#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 15, 2020; 8:01 GMT TreeBASE (cc) 1994-2008 Study reference: Corl A., & Ellegren H. 2013. Sampling strategies for species trees: The effects on phylogenetic inference of the number of genes, number of individuals, and whether loci are mitochondrial, sex-linked, or autosomal. Molecular Phylogenetics and Evolution, 67: 358-366. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13356] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=72; TAXLABELS Calidris_fuscicollis_11449_1 Calidris_fuscicollis_11449_2 Calidris_fuscicollis_11450_1 Calidris_fuscicollis_11450_2 Calidris_fuscicollis_11451_1 Calidris_fuscicollis_11451_2 Calidris_fuscicollis_11721_1 Calidris_fuscicollis_11721_2 Calidris_fuscicollis_11723_1 Calidris_fuscicollis_11723_2 Calidris_fuscicollis_11725_1 Calidris_fuscicollis_11725_2 Calidris_mauri_905_1 Calidris_mauri_905_2 Calidris_mauri_913_1 Calidris_mauri_913_2 Calidris_mauri_916_1 Calidris_mauri_916_2 Calidris_mauri_921_1 Calidris_mauri_921_2 Calidris_mauri_923_1 Calidris_mauri_923_2 Calidris_mauri_929_1 Calidris_mauri_929_2 Calidris_melanotos_11496_1 Calidris_melanotos_11496_2 Calidris_melanotos_11497_1 Calidris_melanotos_11497_2 Calidris_melanotos_11498_1 Calidris_melanotos_11498_2 Calidris_melanotos_11555_1 Calidris_melanotos_11555_2 Calidris_melanotos_14946_1 Calidris_melanotos_14946_2 Calidris_melanotos_14949_1 Calidris_melanotos_14949_2 Calidris_minutilla_11534_1 Calidris_minutilla_11534_2 Calidris_minutilla_11750_1 Calidris_minutilla_11750_2 Calidris_minutilla_11776_1 Calidris_minutilla_11776_2 Calidris_minutilla_11777_1 Calidris_minutilla_11777_2 Calidris_minutilla_11785_1 Calidris_minutilla_11785_2 Calidris_minutilla_14959_1 Calidris_minutilla_14959_2 Phalaropus_lobatus_11480_1 Phalaropus_lobatus_11480_2 Phalaropus_lobatus_11664_1 Phalaropus_lobatus_11664_2 Phalaropus_lobatus_11727_1 Phalaropus_lobatus_11727_2 Phalaropus_lobatus_11736_1 Phalaropus_lobatus_11736_2 Phalaropus_lobatus_14868_1 Phalaropus_lobatus_14868_2 Phalaropus_lobatus_14895_1 Phalaropus_lobatus_14895_2 Philomachus_pugnax_120_1 Philomachus_pugnax_120_2 Philomachus_pugnax_121_1 Philomachus_pugnax_121_2 Philomachus_pugnax_123_1 Philomachus_pugnax_123_2 Philomachus_pugnax_124_1 Philomachus_pugnax_124_2 Philomachus_pugnax_171_1 Philomachus_pugnax_171_2 Philomachus_pugnax_204_1 Philomachus_pugnax_204_2 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=6; TAXLABELS Calidris_fuscicollis_11449_1 Calidris_mauri_905_1 Calidris_melanotos_11496_1 Calidris_minutilla_11534_1 Phalaropus_lobatus_11480_1 Philomachus_pugnax_120_1 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14298] TITLE 'Locus_9.93: Gene_DNAJA5'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=520; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Calidris_fuscicollis_11449_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCATTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11449_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTGTAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11450_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCATTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11450_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTGTAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGATGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGTGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11451_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCATTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCAT?TCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11451_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TACTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGT?TCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11721_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCATTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11721_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11723_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11723_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTGTAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11725_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTGTAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_fuscicollis_11725_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTGTAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGCCCCTCTCTGTTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAAAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_905_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTTGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_905_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGAGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATTGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_913_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTTGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_913_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_916_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTTGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_916_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_921_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTTGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_921_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGAGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_923_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_923_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGAGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCTGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_929_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_mauri_929_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGAGTGTCAGGGGGTGACCTATAGTCAGTTGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11496_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGCCAGAGGGTGACCTATAGTCAGTCGTTTTAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGTGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11496_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAGAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11497_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTTAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTC?GACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGTGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11497_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAGAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTC?GACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11498_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGGCCCAGGTTCACAGTTC?GACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGTGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGATGAGATGGTCTTGGTTTGTCTGCGTGTCATTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATTGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11498_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAGAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTC?GACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11555_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTCGCACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGTGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_11555_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTATGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTTAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGTGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_14946_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTC?GACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGTGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAGCGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_14946_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAGAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTC?GACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_14949_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTTAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGTGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAACGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_melanotos_14949_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAGAAGGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCGTCGAAGGTACGGGGTGCCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGGTTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTTTCTGGTGTTCTCCATTGAGCGTGG-G-GCATCAAGCTACAGCTGTTAATCTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCGTGTCACTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCGTATTTGCTGGGGCTTTAAGAGCAGCTTGCTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11534_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11534_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGACTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11750_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCCTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11750_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11776_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11776_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGACTGGAGGAACAGGAAACAAAAGGCATTGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11777_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCGGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11777_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGACTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11785_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_11785_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGACTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTCGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATTGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_14959_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGACTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCGTGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Calidris_minutilla_14959_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGAGATGGATCAGATGATGAAGATGGACTGGAGGAACAGGAAACAAAAGGCATTGAAGGTACGGGGTGTCAGGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAG----TATTGGCTCACTGCACTTAAAGCCCCAGATTCACAGTTTGGACTGTGGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACGTGAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGTTTGTCTGCATGTCACTAATACTAAAAAAGTTGACTGCCATTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATCGCTCATCTGACTTCGTCTCTCTGATCACTGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11480_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAGCAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAAATTCACAATTCGGACTTTAGTGCTACTCCCTGCCTCCAGCTGAGGTGCACCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCGGTAATACTAAAGAAGCTCACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTATTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTC Phalaropus_lobatus_11480_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAATGTGG-G-ACATCAAGCTACAGCTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11664_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTACAGTTGTTAATTTTTCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCGGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGGAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11664_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTTGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11727_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11727_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTGCAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGCCTGCATGTCGGTAATACTAAAGAAGCTCACTGTCAGTGTTGTGCCTATTTGCTGGGTCATTAAGAGCAGCTTACTCAAAAATCGCTCCTCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11736_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_11736_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGATGAATTGGAGGAACATGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCATGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCACTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_14868_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTTGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_14868_2 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAATGTGG-G-ACATCAAGCTACAGCTGTTAATTTATCTTCATGTATGATTTGGTGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTC Phalaropus_lobatus_14895_1 AATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTCGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACGTGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGGTGACATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Phalaropus_lobatus_14895_2 TATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAAGAATTTGGAGATGGATCAGATGATGAAGCTGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACAGGGTGTCAGGGGGTTACCTATAATCAGTCGTTTCAGCCTGAG----CATTGGGTCACTGCACTTAAAGCCCCAGATTCACAATTAGGACTGTAGTGCTACTCCCTGCCTCCAGCTGAGGCACGCCAGGCTAGAGTCTGGCCCTCTCTGGTGTTCTCCATTGAACATGG-G-ACATCAAGCTACAGTTGTTAATTTATCTTCATGTATGATTTGATGAGATGGTCTTGGTCTGTCTGCATGTCAGTAATACTAAAGAAGCTGACTGTCAGTGTTGTGCCTATTTGCTGGGTCGTTAAGAGCAGCTTACTCAAAAATCACTCATCTGACTTCGTCTCTCTGATCCCCGCTTCAGACAAACTCAACGATGAGACTGAAGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_120_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_120_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_121_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_121_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_123_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_123_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_124_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_124_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_171_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_171_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_204_1 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTATTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG Philomachus_pugnax_204_2 GATGTCAGATCTGGAGAGAGAGTTGCAAGAGATGGAGGCACAATATGAAAAGGAATTTGGGGATGGATCAGACGATGAAGATGAATTGGAGGAACAGGAAACAAAAGGCATCGAAGGTACGGGGTGTCATGGGGTGACCTATAGTCAGTCGTTTCAGCCTGAGTATTTATTGGCTCACTGCACTTAAAGCCCCAGACTCACAGTTTGGGCTGTGATGCTGTTCCCTGCCTCCAGCTGAAGTGTGTCAGGCTAGAGTCTGGCCCTCTCTGGTGTCCTCCATTGAACGTGGAGAACATCAAGCTACAGCTGTTAATTTATCCTCATGTATGATTTGGTGAGATGGTCTTGGCTTGTCTGCGTGTCAGTAATACTAAAGAAGTTGACTGTCAGTGTTGTGCCTATTTGCTGGGGCTTTAAGAGCAGCTTACTCAAAAATGGCTCATCTGACTTGGTCTCTCTGATCCCTGCTTCAGACAAACTCAACGATGAGACTGAGGAAGCTGAATTTGTTGATGGTCTG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14294] TITLE 'Locus_9.2: Gene_ATG4B_CHICK'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=997; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11449_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11450_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTGTCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAAAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--GACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11450_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACACATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11451_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11451_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAATACAGGCAGAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--GACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11721_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACACATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11721_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTGTCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAAAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--GACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11723_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAAAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--GACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11723_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAATACAGGCAGAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--GACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11725_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGCTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_fuscicollis_11725_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGAATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACAAGGCAGGGTACACATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCCGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_905_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCCGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAAATTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGGGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_905_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCCGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_913_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_913_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_916_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCCGAGCATTAAAAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAAATTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGGGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_916_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_921_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCCGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAAATTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGGGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_921_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAAATTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGGGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_923_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_923_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_929_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCCGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAAATTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGGGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_mauri_929_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCCAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCAGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATTATCATTCCCTGCTGAGAGCACTCTTACAACCTGATGACAGCTTCAGGGTATTTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGTTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCACTG Calidris_melanotos_11496_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTCCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGTTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCCGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11496_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTTGGGGGGTTGTGGTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTCCACTGCAGACTGAGGCTGCAACTTGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11497_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GGTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCCGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11497_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGAGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGTTTTAGTCAGGAAAACGTGTAGGGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAACCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTCCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11498_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11498_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGGCAGCAGCAGAGCCAGGTTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11555_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GGTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_11555_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GGTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGTTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCCGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_14946_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_14946_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGTTTTAGTCAGGAAAACGTGTAGGGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTCCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGTTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_14949_1 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATATTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGTTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCCGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_melanotos_14949_2 GGCATTCTGATGCTTAAGGACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATGGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCGGCTGATGGTTGCGGTGTGGAGTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCCGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAATGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Calidris_minutilla_11534_1 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11534_2 GGCATTCTGATGTTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACGACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11750_1 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11750_2 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11776_1 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11776_2 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11777_1 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11777_2 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11785_1 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_11785_2 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_14959_1 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Calidris_minutilla_14959_2 GGCATTCTGATGCTTAAGAACCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGTGTTGAGACAATCCTTGTCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGTGTAGGGCTTTCGGGGGGTTGTGTTTTTTGGTGTTTGAGGTT-GTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTCAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAACTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTGCACTGCAGACTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGGAGTATCAGAATCTAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCATTGTCTTGCTGTACTATTGCTAGCAAGCTCTGAGC-TGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCTCGAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTCCCAGCACTG Phalaropus_lobatus_11480_1 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAG?????????????????CTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11480_2 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGGCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAG?????????????????CTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11664_1 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11664_2 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGATT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGAAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11727_1 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11727_2 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCGCCATACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTGTCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11736_1 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACATAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCTAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_11736_2 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_14868_1 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_14868_2 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCGCCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_14895_1 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Phalaropus_lobatus_14895_2 GGCGTTCTCATGCTTAAGGACCCTGGTGTGAATTAAGTCATGTCTGGAATTTGGTTTTGGGGCAAAAATACTCAGAAATAATTGTCCCGTTTTCAAAAGAAAAATGTGTCGAGACAATCCTTGCCAGAGGTCAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAACGTGTAGAGCTTTTGGGGGGTTGTGTTTTTTGGTGTTTGGGTGAGGTTTTTTTTAAGGATCTAACTTCACAACTTAATGAAGTTGTCCCTCTT--TGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACCACCGTACCATGCTTGGTGGCAACCTGAGCATTAAAGAACGTAGTGTTGCCAACTCCCTGTGGCTCTGCTGCTGGAGCTTGCACTGCAGACTGAGGCTGCAGCTCGGCTGATGGTTGCAGTGTGGACTATCAGAATTTAGGGTGTGCAGAGTACAGGCACGAGACAGGGCACACGTTGTCTCACCGTACTAACACTAGCAAGCTCTGAGT-TGTGCAGGCAAGAGAGCTCCAAATTCATGAGAGCTCCAAATTCATGTGAGCTTACTTGCCCTTAGCTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGGAAAACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAGCCTGATGACAGCTTCAGGGTATCTTGCCACTGACAGCAGCAGAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCATCTGTCTGTTCCTGTCAGCAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGATTTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGCTGTTTGCCTTTGTTGCCACCTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGC-TTTCCAGCAGCG Philomachus_pugnax_120_1 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_120_2 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_121_1 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_121_2 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_123_1 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_123_2 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCATAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTATGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_124_1 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_124_2 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_171_1 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_171_2 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_204_1 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG Philomachus_pugnax_204_2 GGCGTTCTCATGCTTAAGGAGCCTGTTGAGAATTAAGTCATTTCTGGAATTTGGTTCTGGGGCAAAAATACTCAGAAATAATTGTCCTGTTTTCAAAAGAAAAATGCGTTGAGACAATCCTTGTCAGAGGTGAGGATGTGTGTTCTTGCAGGCTTTAGTCAGGAAAATGCGTAGGGCTTT-GGGGGGTTGTGTTTTTTGGTGTTTGGGTTTGGTTTTTTTTAAGGATCTAACTTCACAACTTAAT--CTGAGTCCCTCTTTGTGTTTAGATGGTACCAACCTGCTGAAGCATTTGTTCAGCACAGCTGTGCTGTGCTTGGTGGCAACCTGAGCATTAACAAACGTAGTGTTGCAAACTCCCTGTGGCTCTGATGCTGGAGCTTACACTGCAGGCTGAGGCTGCAACTCAGCTGATGGTTGCGGTGTGCAGTATCAGAATTCAGGGTGTGCAGAGTACAGGCACGAGGCAGGGTACGCA---------TGTACTAATGCTGGCAAGCTCTGAGCTTGCACAGGTAAGAGAGCTCCAAATTCATGTGA-----------------GGTTACTTGCCCTTAACTCAGTAGATGGTGCCTGGATACTGCAGCTGGATAAGG--AACTTAAGCTGTTTCCCAAATGATCATTCCCTGCTGAGAGCACTCTTGCAACCTGATGGCAGCTTCAGAGTATCTTGCCACTGACAGCAGCAAAGCCAGGCTGAGTCCTGGAGTAATGCTGCTGCTTCTGTTTGGTCCGTCTGTCTGTTCCTGTC--CAGTTAAAGGTGGTTTTGAGCTGCTTCTGTGTTACTTGAAAGCCCTGTGTTGCAGCCTTCAGCCTTCCTGGCAGAGCTTCTCTCCAGAAATGGCTGATTCTGCTGAATTTCAGTGTCTCCATCTTTCTTTCCCACTGCATTTTTGGATGTTTGCCTTTGTTGCCACTTGCTGTCTCACTGTCTGTCAGCTGTGTGTTTTCTGTATTGCTTTTCCAGCACTG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14307] TITLE 'Locus_7878620: Gene_PARP8'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1069; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTTGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTAATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATGCAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11449_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGGACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTTGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAGTAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAATCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11450_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATACATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11450_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTCATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11451_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCAGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTAATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATGCAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11451_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCAGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTAATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATGCAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11721_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATACATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11721_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTTGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTAATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATGCAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11723_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCAGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTAATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATGCAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11723_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCAGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTAATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATGCAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11725_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGGACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTTGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAGTAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAATCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_fuscicollis_11725_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCGTCTGTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCTCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATACATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_905_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTAACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_905_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTCACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_913_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATGGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTCACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_913_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTAACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_916_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTCACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_916_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTCACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_921_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTAACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_921_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTAACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_923_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTAACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_923_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATGGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTCACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_929_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTAACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_mauri_929_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTTCCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACGATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATGGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGCGATCACATTCACATGTTGATTTTTTTGTCCGCTATCAATTTGGAGTTTGGTAACACTGCTATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATATTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11496_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11496_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCGAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTATGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11497_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11497_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGATTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACGATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATTGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11498_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11498_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGGCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11555_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_11555_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_14946_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_14946_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTATTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCGAAGC---AGAATTTATGAAGATAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTAGAAAGACTGACTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_14949_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_melanotos_14949_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAACTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCATCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCGCAGAATCACAGAATTACAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCC---AAAGTAATATAATTGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATTTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAGCAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11534_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAAAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11534_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACCGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAACTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACTTTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11750_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAAAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11750_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTAGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCGCATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTTAGAAATAGAAGGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11776_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACTTTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAAAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11776_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTAGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTTAGAAATGGAAGGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11777_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAACTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACTTTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAAAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11777_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTCATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTTGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11785_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAAAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_11785_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTAGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_14959_1 