#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:18 GMT TreeBASE (cc) 1994-2008 Study reference: Meeboon J., Hidayat I.-., & Takamatsu S. 2012. Setoidium castanopsidis, a new species of anamorphic Cystotheca (Ascomycota, Erysiphales) from Indonesia. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13331] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=55; TAXLABELS Arthrocladiella_mougeotii_ex_Lycium_AB022379 Arthrocladiella_mougeotii_ex_Lycium_AB329690 Blumeria_graminis_ex_Bromus_AB022362 Blumeria_graminis_ex_Hordeum_AB022399 Blumeria_graminis_ex_Triticum_AB022376 Byssoascus_striatisporus_U17912 Caespitotheca_forestalis_ex_Schinopsis_AB193467 Cystotheca_lanestris_ex_Quercus_AB022353 Cystotheca_wrightii_ex_Quercus_AB022355 Erysiphe_abbreviata_ex_Quercus_AB271785 Erysiphe_adunca_ex_Salix_AB022374 Erysiphe_alphitoides_ex_Quercus_AB257431 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 Erysiphe_arcuata_ex_Carpinus_AB252473 Erysiphe_australiana_ex_Lagerstroemia_AB022407 Erysiphe_epigena_ex_Quercus_AB292720 Erysiphe_glycines_ex_Desmodium_AB022397 Erysiphe_gracilis_ex_Quercus_AB022357 Erysiphe_hypophylla_ex_Quercus_AB292715 Erysiphe_japonica_ex_Quercus_AB022415 Erysiphe_javanica_ex_Castanopsis_javanica_MUMH5153 Erysiphe_mori_ex_Morus_AB022418 Erysiphe_paeoniae_ex_Paeonia_AB257438 Erysiphe_pulchra_ex_Swida_AB022389 Erysiphe_simulans_ex_Rosa_AB022395 Erysiphe_trinae_ex_Quercus_AB022350 Golovinomyces_adenophorae_ex_Adenophora_AB077632 Golovinomyces_cichoracearum_ex_Solidago_AB077650 Golovinomyces_orontii_ex_Veronica_AB077651 Golovinomyces_sordidus_ex_Plantago_AB077657 Leveillula_saxaouli_ex_Haloxylon_AB080469 Leveillula_sp_ex_Chondrilla_AB080478 Leveillula_taurica_ex_Artemisia_AB080470 Microiduim_phyllanthi_ex_Phyllanthus_AB120754 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369 Neoerysiphe_galii_ex_Galium_AB329682 Oidium_aloysiae_ex_Aloysia_AB329683 Oidium_baccharidis_ex_Baccharis_AB329684 Oidium_maquii_ex_Aristotelia_AB329686 Parauncinula_septata__ex_Quercus_AB183533 Parauncinula_septata_ex_Quercus_AB022420 Phyllactinia_fraxini_ex_Syringa_AB080436 Phyllactinia_guttata_ex_Diospyros_AB022372 Pleochaeta_shiraiana_ex_Celtis_AB022403 Podosphaera_filipendulae_ex_Filipendula_AB022384 Podosphaera_longiseta_ex_Prunus_AB022423 Podosphaera_pannosa_ex_Rosa_AB022347 Podosphaera_tridactyla_ex_Prunus_AB022393 Podosphaera_xanthii_ex_Melothria_AB022410 Sawadaea_nankinensis_AB353763 Sawadaea_polyfida_ex_Acer_AB022364 Sawadaea_tulasnei_ex_Acer_AB022366 Setoidium_sp._ex_Castanopsis_javanica_MUMH5123 Setoidium_sp._ex_Castanopsis_javanica_MUMH5147 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=10; TAXLABELS Cystotheca_lanestris_ex_Myrica_californica_AF011288 Cystotheca_lanestris_ex_Quercus_agrifolia_AB000933 Cystotheca_lanestris_ex_Quercus_agrifolia_AF011289 Cystotheca_lanestris_ex_Quercus_sp._AF073354 Cystotheca_tjibodensis_ex_Castanopsis_argentea_JN807325 Cystotheca_tjibodensis_ex_Castanopsis_argentea_JN807326 Cystotheca_wrightii_ex_Quercus_glauca_AB000932_JPN Setoidium_nankinensis_ex_Acer_buergerianum_AB353763 Setoidium_sp._ex_Castanopsis_javanica_MUMH_5123 Setoidium_sp._ex_Castanopsis_javanica_MUMH_5147 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14204] TITLE Setoidium_55_taxa_28S; LINK TAXA = Taxa1; DIMENSIONS NCHAR=818; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Arthrocladiella_mougeotii_ex_Lycium_AB022379 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGG-CCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTGTTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTACGTGAGAACCCGTA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTACCAGCAT----------- Arthrocladiella_mougeotii_ex_Lycium_AB329690 AAGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGCGG-CCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGACCCTAGGAACGTAGCTCCCTTC----GGGGCGTGTTATAGCCTAGGGTGCAATGCAGCCTACCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_ex_Bromus_AB022362 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGATCCAT---TAGGAGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGCG-ACGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACCTGTGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATA------AGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Blumeria_graminis_ex_Hordeum_AB022399 