Begonia_annobonensis, 68 Begonia_ankaranensis, 69 Begonia_aequata; TREE Molecular = [&R] (((((((((((69,1),5),((((65,(60,26)),21),46),(((58,51),47),((19,15),6)))),((57,(56,55)),(48,12))),((((61,((35,(9,8)),7)),((45,28),27)),43),(16,10))),(62,53)),42),(((((((68,33),(50,29)),20),64),34),31),(((66,((59,(((24,22),17),23)),(((54,38),18),14))),41),((((((((63,49),39),44),13),32),30),(37,(36,25))),11)))),(67,(52,40))),2),(4,3)); END; BEGIN TREES; TITLE Tb7190; LINK TAXA = Taxa1; TRANSLATE 1 Begonia_symsanguinea, 2 Hillebrandia_sandwicensis, 3 Datisca_glomerata, 4 Datisca_cannabina, 5 Begonia_masoniana, 6 Begonia_malabarica, 7 Begonia_sp._Pritzelia, 8 Begonia_lobata, 9 Begonia_angularis, 10 Begonia_violifolia, 11 Begonia_thomeana, 12 Begonia_sutherlandii, 13 Begonia_subscutata, 14 Begonia_staudtii, 15 Begonia_socotrana, 16 Begonia_sericoneura, 17 Begonia_scutifolia, 18 Begonia_scapigera, 19 Begonia_samhaensis, 20 Begonia_salaziensis, 21 Begonia_roxburghii, 22 Begonia_quadrialata, 23 Begonia_prismatocarpa, 24 Begonia_potamophila, 25 Begonia_poculifera, 26 Begonia_palmata, 27 Begonia_olbia, 28 Begonia_obliqua, 29 Begonia_nossibea, 30 Begonia_molleri, 31 Begonia_meyerijohannis, 32 Begonia_mannii, 33 Begonia_mananjebensis, 34 Begonia_madecassa, 35 Begonia_luxurians, 36 Begonia_loranthoides, 37 Begonia_longipetiolata, 38 Begonia_letouzeyi, 39 Begonia_kisuluana, 40 Begonia_johnstonii, 41 Begonia_iucunda, 42 Begonia_integerrima, 43 Begonia_incarnata, 44 Begonia_horticola, 45 Begonia_holtonis, 46 Begonia_grandis, 47 Begonia_goegoensis, 48 Begonia_geranioides, 49 Begonia_gabonensis, 50 Begonia_francoisii, 51 Begonia_floccifera, 52 Begonia_engleri, 53 Begonia_edmondoi, 54 Begonia_duncanthomasii, 55 Begonia_dregei_partita, 56 Begonia_dregei_ssp_homonyma, 57 Begonia_dregei, 58 Begonia_dipetala, 59 Begonia_dewildei, 60 Begonia_crassirostris, 61 Begonia_convolvulacea, 62 Begonia_cinnabarina, 63 Begonia_capillipes, 64 Begonia_bogneri, 65 Begonia_balansana, 66 Begonia_aspleniifolia, 67 Begonia_annobonensis, 68 Begonia_ankaranensis, 69 Begonia_aequata; TREE Fig._2 = [&R] (((((((((((69,1),5),((((65,(60,21)),26),(((58,51),47),((19,15),6))),46)),(((57,(56,55)),12),48)),((((61,((35,(9,8)),7)),42),43),(16,10))),((45,28),27)),(62,53)),((((((68,((50,29),33)),20),64),34),31),((((66,((59,(((24,22),17),23)),(((54,38),18),14))),11),41),(((((((63,49),13),39),44),32),30),(37,(36,25)))))),(67,(52,40))),2),(4,3)); END;