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACGGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTTGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTCAGAAATGGAAAGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCTGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Calidris_minutilla_14959_2 TAAGAGCAGTAATACGTCACAGGTACAGTACATCAGCCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCGCTGAAAAGGAGGTAGTGTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCAACAACTTCAGAGACCACAAACATCAAATACAGCCCAACTGCTTTTAGTAACAATTTACAGACTATACTGCAGGTGTTGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACACATTGCATTATGACTCTTAGCAATCCCTTGCTTTCTGAGTTCTAGACCT-CAGAATAATGATGCAGAAGGAATTGAGTGTAGTTAATGCTGGCAACTGAGTACCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATCAAA-CATTACAATTTTACACATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCGCATAGCGTTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCCGTCTCCATAGTTAACACATAGAAACTACAGAATAATCTGGCTTCGGAGACAGACTGGTATGTAACAGCAGAAACTGTTAGAAATAGAAGGGCCAGTAAAATCACAGAATCACAGAATTATAGGGTAGAAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCACATGTTGATTTTTTTGTCTGCTATCAATTTGGAGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTGGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCTCAATAATCCAAAGAAGTAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAATGTTTTAGAAAGACTGCCTCTATCTTCGTTTACCAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11480_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11480_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATAGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11664_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11664_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAAACCGCAAATATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCACATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11727_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11727_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACTAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGCGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGCGTTCTTTTACATATTAAACTATTACAATTTTACATGTGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACTGCTAAATTTTGAGAAAGAAATGTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGACACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTACCTCTGCTATCAACGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCGTTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAATTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11736_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCATTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_11736_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCATTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACATTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGTCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGCGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCGTTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTCGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_14868_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCATTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACTGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCGTTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCCCTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_14868_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCATTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAAACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCGTTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAATTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_14895_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTTTTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Phalaropus_lobatus_14895_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCCGTCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTGTTCCGTTTGTGAAAGCTA--AGTATTATTTTATTGAACAAAATCAACAGCATCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTATGGACTACACTGCAGGTGTCGTGCCCTTCTTTTCCAAGCAGAAGAATTTACGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACGCTTAGCAATCCTTTGCTTTCTGAGTTCTAGACTTGCAGAGTAATGATGCAGAAGGAATTGAGTGTGGTTAATGCTGAAAACTGAGTAGCGTTTCGTATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACTATTACAATTTTACATATGAAATCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAAGAAATCTTACATTTGTC----TAGTTAACACATAGAAACTACAGAATAATCTGGCTTTGGAGACAGACTGGTGTGTAACAGGAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCAAAGAATTGGTGATCACATTCGCATGTTGATTTTTTCCTCTGCTATCAATGTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCGTTCAGTTATAATTGGGAACATTATTTCTGGATCAAGGAGTTCAAATCCTTCCTACAATAATCCAGACAAATAATATAAATGTTTTTAGAATTTCTATTAAATTTAGAAATACAAAAGAAAGGTTTTAGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTCCCTTTGTTACTTTTTCACTCAGTTTGTCTTACGGCACTAATTAAGTTTTCTCATGTTTTTACATCTTAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_120_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_120_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_121_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_121_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------ACAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGTCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_123_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTC-GCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_123_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTC-GCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_124_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_124_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_171_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_171_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTCTGCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_204_1 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTC-GCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT Philomachus_pugnax_204_2 TAAGAGCAGTAATACATCACAGGTACAGTACATCAACCATCTCTGGAAGATTTATGGTTTTATGTTTGGGAACTTGATCACTGAAAAGGAGGTAGTCTTCCCTTTGTGAAAGCTAACAGTTTTATTTTATTGAACAAAATCA------GCAGAGACCGCAAACATCAAATACAGCCCAACTGCTTTTAGTAGCAATTTACGGACTATACTGCAGGTGTCGTGCCCTTCTTTTCCAAGC---AGAATTTATGAAGAGAATGAAAATTAAATACAGGTTGCATTATGACTCTTAGGAATCCCTTGCTTTCTGAGATCTAGACCT--AGAGTAATGATACAGAAGGAATTGAGTGTGGTTAATGCTGGCAACTGAGTAGCATTTCATATGTAGCAAGTCAGGTTTTTTCTTTCGTGTTCTTTTACATATTAAACCATTACAATTTTACGCATTAAGTCATTACAATTC-GCTTTGTCTAAAGCAATCACATAGCATTTCTCTGGACAGCTAAATTTTGAGAAA----TCTTACATCTATCTCCATAGTTAACAAATAGAAACTACAGAATAATCTGGTTTTGGAGACAAACTGGTATGTAACAGCAGAAACTGTCAGAAATGGGAAGGCCAGTA------------------------------AAATATCAGGGTAGTGGCCGAAGAATTGGTGATCACATTCATGTGTTGA-TTTTTTGTCTACTATCAATTTGGGGTTTGGTAACACTGATATTTCTAATGATACTATTCATTCTGTAATAATTAGGAACATTCTTTCTGGATCAAGGAGTTCAAATCCCTCCCGCAATAATCCAAAGAAGTAATATAAATTTTTTTAGAATTTCTATTAAATTTAGAAATACAAAATAAATGTTTTGGAAAGACTGCCTCTATCTTTGTTTACTAATAAACCACTGAAAATAGCAGCCCTTTCCTTTGTTACTTTTTCACTCAGTTTGTCTTACTGCACTAATTAAGTTTTCTCATGTTTTTACATCTCAGTCACAGAAGAAAGGACAACAGTCACAATTTTTGCAAAGCCGTAACTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14292] TITLE 'Locus_4.8c: Gene_CBPZ_CHICK '; LINK TAXA = Taxa1; DIMENSIONS NCHAR=930; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Calidris_fuscicollis_11449_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTATCTAGATGGGAAAGGTCTCATCCCACTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACCGGAGGTTGCACAAAGTATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGGTTTTGGTTGTGGCTGTATTTTCTGTAATTCTACGACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11449_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCACTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTCTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCACGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11450_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11450_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGCAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11451_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCACGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACAATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11451_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAGGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAACATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAATACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTACCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11721_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTATCTAGATGGGAAAGGTCTCATCCCACTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACCGGAGGTTGCACAAAGTATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGGTTTTGGTTGTGGCTGTATTTTCTGTAATTCTACGACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11721_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTCTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCACGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACAATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11723_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGCAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11723_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCACTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTATCTAGATGGGAAAGGTCTCATCCCACTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACCGGAGGTTGCACAAAGTATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGTGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11725_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTATCTAGATGGGAAAGGTCTCATCCCACTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACCGGAGGTTGCACAAAGTATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGGTTTTGGTTGTGGCTGTATTTTCTGTAATTCTACGACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_fuscicollis_11725_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTATCTAGATGGGAAAGGTCTCATCCCACTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTGTATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACCGGAGGTTGCACAAAGTATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGGTTTTGGTTGTGGCTGTATTTTCTGTAATTCTACGACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTAT-------CTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_905_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_905_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_913_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGGCAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_913_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATCTTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_916_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_916_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGCGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_921_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGGCAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_921_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_923_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATCTTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_923_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTTTTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATCTTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGAACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_929_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_mauri_929_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGCGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTTATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11496_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11496_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGTTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11497_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11497_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAGAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGGTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGCCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAGGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGACTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11498_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11498_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAGAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGCCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATGCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11555_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAAGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGACTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_11555_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGTTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_14946_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAGAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGAT???GAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_14946_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAGAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTTAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGAT???GAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_14949_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACACAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAAATTTAATGCACTCCTAAATTTAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGCGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----ATAGCATGTACTACATAGATTTGAGATTTTGATTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_melanotos_14949_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAGAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTATGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTTAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAATATCTGTACATTTTGTGACTAAAATGAGCTAAGTATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGATTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAACACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11534_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATATAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11534_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAATATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATATAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11750_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGATAGGTGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTACAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAGAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTACAGGAGAAGTAGATGTGGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11750_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCAGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGATAGGTGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAATATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATATAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11776_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGATAGGTGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCACTAATATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATGTAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11776_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCTGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGACAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTACAGGAGAAGTAGATGTGGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11777_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGATAGGTGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGACAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATGTAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11777_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGGTGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCCGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATCTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAGAAAAGATATTTTGTGGGAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATGTAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11785_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTACAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_11785_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGGAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATCTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_14959_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTCATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGGCAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAATATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGAGTTTTCTTTACAGGAGAAGTAGATATAGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Calidris_minutilla_14959_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGGCACATCTCACTTGTCTAGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCTGCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGACAAATCTGTACATTTTGTGACTAAAATGAGCTAAGTAAGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTATCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGCATGTACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTACAGGAGAAGTAGATGTGGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11480_1 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGTTTGACACGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGGATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGTGGCTGTATTTTCTGTAATTCTACAACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGATTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11480_2 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTCACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGCTTGACATGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11664_1 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGCTTGACACGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCAACTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11664_2 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGTTTGACACGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCAACTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11727_1 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGTTTGACACGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCAACTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTAAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTTCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11727_2 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGTTTGACACGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGGATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----ATAGGATGTACTACATAGATTTGAGATTTTGATTGTGGCTGTATTTTCTGTAATTCTACAACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11736_1 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGCTTGACTTGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCAACTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_11736_2 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTCACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGCTTGACATGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGGATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAAGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_14868_1 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGCTTGACATGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_14868_2 TGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGCTTGACACGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCAACTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCTTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATCAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_14895_1 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCGCTCAGTTTGACATGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCAACTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTAAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTTCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Phalaropus_lobatus_14895_2 CGACCGCTTTTTCGCGGGGGAAGAAGAAGGATGTTTTGACCCCCTGGCAAAGCTGCGAGGTAAGGAGGGAAGCTCTGCTGACACATCGTACTTGTCTAGATGGGAAAGGTCTCATCTCACTCAGCTTGACATGTCTATGGCACAAAACCTCTCCTCTTGTCATCTCAGCTTGTCGTCTTTATAGACACCTGTAAGATGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATACACAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTGGGACTGCTAATGTGCATTTAGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGGTTGCTTGACAAGCTTAAAAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGACAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAGC-----GTAGGATGTACTACATAGATTTGAGATTTTGATTGCAGCTGTATTTTCTGTAATTCTACTACCAAAAAAGGTATTTTGTGGAAAACTACCGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACCTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_120_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_120_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACAATTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_121_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_121_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_123_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_123_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_124_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_124_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGATAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_171_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_171_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGATAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_204_1 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGAAAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCGTGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG Philomachus_pugnax_204_2 CGACCGCTTTTTCGCAGGGGAAGAAGAAGGATGTTTTGACCCGCTGGCAAAGCTGCGAGGTGAGGAGGGAAGCTCTGCTGACACATCTGACTTGTCTGGATGGGAAAGGTCTCATCCCGCTCAGCTTGACATGCCTATGGCACAAAACCTCTCCGCTTGTCATCTCAGCTTGTCGTCTTTAGAGACACCTGTAAGGTGTGACTCATTTTGTTCCACCTATTTTAAACACTTAATTAAACTGTGCTCAAGAAGCATCTGTTTCTCTCCCCCATATAGATAGAGCATCAAGACAGGCAGCTCAGAGCTAGATGTTTGGACTGCTGATGTGCATTTGGATAAGTCCTGCCCTGTGTGATAGCTGTCTGTATATTTGAAATATTTTATTTAAAAACTGAAACTTTAATGCACTCCTAAATTCAGGATTGCTTGACAAGCTTAACAGCTCATTAAAATAATCTCATTAGTGATTGTCACAGATTTTTGTTTGGATGAAGAAGATCCAGATAGCTGAAGACAGCTGAATCTCATAAAAACTGAGTTTGATCCACCAGATTCAAAGGGAAAAATCTGTACATTTTGTGACTAAAATGAGCTAAGCATGCCAAAGGCCAAATTATAACTGGAGGTTGCACAAAATATTTGTCAGCATGCATATGCATTAGTATGGTTTTGCAGACAAAATATGCCACAATAAACAG-GATGC---------ACTACATAGATTTGAGATTTTGGTTGCGGCTGTATTTTCTGTAATTCTACTACCAAAAAAGATATTTTGTGGAAAACTGCAGGCATTCATGCAGTCCTCTGAGCACCATGGTTTTAAACACTGCTATGATTTTTCTTTGCAGGAGAAGTAGATGTTGAGGAAGATTTGCCTTCAGACTTGCCAGCAACTTTTATTCAGTTCAAACACCATTCATATG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14310] TITLE 'Locus_COX1: Gene_COX1'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=801; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 ATATGTGGTGGGCTCAGACAATAAAGCCCAGGAAGCCGATGGATAATATAGCTCACACTATCCCTATGTATCCGAATGGTTCTTTTTTGCCTGCATAGTAGGCTACGACGTGAGAGATGATTCCGAAGCCCGGTAGGATTAGGATATAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAAGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGTAGTATGGTAATGCCGGCAGCGAGAACTGGAAGAGAGAGTAAGAGTAGGACGGCGGTGATGAGTACCGATCATACGAATAGGGGTGTTTGGTATTGAGAGAGAGCTGGGGGTTTTATGTTGATAGCGGTTGTGATGAAGTTAATAGCACCTAGGATAGAGGAGACACCTGCCAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGATTACCGGCAAGTGGGGGATACACTGTTCATCCTGTACCTGCTCCAGCTTCTACTGTAGATGATGCCAGTAGCAACAGGAAGGATGGAGGTAGCAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCGGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATCACTATGAAGAAGATTATTACAAAGGCGTGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGAGTTCCAGGTTGACCTAGTTCTGCACGAATGAGTAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_fuscicollis_11449_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_fuscicollis_11450_1 ATATGTGGTGGGCTCAGACAATAAAGCCCAGGAAGCCGATGGATAATATAGCTCACACTATCCCTATGTATCCGAATGGTTCTTTTTTGCCTGCATAGTAGGCTACGACGTGAGAGATGATTCCGAAGCCCGGTAGGATTAGGATATAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAAGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGTAGTATGGTAATGCCGGCAGCGAGAACTGGAAGAGAGAGTAAGAGTAGGACGGCGGTGATGAGTACCGATCATACGAATAGGGGTGTTTGGTATTGAGAGAGAGCTGGGGGTTTTATGTTGATAGCGGTTGTGATGAAGTTAATAGCACCTAGGATAGAGGAGACACCTGCCAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGATTACCGGCAAGTGGGGGATACACTGTTCATCCTGTACCTGCTCCAGCTTCTACTGTAGATGATGCCAGTAGCAACAGGAAGGATGGAGGTAGCAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCGGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATCACTATGAAGAAGATTATTACAAAGGCGTGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGAGTTCCAGGTTGACCTAGTTCTGCACGAATGAGTAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_fuscicollis_11450_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_fuscicollis_11451_1 ATATGTGGTGGGCTCAGACAATAAAGCCCAGGAAGCCGATGGATAATATAGCTCACACTATCCCTATGTATCCGAATGGTTCTTTTTTGCCTGCATAGTAGGCTACGACGTGAGAGATGATTCCGAAGCCCGGTAGGATTAGGATATAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAAGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGTAGTATGGTAATGCCGGCAGCGAGAACTGGAAGAGAGAGTAAGAGTAGGACGGCGGTGATGAGTACCGATCATACGAATAGGGGTGTTTGGTATTGAGAGAGAGCTGGGGGTTTTATGTTGATAGCGGTTGTGATGAAGTTAATAGCACCTAGGATAGAGGAGACACCTGCCAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGATTACCGGCAAGTGGGGGATACACTGTTCATCCTGTACCTGCTCCAGCTTCTACTGTAGATGATGCCAGTAGCAACAGGAAGGATGGAGGTAGCAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCGGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATCACTATGAAGAAGATTATTACAAAGGCGTGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGAGTTCCAGGTTGACCTAGTTCTGCACGAATGAGTAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_fuscicollis_11451_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_fuscicollis_11721_1 ATATGTGGTGGGCTCAGACAATAAAGCCCAGGAAGCCGATGGATAATATAGCTCACACTATCCCTATGTATCCGAATGGTTCTTTTTTGCCTGCATAGTAGGCTACGACGTGAGAGATGATTCCGAAGCCCGGTAGGATTAGGATATAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAAGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGTAGTATGGTAATGCCGGCAGCGAGAACTGGAAGAGAGAGTAAGAGTAGGACGGCGGTGATGAGTACCGATCATACGAATAGGGGTGTTTGGTATTGAGAGAGAGCTGGGGGTTTTATGTTGATAGCGGTTGTGATGAAGTTAATAGCACCTAGGATAGAGGAGACACCTGCCAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGATTACCGGCAAGTGGGGGATACACTGTTCATCCTGTACCTGCTCCAGCTTCTACTGTAGATGATGCCAGTAGCAACAGGAAGGATGGAGGTAGCAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCGGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATCACTATGAAGAAGATTATTACAAAGGCGTGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGAGTTCCAGGTTGACCTAGTTCTGCACGAATGAGTAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_fuscicollis_11721_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_fuscicollis_11723_1 ATATGTGGTGGGCTCAGACAATAAAGCCCAGGAAGCCGATGGATAATATAGCTCACACTATCCCTATGTATCCGAATGGTTCTTTTTTGCCTGCATAGTAGGCTACGACGTGAGAGATGATTCCGAAGCCCGGTAGGATTAGGATATAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAAGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGTAGTATGGTAATGCCGGCAGCGAGAACTGGAAGAGAGAGTAAGAGTAGGACGGCGGTGATGAGTACCGATCATACGAATAGGGGTGTTTGGTATTGAGAGAGAGCTGGGGGTTTTATGTTGATAGCGGTTGTGATGAAGTTAATAGCACCTAGGATAGAGGAGACACCTGCCAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGATTACCGGCAAGTGGGGGATACACTGTTCATCCTGTACCTGCTCCAGCTTCTACTGTAGATGATGCCAGTAGCAACAGGAAGGATGGAGGTAGCAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCGGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATCACTATGAAGAAGATTATTACAAAGGCGTGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGAGTTCCAGGTTGACCTAGTTCTGCACGAATGAGTAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_fuscicollis_11723_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_fuscicollis_11725_1 ATATGTGGTGGGCTCAGACAATAAAGCCCAGGAAGCCGATGGATAATATAGCTCACACTATCCCTATGTATCCGAATGGTTCTTTTTTGCCTGCATAGTAGGCTACGACGTGAGAGATGATTCCGAAGCCCGGTAGGATTAGGATATAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAAGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGTAGTATGGTAATGCCGGCAGCGAGAACTGGAAGAGAGAGTAAGAGTAGGACGGCGGTGATGAGTACCGATCATACGAATAGGGGTGTTTGGTATTGAGAGAGAGCTGGGGGTTTTATGTTGATAGCGGTTGTGATGAAGTTAATAGCACCTAGGATAGAGGAGACACCTGCCAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGATTACCGGCAAGTGGGGGATACACTGTTCATCCTGTACCTGCTCCAGCTTCTACTGTAGATGATGCCAGTAGCAACAGGAAGGATGGAGGTAGCAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCGGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATCACTATGAAGAAGATTATTACAAAGGCGTGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGAGTTCCAGGTTGACCTAGTTCTGCACGAATGAGTAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_fuscicollis_11725_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_mauri_905_1 ATATGTGGTGGGCTCAGACAATAAAGCCTAGGAAGCCGATAGATAGTATGGCTCATACTATTCCTATATACCCGAACGGTTCTTTTTTGCCTGCATAGTAGGCTACAACGTGGGAGATGATTCCAAATCCTGGCAGGATTAGGATGTAAACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGATATAGGACTGGGTCTCCTCCTCCGGCGGGGTCGAAGAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGCATGGTAATGCCGGCAGCAAGAACTGGGAGAGAGAGTAAAAGTAGAACGGCGGTGATAAGTACTGATCACACGAATAAGGGTGTTTGGTATTGAGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTAGTGATGAAGTTGATGGCACCTAGGATAGAGGAGACACCTGCTAGGTGGAGAGAGAAGATGGCTAGGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGGGGATATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTAGACGATGCCAGTAGTAGCAGGAATGATGGGGGTAGTAGTCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCAGGGGCACCGATTATAAGTGGGACTAGTCAATTTCCGAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACGAAAGCGTGGGCGGTGACAATAACGTTGTAGATCTGGTCGTCTCCTAAGAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCGGTTCCGACTATACCAG Calidris_mauri_905_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_mauri_913_1 