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACC-CAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGGT---TACGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTA-GTGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGAGTACTCAGTGCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACC------------------------------------------------------------------------------------------------------------------------------------------------------- Blumeria_graminis_ex_Triticum_AB022376 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCCGTT---TACGGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGTG-GCGAGTCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTATGCGGCCGGGTGCTCGATGCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCAGTGCGCAGGCCAGCATCAGTTTGGGTGGTTGGATAAAGACTTGTGGAATGTAGCTCCTTTC----GGGGAGTGTTATAGCCACAGGTGCCATGCGACCAACCCGGACTGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATA------AGGGGGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Byssoascus_striatisporus_U17912 ----------------------------------------------------------AAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTT---TG-GGGTCCGAGTTGTAATTTGGAGAAGATGCTTCGGGT-ACGGTCCCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGGTG-GCCGTGCCCGTGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCCATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCCTGGGTTCG-CCCGGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTCGGGAACGTGGCTCCCCTC----GGGGAGTGTTATAGCCCGAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Caespitotheca_forestalis_ex_Schinopsis_AB193467 TTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGTCTGTC---GTCAGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GCGGGCCCGGCCTAAGTTCCTTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CTCGTGCCCGGGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTACCGATCACCCAGAGTTCTGCTCTGGTGCACTCGGTAGCGTACAGGCCAGCATCGGTTCGGGCGGTCGGACAAGGGCCGTAGGAATGTATCTCTCCCTCACGGAAGAGTATTATAGCCTACGGCGCCATACGGCCTGCCTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTGAAACCCATACGCGAAATGAAAGTGAACGTAGGTGAGAACCCCGT--CAAACGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAGGAGCATAGCTGTTGGGA Cystotheca_lanestris_ex_Quercus_AB022353 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TG-GAGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-ATGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTTGTCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCTGGGGTTCT-CCCCGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGAGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCTCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Cystotheca_wrightii_ex_Quercus_AB022355 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CG-GGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCGGGGTTCT-CCCCGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGTGAGGGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCCCTCGCGTCATGCAGCCTACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_abbreviata_ex_Quercus_AB271785 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGACTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGTGCTGCCGATCACCCGGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG--------------------------------------------------------------------------------- Erysiphe_adunca_ex_Salix_AB022374 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGCAGCTTTGGGTTGTGGGACCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCACCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACACCACTGATCCGCGAGGGTTCT-CTCTCGGGCACTCGGTGGGGTACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCCGAAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTTCGGTGCAATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTA-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCCT-----CGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_alphitoides_ex_Quercus_AB257431 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGTCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTGGCTCCCTTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-------------------------------------------------------------------------------------------------------------------- Erysiphe_aquilegiae_ex_Cimicifuga_AB022405 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGCTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCATGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAATGTAGCTCTCTTC----GGGGAGTGTTATAGCCCACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTT-----TGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_arcuata_ex_Carpinus_AB252473 