ATATGTGGTGGGCTCAGACAATAAAGCCTAGGAAGCCGATAGATAGTATGGCTCATACTATTCCTATATACCCGAACGGTTCTTTTTTGCCTGCATAGTAGGCTACAACGTGGGAGATGATTCCAAATCCTGGCAGGATTAGGATGTAAACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGATATAGGACTGGGTCTCCTCCTCCGGCGGGGTCGAAGAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGCATGGTAATGCCGGCAGCAAGAACTGGGAGAGAGAGTAAAAGTAGAACGGCGGTGATAAGTACTGATCACACGAATAAGGGTGTTTGGTATTGAGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTAGTGATGAAGTTGATGGCACCTAGGATAGAGGAGACACCTGCTAGGTGGAGAGAGAAGATGGCTAGGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGGGGATATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTAGACGATGCCAGTAGTAGCAGGAATGATGGGGGTAGTAGTCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCAGGGGCACCGATTATAAGTGGGACTAGTCAATTTCCGAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACGAAGGCGTGGGCGGTGACAATAACGTTGTAGATCTGGTCGTCTCCTAAGAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCGGTTCCGACTATACCAG Calidris_mauri_913_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_mauri_916_1 ATATGTGGTGGGCTCAGACAATAAAGCCTAGGAAGCCGATAGATAGTATGGCTCATACTATTCCTATATACCCGAACGGTTCTTTTTTGCCTGCATAGTAGGCTACAACGTGGGAGATGATTCCAAATCCTGGCAGGATTAGGATGTAAACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGATATAGGACTGGGTCTCCTCCTCCGGCGGGGTCGAAGAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGCATGGTAATGCCGGCAGCAAGAACTGGGAGAGAGAGTAAAAGTAGAACGGCGGTGATAAGTACTGATCACACGAATAAGGGTGTTTGGTATTGAGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTAGTGATGAAGTTGATGGCACCTAGGATAGAGGAGACACCTGCTAGGTGGAGAGAGAAGATGGCTAGGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGGGGATATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTAGACGATGCCAGTAGTAGCAGGAATGATGGGGGTAGTAGTCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCAGGGGCACCGATTATAAGTGGGACTAGTCAATTTCCGAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACGAAGGCGTGGGCGGTGACAATAACGTTGTAGATCTGGTCGTCTCCTAAGAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCGGTTCCGACTATACCAG Calidris_mauri_916_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_mauri_921_1 ATATGTGGTGGGCTCAGACAATAAAGCCTAGGAAGCCGATAGATAGTATGGCTCATACTATTCCTATATACCCGAACGGTTCTTTTTTGCCTGCATAGTAGGCTACAACGTGGGAGATGATTCCAAATCCTGGCAGGATTAGGATGTAAACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGATATAGGACTGGGTCTCCTCCTCCGGCGGGGTCGAAGAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGCATGGTAATGCCGGCAGCAAGAACTGGGAGAGAGAGTAAAAGTAGAACGGCGGTGATAAGTACTGATCACACGAATAAGGGTGTTTGGTATTGAGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTAGTGATGAAGTTGATGGCACCTAGGATAGAGGAGACACCTGCTAGGTGGAGAGAGAAGATGGCTAGGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGGGGATATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTAGACGATGCCAGTAGTAGCAGGAATGATGGGGGTAGTAGTCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCAGGGGCACCGATTATAAGTGGGACTAGTCAATTTCCGAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACGAAGGCGTGGGCGGTGACAATAACGTTGTAGATCTGGTCGTCTCCTAAGAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCGGTTCCGACTATACCAG Calidris_mauri_921_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_mauri_923_1 ATATGTGGTGGGCTCAGACAATAAAGCCTAGGAAGCCGATAGATAGTATGGCTCATACTATTCCTATATACCCGAACGGTTCTTTTTTGCCTGCATAGTAGGCTACAACGTGGGAGATGATTCCAAATCCTGGCAGGATTAGGATGTAAACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGATATAGGACTGGGTCTCCTCCTCCGGCGGGGTCGAAGAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGCATGGTAATGCCGGCAGCAAGAACTGGGAGAGAGAGTAAAAGTAGAACGGCGGTGATAAGTACTGATCACACGAATAAGGGTGTTTGGTATTGAGAGAGAGCTGGAGGTTTTATGTTAATGGCGGTAGTGATGAAGTTGATGGCACCTAGGATAGAGGAGACACCTGCTAGGTGGAGAGAGAAGATGGCTAGGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGGGGATATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTAGACGATGCCAGTAGTAGCAGGAATGATGGGGGTAGTAGTCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCAGGGGCACCGATTATAAGTGGGACTAGTCAATTTCCGAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACGAAGGCGTGGGCGGTGACAATAACGTTGTAGATCTGGTCGTCTCCTAAGAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCGGTTCCGACTATACCAG Calidris_mauri_923_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_mauri_929_1 ATATGTGGTGGGCTCAGACAATAAAGCCTAGGAAGCCGATAGATAGTATGGCTCATACTATTCCTATATACCCGAACGGTTCTTTTTTGCCTGCATAGTAGGCTACAACGTGGGAGATGATTCCAAATCCTGGCAGGATTAGGATGTAAACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGATATAGGACTGGGTCTCCTCCTCCGGCGGGGTCGAAGAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGCATGGTAATGCCGGCAGCAAGAACTGGGAGAGAGAGTAAAAGTAGAACGGCGGTGATAAGTACTGATCACACGAATAAGGGTGTTTGGTATTGAGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTAGTGATGAAGTTGATGGCACCTAGGATAGAGGAGACACCTGCTAGGTGGAGAGAGAAGATGGCTAGGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGGGGATATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTAGACGATGCCAGTAGTAGCAGGAATGATGGGGGTAGTAGTCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCAGGGGCACCGATTATAAGTGGGACTAGTCAATTTCCGAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACGAAGGCGTGGGCGGTGACAATAACGTTGTAGATCTGGTCGTCTCCTAAGAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCGGTTCCGACTATACCAG Calidris_mauri_929_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_melanotos_11496_1 ATATGTGGTGAGCTCAGACAATAAAGCCTAAAAAGCCAATGGATAGTATAGCTCATACTATTCCCATGTATCCGAATGGTTCTTTTTTGCCTGCATAATAGGCTACAACGTGGGAAATAATTCCAAATCCTGGTAGGATTAGGATGTAAACTTCTGGATGACCGAAGAATCAGAAGAGATGTTGGTATAGGACTGGGTCCCCTCCTCCGGCAGGGTCGAAGAATGTAGTGTTCAGGTTTCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCAAGAACTGGAAGAGAGAGTAGTAGTAGGACGGCAGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTGATGGCGGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACACCTGCTAGATGGAGAGAGAAAATAGCTAGGTCTACAGAAGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGAGGATATACTGTTCATCCTGTGCCTGCTCCGGCTTCAACTGTAGATGATGCTAGCAGTAGTAGGAATGATGGGGGTAGTAATCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCGGGGGCACCGATTATAAGTGGGACTAATCAGTTTCCGAAGCCACCGATCATGATTGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCGCGAATGAGCAGGCTAAGGGCAGTTCCTACTATACCAG Calidris_melanotos_11496_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_melanotos_11497_1 ATATGTGGTGAGCTCAGACAATAAAGCCTAAAAAGCCAATGGATAGTATAGCTCATACTATTCCCATGTATCCGAATGGTTCTTTTTTGCCTGCATAATAGGCTACAACGTGGGAAATAATTCCAAATCCTGGTAGGATTAGGATGTAAACTTCTGGATGGCCGAAGAATCAGAAGAGATGTTGGTATAGGACTGGGTCCCCTCCTCCGGCAGGGTCGAAGAATGTAGTGTTCAGGTTTCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCAAGAACTGGAAGAGAGAGTAGTAGTAGGACGGCAGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTGATGGCGGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACACCTGCTAGATGGAGAGAGAAAATAGCTAGGTCTACAGAAGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGAGGATATACTGTTCATCCTGTGCCTGCTCCGGCTTCAACTGTAGATGATGCTAGCAGTAGTAGGAATGATGGGGGTAGTAATCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCGGGGGCACCGATTATAAGTGGGATTAATCAGTTTCCGAAGCCACCGATCATGATTGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCGCGAATGAGCAGGCTAAGGGCAGTTCCTACTATACCAG Calidris_melanotos_11497_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_melanotos_11498_1 ATATGTGGTGAGCTCAGACAATAAAGCCTAAAAAGCCAATGGATAGTATAGCTCATACTATTCCCATGTATCCGAATGGTTCTTTTTTGCCTGCATAATAGGCTACAACGTGGGAAATAATTCCAAATCCTGGTAGGATTAGGATGTAAACTTCTGGATGACCGAAGAATCAGAAGAGATGTTGGTATAGGACTGGGTCCCCTCCTCCGGCAGGGTCGAAGAATGTAGTGTTCAGGTTTCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCAAGAACTGGAAGAGAGAGTAGTAGTAGGACGGCAGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTGATGGCGGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACACCTGCTAGATGGAGAGAGAAAATAGCTAGGTCTACAGAAGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGAGGATATACTGTTCATCCTGTGCCTGCTCCGGCTTCAACTGTAGATGATGCTAGCAGTAGTAGGAATGATGGGGGTAGTAATCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCGGGGGCACCGATTATAAGTGGGACTAATCAGTTTCCGAAGCCACCGATCATGATTGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCGCGAATGAGCAGGCTAAGGGCAGTTCCTACTATACCAG Calidris_melanotos_11498_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_melanotos_11555_1 ATATGTGGTGAGCTCAGACAATAAAGCCTAAAAAGCCAATGGATAGTATAGCTCATACTATTCCCATGTATCCGAATGGTTCTTTTTTGCCTGCATAATAGGCTACAACGTGGGAAATAATTCCAAATCCTGGTAGGATTAGGATGTAAACTTCTGGATGACCGAAGAATCAGAAGAGATGTTGGTATAGGACTGGGTCCCCTCCTCCGGCAGGGTCGAAGAATGTAGTGTTCAGGTTTCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCAAGAACTGGAAGAGAGAGTAGTAGTAGGACGGCAGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTGATGGCGGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACACCTGCTAGATGGAGAGAGAAAATAGCTAGGTCTACAGAAGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGAGGATATACTGTTCATCCTGTGCCTGCTCCGGCTTCAACTGTAGATGATGCTAGCAGTAGTAGGAATGATGGGGGTAGTAATCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCGGGGGCACCGATTATAAGTGGGACTAATCAGTTTCCGAAGCCACCGATCATGATTGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCGCGAATGAGCAGGCTAAGGGCAGTTCCTACTATACCAG Calidris_melanotos_11555_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_melanotos_14946_1 ATATGTGGTGAGCTCAGACAATAAAGCCTAAAAAGCCAATGGATAGTATAGCTCATACTATTCCCATGTATCCGAATGGTTCTTTTTTGCCTGCATAATAGGCTACAACGTGGGAAATAATTCCAAATCCTGGTAGGATTAGGATGTAAACTTCTGGATGACCGAAGAATCAGAAGAGATGTTGGTATAGGACTGGGTCCCCTCCTCCGGCAGGGTCGAAGAATGTAGTGTTCAGGTTTCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCAAGAACTGGAAGAGAGAGTAGTAGTAGGACGGCAGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTGATGGCGGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACACCTGCTAGATGGAGAGAGAAAATAGCTAGGTCTACAGAAGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGAGGATATACTGTTCATCCTGTGCCTGCTCCGGCTTCAACTGTAGATGATGCTAGCAGTAGTAGGAATGATGGGGGTAGTAATCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCGGGGGCACCGATTATAAGTGGGACTAATCAGTTTCCGAAGCCACCGATCATGATTGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCGCGAATGAGCAGGCTAAGGGCAGTTCCTACTATACCAG Calidris_melanotos_14946_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_melanotos_14949_1 ATATGTGGTGAGCTCAGACAATAAAGCCTAAAAAGCCAATGGATAGTATAGCTCATACTATTCCCATGTATCCGAATGGTTCTTTTTTGCCTGCATAATAGGCTACAACGTGGGAAATAATTCCAAATCCTGGTAGGATTAGGATGTAAACTTCTGGATGACCGAAGAATCAGAAGAGATGTTGGTATAGGACTGGGTCCCCTCCTCCGGCAGGGTCGAAGAATGTAGTGTTCAGGTTTCGGTCTGTTAGTAGTATAGTGATGCCAGCAGCAAGAACTGGAAGAGAGAGTAGTAGTAGGACGGCAGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTGATGGCGGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACACCTGCTAGATGGAGAGAGAAAATAGCTAGGTCTACAGAAGCTCCAGCATGGGCTAGGTTACCAGCAAGTGGAGGATATACTGTTCATCCTGTGCCTGCTCCGGCTTCAACTGTAGATGATGCTAGCAGTAGTAGGAATGATGGAGGTAGTAATCAGAAGCTTATGTTGTTTATACGAGGGAATGCTATGTCGGGGGCACCGATTATAAGTGGGACTAATCAGTTTCCGAAGCCACCGATCATGATTGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTGACGATAACATTGTAGATTTGGTCGTCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCGCGAATGAGCAGGCTAAGGGCAGTTCCTACTATACCAG Calidris_melanotos_14949_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_minutilla_11534_1 ATATGTGATGAGCTCAGACAATGAAGCCCAGGAAGCCGATGGATAGTATAGCTCATACTATTCCTATGTATCCGAATGGTTCTTTTTTACCAGCATAGTAGGCTACAACGTGAGAGATGATTCCGAAACCTGGTAGGATTAAGATGTAGACTTCTGGGTGACCAAAGAATCAGAAGAGGTGCTGGTATAGGACCGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGCAGTATAGTGATGCCGGCGGCAAGGACTGGGAGGGAGAGTAAGAGTAGGACAGCGGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTTGTAATGAAGTTGATAGCGCCTAGGATGGAGGAGACACCTGCTAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCGAGTGGGGGGTATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCCAGTAGTAGTAGGAATGATGGGGGTAGCAATCAGAAGCTTATATTGTTTATACGAGGAAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACAAAAGCGTGGGCAGTGACAATAACGTTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_minutilla_11534_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_minutilla_11750_1 ATATGTGATGAGCTCAGACAATGAAGCCCAGGAAGCCGATGGATAGTATAGCTCATACTATTCCTATGTATCCGAATGGTTCTTTTTTACCAGCATAGTAGGCTACAACGTGAGAGATGATTCCGAAACCTGGTAGGATTAAGATGTAGACTTCTGGGTGACCAAAGAATCAGAAGAGGTGCTGGTATAGGACCGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGCAGTATAGTGATGCCGGCGGCAAGGACTGGGAGGGAGAGTAAGAGTAGGACAGCGGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTTGTAATGAAGTTGATAGCGCCTAGGATGGAGGAGACACCTGCTAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCGAGTGGGGGGTATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCCAGTAGTAGTAGGAATGATGGGGGTAGCAATCAGAAGCTTATATTGTTTATACGAGGAAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACAAAAGCGTGGGCAGTGACAATAACGTTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_minutilla_11750_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_minutilla_11776_1 ATATGTGATGAGCTCAGACAATGAAGCCCAGGAAGCCGATGGATAGTATAGCTCATACTATTCCTATGTATCCGAATGGTTCTTTTTTACCAGCATAGTAGGCTACAACGTGAGAGATGATTCCGAAACCTGGTAGGATTAAGATGTAGACTTCTGGGTGACCAAAGAATCAGAAGAGGTGCTGGTATAGGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGCAGTATAGTGATGCCGGCGGCAAGGACTGGGAGGGAGAGTAAGAGTAGGACAGCGGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGTGCTGGAGGTTTTATGTTAATGGCGGTTGTAATGAAGTTGATAGCGCCTAGGATGGAGGAGACACCTGCTAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCGAGTGGGGGGTATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCCAGTAGTAGTAGGAATGATGGGGGTAACAATCAGAAGCTTATATTGTTTATACGAGGAAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACAAAAGCGTGGGCAGTGACAATAACGTTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_minutilla_11776_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_minutilla_11777_1 ATATGTGATGAGCTCAGACAATGAAGCCCAGGAAGCCGATGGATAGTATAGCTCATACTATTCCTATGTATCCGAATGGTTCTTTTTTACCAGCATAGTAGGCTACAACGTGAGAGATGATTCCGAAACCTGGTAGGATTAAGATGTAGACTTCTGGGTGACCAAAGAATCAGAAGAGGTGCTGGTATAGGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGCAGTATAGTGATGCCGGCGGCAAGGACTGGGAGGGAGAGTAAGAGTAGGACAGCGGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTTGTAATGAAGTTGATAGCGCCTAGGATGGAGGAGACACCTGCTAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCGAGTGGGGGGTATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCCAGTAGTAGTAGGAATGATGGGGGTAACAATCAGAAGCTTATATTGTTTATACGAGGAAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACAAAAGCGTGGGCAGTGACAATAACGTTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_minutilla_11777_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_minutilla_11785_1 ATATGTGATGAGCTCAGACAATGAAGCCCAGGAAGCCGATGGATAGTATAGCTCATACTATTCCTATGTATCCGAATGGTTCTTTTTTACCAGCATAGTAGGCTACAACGTGAGAGATGATTCCGAAACCTGGTAGGATTAAGATGTAGACTTCTGGGTGACCAAAGAATCAGAAGAGGTGCTGGTATAGGACCGGATCTCCCCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGCAGTATAGTGATGCCGGCGGCAAGGACTGGGAGGGAGAGTAAGAGTAGGACAGCGGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCGGTTGTAATGAAGTTGATAGCGCCTAGGATGGAGGAGACACCTGCTAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCGAGTGGGGGGTATACTGTTCATCCTGTGCCTGCTCCGGCTTCTACTGTGGATGATGCCAGTAGTAGTAGGAATGATGGGGGTAGCAATCAGAAGCTTATATTGTTTATACGAGGAAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACAAAAGCGTGGGCAGTGACAATAACGTTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_minutilla_11785_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Calidris_minutilla_14959_1 ATATGTGATGAGCTCAGACAATGAAGCCCAGGAAGCCGATGGATAGTATAGCTCATACTATTCCTATGTATCCGAATGGTTCTTTTTTACCAGCATAGTAGGCTACAACGTGAGAGATGATTCCGAAACCTGGTAGGATTAAGATGTAGACTTCTGGGTGGCCAAAGAATCAGAAGAGGTGCTGGTATAGGACTGGATCTCCTCCTCCGGCGGGGTCGAAGAATGTAGTGTTTAGGTTTCGGTCTGTTAGCAGTATAGTGATGCCGGCGGCAAGGACTGGGAGGGAGAGTAAGAGTAGGACAGCGGTGATAAGTACTGATCATACGAATAGGGGTGTTTGGTATTGGGAGAGTGCTGGAGGTTTTATGTTAATGGCGGTTGTAATGAAGTTGATAGCGCCTAGGATGGAGGAGACACCTGCTAGGTGGAGGGAGAAGATAGCTAAGTCTACGGAGGCTCCAGCATGGGCTAGGTTACCAGCGAGTGGGGGGTATACTGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCCAGTAGTAGTAGGAATGATGGGGGTAACAATCAGAAGCTTATATTGTTTATACGAGGAAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAGTCAGTTTCCAAAGCCACCAATTATGATTGGCATTACTATGAAGAAGATTATTACAAAAGCGTGGGCAGTGACAATAACGTTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCTAGTTCTGCACGAATGAGCAGGCTAAGGGCAGTTCCGACTATACCGG Calidris_minutilla_14959_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phalaropus_lobatus_11480_1 ATATGTGGTGGGCTCAGACGATAAAGCCTAGGAATCCGATAGATAGTATGGCTCATACCATTCCTATGTATCCAAATGGTTCTTTTTTACCTGCATAGTAGGCTACAACATGGGAGATGATTCCAAAACCTGGTAGGATTAAAATGTAAACTTCGGGGTGGCCGAAAAATCAGAAAAGATGTTGGTATAGAACTGGATCTCCACCTCCGGCCGGGTCGAAAAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGTATAGTAATACCAGCAGCGAGGACGGGGAGGGAGAGTAAGAGCAGGACAGCGGTAATGAGTACTGATCATACGAATAGAGGGGTCTGGTATTGGGAGAGGGCTGGGGGTTTTATGTTAATGGCAGTTGTGATGAAATTAATGGCACCAAGGATGGATGAGACACCTGCTAGGTGAAGGGAGAAGATGGCTAAATCTACTGAGGCACCAGCGTGGGCTAGGTTACCGGCAAGAGGGGGATATACTGTTCATCCTGTTCCGGCTCCGGCTTCTACTGTAGATGATGCCAGTAGAAGTAGGAATGATGGGGGAAGTAGCCAGAAGCTTATGTTGTTTATGCGGGGGAATGCTATATCAGGGGCGCCGATTATGAGGGGTACTAATCAGTTTCCGAAGCCACCAATCATGATCGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTAACGATTACATTATAGATTTGGTCGTCTCCTAAAAGGGTCCCTGGTTGACCTAGTTCTGCACGGATAAGCAGGCTAAGGGCGGTTCCAACTATGCCAG Phalaropus_lobatus_11480_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phalaropus_lobatus_11664_1 ATATGTGGTGGGCTCAGACGATAAAGCCTAGGAATCCGATAGATAGTATGGCTCATACCATTCCTATGTATCCAAATGGTTCTTTTTTACCTGCATAGTAGGCTACAACATGGGAGATGATTCCAAAACCTGGTAGGATTAAAATGTAAACTTCGGGGTGGCCGAAAAATCAGAAAAGATGTTGGTATAGAACTGGATCTCCACCTCCGGCCGGGTCGAAAAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGTATAGTAATACCAGCAGCGAGGACGGGGAGGGAGAGTAAGAGCAGGACAGCGGTAATGAGTACTGATCATACGAATAGAGGGGTCTGGTATTGGGAGAGGGCTGGGGGTTTTATGTTAATGGCAGTTGTGATGAAATTAATGGCACCAAGGATGGATGAGACACCTGCTAGGTGAAGGGAGAAGATGGCTAAATCTACTGAGGCACCAGCGTGGGCTAGGTTACCGGCAAGAGGGGGATATACTGTTCATCCTGTTCCGGCTCCGGCTTCTACTGTAGATGATGCCAGTAGAAGTAGGAATGATGGGGGAAGTAGCCAGAAGCTTATGTTGTTTATGCGGGGGAATGCTATATCAGGGGCGCCGATTATGAGGGGTACTAATCAGTTTCCGAAGCCACCAATCATGATCGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTAACGATTACATTATAGATTTGGTCGTCTCCTAAAAGGGTCCCTGGTTGACCTAGTTCTGCACGGATAAGCAGGCTAAGGGCGGTTCCAACTATGCCAG Phalaropus_lobatus_11664_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phalaropus_lobatus_11727_1 ATATGTGGTGGGCTCAGACGATAAAGCCTAGGAATCCGATAGATAGTATGGCTCATACCATTCCTATGTATCCAAATGGTTCTTTTTTACCTGCATAGTAGGCTACAACATGGGAGATGATTCCAAAACCTGGTAGGATTAAAATGTAAACTTCGGGGTGGCCGAAAAATCAGAAAAGATGTTGGTATAGAACTGGATCTCCACCTCCGGCCGGGTCGAAAAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGTATAGTAATACCAGCAGCGAGGACGGGGAGGGAGAGTAAGAGCAGGACAGCGGTAATGAGTACTGATCATACGAATAGAGGGGTCTGGTATTGGGAGAGGGCTGGGGGTTTTATGTTAATGGCAGTTGTGATGAAATTAATGGCACCAAGGATGGATGAGACACCTGCTAGGTGAAGGGAGAAGATGGCTAAATCTACTGAGGCACCAGCGTGGGCTAGGTTACCGGCAAGAGGGGGATATACTGTTCATCCTGTTCCGGCTCCGGCTTCTACTGTAGATGATGCCAGTAGAAGTAGGAATGATGGGGGAAGTAGCCAGAAGCTTATGTTGTTTATGCGGGGGAATGCTATATCAGGGGCGCCGATTATGAGGGGTACTAATCAGTTTCCGAAGCCACCAATCATGATCGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTAACGATTACATTATAGATTTGGTCGTCTCCTAAAAGGGTCCCTGGTTGACCTAGTTCTGCACGGATAAGCAGGCTAAGGGCGGTTCCAACTATGCCAG Phalaropus_lobatus_11727_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phalaropus_lobatus_11736_1 ATATGTGGTGGGCTCAGACGATAAAGCCTAGGAATCCGATAGATAGTATGGCTCATACCATTCCTATGTATCCAAATGGTTCTTTTTTACCTGCATAGTAGGCTACAACATGGGAGATGATTCCAAAACCTGGTAGGATTAAAATGTAAACTTCGGGGTGGCCGAAAAATCAGAAAAGATGTTGGTATAGAACTGGATCTCCACCTCCGGCCGGGTCGAAAAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGTATAGTAATACCAGCAGCGAGGACGGGGAGGGAGAGTAAGAGCAGGACAGCGGTAATGAGTACTGATCATACGAATAGAGGGGTCTGGTATTGGGAGAGGGCTGGGGGTTTTATGTTAATGGCAGTTGTGATGAAATTAATGGCACCAAGGATGGATGAGACACCTGCTAGGTGAAGGGAGAAGATGGCTAAATCTACTGAGGCACCAGCGTGGGCTAGGTTACCGGCAAGAGGGGGATATACTGTTCATCCTGTTCCGGCTCCGGCTTCTACTGTAGATGATGCCAGTAGAAGTAGGAATGATGGGGGAAGTAGCCAGAAGCTTATGTTGTTTATGCGGGGGAATGCTATATCAGGGGCGCCGATTATGAGGGGTACTAATCAGTTTCCGAAGCCACCAATCATGATCGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTAACGATTACATTATAGATTTGGTCGTCTCCTAAAAGGGTCCCTGGTTGACCTAGTTCTGCACGGATAAGCAGGCTAAGGGCGGTTCCAACTATGCCAG Phalaropus_lobatus_11736_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phalaropus_lobatus_14868_1 ATATGTGGTGGGCTCAGACGATAAAGCCTAGGAATCCGATAGATAGTATGGCTCATACCATTCCTATGTATCCAAATGGTTCTTTTTTACCTGCATAGTAGGCTACAACATGGGAGATGATTCCAAAACCTGGTAGGATTAAAATGTAAACTTCGGGGTGGCCGAAAAATCAGAAAAGATGTTGGTATAGAACTGGATCTCCACCTCCGGCCGGGTCGAAAAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGTATAGTAATACCAGCAGCGAGGACGGGGAGGGAGAGTAAGAGCAGGACAGCGGTAATGAGTACTGATCATACGAATAGAGGGGTCTGGTATTGGGAGAGGGCTGGGGGTTTTATGTTAATGGCAGTTGTGATGAAATTAATGGCACCAAGGATGGATGAGACACCTGCTAGGTGAAGGGAGAAGATGGCTAAATCTACTGAGGCACCAGCGTGGGCTAGGTTACCGGCAAGAGGGGGATATACTGTTCATCCTGTTCCGGCTCCGGCTTCTACTGTAGATGATGCCAGTAGAAGTAGGAATGATGGGGGAAGTAGCCAGAAGCTTATGTTGTTTATGCGGGGGAATGCTATATCAGGGGCGCCGATTATGAGGGGTACTAATCAGTTTCCGAAGCCACCAATCATGATCGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTAACGATTACATTATAGATTTGGTCGTCTCCTAAAAGGGTCCCTGGTTGACCTAGTTCTGCACGGATAAGCAGGCTAAGGGCGGTTCCAACTATGCCAG Phalaropus_lobatus_14868_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Phalaropus_lobatus_14895_1 ATATGTGGTGGGCTCAGACGATAAAGCCTAGGAATCCGATAGATAGTATGGCTCATACCATTCCTATGTATCCAAATGGTTCTTTTTTACCTGCATAGTAGGCTACAACATGGGAGATGATTCCAAAACCTGGTAGGATTAAAATGTAAACTTCGGGGTGGCCGAAAAATCAGAAAAGATGTTGGTATAGAACTGGATCTCCACCTCCGGCCGGGTCGAAAAATGTGGTGTTTAGGTTTCGGTCTGTTAGTAGTATAGTAATACCAGCAGCGAGGACGGGGAGGGAGAGTAAGAGCAGGACAGCGGTAATGAGTACTGATCATACGAATAGAGGGGTCTGGTATTGGGAGAGGGCTGGGGGTTTTATGTTAATGGCAGTTGTGATGAAATTAATGGCACCAAGGATGGATGAGACACCTGCTAGGTGAAGGGAGAAGATGGCTAAATCTACTGAGGCACCAGCGTGGGCTAGGTTACCGGCAAGAGGGGGATATACTGTTCATCCTGTTCCGGCTCCGGCTTCTACTGTAGATGATGCCAGTAGAAGTAGGAATGATGGGGGAAGTAGCCAGAAGCTTATGTTGTTTATGCGGGGGAATGCTATATCAGGGGCGCCGATTATGAGGGGTACTAATCAGTTTCCGAAGCCACCAATCATGATCGGTATTACTATGAAGAAGATTATTACGAAGGCATGGGCAGTAACGATTACATTATAGATTTGGTCGTCTCCTAAAAGGGTCCCTGGTTGACCTAGTTCTGCACGGATAAGCAGGCTAAGGGCGGTTCCAACTATGCCAG Phalaropus_lobatus_14895_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Philomachus_pugnax_120_1 ATATGTGATGGGCCCAGACAATAAAGCCTAGGAAGCCGATGGATAGTATAGCTCATACCATTCCTATATATCCGAATGGTTCTTTTTTGCCCGCATAATAGGCTACAACGTGTGAAATGATTCCAAAGCCTGGGAGGATAAGGATGTAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAGAACTGGATCTCCTCCTCCAGCAGGATCGAAGAATGTGGTGTTAAGGTTTCGGTCTGTTAGTAGCATAGTAATACCAGCAGCAAGAACTGGAAGAGAAAGTAAGAGTAGGACAGCAGTAATAAGTACTGATCATACAAACAGAGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCAGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACCCCTGCCAGGTGGAGGGAGAAGATGGCAAGGTCGACGGAGGCTCCAGCGTGGGCCAGGTTGCCGGCGAGTGGGGGATACACCGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCTAATAGTAGTAGGAATGATGGAGGGAGTAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAATCAGTTTCCAAAGCCACCAATTATAATTGGCATTACTATGAAGAAGATTATTACAAAGGCGTGAGCGGTGACAATCACATTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCACGAATGAGTAGGCTAAGGGCGGTTCCGACTATACCAG Philomachus_pugnax_120_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Philomachus_pugnax_121_1 ATATGTGATGGGCCCAGACAATAAAGCCTAGGAAGCCGATGGATAGTATAGCTCATACCATTCCTATATATCCGAATGGTTCTTTTTTGCCCGCATAATAGGCTACAACGTGTGAAATGATTCCAAAGCCTGGGAGGATAAGGATGTAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAGAACTGGATCTCCTCCTCCAGCAGGATCGAAGAATGTGGTGTTAAGGTTTCGGTCTGTTAGTAGCATAGTAATACCAGCAGCAAGAACTGGAAGAGAAAGTAAGAGTAGGACAGCAGTAATAAGTACTGATCATACAAACAGAGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCAGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACCCCTGCCAGGTGGAGGGAGAAGATGGCAAGGTCGACGGAGGCTCCAGCGTGGGCCAGGTTGCCGGCGAGTGGGGGATACACCGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCTAATAGTAGTAGGAATGATGGAGGGAGTAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAATCAGTTTCCAAAGCCACCAATTATAATTGGCATTACTATGAAGAAGATTATTACAAAGGCGTGAGCGGTGACAATCACATTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGGCCCAGTTCTGCACGAATGAGTAGGCTAAGGGCGGTTCCGACTATACCAG Philomachus_pugnax_121_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Philomachus_pugnax_123_1 ATATGTGATGGGCCCAGACAATAAAGCCTAGGAAGCCGATGGATAGTATAGCTCATACCATTCCTATATATCCGAATGGTTCTTTTTTGCCCGCATAATAGGCTACAACGTGTGAAATGATTCCAAAGCCTGGGAGGATAAGGATGTAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAGAACTGGATCTCCTCCTCCAGCAGGATCGAAGAATGTGGTGTTAAGGTTTCGGTCTGTTAGTAGCATAGTAATACCAGCAGCAAGAACTGGAAGAGAAAGTAAGAGTAGGACAGCAGTAATAAGTACTGATCATACAAACAGAGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCAGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACCCCTGCCAGGTGGAGGGAGAAGATGGCAAGGTCGACGGAGGCTCCAGCGTGGGCCAGGTTGCCGGCGAGTGGGGGATACACCGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCTAATAGTAGTAGGAATGATGGAGGGAGTAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAATCAGTTTCCAAAGCCACCAATTATAATTGGCATTACTATGAAGAAGATTATTACAAAGGCGTGAGCGGTGACAATCACATTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGGCCCAGTTCTGCACGAATGAGTAGGCTAAGGGCGGTTCCGACTATACCAG Philomachus_pugnax_123_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Philomachus_pugnax_124_1 ATATGTGATGGGCCCAGACAATAAAGCCTAGGAAGCCGATGGATAGTATAGCTCATACCATTCCTATATATCCGAATGGTTCTTTTTTGCCCGCATAATAGGCTACAACGTGTGAAATGATTCCAAAGCCTGGGAGGATAAGGATGTAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAGAACTGGATCTCCTCCTCCAGCAGGATCGAAGAATGTGGTGTTAAGGTTTCGGTCTGTTAGTAGCATAGTAATACCAGCAGCAAGAACTGGAAGAGAAAGTAAGAGTAGGACAGCAGTAATAAGTACTGATCATACAAACAGAGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCAGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACCCCTGCCAGGTGGAGGGAGAAGATGGCAAGGTCGACGGAGGCTCCAGCGTGGGCCAGGTTGCCGGCGAGTGGGGGATACACCGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCTAATAGTAGTAGGAATGATGGAGGGAGTAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAATCAGTTTCCAAAGCCACCAATTATAATTGGCATTACTATGAAGAAGATTATTACAAAGGCGTGAGCGGTGACAATCACATTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGGCCCAGTTCTGCACGAATGAGTAGGCTAAGGGCGGTTCCGACTATACCAG Philomachus_pugnax_124_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Philomachus_pugnax_171_1 ATATGTGATGGGCCCAGACAATAAAGCCTAGGAAGCCGATGGATAGTATAGCTCATACCATTCCTATATATCCGAATGGTTCTTTTTTGCCCGCATAATAGGCTACAACGTGTGAAATGATTCCAAAGCCTGGGAGGATAAGGATGTAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAGAACTGGATCTCCTCCTCCAGCAGGATCGAAGAATGTGGTGTTAAGGTTTCGGTCTGTTAGTAGCATAGTAATACCAGCAGCAAGAACTGGAAGAGAAAGTAAGAGTAGGACAGCAGTAATAAGTACTGATCATACAAACAGAGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCAGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACCCCTGCCAGGTGGAGGGAGAAGATGGCAAGGTCGACGGAGGCTCCAGCGTGGGCCAGGTTGCCGGCGAGTGGGGGATACACCGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCTAATAGTAGTAGGAATGATGGAGGGAGTAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAATCAGTTTCCAAAGCCACCAATTATAATTGGCATTACTATGAAGAAGATTATTACAAAGGCGTGAGCGGTGACAATCACATTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGGCCCAGTTCTGCACGAATGAGTAGGCTAAGGGCGGTTCCGACTATACCAG Philomachus_pugnax_171_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Philomachus_pugnax_204_1 ATATGTGATGGGCCCAGACAATAAAGCCTAGGAAGCCGATGGATAGTATAGCTCATACCATTCCTATATATCCGAATGGTTCTTTTTTGCCCGCATAATAGGCTACAACGTGTGAAATGATTCCAAAGCCTGGGAGGATAAGGATGTAGACTTCTGGGTGGCCGAAGAATCAGAAGAGATGTTGGTATAGAACTGGATCTCCTCCTCCAGCAGGATCGAAGAATGTGGTGTTAAGGTTTCGGTCTGTTAGTAGCATAGTAATACCAGCAGCAAGAACTGGAAGAGAAAGTAAGAGTAGGACAGCAGTAATAAGTACTGATCATACAAACAGAGGTGTTTGGTATTGGGAGAGGGCTGGAGGTTTTATGTTAATGGCAGTTGTGATGAAGTTGATGGCACCTAGAATAGAGGAGACCCCTGCCAGGTGGAGGGAGAAGATGGCAAGGTCGACGGAGGCTCCAGCGTGGGCCAGGTTGCCGGCGAGTGGGGGATACACCGTTCATCCTGTACCTGCTCCGGCTTCTACTGTGGATGATGCTAATAGTAGTAGGAATGATGGAGGGAGTAGTCAGAAGCTTATGTTGTTTATGCGAGGGAATGCTATGTCAGGGGCGCCGATTATAAGTGGGACTAATCAGTTTCCAAAGCCACCAATTATAATTGGCATTACTATGAAGAAGATTATTACAAAGGCGTGAGCGGTGACAATCACATTGTAGATTTGGTCATCTCCTAAAAGGGTTCCGGGTTGACCCAGTTCTGCACGAATGAGTAGGCTAAGGGCGGTTCCGACTATACCAG Philomachus_pugnax_204_2 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14295] TITLE 'Locus_IRF: Gene_IRF2'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=623; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11449_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11450_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGTGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATCGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGCGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11450_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCATGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATAAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11451_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCCGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11451_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGTGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAATGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAACGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11721_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCATGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCACAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAAAGTTCCAATACC Calidris_fuscicollis_11721_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAATGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11723_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGTGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAATGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTGAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11723_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTGTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATCGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGCGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11725_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCCGCAGAAAGAGAGTTCCAATACC Calidris_fuscicollis_11725_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGTGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACGAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCCGCAGAAAGAGAGTTCCAATACC Calidris_mauri_905_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGCAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGACCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_905_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_913_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGACCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCATGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_913_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_916_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGACCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCATGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_916_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_921_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGCAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGACCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_921_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACATGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAATCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_923_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_923_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACATGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAATCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_929_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_mauri_929_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGTGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACGTGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAATCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11496_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAACTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACACTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAACATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11496_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTTTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATGTAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11497_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGTGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTTTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAATGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11497_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGCCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCACAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11498_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11498_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGCCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCACAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11555_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAACATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_11555_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTTTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATGTAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_14946_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTTTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATGTAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_14946_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGCTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTGCAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTT-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAACATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_14949_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAACATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_melanotos_14949_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAGTCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACACTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACGTTAAATTCACTGTGTTAGTAAAAGCAGAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11534_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATCGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11534_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAACACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11750_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11750_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAAAAAATCAGGCACACGTGAGGTGTAATCGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11776_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11776_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACATGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCATAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11777_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11777_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATCGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACATGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11785_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATCGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTTGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_11785_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATCGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTAACTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_14959_1 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATCGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Calidris_minutilla_14959_2 TCTACTCCTGACTGGTATTTTCCTAAGCAAGAAAAGAAAATCAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGGTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAGAAAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTTGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGTAAATGAGTTATGGCACTTCAATAAAGCTAGAGAGTATCGCAGACCTC-AAAGAAAGCACTTAAGCCTCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGAAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11480_1 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTATGGTGAATTAATAACAGCGTGGGTATTAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11480_2 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11664_1 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTATGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11664_2 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCACTTAAGCCCCCCACAAATTTAGAACCTTAAATTCACTGTGTTAGTAAAAGCAAAGACAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAACCTGTCCTGCAGAAAGAGGGTTCCAATACC Phalaropus_lobatus_11727_1 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCACTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCCCATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11727_2 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATTAAACTGGAGAGTATCACAGACCTTGAAATAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11736_1 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTGCTGACAATTTCGAACCCAATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGAAGAGTATCACAGACCTTTAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_11736_2 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGTGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTGCTGACAATTTCGAACCCCATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAATAAAGCGCTTAAGTCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_14868_1 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCCCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCCATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_14868_2 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATAGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_14895_1 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATTAAACTGGAGAGTATCACAGACCTTGAAATAAAGCGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Phalaropus_lobatus_14895_2 TCTACTCCTGACTGGTATTTTCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTACGGTGAATTAATAACAGCGTGGGTATCAGCCTTTGGTTCCCATGATAAGCGCTCAAACAATAGCTGAGGTTGCAAGAGAGCGAGCGTTGTGATCTCATTCCCA-TGCACATTTCTAGAACACATGAGGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCCACGTGGAAAAGCTTGCACAGCATTTACCTTTATTTTGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTACTCCTGACAATTTCGAACCCTATCTTGTTAATGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATTAAGCTGGAGAGTATCACAGACCTTGAAAAAAAGTGCTTAAGCCCCCCACAAATTTAGAACCT?AAATTCACTGTGTTAGTAAAAGCAAAGACAAG???????????AACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_120_1 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_120_2 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_121_1 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_121_2 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_123_1 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_123_2 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_124_1 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_124_2 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_171_1 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_171_2 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_204_1 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC Philomachus_pugnax_204_2 TCTACTCCTGACTGGTATTTCCCTAAGTAAGAAAAGAAAGTTAGGCACACGTGAGGTGTAATTGAAAACCTAAGGTGAATTAATAACAGCGTAGCTATCAGCCTTTGGTTCCCATGACAAGCACTCAAACAACAGCTGAGGTTGCAAGAGAGGGAGCGTTGTGATCTCATTCCCATTGCACATTTCTAGAACACATGATGAAGAGTTTCTGCTCAAG-AAAGACCCAGGGCACTGCCAATCAGATGCGACTCCACACCAACGTGGAAGAGCTTGCACAGCATTTACCTTTATTATGTCTGGCTCAAATCCATAGAAAGGCATAAAAAGCCTAAGGGCCCAAGTCTACAAAGTGCTGAGCACGCTCTGCTCCTGACAATTGCGAACCCAATCTTGTTAACGCTTAAATCAATTAAGTTTTACTGTGTTCCTCAATGCAAATGAGTTATGGCACTTCAATAAAGCTGGAGAGTATCGCAGACCTTGAAAGAAAGCACTTAAGCCTCCCACAGATTTAGAACCTTAAATCCACTGTGTTAGTAAAAGCAAAGCCAAGAAAGAAAATATAACTTTAAAAGGGGAAACAATGTGAAAATCTGTCCTGCAGAAAGAGAGTTCCAATACC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14309] TITLE 'Locus_Musk: Gene_Musk'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=605; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGCCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTCCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11449_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCCTGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11450_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAACAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11450_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAACCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11451_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11451_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11721_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGCCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTCCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11721_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAACAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11723_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11723_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11725_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_fuscicollis_11725_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGACATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAATATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCCGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTACAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_905_1 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_905_2 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_913_1 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTGTAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_913_2 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTGTAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_916_1 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_916_2 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTGTAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_921_1 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_921_2 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTGTAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_923_1 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_923_2 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATAAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTGTAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_929_1 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_mauri_929_2 TCCAAAACCTTCTGTGTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTGAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGG-AGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTGTAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11496_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATACTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11496_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGTCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11497_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTTTTACTACTAAGCATGGTCAGATGCTGCTGAATTCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTTCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11497_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTTTTACTACTAAGCATGGTCAGATGCTGCTGAATTCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTTCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11498_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTTTTACTACTAAGCATGGTCAGATGCTGCTGAATTCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTTCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11498_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTAAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTTCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11555_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTTTTACTACTAAGCATGGTCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGTCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_11555_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTTTTACTACTAAGCATGGTCAGATGCTGCTGAATTCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_14946_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGTCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTTCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_14946_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTTTTACTACTAAGCATGGTCAGATGCTGCTGAATTCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGTCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_14949_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGTCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_melanotos_14949_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTAAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGTCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAGCTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCATCTCAATCCCTTCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11534_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCCAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11534_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCCAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGGTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11750_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11750_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11776_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11776_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACATCATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11777_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11777_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTAAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11785_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_11785_2 TCCAAAACCTTCTGTTTCGTGGATGAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATACTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGACCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_14959_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Calidris_minutilla_14959_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCCAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATAACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAATTTTCGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTTCTTCCTCTGGCAGGAGAATGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11480_1 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCGTAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTCTATATTATATATATTTATTACTCCTAAGCATGGCCAGATGCTGCTGAATGCACT?GTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11480_2 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCGTAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTCTATATTATATATATTTATTACTCCTAAGCATGGCCAGATGCTGCTGAATGCACT?GTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11664_1 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11664_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGGGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCACCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCGGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11727_1 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11727_2 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTGTTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11736_1 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_11736_2 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATTAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAACGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGGTATAGAACACTACAGATAATTTTCATGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_14868_1 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGACGCTGCTGAATGCACT?GTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_14868_2 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCGTAAATGTCTGTATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTCCTAAGCATGGCCAGATGCTGCTGAATGCACT?GTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_14895_1 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTACCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCAGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Phalaropus_lobatus_14895_2 TCCAAAACCTTCTGTTTCATGGATCAAAGGAGAAACAGTTGTAAAGGTGAGTAGAGAATGAAATTTAAATAATGCTAACTATTCACTAAAGGTACTGTTTTAAAATATTGGCATCAATTACAACATTTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCGGGGCTCATCTCATAAATGTCTATATCTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTATATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCACTTGTGAGCGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTCAGGGCTCTTTTGCAGCTATAATTCATTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTATAGAACACTACAGATAATTTTCGTGCATGTAAGCTCAATCTTTGCAAATGGGTATTTGCTGCTGCTTGTGTGCGGCCTGAATGTACAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_120_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTTTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_120_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTTTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_121_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_121_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTTTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_123_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_123_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTTTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_124_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_124_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTTATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_171_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTTTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_171_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTTATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_204_1 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTCATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTTTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT Philomachus_pugnax_204_2 TCCAAAACCTTCTGTTTCGTGGATCAAAGGAGAGACAGTTGTAAAGGTGAGTAGAGAATGAAATTTATATAATGCTAACTATTCACTAAAGGTACTGTGTTAAAATATTGGCATCAATTACAACATCTGTAAATTCTAGTTGCTAGGAAGCAAGCATTTGGAAAATCCAGGGCTTATCTCATAAATGTCTATATTTGCAATAACTCTGCCTATAAACCAAACATTCTCTGTGTATCTATATTTTATATTATATATATTTATTACTACTAAGCATGGCCAGATGCTGCTGAATGCAC-TGTGAGTGTTCTCATAAATAAGAGCTACTGAGACACTTAGCTAAGATTGAGGGCTCTTTTGCAGCTATAATTCACTGATCTGCAAAAAGAGGGATGGGTGAGCATGTCATGACAATGCTGAGCAGGAAGAGCTGGCCCCAAATCCTTCAGCTGTAGGACACCACAGATAACTTTTGTGCATGTAAGCTCAAACTTTGCAAATGGGTATTTGCTGCTGCTTGTGCGCAGCCTGAATGTAGAGCCCTCACCTCAATCCCTCCTTCCTCTGGCAGGAGAACGCTCGCATTGCTGTCCTTGATTCAGGGAAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14300] TITLE 'Locus_26.59: Gene_DOCK8'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=686; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11449_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTTTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11450_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11450_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTTTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11451_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11451_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGTAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11721_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11721_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTTTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11723_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCA--GAAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTAAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGTAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11723_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTTTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11725_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGTAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_fuscicollis_11725_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTTAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGTAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_905_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_905_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGATTTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_913_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_913_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGATTTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_916_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_916_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGATTTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_921_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_921_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGAGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_923_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_923_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAAGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_929_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_mauri_929_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTACATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTCGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTACGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11496_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAA??GAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGATTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11496_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAA??GAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11497_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-AAAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTGTTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11497_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-AAAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTGTTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGGCATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11498_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAA??GAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGATTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11498_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAA??GAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGATTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11555_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_11555_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?ACAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTCTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_14946_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAA??GAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGATTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_14946_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-?AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAA??GAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGATTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_14949_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-AAAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTGTTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_melanotos_14949_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG-AAAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTAGTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGCCAGATCCACATCCTGTTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGCTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11534_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11534_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11750_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11750_2 TAGAATAAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGACTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11776_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11776_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11777_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11777_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11785_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_11785_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_14959_1 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Calidris_minutilla_14959_2 TAGAATCAATGTCATTCACAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTAAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCATAAATAGGAATGGCATAAAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAGAAAAGAGGACAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTGTTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGATCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAAGAGGGAGCCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGCGGTATTGCCAGATTTAAAACAGGTCAACTGCATGAATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11480_1 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACATATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGTAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCAACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGTAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGAGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11480_2 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11664_1 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAGAAAAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAAGGATAGTGGTATTGCCAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11664_2 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAGAAAAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAAGGATAGTGGTATTGCCAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11727_1 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAAGGATAGTGGTATTGCCAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11727_2 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTTTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGGAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCAACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGAGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11736_1 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAGAAAAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAAGGATAGTGGTATTGCCAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_11736_2 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGGCAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGATGAGAAGAGTTTCAAATTCTATGCTTTGCAGAAAAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATAGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAAGGATAGTGGTATTGCGAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_14868_1 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAAGGATAGTGGTATTGCCAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_14868_2 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTGTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTATTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGCTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATCTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_14895_1 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACATATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGCAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGTAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCAACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGAGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACA-GTCAACTGCTTGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Phalaropus_lobatus_14895_2 TAGAATCAATGTCATCCAAAAAGAAGAGGTAATTGCATTTTGAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTTGCAG??AAAAAAAGAAGGCTGAATTTCTCAGACTTGTTACTCTCATAAATGGAAATGGCATAGAATGGGTAAACAAATGCAAGATGGGTTTTTACTATGGAGAAAAGAGGATAGTGAGTGTATGTTCTTCTTTTGACCTGTCAGTTGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTACGACTGTACTTCTAGCTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGAGAAGCTTTATTGAGGTAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTAGGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACAGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTATTGCCAGATTTAAAACA-GTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_120_1 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_120_2 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_121_1 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_121_2 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGTTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_123_1 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_123_2 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_124_1 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_124_2 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_171_1 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_171_2 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGTTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_204_1 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAAGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG Philomachus_pugnax_204_2 TAGAATCAACGTCATTCACAAAGAAGAGGTAATTGCATTTCAAGGACAGATCTAATTTCTCAAGGGCTGAGGGAGTTTCTGGGTGAGAAGAGTTTCAAATTCTATGCTTGGCAG--AAAAAAAGGAGGCTGAATTTCTCAGACATGTTACTCTCAT-AATAGGAATGGCATAGAATGGGTAAACAAATGCAAGATGGGGTTTTACTATGGAAAAAAGAGGATAGTGAGTGTATGTTCTTTTTTTGACCTGTCAGTAGTAATGCTGTGTAGGAGGATGTGTGGAGCTGTATTTATGGCTGTACTTCTAACTGATAAAGTGCAGTCAAAGCACTAAATTGGGCTCTGAGCTGGTTTAGAGACAGGGAAGCTTTATTGAGATAGAAAGTGCAAAACCATTTCAGACATGAAGTCAGTAACTTATAATAATAATGAATTTATGCAAACAGGGAGTCAGATCCACATCCTATTCTTGGAAATGATAAGGTGTCAAAGAGCTTTGGATCAGATGCAGCATCTACCAAGATGACATTTAGATTAAACTGTCTTCCTGGGTTTCACAACTGCTGCTTTTGGCACAGGATAATGATAGTGGTGTTGCCAGATTTAAAACAGGTCAACTGCATGCATGATTCAGGTAATGAAGCATCTTTTCTTCCATTTCTATTAGTTTATTTTAACTCCAATTG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14287] TITLE 'Locus 2.3: Gene_MPP6'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=640; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Calidris_fuscicollis_11449_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACTAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTTACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCATGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTGTTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11449_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11450_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTGTTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11450_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCATGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11451_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTACTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11451_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAATGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11721_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11721_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCATGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11723_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACTAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCGTTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTATCTGATCCTGATAGAAAATGACAGGATTGCATGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11723_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11725_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACTAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCGTTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTATCTGATCCTGATAGAAAATGACAGGATTGCATGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_fuscicollis_11725_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAA--------------TAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTATCTTTAAAAAA-TTATGGAATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAATAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGG-GGAATGATAGATCGA