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCTGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGTTCT-CTCTGGGGCACTCGACAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTGCGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACG{CT}AGGTG--------------------------------------------------------------------------------- Erysiphe_australiana_ex_Lagerstroemia_AB022407 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTGGTAACG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGG-CTTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACTAGACTTGGGCATCGCTGATCATCCGGGGGTAT-CTCCGGTGCACTCGACGATGCACAGGCCAGCATCGGTTTGGATGGTTGGATAAAGGCTGTGGGAACGTGGCTCCTTTC----GAGGAGTGTTATAGCCCACGGTGCAATGCAGCCCATCCGGACCGAGGACCGCGCCCTTCGGGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT-----TGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_epigena_ex_Quercus_AB292720 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCTCC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCCTT-----TGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_glycines_ex_Desmodium_AB022397 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGATTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGTTGATCATCTAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCTAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCTCTT----GGGGAGTGTTATAGCTTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGCAGGTGAGAACCCCTT-----TGGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_gracilis_ex_Quercus_AB022357 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCACTGCTGATCATCCAGAGGTTCCCTCTGGTGCACTCAGTAGTGCACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTTTCG--GGGGAGTGTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATC-ACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_hypophylla_ex_Quercus_AB292715 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTC---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGCGG-CCCGCGCCTATGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCCGATCACCCCGAGTTCT-CTCGAGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTGGGAACGTGGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATACGCGGAATGAAAGTGAACGT-------------------------------------------------------------------------------------- Erysiphe_japonica_ex_Quercus_AB022415 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAA--------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCTGATCATCCAGAGTTCT-CTCTGGTGCACTCGACAGCGCGCAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCAGAGGAACGTAGCTACCTTTCGGGGGAGTGTTTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_javanica_ex_Castanopsis_javanica_MUMH5153 -------------------------------------------------------------------------------------------GAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---CG-GAGTGCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGGCCCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATGGGTTCGGGTGGCTGGACAAAGACCGGAGGAACGTAGCTCCCTTTCGC-GGGGAGTGTTATAGCCTCTGGTGCCATACAGCCCAACCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_mori_ex_Morus_AB022418 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCGT---CG-GAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGACCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGCTGCTGATCATCCAGAGTTCT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGATGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCTCTCG--GGGGAGTGTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGCAGGTG--------------------------------------------------------------------------------- Erysiphe_paeoniae_ex_Paeonia_AB257438 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCTGCGCCTGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGGGCACTGCCGATCACCCTGAGTTCT-CTCAGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-A------------------------------------------------------------------------------------------------------------------ Erysiphe_pulchra_ex_Swida_AB022389 TTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGTGATGGGTTCGGCCTAAGTTCCTTGGAATAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCCGAGG-CCCGCGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGCTGCCGATCACCCAGAGTTTT-CTCTGGTGCACTCGACAGCGCACAGGCCAGCATCGGTTCGGGTGGCTGGATAAAGGCCGTAGGAACGTAGCTCCCCTC----GGGGAGTGTTATAGCCTACGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAATGTAGGTGAGAACCCCTT-----TGGGGCGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_simulans_ex_Rosa_AB022395 