Calidris_mauri_905_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTTGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_905_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_913_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_913_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_916_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_916_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_921_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_921_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAATGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGAGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_923_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_923_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATGGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_929_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTTGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_mauri_929_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGGCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_melanotos_11496_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAATTACTTTTGCGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11496_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACCGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAATTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACAAACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11497_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAATTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11497_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAATGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCATATGAAAACCTTGTCTGAAAGTACTTTTGCGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCACTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAAATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACAAACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11498_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCGTTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAATTACTTTTGCGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACAAACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11498_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTGAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCGTAAATCACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCTTAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11555_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCGTAAATCACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACAAACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_11555_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAATGCAAGTGAAAACATTTGCATGTGCCTCATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGATAGGACCAGTATGGAGAGGCTGAAATAAGGAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTGAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGCGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACTGACCTCTTCCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_14946_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCGTAAATCACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACAAACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_14946_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACCGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAATTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_14949_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_melanotos_14949_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGAGTGACAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACCGGATTGCACGTAGTCAAGAACAATGGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCAGTTTGCATTGGGGTAGATAGAATATCCCATAGGTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Calidris_minutilla_11534_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11534_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCAAGATAACGGCAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11750_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11750_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACAGTAAAACAAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11776_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGCGTGTCTTTAATTTTAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTAAGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11776_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGCGTGTCTTTAAATTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTAAGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAATTCAAACGATGGTAAACTAGGTGTCACATACCTCTTCCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11777_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAGCATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCATGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11777_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACAGTAAAACAAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11785_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_11785_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTACGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACAGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_14959_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAACAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Calidris_minutilla_14959_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGCGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAATATGTTGTGTGATTTAGTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGAATGACTTGCTAACATAACTGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCATAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAACGGTAAAACGAAATTGAAATTCAAATAATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGTGGAATGATAGATCGA Phalaropus_lobatus_11480_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11480_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11664_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11664_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGGTACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACGTAGTCAAGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCAAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11727_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11727_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGAGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11736_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_11736_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAACACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_14868_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_14868_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTTAACTAGGTGTCACATACCTCTTTCAGGGTGTTACATTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_14895_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Phalaropus_lobatus_14895_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATGAGTGTGTCTTTAATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATCTTTTAATTATTGCCATTATTATGTTGTGTGATTTATTGGGTGATAGGACCAGTATGGAGAGGCTGAAATAAAAAGATACTTGTGTGTTCTCCATTCTGTTCTCTTTAAAAAA-TTATGGGATAGTGAATAGGCAGTCACTAGGCTGACTGACTTGCTAGCATAACTGACTAACACAGTATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACATAGTCAGGAACAATACAGTCATTGTTCTGTCATATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTCTTACACTGTCGTAACTATTGCTGTCTGTTTGCATTGGGGTAGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAATGAAATAGAAACTCAAACGATGGTAAACTAGGTGTCACATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCACGGATTCTTCATGGCGGAATGATAGATCGA Philomachus_pugnax_120_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAATGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_120_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAATGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_121_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_121_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_123_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_123_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_124_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_124_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_171_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_171_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCATAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_204_1 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGACTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA Philomachus_pugnax_204_2 TATCCTTGGAATTCACAAAAGAGCAGGAGAACCACTGGTAAGTAATTGAAGATAAGTGTGTTTTTCATTTAAAGTGCAAGTGAAAACATTTGCATGTGCCTGATTTCTTGCATTATGATTTAATTATTGCTATTAAGATGTTGTGTGATTAAGTGGGTGACAGGACCAGTGTGGAGAGGCTGAAATAAGAAGATACTTGTGTGTTGTTCATTCTGTTCTCTTTAAAAAAATTATGGGATAGTGAATAGGCAGTCACTAGGCTGAA-----------------TGAGTAACACAACATCTGTCTGGTCCTGATAGAAAATGACAGGATTGCACAGAGTCAAGAACAATAGAGTCATTGTTCAGTCGTATGAAAACCTTGTCTGAAAGTACTTTTGTGTCACCTGGAGCTTATGTGTGTATTAGGAACTTTTACACTGCCATAACTGTTGCTGTCTGTTTGCACTGGGGTGGATAGAATATCCCAGAGCTGTGTATTTTTGCTCGAGATAATGGTAAAACGAAATTGAAGTTCAAACGATGGTGAACTAGGTGTCCCATACCTCTTTCAGGGTGTTACGTTTAGAGTTGAGAACAATGATCTGGTAATAGCCCGGATTCTTCATGGCGGGATGATAGATCGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14306] TITLE 'Locus_73.07: Gene_ZNF608'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=853; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11449_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11450_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11450_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11451_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11451_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11721_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11721_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11723_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11723_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11725_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_fuscicollis_11725_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAAGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGACAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_905_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAAGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_905_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_913_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_913_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_916_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTTCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_916_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAATGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTTCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGCACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_921_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATATCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_921_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAATGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_923_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_923_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_929_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_mauri_929_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTTGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11496_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCCGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGCTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11496_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11497_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11497_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11498_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCCGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGCTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTTTGATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11498_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCCGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTTTGATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11555_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCCGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_11555_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_14946_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCCGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTTTGATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_14946_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTTTGATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_14949_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCCGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTTTGATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_melanotos_14949_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTTTGATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11534_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11534_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTGAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTGAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11750_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATGTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11750_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATGTACACCCTCAAAATGCAGGAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11776_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGGAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11776_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGTGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGGAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11777_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11777_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTGAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11785_1 ???????GGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_11785_2 ???????GGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGGAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_14959_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Calidris_minutilla_14959_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAATCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACGCTAGTTAAGATGTACACCCTCAAAATGCAGGAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGAGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCTCCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATCTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Phalaropus_lobatus_11480_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11480_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11664_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11664_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11727_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11727_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGTGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11736_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_11736_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_14868_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_14868_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAATGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_14895_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Phalaropus_lobatus_14895_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTGCACGCTAGTTAAGATTTACATCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCGTGGGTGACATCTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAGGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCCGTTTGATAGTCACGTGATCCATTTTT-GATGTTATCCTCTGTCCTGGCATCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTATTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCATTATCCAGTTTATGGAAAG Philomachus_pugnax_120_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_120_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_121_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_121_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_123_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_123_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_124_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_124_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_171_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_171_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_204_1 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGATTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG Philomachus_pugnax_204_2 CTAAAGAGGTCAAGCGTTCTGATTCTCAATCAGTGGATGAGAGCAAGATAAAAAACGATGATCGAAAGACTCCTGTAAATTGGAAGGACTCTCGGGGTGCTAGAGTAGCAGTTTCCTCACCAATGAGTCAGCATCAGTCATATATCCAGTACTTGCATGCTTATCCTTATCCACAGATGTACGATCCCAACCATCCAGCCTATCGCGCAGTCTCTCCTGTCCTAATGCACAGCTATCCTGGTATGTATTCTGAAATTTGCCTTTCACCCTAGTTAAGTTTTACACCCTCAAAATGCAGTAAAGCCTGCATTTTAGTATTTCTGTTAGTAGCTAGGGTAAATTAGAAGCTTCTTGGGTGACATTTGTTTTGCTTGTGCTTCCACTAGGGAAAGTTCTGTAGATGAAACTGATTTAATACAAGATGTTCCTTTTATGAACTGTCACAATTCCCAGCTACAGTTTTCTCAACCCTTGACAGTCTGCTATTGCTGTTAGACTGACAGATAGTTTATTGCCTATAAAAATATTCTAAGCACTTACTGTCAGGACCATTATAGTTACTATTCCTTTCACTTAAAGAGGACCCATAAATGTCTGAAATGGCTATCAGCTCAACCCTCTTTATAACCTCCATTCATCAAGGTAAATTAGGTGAAGAAATTGAAGAGCAAAGATGCTGTTTGATAGTCACATGATCCATTTTT-GATGTTATCCTCTGTCCTGGCACCCCCTCCTCCCACCTTGATATAACCAAAATGTAAAACCAGTAACTTGATGTTTATTTTGTTTTATTGTTGTTTACCCACAGGGGCCTATCTCTCTCCAGGATTTCACTATCCAGTTTATGGAAAG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14305] TITLE 'Locus_69.74: Gene_DMXL1'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=612; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11449_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11450_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAGGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11450_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11451_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAGGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11451_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11721_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTTATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11721_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTTATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11723_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11723_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTTATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11725_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_fuscicollis_11725_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGGTTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATCAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTGTAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGCAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAAAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_905_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_905_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_913_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_913_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_916_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_916_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_921_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCAAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_921_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_923_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_923_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_929_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_mauri_929_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTAGACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGCGAAGGTCAGGGTTGAGAACAAATGTAGAACATGTGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11496_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAA?TCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATACAGCAATCTGTAATGACAG??TTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11496_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAA?TCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAG??TTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11497_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGTGAGTCATGA Calidris_melanotos_11497_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11498_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11498_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAATAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11555_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_11555_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_14946_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_14946_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATATGGGAACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_14949_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAA??TCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAATTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCTGTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTC?T?AGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_melanotos_14949_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCATGAAAAAA??TCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAATTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAA?TGTAGAACGTATGACATATCTGATTATTCCACACA?CTGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTC?TTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGGGAGTCATGA Calidris_minutilla_11534_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAG??TTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11534_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAG??TTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGCAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11750_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAG??TTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11750_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAG??TTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTTCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11776_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCCTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11776_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCCTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11777_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11777_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGAAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGCAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAATGTATGACATATCTGATCATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11785_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_11785_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGCAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAATGTATGACATATCTGATCATTCCACACCCATGCACAATTCTGTTTGAATTTGGACACCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_14959_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Calidris_minutilla_14959_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCATTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCAGACTACATTTTGCATTCATTTTTCTTATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATTACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACGGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCATATTTCATAAACAAATTAGTAAATGTGAAGGTCAGGGTTGAGAACAAATGTAGAATGTATGACATATCTGATCATTCCACACCCATGCACAATTCTGTTTGAATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGCGAGTCATGA Phalaropus_lobatus_11480_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11480_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAACATTCACCAATAATGACTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTACCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTTAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11664_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11664_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTTAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11727_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11727_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAAGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11736_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_11736_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_14868_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCAGTAATGACAGAGTTATGGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_14868_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_14895_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Phalaropus_lobatus_14895_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATACCATGATCTTAAAATTCACCAATAATGAGTCATG-AAAAAAATCAGACTACATTCTGCATTCATTTTTCTGACACTAACTATAAAAGAATAGATATGTAGCAATCTGTAATGACAGAGTTATAGAATATTAATGTTCATTTTGTTTAAGAAGGAACATATATGGGGACTAAGGCAAGACAAACTAAAAGGAGTTTAGTAAGGTAACACTCACTGCAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGCAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGAATTTAGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAATACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCAATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_120_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_120_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_121_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_121_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_123_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_123_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_124_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_124_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_171_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_171_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_204_1 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA Philomachus_pugnax_204_2 GAAGATGTGATTTGCTGGTCCTGTCTCAATTTGCATGACTCCTGTCCCAATGTTTCTGAAGAGAGACTGTCGAGCATGCTCGTTGATGAAAGTGTGAAGAAGATTAAATGTAGACAGACTCCATACCTGAAAAAGCATCAAACCATTCCATGATCTTAAAATTCACCAGTAATGAGTCACG--AAAAAATCACACTACATTTTGCATTCATTTTGCTGATACTAACTATAAAAGAATAGATATGCAGCAATCTGTAATGACAGAGTTATAGAATATTAATATTCATTTTCTATAAGAAGGAACATATACAGGGACTAAGGTAAGACAAACTAAAAGGAGTTTAGTAAGATAACACTCACTGTAAGGTAAGACTCACATTTCATAAACAAATTAGTAAATGTGAAAGTCAGGGTTGAGAACAAATGTAGAACGTATGACATATCTGATTATTCCACACCCATGCAAGATTCTGTTTGGATTTGGACATCATCACCACCTTCACCTCTGTGCTCCCTCCCCCTCATTAGTACCTTTATGTTGCCTTCAGCAGATCCTGTGACAAAATACTCTTCTGTAGGATCAACAGCGATTGCTTTGACTGGAGAGTCATGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14299] TITLE 'Locus_10.39: Gene_RANBP3L'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=738; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAATCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCACTCTGACAGTTTGCTCTTTGTTGATTGTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11449_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAATCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCACTCTGACAGTTTGCTCTTTGTTGATTGTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11450_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCCGCTTTTCCAGGAGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11450_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTGTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11451_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCCGCTTTTCCAGGAGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11451_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTGTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11721_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCCGCTTTTCCAGGAGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11721_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAATCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCACTCTGACAGTTTGCTCTTTGTTGATTGTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11723_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCCGCTTTTCCAGGAGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11723_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAATCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCACTCTGACAGTTTGCTCTTTGTTGATTGTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11725_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATGTAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_fuscicollis_11725_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTGTATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATGTAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAAAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_905_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTACTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTATACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_905_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_913_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_913_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTACTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_916_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCTAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTATACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_916_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_921_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTACTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTATACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_921_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTATACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGGTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_923_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCTAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTATACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_923_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_929_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_mauri_929_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11496_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAGCTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11496_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAGTTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTTGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11497_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTTGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11497_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAGTTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11498_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAGCTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATAAAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11498_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAGTTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11555_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAGCTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGCCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCAAGAAAATATTAGTCGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_11555_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAGTTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_14946_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_14946_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAGCTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTTGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTAGACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_14949_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAGCTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTAATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_melanotos_14949_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAGCTTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATGTCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCGCTTTTTATACTGTATTGCAGAGTTTCAGAAGATTATTTGTTTTGTATGCTATATATATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAAGGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11534_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11534_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11750_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11750_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11776_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11776_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTTGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACCGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGTTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11777_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGTTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11777_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTGTTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGGCTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACCGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGTTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCACGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11785_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_11785_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTGTTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGGCTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACCGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGTTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCACGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_14959_1 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Calidris_minutilla_14959_2 TTCTAGCAATACGTGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTCCAGAATAAGTTTATTTCAGATCATTTAAAATTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGCATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCGTACACTCACACTTGCATGTGTTGGTAGGTTCTGTATATTGCTGCTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCCGGAATGTTGTTTTACTCTGTTGTCGCTTTTTGTACTGTATTACAGAGTTTCAGCAGATTATTTGTTTTGTATGCTATATGTATTGAAAGAAACTAATATATTTTGGTGTGTAAAATATAATAATAATAAAAAAGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTCTTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTTAATACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11480_1 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGTGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11480_2 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAG-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTATTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTTATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTATATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACACAATAATAATAAAAACGCTCACTATGTCAGATTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTACCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11664_1 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAATAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTATTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGCGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTTATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACTATGTCAGATTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11664_2 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGTGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11727_1 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGTGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11727_2 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGCAGTTTTATTTAAGTCTATTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACCGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGCGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGATTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11736_1 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGTGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_11736_2 TTCTAGCAATAAACGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAATAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCGCACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGCGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGGCTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAATGCTCACCATGTCAGGTTTAGACCAAACTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_14868_1 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGCAGTTTTATTTAAGTCTATTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACCGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGCGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGATTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_14868_2 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCACACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGCGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGGCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_14895_1 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGTACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCCAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGTGTTATAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCGCACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGTGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTTTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAATGCTCACCATGTCAGGTTTAGACGAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAATGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Phalaropus_lobatus_14895_2 TTCTAGCAATAAATGTGGAATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCAAGTAGCACATACACAAAACACTAAAT-A-TTGTACTATTGCTGTCCAAAATAA-TTTATTTCAGATCATTTAAAATGCAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAATGTTGCCTGAAAAAAGTTAGCTGCGTTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACACTCGCACTTGCATGTGTTGTTAGGTTCTGTATATTTCTACTGTGATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTCTGCTTTTCCAGGGGAGCTATTTCAAGTGACTTCCAGAATGTTGTTTTACTCTGTTGTCATTTTTTGCACTGTATTGCAGAGTTTCAGCAGATTATTTGCTTTGTATGACATATGTATTGAAAGAAACTAATATATTTGGGTATGTAAAACATAATAATAATAAAAACGCTCACCATGTCAGGTTTAGACCAAATTAAAAAGAGTAACTTATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAATGTTGCAGTAAAAACGAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGCGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGCCTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_120_1 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_120_2 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATGTAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_121_1 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_121_2 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_123_1 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_123_2 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATGTAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_124_1 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_124_2 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACATTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_171_1 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_171_2 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACTTGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAGTATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACATTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTACTGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAATCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATGTAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_204_1 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT Philomachus_pugnax_204_2 TTCTAGCAATAACTGTGGGATGTTGCAGTCAAGGCTAAGTAAGAATTAAATAACCTAGTAGCACATACACAAAACACTAAATAACATGTACTATTGCTGTTCATAATAAGCTTATTTCAGATCATTTAAAACTGAATATGTAGTTTTATTTAAGTCTAGTTGATGAGAACCTTTTTAACGTTGCCTG-AAAAAGTTAGCTGAATTACAGACTGAGGCACTGGGCACTTTTCACTCAGTTCATACAATCACAATTGCATGTGCTGGTAGGTTCTGTATATTTCTAATGCAATATCTCTTTAGCTCAGTCACCAGTCTGACAGTTTGCTCTTTGTTGATTTTGCTTTTCCAGGGGAGCTATTTCTAGTCACTTCTGGAATGTTGTTTTACTCTGTTGTCACTTTTTGTACTGTATTGCAGAGTTTCAGCAGATTATTTGTTTTGTATGCCAAATGTATTGAAAGAAACTAATATATTTTGGTATATAAAATATAATAAGAA---AAAAGCTCACCATGTCAGGCTTAGACCAAATTAAAAAGAGTAATTCATGAAAATATTAGTTGTATACAAGTGGTAGAGAAAAACATTGCAGTAAAACCAAAGATGGTTCCAATGACTTATCATATAAACCTTGTTATTTTAGTTATGAGAAATCAAGGCAGCTTGAGACTGATTCTCAACACCCGACTCTGGGATCAGATGGTTATAAAAAGAGCAAACAGAAAAAGCTTGTGCTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14293] TITLE 'Locus_6.1b: Gene_RasGEF1A'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=722; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGGAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11449_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGGAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11450_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGGAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11450_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTGATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAACCAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11451_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11451_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAACCAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11721_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11721_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11723_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATATACCATGTTTA----------------------CCATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11723_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCTCATTTTAATGTAGAACTAACGAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATATACCATGTTTA----------------------CCATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11725_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_fuscicollis_11725_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAACCAGGCAAATGTTTGTGATGTACTATGTTTA----------------------CCATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_905_1 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTTAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAGTAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_905_2 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCCCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTGTTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_913_1 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAGTAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_913_2 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTTAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATGTGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_916_1 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATACTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATTATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAGTAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_916_2 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATACTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATTATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAGTAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_921_1 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAGTAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_921_2 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTTAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATGTGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_923_1 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCCCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTGTTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_923_2 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_929_1 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_mauri_929_2 TTGAAATTTCCCAGAATTTCTGTATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCCCTCAGTCTTTTATTCATGCTTC-----------TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATTCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT?AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-TCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11496_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATAATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTGCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCGTTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACTCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11496_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTGAAACTAATCTTCT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11497_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATAATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACTCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11497_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTGAAACTAATCTTCT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11498_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATAATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACTCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11498_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCCCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTGTATTCACTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTCACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATACT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCACTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11555_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTGAAACTAATCTTCT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_11555_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTGAAACTAATCTTCT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_14946_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCCCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTGTATTCACTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTCACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATACT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCACTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_14946_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATAGTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCGGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATACT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_14949_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACGCAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_melanotos_14949_2 TTGAAATTTCCCAGAATTTGTGCATGAGGTAATTAAACAGATATTATTAAAATCATATTTGGTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTC???????????TTCTATTACATTGTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCGGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAGTTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCACTGCAAGCTTCTATAATAC----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11534_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCGCCTTCCTTGATATCATTTCCTATTGTTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTTTAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11534_2 TTGAAATTTCCCAGAATTTCTGCATGAGATAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAGTTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAATGGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11750_1 TTGAAATTTCCCAGAATTTCTGCATGAGATAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTGTTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAATGGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11750_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11776_1 TTGAAATTTCCCAGAATTTCTGCATGAGATAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGGTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAGTTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTTTAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11776_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAATGGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11777_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTTTAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11777_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTTTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACGGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11785_1 TTGAAATTTCCCAGAATTTCTGCATGAGATAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_11785_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAACTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_14959_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTTCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTGTTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAATGGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Calidris_minutilla_14959_2 TTGAAATTTCCCAGAATTTCTGCATGAGATAATTAAACAGATATTATTTAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTCATTCATGCTGCTTCTATTACATTTTATTCAGTCTTCTTCCTTGATATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACCCCAATTGTTATGTGAATTTTATATTTTGCAGTGCATCTGTCCCATTTTAATGTAGAACTAACAAAAAATAATCTTTATTTCATTACATTTTAAAGCTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATGTATATGCAATTGTGGGCCTGCTGGATAAATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGGAATCATTTCCTCTAGATAATGATATT-GCTTGATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATATAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTA----------------------CTATTATAGAAGCTTGCAATGCTAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11480_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11480_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTGATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCTATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATGTGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCCTTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAACTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11664_1 TTGAAATTTCCCAAAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAACGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCTATTT-AATGTAAAACTAACAAAAAATAATGTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAACGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11664_2 TTGAAATTTCCCAAAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAACGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCTATTT-AATGTAAAACTAACAAAAAATAATGTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAACGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11727_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11727_2 TTGAAATTTCCCAGAATTTCTGCACGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATGTGGTGAAATCATTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGACGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11736_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAATGATA?TTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_11736_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTACTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTCTGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATACGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAATGATA?TTGCTTAATGTCTACATCACAGAAATGCTGAAGAAATTTCTAATATAATGAGTTAGACGTCCAAAACTGGCAAATGTTTGTGACGTACTATGTTTAGCATTGCAAGCTTCGATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_14868_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_14868_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCGCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAACGTTACCCCAATTATTATGTGAATTTTGTATTTTGTAGTGCATCTGTCCTATTT-AATGTAAAACTAACAAAAAATAATGTCTATTTCATTACATTTTAAAACTAATCTTTT-AATTGAAGGCAATTGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACGGAAATGCTGAAGAAATTTCTAATATAATGAACTAGACATTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_14895_1 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATGGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACGGCAACTGCAAGCGCTGGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTAGATAACAATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACGTTCAAAACTGGCAAATGTTTGTGATGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Phalaropus_lobatus_14895_2 TTGAAATTTCCCAGAATTTCTGCATGAGGTAATTAAACAGATATTATTGAAATCATATTCATTTTTTTCAAATACTAATTCTTTTGTTTCAATTTCAGAGCCTCTCAGTCTTTAATTCATGCTTCATTCATGCTGCTTCTATTACATT-TATTCAGTCTTCTTCCTTGTTATCATTTCCTATCGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATTGGTTTTGGTAACAAATTAATGTTACCCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTT-AATGTAAAACTAACAAAAAATAATCTCTATTTCATTACATTTTAAAACTAATCTTTT-AACTGAAGGCAATAGCATTCCAACAGTTTTATGGACTCTCTTCTGTATATGCAATTGTGGGCCTGCTGGATATGTAATATAAACACAGCAACTGCAAGCGCTGGCTTTCACAGAAATGTGGTGAAATCATTTCCCCTAGATAATGATATTTGCTTAATGTCTAGATCACAGAAATGCTGAAGAAATTGCTAATATAATGAGCTAGACGTTCAAAACTGGCAAATGTTTGTGACGTACCATGTTTAGCATTGCAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTATGTATT Philomachus_pugnax_120_1 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_120_2 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTTCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_121_1 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTCC-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATCTTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_121_2 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_123_1 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTCC-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATCTTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_123_2 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAATGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTTCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_124_1 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTCC-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATCTTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_124_2 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTTCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_171_1 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTCC-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATCTTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_171_2 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_204_1 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTCC-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATCTTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTGCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT Philomachus_pugnax_204_2 TTGAAATTTCCCAGAATTTCTGCATAAGGTAATTAAAAAGATATTATTAAAATCATATTTGTTTTTTTCAAATACTAATTCTTTTGTTTCGATTTCAGAGCCTCTCAGTCTTTTATTCATGCTTA-----------TTCTATTACATTTTATTCAGTCTTCTTCCTTGTTATCATTTCCTATTGCTCCCTCCATCTCCCCTTCTTGCTTCAGTTCCTCATCTGTTCTTCTCAATGTTTTCATGCATCAGTTTTGGTAACAAATTAACGTTACTCCAATTATTATGTGAATTTTATATTTTGTAGTGCATCTGTCCCATTTTAATGTAAAACTAACAAAAAATAATATTCATTTCATTGCATTTTAAAACTAATCTTTT-AACTGAAGGCAATTGCATTCCAACAGTTTTATGGACCCTCTTATATATATGCAATTGTAGGCCTTCTGGATACATAATATAAACACAGCAACTGCAAGCACTAGCTTTCACAGAAATTTGGTGAAATCATTTCCCCTACATAATGATATT-GCTTAATGTCTAGATCACAGAAATGCTGAAGGAATTGCTAATCTAATGAGCTAGACATTCAAAACAGGCAAATGTTTGTGATGTACCATGTTTAGCATCACAAGCTTCTATAATAG----------------------TAAACTCCTACCTTGAAGTTTATCTGCCCATTGGGCAAGCGGTTCGTGTGTATT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14291] TITLE 'Locus_4.5b: Gene_NDST3'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=958; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11449_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATACTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCACATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATCTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11450_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11450_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATACTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCACATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATCTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11451_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11451_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATACTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCACATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATCTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11721_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATACTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCACATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATCTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11721_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATACTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCACATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATCTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11723_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11723_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11725_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_fuscicollis_11725_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA?TTTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTATCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_905_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_905_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_913_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_913_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAAACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTTTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_916_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_916_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTACGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_921_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_921_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_923_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_923_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACGTAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_929_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACGTAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_mauri_929_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACACCAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGA-TTTTTTGGCTTTATGTCAAAATTAGTAGCCCT-----TTGATAAAGAGATAAACAAGGTA-------------------GTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTCA-TTTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTGAATTATTTTTGTGACAGTCTCATAAGATCCAATAATTACATGTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCCGCATTGGCACTCCAATTTCTGATACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGATTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11496_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11496_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11497_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11497_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTAATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11498_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11498_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11555_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_11555_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTAGAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGACTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAGTGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGGGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_14946_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_14946_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTTTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCGATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGGGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_14949_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_melanotos_14949_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATAATCCACCTATAGTTTAATCATGTAAATTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTTTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCGATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGGGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGAACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11534_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA?TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11534_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA?TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11750_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11750_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAAGAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11776_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA?TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCC-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11776_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA?TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11777_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11777_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAAGAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11785_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA?TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_11785_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA?TTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_14959_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Calidris_minutilla_14959_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCGGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCATTTTTTTTTATTTTTAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGAACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCTTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATCTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCGGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGACCATCTGTGGGTATGAGTCCCCCCA-AAAAAATGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11480_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAAATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11480_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGCGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGATTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11664_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11664_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGGCAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAAATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATAAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11727_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTCTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATACGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTTTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11727_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGCGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11736_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTATATGTCAAAATGAGTAGCACT-----TTGATAAAGAAATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCC?????GAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_11736_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGCGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTTTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCC?????GAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_14868_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTATATGTCAAAATGAGTAGCACT-----TTGATAAAGAAATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_14868_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGATTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_14895_1 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGACAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTATATGTCAAAATGAGTAGCACT-----TTGATAAAGAAATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Phalaropus_lobatus_14895_2 GCACAGAGATATCTGGTCTAAAGAAAAAACCTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAGACTGGTGAGATTTTATTGTATTTCAACAAGATAGGCTATGTGTATATTCAAATAATTATACTGATTAATCACTTTTTACTCAGACTGCTGTATAGGGATCTTGATTATCTAATAGCA-TTTTTTTTATTTCCAGATGTCATCCACCTATAGTTTAATCATGTAAGTTATAACAACAGGCAGTACACATATTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATGAGTAGCACT-----TTGATAAAGAGATAAACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCATTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTGAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGAAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCCAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTTGGCATTGGCACTCCGATTTCTTTTAACTATTTTCAGTTCTTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAATGAAATGAAATGAAATGAAA-----------------------------------------------TGTGTGTGTGTTTTTCTTAATCTTGGACTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_120_1 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AA?GT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTC?AGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCGAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_120_2 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCGATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCCAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_121_1 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_121_2 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_123_1 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_123_2 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCGATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_124_1 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_124_2 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_171_1 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AA?GT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTC?AGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_171_2 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCGATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCACTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCCAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGATCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_204_1 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCAATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA Philomachus_pugnax_204_2 GCACAGAGATATCTGGTCTAAAGAAAAAACTTGTGATCGATTACCAAAATTCTTGGTTGTAGGACCCCAGAAAACCGGTGAGATTTTATTGTATTTCAACAAGATAGACTATGTGTATATTCAAATAATTATACTGATTAATCAGTTTTTACTCAGACTGCTGTATAGAGATCTTGATCATCTAATAGCA-TTTTTTTTATTTTCAGATATCATCCACCTATAGTTTAATCATGTAAGTTACAACAACAGACAGTACACATACTGAAAATGCAGAGTTTAGGTGTGTGTCAGATTTTTTTGGCTTTATGTCAAAATTAGTAGCAC-AAGAT--------------AACAAGATAGATTCTCTCTCCTGCAAGTGTCTGATTTATAGAAACTTGTTAGTTCATGGCGTTTATTTCAAGTCAAGAAGTTCCTAATTGACAGTTCAAATTCCAAGGTTGCAGTAGTTTATAAATTAACTTAATGGTTGA--TTTTTTTTCTCTGTAATCAGGAAATTGCATATGTGCTTCCTTTCATCTTCACCAATTCCGAATAGCTACCGAGTGTGAGATTTTTAAATTATTTTTGTGACAGTCTCATAAGAACCAATAATTACATTTAAAACATAGCTATTAAAAGTGAGTAAAACAGATTTCAGCATTGGCACTCCGATTTCTGTTACCTATTTTCAGTTATTTAAATGTCTTCAATTTAGAAGTACAGAAAGCACAGATTCTTAGGTGACATAAATCAGCATCCCCTCGCTGAAATGAAATGAAA--------------------CAAAGCTGGTTTAGATCATCTGTGGGTATGAGTCCCCCCCAAAAAAGTGTGTGTGTGTTTTTCTTAATCTTGGGCTTTTATCCTATTTGCAGGTACCACTGCCTTGTATTTGTTCCTGGTCATGCATCCTTCCATCATTAGTAACTCCCCCAGCCCAAAAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14289] TITLE 