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCA-CCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CG-GAGTCCGAGTTGTAATTTGGAGAAGATGCTTTGGGCTGTGGGTTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCTGAGG-CCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGACGCTGCCGATCATTCCGAGTTCT-CTCTGATGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGCAGAAAGACCGGAGGAACGTAGCTCCCCCCTCGGGAGGAGTGTTATAGCCTCTGGTGCCATACAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AACCCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTC------GGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Erysiphe_trinae_ex_Quercus_AB022350 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTGACAGCTCAAATTTGAAATCTGGCTCCGT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGAATCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGAGG-TTTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGCC---AGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCTACCAGACTTGGGCGCTGCCGATCATCCCGAGTTCT-CTCTGGTGCACTCGACAGCGTACAGGCCAGCATCGGTTCGGGTGGCTGGAGAAAGACCGGAGGAACGTAGCTCCCCTTCG--GGGCAGTGTTATAGCCTCTGGTGCCATGCAGCCCAGCCGGACCGAGGACCGCGCCTTC--GGGTTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTTACATCAATGCGAGTGTTTGGGCGTG-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTTGTAAAGGGGGTGCATCATCGACCGATCCTGATGT?TTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_adenophorae_ex_Adenophora_AB077632 TTGACCTCGAATCAGGTAGGGATACCCG------------------------------------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CG-GAGTCCGAATTGTAATTTGTAGAAGATGCTTTGGGAGGTCGGCGCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-CCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCATCCGGACCGAGGACCGCGCCTTT--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_cichoracearum_ex_Solidago_AB077650 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTTC---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGTAGGGCCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-CCTACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCGAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTCGGGCGCAATGCAACCCATCCGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGACGGATTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_orontii_ex_Veronica_AB077651 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-CCTCCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCTCTTC----GGGGAGTGTTATAGCCTAGGGCGTAATGCAGCCCATCGGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCATC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Golovinomyces_sordidus_ex_Plantago_AB077657 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTG---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGAGGGAGGCTCGGCCTAAGTTCCTTGGAACAGGACATCAGAGAGGGTGAGAATCCCGTATGTGGCCGTGG-TCTCCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTCGTCGATCATCCGAGGTTCT-CCTCGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTTGGATGGTTGGAGAAAGGCTCTAGGAACGTAGCTCGCTTC----GGGGAGTGTTATAGCCTAGGGCGGAATGCAGCCCATCTGGACCGAGGACCGCGCCTTC--GGGCTAGGATGCTGGCGTAATGGTTGCAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTC------TGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGG- Leveillula_saxaouli_ex_Haloxylon_AB080469 TTGACCTCGAATC-----------------------------------------------------------------------------------------TAACAGCTCAAATTTGAAATCTGGCTCCCT--GCG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGACGCAATACCGCCTACTCCGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCAT----------------------------------------------------- Leveillula_sp_ex_Chondrilla_AB080478 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGTGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGAGTGGTGGGAGAAAGGACGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGTAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTT---------------------------------- Leveillula_taurica_ex_Artemisia_AB080470 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCGCGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-CGCCTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTC-CTTTGGTGCACTCGGCGAGGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTCGTGGGAACGTAGCTCCTTTC----GGGGAGTGTTATAGCCTGCGGCGCAATACCACCTACTCCGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCA-AAACCCATACGCGCAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGAT--------------------------------------- Microiduim_phyllanthi_ex_Phyllanthus_AB120754 ----------------------------------------------------------------------------------------------------------AGCTCAAATTTGAAATCTGGCTCCTT---TG-GAGCCCGAGTTGTAATTTGTAGAAGACGCTTTGGGTTGTGGGCTTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGTCGAGACCCTACGCCTATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCACCCAGACTTGGGCGTTGTTGATCATCCGAGGTTCTGCCTCGGTGCACTCGACAATGTGCAGGCCAGCATCGGTTTGACTGGCTGGACAAAGGTCCTAGGAACGTAACTCCTCGC----GGGGAGTGTTATAGCCTAGGGCGTCATGCAGCCCAGTCGGACCGAGGACCGCGCCTTTT-GGGCTAGGATGCTGGCGTAATGGGTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTT-----TAGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_cumminsiana_ex_Cacalia_AB329669 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCATCCGAGGTTCT-CCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGA----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------TGGGGGCATCATCGACCGATCCTGAAGTCTTCGGA--GATTTGAGT------------------- Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCTGCGGCCGTGA-CCTGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCACAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCTTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGTAATGCAGCCCATCTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------TGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGATTTGAGTAAGAGCATAGCTGTTGGGA Neoerysiphe_galii_ex_Galium_AB329682 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGCAGGTTTGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATAGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGTGGATCATCCGAGGTTCT-CCTCGGTGCACTCGACGACGCGCAGGCCAGCATCGGTTCGGATGGCTGGAAAAAGGTCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCAACTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACG--------------------------------------------------------------------------------------- Oidium_aloysiae_ex_Aloysia_AB329683 -------------------------------------------------------------------------------------AACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGGTAGGTTCGGTCTAAGTTCCCTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCACCCGAGGTTCT-CCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGTAATGCAGCCCACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------TGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGATTTGAGTAAGAGCATAGCTGTTGGGA Oidium_baccharidis_ex_Baccharis_AB329684 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG-------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGGACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-TCTATGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCATCCGAGGTTTT-CCTCGGTGCACTCGATGATGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCATCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTA------TGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGATTTGAGTAAGAGCATAGCTGTTGGGA Oidium_maquii_ex_Aristotelia_AB329686 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGG----------------------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTTGTAGGTTCGGTCTAAGTTCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGCCGTGA-CCTGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCATGGATCACCCGAGGTTCT-CCTCGGTGCACTCGATGACGCGCAGGCCAGCATCGGTTTGGATGGCTGGAAAAAGGCCCTAGAAATGTAGCTCCTCGC----GGGGAGTGTTATAGTCTAGGGCGCAATGCAGCCCACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCACCCGTATGGGGGGGCATCATCGACCGATCCTGAAGTCTTCGGACGGATTTGAGTAAGAGCATAGCTGTTGGGA Parauncinula_septata__ex_Quercus_AB183533 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTCAGTAACGGCGAGTGAAGCGGTACAAGCTCAAATTTGAAATCTGGCGCCCT---CG-GCGTCCGAGTTGTAATTTGTAGACGATGCTTTGGGCTG-GGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCGGGCTTCGGGCCCGGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTAGAGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTC----GGCTAGGATGTTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGC-AAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGA------AGGGTGCATCATCGACCGATTCTGATGTCT----------------------------------- Parauncinula_septata_ex_Quercus_AB022420 TTGACCTCGGATCA--------------------------------------------------------------------AGTAACGGCGAGTGAAGCGGTACTAGCTCAAATTTGAAATCTGGCGCCCT---CG-GCGTCCGAATTGTAATTTGTAGACGATGCTTTGGGTAG-GGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGGCAGGTGCCCCCCGCCCGTGTAAAGCTCGTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGGGGGCCGTGGATCATCCAGGCTTCG-GGCCTGTGCACTCGGCGGCCCACAGGCCAGCATCGGTTCGGGTGGTTGGAGAAAGGCCCTAGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCTAGGGCGCCATGCAGCCTACCTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGGT-AAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTGA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGAT------------------------- Phyllactinia_fraxini_ex_Syringa_AB080436 