'Locus 3.3: Gene_Q6JLB2_CHICK'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=509; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11449_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTCGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11450_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11450_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11451_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11451_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATATTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTCAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11721_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11721_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTCGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11723_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11723_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11725_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCT?T?GCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_fuscicollis_11725_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCT?T?GCTAGTGGAAGGTCAGGCAGGGGAAGTTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGCGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCACTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_905_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCCTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTAGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTATTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_905_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTAGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_913_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTAGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_913_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCACAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTTTAT-GATAACTCTATTGCTAGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_916_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTAGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_916_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCACAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTTTAT-GATAACTCTATTGCTAGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_921_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTAGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_921_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCACAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTTTAT-GATAACTCTATTGCTAGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_923_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTTATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTAGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_923_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTTAGGTAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_929_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCACAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTAGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTATTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_mauri_929_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCACAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTTTAT-GATAACTCTATTGCTAGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGACAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11496_1 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTACGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATAACAAATTTAAAGAACGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGATGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11496_2 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11497_1 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11497_2 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAAGTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTGTTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATAACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11498_1 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11498_2 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11555_1 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTACGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAAAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAAAGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCAAATAACAAGACCATGACTACTGGGG Calidris_melanotos_11555_2 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCAAATAACAAGACCATGACTACTGGGG Calidris_melanotos_14946_1 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTACGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTGTTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATAACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_14946_2 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA??????CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCAAATAACAAGACCATGACTACTGGGG Calidris_melanotos_14949_1 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA?AATG?CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGCTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_melanotos_14949_2 TAAAATTCTTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAGTTTTTGCTGGTTTTCTTCAAGTGTTTGTAT-GATAACTCTATTGCTTGTGGAAGGTTAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGA?AATG?CAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11534_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTTGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11534_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTACAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11750_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTTGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11750_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTACAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGCGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11776_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTTGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11776_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGCGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11777_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTTGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTATTGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11777_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTATTGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCCTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11785_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_11785_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTACAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_14959_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTTGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGTTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Calidris_minutilla_14959_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTATTGGTCGCAAATGTGATACTATGATATGTTTTAAATACAATTTTTGCTGGTTTTCTTCAAGTGTTTGTA?TGATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGAAGAAATGCTAATTTTTGACTTATAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAATGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACGTGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Phalaropus_lobatus_11480_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATAATTGGTCTCAAATGTGATACTATGATATGTTTTAAATGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAGATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTAGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTA?TAATCTTGCTTAGCTTCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_11480_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATTATTGGTCTCAAATGTGATACTATGATATGTTTTAAATGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAGATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTA?TAATCTTGCTTAGCTTCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAATGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_11664_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATTATTGTTCTCAAATGTGACGCTATGATATGTTTTAAATGCAATTTTTGCTGATTTTCTGCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACAACACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTTTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAGTAATCTTGCTTAGCATCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Phalaropus_lobatus_11664_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAATTTAAATTCTCATTATTGGTCTCAAATGTGATACTATGATATGTTTTAAATGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_11727_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATAATTGGTCTCAAATGTGATACTATGATATGTTTTAAATGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAGATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATCCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_11727_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATTATTGGTCTCAAATGTGATACTATGATATGTTTTAAATGCAATCTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGAAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCCAGTTAATAATCTTGCTTAGCTTCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_11736_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATTATTGGTCTCAAATGTGATACTATGATATGTTTTAAATGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATG??????AGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCTTCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_11736_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATTATTGTTCTCAAATGTGATGCTATGATATGTTTTAAATGCAATTTTTGCTGATTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATG??????AGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAGTAATCTTGCTTAGCATCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_14868_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTATTGTGTTTACAAACTTAAATTCTCATTATTGGTCTCAAATGTGCTACTATGACATGTTTTAAATGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCGGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTA??GTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_14868_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTGTTTACAAACTTAAATTCTCATTATTGGTCTCAAATGTGATACTATGATATGTTTTAAAAGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTATTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTA??GTGAGGTTACAGAAAATGTAATTCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTGCCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_14895_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTGTTTACAAACTTAAATTCTCATTATTGGTCTCAAATGTGATACTATGATATGTTTTAAAAGCAATTTTTGCTGGTTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATTCTGATGGATTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Phalaropus_lobatus_14895_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTAGCTATCTTACTGTGTTTACAAACTTAAATTCTCATTATTGTTCTCAAATGTGATGCTATGATATGTTTTAAATGCAATTTTTGCTGATTTTCTTCAAGTGTTTGCAT-GATAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTTCTTACTAAGTGTAACATCACAAATTTAAAGAATGGAAGACCTGGAGAAGATAATGTTAATGAGGTAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGTTAATAATCTTGCTTAGCATCAGATGTTTCTATAGTGAGGTTACAGAAAATGTAATCCTGATGGAGTGTAAAATTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGAG Philomachus_pugnax_120_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_120_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_121_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_121_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_123_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_123_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_124_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_124_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_171_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_171_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_204_1 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG Philomachus_pugnax_204_2 TAAAATTATTGAAGCAAGATTAAAGGTAGCTATCTATCTTACTGTATTTACAAACTTAAATTCTCATTAGTGGTCGCAAATGTGATACTATGGTATGTTTTAAATACAATTTTTGCT-GTTT--TTCAAGTGTTTGTAT-GACAACTCTATTGCTAGTGGAAGGTCAGGCAGGGGAAATTGATGCTGTGTT----CTAAGTGTAACATCACAAATTTAAAGAATGGAAGAGCTGGAGAAGATAATGTTAATGAGGCAACATCTGTTCTTTGCAAAACTTTGGAGAAATGTTAATTTTTGGCTTGTAAGAAGGCTTTACTTTTAGACCAGTGTGTTTTCAGTAATCATGCTAGCTAATAATCTTGCTCAGCATCAGATGTTTCTGTAGTGAGGTTACAGAAAGTGTAGTTCTGATGGAATGTAAAGTTCAGTGTTTGACTTTCTTCTTGGACATGTGGTACCACTTGCAGATGTACAAGCATTCCAATAACAAGACCATGACTACTGGGG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14290] TITLE 'Locus 4.4: Gene_HMG-2'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=790; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Calidris_fuscicollis_11449_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGCGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGTAACCTGGGCCAGGCTCTCACCACCCTTCCACCAAATAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCGTACTCCAAAACACTGCAGTCCTAAAATTCCTAGAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAACTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11449_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCGTACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11450_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAC?AAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATTGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11450_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCGTCATATGGTTCATAATTCGAAGTCATAGAATGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTTTCACCACCCTCCCAC?AAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTATAAAAAAC----TCTCTCTCCACTTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAGAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATTGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11451_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCCCACCAAATAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCGTACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11451_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAAGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGAGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11721_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGACTCTCACCACCCTCACACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11721_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGACTCTCACCACCCTCACACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11723_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11723_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CTATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACTTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11725_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACCTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_fuscicollis_11725_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGACCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CTATTACCTGTTGTCTTACCACAAGATGCCCTTGTAAAAAAC----TCTCTCTCCACTTTTCT???TGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCTAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG?TTTTTCTTGCAGGATATCGCA Calidris_mauri_905_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_905_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGGTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_913_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_913_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGACAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_916_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_916_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAAAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGTATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_921_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_921_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGTATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_923_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCGGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_923_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGGTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACAGCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_929_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_mauri_929_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGGACCTTAAAGACAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCATCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGGTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAATCTCCCCTCTTTCAGTGTCGAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA---ACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCACGGCTGAAACCCCACTCTTGCACACATGCTCTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAACTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11496_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATATGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTATTTTCTTACCACAAGATGCCCTTGT-?AAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCTCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCTTTCCGGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTTGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCAGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11496_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATATGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATATGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTCAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTTTCTTACCACAAGATGCCCTTGT-?AAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCTCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCTTTCCGGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11497_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATATGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTATCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATATCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTTAGCATGGAGGTTCCAGGGCTGAAACCCCGCTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11497_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCGTATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTCAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTTAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTTGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11498_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCTAGCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTTTCTTACCACAAGATGCCCTTGT-?AAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCTCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCTTTCCGGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGGATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATTGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCA-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11498_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATATGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATATGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTATTTTCTTACCACAAGATGCCCTTGT-?AAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCTCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCTTTCCGGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCTCACTCTTGCACACACGCTGTATTTGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11555_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGTGCCTAAACCATAATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTTTCTTACCACAAGATGCCCTTGT-AAAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCGCTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCA-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_11555_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATATGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGTGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCTAGCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGGACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-AAAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTTAGCATGGAGGTTCCAAGGCTGAAACCCCGCTCTTGCACACACGCTGTATTCGATCTGCGTGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACA-TTCCCCACAAGTAAACAGCA-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_14946_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCGTATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTCAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTGTCTTACCACAAGATGCCCTTGT-?AAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAGATGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTTAGCATGGAGGTTCCAAGGCTGAAACCCCGCTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_14946_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGTGCCTAAACCATAATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTCAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTTTCTTACCACAAGATGCCCTTGT-?AAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCTCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCTTTCCGGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTTAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTTGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_14949_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATATGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTTTCTTACCACAAGATGCCCTTGT-AAAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAGACGCTTCCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCGCTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGCG-TTTTTCTTGCAGGATATCGCA Calidris_melanotos_14949_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAGAGGAGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCGCCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACAGCACGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAACCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCTATCTCCCCTCTTTCAGTGTCAAA-CCATTACCTGTTTTCTTACCACAAGATGCCCTTGT-AAAAA--ACCTCTCTCTCCACCTTTCTTGGTGGCCTCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACGCTTCCTTTCCGGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATCTGCATGGTATATATTAGTATTCAGTTATTAAATCGGTACAAATTTGTCTCCAGACTAACG-TTCCCCACAAGTAAACAGTG-TTTTTCTTGCAGGATATCGCA Calidris_minutilla_11534_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGTCTCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCCGGGCAACCTGGGCCAGGCTCTCACCACCCTCCCAGCAAACAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACCCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATACTGCCAAGGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGGAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11534_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACTCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11750_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCGCACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACACTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCGTACTCCAAAACACTGCAGTCCTAAAATTTCTAAACCTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11750_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCCCAGTTCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCGTTGTCTTACCACAAGATGCCCTTGT-AAAA---AACTCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATACTGCCAATGAGACACTTCCT--CCTTCCAG--GGGCACCTGCTTGGAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11776_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCCCAGTTCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGTTCTCACCACCCTCACAGCAAACAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACTCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCATACTCCACAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGTATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATG-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11776_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACTTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCAATATCCCCTCTTTCAGTGTCAAA-CCATTACCCGTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATACTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11777_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGCCACCTCCCACCAGCCCAGGTTGCTCCAAGCCTCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCCCACCAAACAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACTCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATACTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11777_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACTTTAAAGCCAGCCCCCGCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCACCTCAATATCCCCTCTTTCAGTGTCAAA-CCATTACCCGTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACTCTCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATACTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGTATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11785_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCACAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCCCACCAAACAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCGTTGTCTTACCACAAGATGCCCTTGT-AAAA---AACTCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATACTGCCAATGAGACACTTCCT--CCTTCCAG--GGGCACCTGCTTGGAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_11785_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCAAAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGCCCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCGCACCAAAGAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACTCTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCATACTCCAAAACACTGCAGTCCTAAAATTCCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_14959_1 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCACAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCCCACCAAACAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACACTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCGTACTCCAAAACACTGCAGTCCTAAAATTTCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Calidris_minutilla_14959_2 GGCCAAAGATAAACAGCCGTACGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGGAGGGACCTTAAAGCCAGCCCCCACAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGCCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCCCACCAAACAAGTTCTTCCCCACATCTCACCTCAATCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTACCACAAGATGCCCTTGT-AAAA---GACACTCTCTCTACCTTTCTTGGTGGCCCCCTTTGGATCCATGTCTAGAGATATTGCCAATGAGACACTTCCC--CCTTCCAG--GGGCACCTGCTTGAAAAATAAATGGTCGTACTCCAAAACACTGCAGTCCTAAAATTTCTAAAACTAGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGGTTCCAAGGCTGAAACCCCACTCTTGCACACACGCTGTATTCGATATGCATGGTATA-ATTAGTATTCAGTTATTAAATCGCTACAAATTTGTCTCCAGACTAATG-TTCCCCACAACTAAACAGCG-TTTTTCTTGCAGGATATTGCA Phalaropus_lobatus_11480_1 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAGTCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAATCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGAGCAGGTTGCTCCAGGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCCGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGT?AAAAA-AATC??TCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAAAGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTTGATCTGCATGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCGCAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11480_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAGTGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTCGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCATCTCAGTCTCCCCTCTTTCAGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGT?AAAAA-AATC??TCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAGTGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTCGATCTGCGTGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCGCAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11664_1 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAGTGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTCGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCCGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGTAAAAAA-AATATCTCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAAAGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCACTTTTGCACACACGCTCTATTCGATCTGCGTGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCGCAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11664_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAGTGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTCGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAATGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCGGGTTGCTCCAGGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCGGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCAGTGTCAAACCCACTACCCCTTGTCTTACCACAAGATGCCCTTGTAAAAAA-AATATCTCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAGACGCTTTCCTTCCAGAAAGCGGGGCACCTGCTTGGAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATTATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTCGATCTGCGTGGTATATATTAGCATTCGGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCACAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11727_1 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTCGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCATCTCAGTCTCCCTTCTTTCAGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGTAAAAAA-AATATCTCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACATCTAGAGATATTGCCAATGAGACGCTTTCCTTCCAGAAAGCGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACACTCTATTCGATCTGCGTGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCACAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11727_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGACCAGGTTGCTCCAAGCCCCCTCCAAGCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACTCTCACACCAAACAAGTTCTTCCCCACATCTCATCTCAGTCTCCCCTCTTTCAGGGTCAAACCCATTACCCGTTGTCTTACCACAAGATGCCCTTGTAAAAAA-AATATCTCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAAAGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAGAATACTGCAGTCCTAAAATATCTAAAACTGGATCATGTGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGCATTCGGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCGCAACTAAACAGCA-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11736_1 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAATCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGAGCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCAGTCTCCCCTCTTTCCGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGT?AAAAA-AATC??TCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAGTGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTCGATCTGCGTGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCACAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_11736_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAGTGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAATCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGAGCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCCGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGT?AAAAA-AATC??TCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAGTGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCACAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_14868_1 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAATCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGAGCAGGTTGCTCCAGGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCGCATCTCAGCTCCATCTCCCCTCTTTCAGGGTCAAACCCATTACCCGTTGTCTTACCACAAGATGCCCTTGTAAAAAA-AATATCTCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAAAGAGATGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCAGAATACTGCAGTCCTAAAATATCTAAAACTGGATCATGTGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTCGATCTGCATGGTATATATTAGCATTCGGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACA-TTCCCCGCAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_14868_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAGTGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCCGGGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGTAAAAAA-AATATCTCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAAAGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACGCTCTATTTGATCTGCATGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCGCAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_14895_1 