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTCGGCCCGGTCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGGG-TGGGTGCTCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTCGCTGATCATCCAAAGTTTT-CTTTGGTGCACTCGACGACGTACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGGTTGTAGGAACGTAGCTCTTTTC----GGGGAGTGTTATAGCCTGCGACGCAATGCCGCCTACCCTGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCTTC-----GAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGA Phyllactinia_guttata_ex_Diospyros_AB022372 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCCTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT--GCG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCACGATCCGGCCTAAGTGCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCCGGTT-TCGACGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCATCGCTGATCATCCAAAGTTCT-CTTTGGTGCACTCGACGATGCACAGGCCAGCATCGGTTGGGGTGGTGGGAGAAAGACTGCAGGAACGTAGCTCTTTTC----GGAGAGTGTTATAGCCTGCGGTGCAATACCGCCTACCTCGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGCG-AAACCCATGCGCGAAATGAAAGTGAACGTAGGTGAGAACCCGTT-----AAGGGGGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGG- Pleochaeta_shiraiana_ex_Celtis_AB022403 TTGACCTCGAATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCTCA--CCG-GAGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGTGCTAGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGCCGGTG-CCTGTGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGGGCGTTGGTGATCATCCGGAGTTTT-CTCTGGTGCACTCGGCAATGCACAGGCCAGCATCGGTTCGGGTGGTTGGATAAAGGCCTAGGGAACGTAGCTCCTCTC----GGGGAGTGTTATAGCCCTGGGCGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGCGTTAAAACCCATGCGCGGAATGAAAGTGAACGTAGGTGAGAACCCTTT------AGGGTGCATCATCGACCGATC-------------------------------------------- Podosphaera_filipendulae_ex_Filipendula_AB022384 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TG-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTGGGGTACTCAGCAGCGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTTAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_longiseta_ex_Prunus_AB022423 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTG------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_pannosa_ex_Rosa_AB022347 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCACCAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---TG-GGGTCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGCGCCCATGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTGGGGTACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTGGCTGCCTTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_tridactyla_ex_Prunus_AB022393 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCTT---CG-GGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGGAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGTTAGGGTTCT-CCCTAGGGCACTCAGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACTGGCGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGTG------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Podosphaera_xanthii_ex_Melothria_AB022410 ATGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCT----CG-GGGCCCGAATTGTAATTTGTAGAAGATGCTTTGGGT-CTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGCG-CCCGTGCCCGTGTAAAGCTCTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGTTGATCCGCTAGGGTTCT-CTCTAGGGCACTCGGCAGTGCGCAGGCCAGCATCGGTTTGGGGGGTTGGAGAATGGCTGGTGGAATGTGGCTGTCTTT----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCTCCCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTCTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTT-AAACCCATACGCGGAATGAAAGTGAACGTAGGTGAGAACCCGCA------AGGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_nankinensis_AB353763 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG?????????????????????????AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CG-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGC-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGGTTCT-CCCCCGGGCACTCGGTAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Sawadaea_polyfida_ex_Acer_AB022364 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTACCTCAGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCCT---CG-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGGTTCT-CCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCCACCTGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTC------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Sawadaea_tulasnei_ex_Acer_AB022366 TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACC---------------AGTAACGGCGAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCCCCT----CG-GGGCCCGAGTTGTAATTTGTAGAAGATGCTTTGGGT-GTGGGCCCGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGAACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGCGGGGGTTCT-CCCCCGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGCTGGAGAAAGGCTGGTGGAATGTAGCTGCCCTC----GGGCAGTGTTATAGCCACCGGTGGCATGCAGCCCACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAGCCCGTC------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Setoidium_sp._ex_Castanopsis_javanica_MUMH5123 -------------------------------------------------------------------------------------------GAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---TG-GGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCAGGGTTCT-CCCTGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGGGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCTCTCGTGCCATGCAGCCTACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA Setoidium_sp._ex_Castanopsis_javanica_MUMH5147 -------------------------------------------------------------------------------------------GAGTGAAGCGGTAACAGCTCAAATTTGAAATCTGGCTCCCT---TG-GGGCCCGAGTTGTAATTTGGAGAAGATGCTTTGGGT-GTGGGCCTGGCCTAAGTTCCTTGGAACAGGACGTCGTAGAGGGTGAGAATCCCGTATGCGGCTGGTG-CCCTCGCCCGTGTAAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATGGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACTTGGGCGCTGCTGATCCGTCAGGGTTCT-CCCTGGGGCACTCGGCAGCGCGCAGGCCAGCATCGGTTTGGGTGGTTGGAGAAAGGCGAGGGGAATGTAGCTGTCTCTCG--GGGCAGTGTTATAGCCTCTCGTGCCATGCAGCCTACCCGGACCGAGGACCGCGCTTC----GGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTC-AAACCCATGCGCGGAATGAAAGTGAACGCAGGTGAGAACCCGTT------AGGGTGCATCATCGACCGATCCGGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14205] TITLE Setoidium_10_taxa_ITS; LINK TAXA = Taxa2; DIMENSIONS NCHAR=479; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cystotheca_lanestris_ex_Myrica_californica_AF011288 ------CGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG Cystotheca_lanestris_ex_Quercus_agrifolia_AB000933 AGGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG Cystotheca_lanestris_ex_Quercus_agrifolia_AF011289 ---GCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCGCGTGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAAAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTGAGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAATACCCATCTTAACAGG Cystotheca_lanestris_ex_Quercus_sp._AF073354 AAGCCACGCTGGGCGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTTGCGCCCTCCTGGCACCTGCTGGGACGTGCCCGCCAGAGCCCCCTTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCTATGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCCGGCTCTACGCGTAGTTATTTCTCTCGCGACAGAGTGGTGACGGGACCTGCCAGAACACCCATTCTAACAGG Cystotheca_tjibodensis_ex_Castanopsis_argentea_JN807325 ----------------------------------------CCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCCGGCGTCGGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCGTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCGGCCCTTAAATGCAGTGGCGGTGCCGTTGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACTTGCCAAAAGGCTCATCTCATTCGG Cystotheca_tjibodensis_ex_Castanopsis_argentea_JN807326 AGGCCACGCTGGGCGCCTGGCGCCTGGCGGGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCCGGCGTCGGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCGTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCGGCCCTTAAATGCAGTGGCGGTGCCGTTGGGCTCTACGCGTAGTTATTTCTCTCGCG------------------------------------------- Cystotheca_wrightii_ex_Quercus_glauca_AB000932_JPN AGGCCACGCTGGGCGCCTGGCGCCAGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCCTGTGCCCTCCCGGCGCCTGCTGGGACGCGCCCGCCAGAGCCACCCTAACGCGTGCTGTTTGTGTGGTCAGAGTGGTAGCAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTGGCTTGGTCTTGGAGCGCGCCCCGCGGGGCGGCTCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATTTCTCTCGCGACAGGGTGGTGACGGGACCTGCCAGAAGCCTCATCATACTAGG Setoidium_nankinensis_ex_Acer_buergerianum_AB353763 AGGCCACGCAGGGCGC---AAGCCCCGCGCGGCCGACCCTCCACCCGTGCCGACTCATATCCGGTTGCCCTGGCGG--------------CCTGCCGGCCCCGGCTGGCA-GTGCCCGCGAGAGGCGCCCCAACTCGTGCTGTCAGTGATGTCTGAGTCGCAGTTAA--TAAAGTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCCCG-CCGGCCTGGCGGCCCTTAAACACAGTGGCGGCGCCGCCGCGCTCTACGCGTAGTAACTCTTCTCGCGACAGGGCGCAGGCGGGGCCAGCCGAAGCACCCCCTTCTCTCGG