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTCGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAAGCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCACACCAGGTTGCTCCAGGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCACATCTCAGCTCCATCTCCCCTCTTTCCGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGT?AAAAA-AATC??TCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAGTGAGACGCTTTCCTTCCAGAAAGTGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCTAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACACTCTATTTGATCTGCATGGTATATATTAGCATTCAGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCGCAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Phalaropus_lobatus_14895_2 GGCCAAAGATAAACAGCCGTATGAACAGAAGGCTGCAAAACTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGATGAAAGAAGGGTTGAAGGTGCAGAGGTCACTGTAAATGCGTGACTTCTGTTTTGCACCTAAACCATCATAAGGTTTGTAATCCTAAGTCATAGAAGGGCTTGGGTGGGAAGGGACCTTAAATCC----CCCCCAGTGCCACCCCCTGCCCTGGGCAGGGACACCTCCCACCAGAGCAGGTTGCTCCAGGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCCCAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACCAAACAAGTTCTTCCCCGCAGCTCAGCTCCATCTCCCCTCTTTCCGTGTCAAACCCATTACCCCTTGTCTTACCACAAGATGCCCTTGC?AAAAA-AATC??TCTCTCCAGCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAGTGAGACGCTTTCCTTCCAGAAAGCGGGGCACCTGCTTGAAAAATAAATGGTCATACTCCATAACACTGCAGTCCGAAAATATCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATTGAGGTCCCAAGGCTGAAACCCCAGTTTTGCACACACACTCTATTTGATCTGCATGGTATATATTAGCATTCGGTTATTAAATAGGTACAGATTTGTCTCCAGACTTACG-TTCCCCACAACTAAACAGCG-TTTTCCTTGCAGGATATCGCA Philomachus_pugnax_120_1 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCCCAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_120_2 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCCCAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGAGCAGCCACAGCTTCTCTGGCCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_121_1 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCACAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_121_2 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCCCAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGCCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_123_1 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCACAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_123_2 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCCCAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGCCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTATGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_124_1 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAGAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACTATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCACAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_124_2 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACCATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCACAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_171_1 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACTATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCACAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTTCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_171_2 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACTATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCCCAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGAGCAGCCACAGCTTCTCTGGCCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTTCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCGTGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTATGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_204_1 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAGAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACTATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCACAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA Philomachus_pugnax_204_2 GGCCAAAGACAAACAGCCGTACGAACAGAAGGCTGCAAAGCTAAAGGAGAAATACGAGAAGGTAGAGTGGAAGTGGTGAAAGAAGCGTTAAAGGTGCAGATGTCACTGTAAATGTGTGACTTCTGTTTTGCACCTAAACTATCATATGGTTCATAATTCTAAGTCATAGAAGGGTTTGGGTTGGAAGGCACCTTACAGCC----CCCCCAGTGCCACC-----CCCTGGGCAGGGACACCTCCTACCAGACCAGGTTGCTCCAAGCCCCCTCCAACCTGGCCTTGAACCCCTCCAGGGATGGGGCAGCCACAGCTTCTCTGGGCAACCTGGGCCAGGCTCTCACCACCCTCACACC--A-AAGTTCTCCCTGAGATCTCATCCCAGTCTCCCCTCTTTCAGTGTCAAA-CCATTACCCCTTGTCTTGCCACAAGATGCCCTTGT-AAAAA--AAAAATCTCTCCACCTTTCTTGGTGGCCCCCTTTGGATCCACGTCTAGAGATATTGCCAATGAAACACTTCCCTTCCAGAAAGCAGGGCACCTGATTGAAAAATAAATGGCCATACTCCAGAACACTGCAGTCCTAAAATTCCTAAAACTGGATCATGCGTTCTCTTGCCAAAATGTTTAAGCATGGAGATTCCAAGGCTGAAACCCCACTTTTGCACACACATTCTATTAGATCTGCATGGTATATATTAGTATTCGGTTATTAAATCAGTATAGATTTGTCTCCAGACTTTTGTTTCCCCACCACTAAACAGCG-TTTTTCTTGCAGGATATCGCA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14304] TITLE 'Locus_50.99: Gene_UDP'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=698; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11449_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11450_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11450_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11451_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11451_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11721_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACAT?GGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11721_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACAT?GGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11723_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACAT?GGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11723_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACGTTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACAT?GGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11725_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_fuscicollis_11725_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACATCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTAACCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAATTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACATTGGAGCTGCAGCAGATGCACATCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATGTGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_905_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_905_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_913_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_913_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_916_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_916_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_921_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_921_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_923_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_923_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_929_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--CCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_mauri_929_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCATAGTTGTTTTTGTTCTCTATTTATCCTCACAGTGTAAGTTGCAGAGCTCAGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGTTGCAGCAGATGCACACCTGATGCTAAGACC-TCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATG--TCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11496_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11496_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11497_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATTTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11497_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATTTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11498_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11498_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11555_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_11555_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_14946_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_14946_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_14949_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_melanotos_14949_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACACCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCTCACAGTATAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATTTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTATCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTGATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCGGGGATAAAAGCACTCCATAAAAACCAATATGTGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11534_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11534_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11750_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11750_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11776_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11776_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11777_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11777_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11785_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_11785_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_14959_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Calidris_minutilla_14959_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCTGAAGGAGCAAACAGCTGTTCATTGAGTTGCCAGCTCAGAGTTGTTTTTGTTCTATATTTATCCCCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTGTGTAGTTTTTAGTTAA-----GAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTGCAGCAGATGCACACCTAATGCTAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGCTTAATATCT Phalaropus_lobatus_11480_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCATTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTTGACCCCAAAATCCACAGCAAAAATCTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCCGAAATGTCCTCCAGCAATGTGAGCA-TGGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAAGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11480_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCATTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTTGACCCCAAAATCCACAGCAAAAATCTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCCGAAATGTCCTCCAGCAATGTGAGCA-TGGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAAGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11664_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAATTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTGTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTTTATGTCTCACATTGTTTCCCTTCATCTTCTTCCTCACACTGAAAAGCTGAAATATCCTCCAGCAATGTGAGCA-TAGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11664_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTTGTTGAGTTGCCAGCTCAGAATTGTTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTGTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATATCCTCCAGCAATGTGAGCA-TAGAGCTGCAGCAGATGCACACCTCATGGTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11727_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGTTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTGTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTTTATGTCTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCCGAAATGTCCTCCAGCAATGTGAGCA-TGGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11727_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGGTGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTTGTTGAGTTGCCAGCTCAGAACTGTTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTGTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTAAAATATCCTCCAGCAATGTGAGCA-TAGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAAACAATATATGCTTTAAAGACAATCTGTTGTATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11736_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTCGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCATTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTTGACCCCAAAATCCACAGCAAAAATCTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAGCA-TGGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAAGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_11736_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGGTGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTCATTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGTTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATATCCTCCAGCAATGTGAGCA-TAGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGCGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_14868_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAATTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTGTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTTTATGTCTCACATTGTTTCCCTTCATCTTCTTCCTCACACTGAAAAGCTGAAATATCCTCCAGCAATGTGAGCA-TAGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_14868_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAATTGCAGAGCTGGGCACATAAGCCCAAGTTGGACCCCAAAATCCACAGCAAAAATCTTTGTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTTTATGTCTCACATTGTTTCCCTTCATCTTCTTCCTCACACTGAAAAGCTGAAATATCCTCCAGCAATGTGAGCA-TAGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_14895_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGGTTTTGTTCTATAGTTATCCTCAAAGTGTAAGTTGCAGAGCTGGGCACATAAGCCCAAGTTTGACCCCAAAATCCACAGCAAAAATCTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCACATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATATCCTCCAGCAATGTGAGCA-TGGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTACAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Phalaropus_lobatus_14895_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGCTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAG---AAATGATTCAAGTTCTGTTGTTAAACTGAAAGTCAAAACATCCAAAGGAGCAAATAGCTGTTCGTTGAGTTGCCAGCTCAGAATTGTTTTTGTTCTATAGTTATCCTCAAAATGTTAGTTGCAGAGCTAGGCACATAAGCCCAAGTTTGACCCCAAAATCCACAGCAAAAATCTTTTTGTAGTTTTTAGTTAATTTAAGAGGCACTGACATTGCTTCTATGTGTCAGATTGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCCGAAATGTCCTCCAGCAATGTGAGCA-TGGAGCTGCAGCAGATGCACACCTCATGCTGAGACCATCTAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCTACGAAAACCAATATATGCTTTAAAGACAATCTGTTGTATGTCCCTCTGTGATTAAGGTGTTTCACTCACCTGCATCCACATTGGGGAACAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_120_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_120_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_121_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_121_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_123_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_123_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_124_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_124_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_171_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_171_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_204_1 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT Philomachus_pugnax_204_2 CTGTTACCAATCATACAACCAGCATGAGCAACTAGCTGAATGAACTGGTCAAATGGGACATGTTTTACTGCCCGAAAATTGGGATGATGTTCAATGCCCTTCTTCCTCATCACCCGAACCATCTCTTTGCTTCCTGCAGAAAAACAAGAAGTAGACTAAATGATTCAAGTTCTGTCGTTAAACTGAAAATCAAAACATCTGAAGGAGCAAATAGCTGTTCACTGAGTTGCCAGCTCAGAGTTGGTTTTGTTCTGTATTTATCCTCACAGTGTAAGTTGCAGAGCTGGGCACATAAGACCAAGTTTGATCCCAAAATCCACTGCAAAAATATTTTTGTAGTCTTTAGTTAATTTAAGAGGCACTAACATTGCTTCTATGTGTCACTTGGTTTCCCTTCATCTTCTTCCCCACACTGAAAAGCTGAAATGTCCTCCAGCAATGTGAACA-TGGAGCTACAGCAGACGCACACCTGATG-TAAGACCATCCAGCTATTTCCATCTGGCTGGAGGTTCTGGGATAAAAGCACTCCATAAAAACCAATATATGCTTTAAAGACAATCTGTTATATGTCTCTCTGTGATTAAGGTATTTCACTCACCTGCATCCACATTGGGGAAGAGAACAAGTGTTCTCTTGTTGAAGGAGATGAGTGCATCTAGTGTCAGCTCAAACATCTTTATGGAATGTTTAATATCT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14297] TITLE 'Locus_TGFB2: Gene_TBFB2'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=464; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Calidris_fuscicollis_11449_1 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTCCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGAATTACCTGC Calidris_fuscicollis_11449_2 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGAATTACCTGC Calidris_fuscicollis_11450_1 CATCCATATTCAGTATACTTACACCATACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAGATGGCAGATAAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGATGATTCCCAGA?CCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAGAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11450_2 CATCCATATTCAGTATACTTACACCATACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAGATGGCAGATAAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGATGATTCCCAGA?CCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAGAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11451_1 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTCCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAATCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAAGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCCTTGTCTGTATAAGCAAGTCCTCCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11451_2 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTCCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAATCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAAGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCCTTGTCTGTATAAGCAAGTCCTCCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11721_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAATCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAAGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCCTTGTCTGTATAAGCAAGTCCTCCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11721_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAATCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAAGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCCTTGTCTGTATAAGCAAGTCCTCCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11723_1 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTCCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAATCAGGAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAAGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCCTTGTCTGTATAAGCAAGTCCTCCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11723_2 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTCCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATGAGGAAGGTTGTGGCCTTAGAAATCAGGAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAAGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCCTTGTCTGTATAAGCAAGTCCTCCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11725_1 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATAAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_fuscicollis_11725_2 CATCCATATTCAGTATACTTACACAGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG?TGGCAGATAAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_905_1 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_905_2 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_913_1 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_913_2 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_916_1 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_916_2 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACTTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTAATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_921_1 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_921_2 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGAAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_923_1 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_923_2 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_929_1 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_mauri_929_2 CACCCATATTCAGTATACTTACACCGTACTACCAGCCTGTGAGGTGTAACACAATTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11496_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11496_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11497_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCTATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11497_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11498_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAGAGAGGCCACTTGGTCGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11498_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACTGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGAGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11555_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_11555_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTGACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_14946_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_14946_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACTGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACTGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_14949_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCTCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCTATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_melanotos_14949_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCAGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAGAGAGGCCACTTGGTCGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11534_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTGGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11534_2 CATCCATATTCAGTATATTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAGGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCCGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11750_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11750_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCATAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGAGACTCAGACTTACCTGC Calidris_minutilla_11776_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11776_2 CATCCATATTCAGTATATTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCAAGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11777_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTACAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGGTGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11777_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACACAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTACAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11785_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_11785_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_14959_1 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Calidris_minutilla_14959_2 CATCCATATTCAGTATACTTACACGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGACGATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATAAGCAGGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11480_1 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCTCAGACCCTCGTTCGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATGGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTCTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11480_2 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGCTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11664_1 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11664_2 CATCCATATTCAGTATACTTACACAGTACTATCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGAAAGTCCTGCCACGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTATTGATGTGACTTGGTCGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11727_1 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11727_2 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGTACAGACCCTCGTTCGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAAAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGAAAGTCCTGCCATGCCTAAGCATCTGATTTCAGTTACAATATAAGATACTATTGATGTGACTTGGTCGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11736_1 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACACGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTTACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCGTTAGCTTTGTCTGTATACGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_11736_2 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAGGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_14868_1 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAAACCCTCGTTTGCAGACCCACAGGGTCTGCGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGAAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_14868_2 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGCTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_14895_1 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Phalaropus_lobatus_14895_2 CATCCATATTCAGTATACTTACACAGTACTACCCTGCTGTGAGGTGTAACGCGGTTGCTTATCATGTTTCTTTACAGCTGGCATTTATACAGAGCACAGACCCTCGTTTGCAGACCCACAGGGTCTGTGTGCTGCAGGTTTCTGCCCAGCAGTCTGCAGGCCCACAGAGACA-ATGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAATTGAGTTCCATCTGGGAGGATTCCCAGACCCATCAGTCCATTACAGCCAAATTATCACCTCCATTGTGCTCACCTACTCTAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGATACTGTTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_120_1 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_120_2 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCTAAGGGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_121_1 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_121_2 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_123_1 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_123_2 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_124_1 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_124_2 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_171_1 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_171_2 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_204_1 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCAAAGAGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGATTGTGAATTTTTGGGACTCAGACTTACCTGC Philomachus_pugnax_204_2 CATCCATATTCAGTATACTTACATGGTACTACCAGCCTGTGAGGTGTAACGCAGTTGCTTATCATGTTTCTTTACAGTTGGCATTTATACAGAGCACAGACCCTCATTTGCAGACCCATGGGGTCTGTGTGCTGCAGGTCTCTGCCCAGCAGTCTGCAGTCCCACAGAGACAG-TGGCAGATGAGGAAGGTTGTGGCCTTAGAAAGCAGAAGTTGAGTTCCATCTGGGGCTATTCCCAGACCCATCAGTCCATTGCAGCCAAATTATCACCTCCATTGCGCTCACCTACTCTAAGGGGCCACTTGGTAGGACCTGGAGAAAAATACTTACTAGTCCTCCAGGGAAACCATTAGCTTTGTCTGTATAAGCAAGTCCTGCCATGTCTAAGCATCTGATTTCAGTTACAATATAAGCTACTATTGATGTGATTTGGTTGTGAATTTTTGGGACTCAGACTTACCTGC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14302] TITLE 'Locus_31.46: Gene_FRAS1'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=810; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Calidris_fuscicollis_11449_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATAAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAATTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAGTGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGTAGG-AAAAAATCTTTGTAATGTACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCATCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11449_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCATCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCTACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAGACACTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATAATCAGCCATTTGAA-GCAAACTACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11450_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCTACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAGACACTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATAATCAGCCATTTGAA-GCAAACTACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11450_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCTACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAGACACTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATAATCAGCCATTTGAA-GCAAACTACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11451_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTA?CCCATGGAAAGCAAGAACAAGAGCTCTGAAAGACACTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATAATCAGCCATTTGAA-GCAAACTACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11451_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAATTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGTACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTA?CCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCATCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11721_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAATTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGTAGG-AAAAAATCTTTGTAATGTACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCATCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11721_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCTACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAGACACTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATAATCAGCCATTTGAA-GCAAACTACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11723_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAATTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGTACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTA?CCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCATCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11723_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCACATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAATTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGTAGG-AAAAAATCTTTGTAATGTACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTA?CCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCATCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11725_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAATTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGTAGG-AAAAAATCTTTGTAATGTACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCATCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_fuscicollis_11725_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCTACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATACGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAATGGTATGTCAGTAAATGGAGATACAATGGAGTTAAAAGCAAAGCCTATGAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAGACACTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATAATCAGCCATTTGAA-GCAAACTACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_mauri_905_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAGTGGTATGTCAGTAAATGGAGATACAATGGAGTTAAATGCAAAGCCTATAAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTATAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTCGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCGTCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_mauri_905_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAGTGGTATGTCAGTAAATGGAGATACAATGGAGTTAAATGCAAAGCCTATAAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCTAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTATAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCGTCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_mauri_913_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAGTGGTATGTCAGTAAATGGAGATACAATGGAGTTAAATGCAAAGCCTATAAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCGTCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_mauri_913_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGGGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAGTGGTATGTCAGTAAATGGAGATACAATGGAGTTAAATGCAAAGCCTATAAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTATAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCGTCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_mauri_916_1 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAGTGGTATGTCAGTAAATGGAGATACAATGGAGTTAAATGCAAAGCCTATAAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCCAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTGTAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGAAAAACATTATTTGTGGTGATGACCTTGGCAACAGCAGGCAGAAAAGATCTATCACAGTTTGATTTGAAAGTCTGTCAGAAGTTGTAAAATCGTCAGCCATTTGAA-GCAAACCACAGGACTCTGCCAAAGATGCTTCAGTGCCATACCTGTGGCTCTGAGAGATTGGGAGGGTCATGGCTATCACACAGCACAAACTCAAGGGAATC Calidris_mauri_916_2 TCTATGAAGTGGAGATGTTTCTTAGTTAGGTGAGCAATCTCAGTCTCCTTAACAACCAGATGACGCGTCACTCCTGGGGCTTCTCTGGGTAGCTGATCATCCACAGGGATAATGTGCACCATCATCACCTCAAATCAGAAAGACAGTAAAATCAGCAGCCACTCCTCTC---AAGAAGGGAGTGTCTAAGCGTCTGTTCACAAAGATGCACACACAGAATTAAGTGGATCTCTGGAATATGAGACATATGATGTGGCTGTCATGCCATATCATGAACACATGAATAATGGAGATATACCATTAAGTGGTATGTCAGTAAATGGAGATACAATGGAGTTAAATGCAAAGCCTATAAATTTTAGTGGTTTCCCTTTAAATTAAAAGCGAAGTTAAA-TCTAGTATGTTGGACTCCTGGGTGAAATAAACAGTCTCTTCTCAATGGACTTTAGTAGGGCTGTTTAGTTTGTTTGTACTGTCTCCAAATCTAATTTGTTTTCAACATTTCATTTTACAATGCAGG-AAAAAATCTTTATAATGGACTTGCTCCTCTGCAGTCAGGCAGAGAGAATTACCCCATGGAAAGCAAGAACAAGAGCTCTGA