Setoidium_sp._ex_Castanopsis_javanica_MUMH_5123 -------------CGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCTGGCGCCTGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCTGAGTGGTAATAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATCTCTCTCGCGACAGGGCGGCGACGGGACTTGCCAAGAACCCCATCTTTACAGG Setoidium_sp._ex_Castanopsis_javanica_MUMH_5147 -------------CGCCTGGCGCCGGGCGTGGCTGACCCTCCACCCGTGTCTA-TCTTCTCATGTTGCTTTGGCGGGCCGGGCCTCGTGCCCTCCTGGCGCCTGCTGGGACGCGCCCGCCAGAGCCCCCCTAACGCGTGCTGTTTGTGTGGTCTGAGTGGTAATAGAATTAGAATAAAACTTTCAACAACGGATCTCTTGGCTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGAGGGGCATGCCTGTCCGAGCGTCAGTACAACCCCTCAAGCCTAGCTTGGTCTTGGGGCGCGCCCCGCGGGGCAGCCCTTAAATGCAGTGGCGGTGCCGTCGGGCTCTACGCGTAGTTATCTCTCTCGCGACAGGGCGGCGACGGGACTTGCCAAGAACCCCATCTTTACAGG ; END; BEGIN TREES; TITLE Setoidium_10_taxa; LINK TAXA = Taxa2; TRANSLATE 1 Cystotheca_lanestris_ex_Myrica_californica_AF011288, 2 Cystotheca_lanestris_ex_Quercus_agrifolia_AB000933, 3 Cystotheca_lanestris_ex_Quercus_agrifolia_AF011289, 4 Cystotheca_lanestris_ex_Quercus_sp._AF073354, 5 Cystotheca_wrightii_ex_Quercus_glauca_AB000932_JPN, 6 Setoidium_sp._ex_Castanopsis_javanica_MUMH_5123, 7 Setoidium_sp._ex_Castanopsis_javanica_MUMH_5147, 8 Cystotheca_tjibodensis_ex_Castanopsis_argentea_JN807326, 9 Cystotheca_tjibodensis_ex_Castanopsis_argentea_JN807325, 10 Setoidium_nankinensis_ex_Acer_buergerianum_AB353763; TREE Fig._2 = [&R] (1,((2,(4,((5,((8,9),10)),(6,7)))),3)); END; BEGIN TREES; TITLE Setoidium_55_taxa; LINK TAXA = Taxa1; TRANSLATE 1 Byssoascus_striatisporus_U17912, 2 Arthrocladiella_mougeotii_ex_Lycium_AB022379, 3 Blumeria_graminis_ex_Bromus_AB022362, 4 Arthrocladiella_mougeotii_ex_Lycium_AB329690, 5 Blumeria_graminis_ex_Hordeum_AB022399, 6 Blumeria_graminis_ex_Triticum_AB022376, 7 Erysiphe_trinae_ex_Quercus_AB022350, 8 Caespitotheca_forestalis_ex_Schinopsis_AB193467, 9 Cystotheca_lanestris_ex_Quercus_AB022353, 10 Cystotheca_wrightii_ex_Quercus_AB022355, 11 Erysiphe_abbreviata_ex_Quercus_AB271785, 12 Erysiphe_adunca_ex_Salix_AB022374, 13 Erysiphe_alphitoides_ex_Quercus_AB257431, 14 Erysiphe_aquilegiae_ex_Cimicifuga_AB022405, 15 Erysiphe_arcuata_ex_Carpinus_AB252473, 16 Erysiphe_australiana_ex_Lagerstroemia_AB022407, 17 Erysiphe_epigena_ex_Quercus_AB292720, 18 Erysiphe_glycines_ex_Desmodium_AB022397, 19 Erysiphe_gracilis_ex_Quercus_AB022357, 20 Erysiphe_hypophylla_ex_Quercus_AB292715, 21 Erysiphe_mori_ex_Morus_AB022418, 22 Erysiphe_paeoniae_ex_Paeonia_AB257438, 23 Erysiphe_pulchra_ex_Swida_AB022389, 24 Erysiphe_simulans_ex_Rosa_AB022395, 25 Golovinomyces_adenophorae_ex_Adenophora_AB077632, 26 Golovinomyces_cichoracearum_ex_Solidago_AB077650, 27 Golovinomyces_orontii_ex_Veronica_AB077651, 28 Golovinomyces_sordidus_ex_Plantago_AB077657, 29 Leveillula_saxaouli_ex_Haloxylon_AB080469, 30 Leveillula_sp_ex_Chondrilla_AB080478, 31 Leveillula_taurica_ex_Artemisia_AB080470, 32 Neoerysiphe_cumminsiana_ex_Cacalia_AB329669, 33 Neoerysiphe_galeopsidis_ex_Chelonopsis_AB022369, 34 Neoerysiphe_galii_ex_Galium_AB329682, 35 Oidium_aloysiae_ex_Aloysia_AB329683, 36 Oidium_baccharidis_ex_Baccharis_AB329684, 37 Oidium_maquii_ex_Aristotelia_AB329686, 38 Microiduim_phyllanthi_ex_Phyllanthus_AB120754, 39 Parauncinula_septata__ex_Quercus_AB183533, 40 Parauncinula_septata_ex_Quercus_AB022420, 41 Phyllactinia_fraxini_ex_Syringa_AB080436, 42 Phyllactinia_guttata_ex_Diospyros_AB022372, 43 Pleochaeta_shiraiana_ex_Celtis_AB022403, 44 Podosphaera_filipendulae_ex_Filipendula_AB022384, 45 Podosphaera_longiseta_ex_Prunus_AB022423, 46 Podosphaera_pannosa_ex_Rosa_AB022347, 47 Podosphaera_tridactyla_ex_Prunus_AB022393, 48 Podosphaera_xanthii_ex_Melothria_AB022410, 49 Sawadaea_polyfida_ex_Acer_AB022364, 50 Sawadaea_tulasnei_ex_Acer_AB022366, 51 Erysiphe_japonica_ex_Quercus_AB022415, 52 Erysiphe_javanica_ex_Castanopsis_javanica_MUMH5153, 53 Setoidium_sp._ex_Castanopsis_javanica_MUMH5123, 54 Setoidium_sp._ex_Castanopsis_javanica_MUMH5147, 55 Sawadaea_nankinensis_AB353763; TREE Fig._1 = [&R] (1,((((((((2,4),((25,(27,28)),26)),((((32,(35,37)),36),(33,34)),38)),((((((((7,24),52),19),(21,51)),18),((((((11,(13,20)),17),14),23),22),15)),12),16)),((((29,(30,31)),41),42),43)),(39,40)),(((3,6),5),((((9,10),(53,54)),((49,50),55)),((44,46),((45,47),48))))),8)); END;