#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 18:48 GMT TreeBASE (cc) 1994-2008 Study reference: Beck J., Allison J.R., Pryer K., & Windham M.D. 2012. Identifying multiple origins of polyploid taxa: a multilocus study of the hybrid cloak fern (Astrolepis integerrima; Pteridaceae). American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13385] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=58; TAXLABELS Astrolepis_cochisensis_chihuahuensis_4716 Astrolepis_cochisensis_chihuahuensis_4718 Astrolepis_cochisensis_chihuahuensis_5651 Astrolepis_cochisensis_chihuahuensis_7107 Astrolepis_deltoidea_5828 Astrolepis_deltoidea_6144 Astrolepis_deltoidea_6884 Astrolepis_integerrima_3159 Astrolepis_integerrima_4719 Astrolepis_integerrima_5635 Astrolepis_integerrima_5636 Astrolepis_integerrima_5637 Astrolepis_integerrima_5638 Astrolepis_integerrima_5640 Astrolepis_integerrima_5642 Astrolepis_integerrima_5643 Astrolepis_integerrima_5644 Astrolepis_integerrima_5645 Astrolepis_integerrima_5646 Astrolepis_integerrima_5647 Astrolepis_integerrima_5648 Astrolepis_integerrima_5656 Astrolepis_integerrima_5660 Astrolepis_integerrima_5665 Astrolepis_integerrima_5668 Astrolepis_integerrima_5675 Astrolepis_integerrima_5677 Astrolepis_integerrima_5686 Astrolepis_integerrima_5708 Astrolepis_integerrima_5709 Astrolepis_integerrima_5710 Astrolepis_integerrima_5724 Astrolepis_integerrima_5725 Astrolepis_integerrima_5726 Astrolepis_integerrima_5727 Astrolepis_integerrima_5728 Astrolepis_integerrima_5995 Astrolepis_integerrima_6131 Astrolepis_integerrima_6155 Astrolepis_integerrima_6156 Astrolepis_laevis_5829 Astrolepis_laevis_6111 Astrolepis_laevis_6217 Astrolepis_laevis_6891 Astrolepis_laevis_6892 Astrolepis_laevis_6895 Astrolepis_laevis_7167 Astrolepis_obscura_6142 Astrolepis_obscura_6143 Astrolepis_obscura_6251 Astrolepis_sinuata_mexicana_2955 Astrolepis_sinuata_mexicana_6126 Astrolepis_sinuata_mexicana_6212 Astrolepis_sinuata_mexicana_6907 Astrolepis_sinuata_mexicana_7166 Pellaea_pringlei_5028 Pellaea_sagittata_5029 Pellaea_truncata_3137 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14399] TITLE trnGR; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1215; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Astrolepis_cochisensis_chihuahuensis_4716 AAGTGTGATTCGTTTCGTAGCAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---ATAAAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGA-- Astrolepis_cochisensis_chihuahuensis_4718 -----------------TAGCAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGA-- Astrolepis_cochisensis_chihuahuensis_5651 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGGGTAAAAGAAAGAGA Astrolepis_cochisensis_chihuahuensis_7107 --------------------------------TTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGG--------------- Astrolepis_deltoidea_5828 AAGTGTGATTCGTTTCGTAGCAATTTGGGTAGTTGAGGGATCTTTCAAACCGGATCTCGACCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACATCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACCGCATCTACTGCTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTT-AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAAAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAAGTTCGTCTAAGTGAGTAGACTTACTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAATGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCC--------------------------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_deltoidea_6144 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACATCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACCGCATCTACTGCTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTT-AT---AAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCGTTCGCTTTCTAGAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTTTTCTTTAGAAAGTTCGTCTAATTGAGTAGACTTATTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCGACTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_deltoidea_6884 -----------------------TTTGGGTAGTTGAGGGATCTTTCAAACCGGATCTCGACCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTAGTGACGAAGCAGAATTTTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACATCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACCGCATCTACTGCTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTT-AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTGCTTGGTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAAAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAG------ATAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAAGTTCGTCTAAGTGAGTGGACTTACTAAGCAAATCTCAACTAATTTCGAACTAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAATGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TGTACAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCC--------------------------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATTGGGAA--GTGGGTGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_3159 AAGTGTGATTCGTTTCGTAGCAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAAAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTTT--AT--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAATATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGACGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--ATGGGTGGGGGGGGGG---TAAAAGAAAGAGA Astrolepis_integerrima_4719 AAGTGTGATTCGTTTCATAACAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGGG---TGAAAGAAAGAGA Astrolepis_integerrima_5635 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGAGA Astrolepis_integerrima_5636 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGAGA Astrolepis_integerrima_5637 ------------------------TTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-------------- Astrolepis_integerrima_5638 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGAGA Astrolepis_integerrima_5640 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5642 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGAGA Astrolepis_integerrima_5643 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5644 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5645 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5646 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5647 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5648 ------------------------TTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGA-- Astrolepis_integerrima_5656 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTT---AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATCGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAGTATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGAGA Astrolepis_integerrima_5660 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5665 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5668 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGGG---TGAAAGAAAGAGA Astrolepis_integerrima_5675 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5677 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5686 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_5708 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAAAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTTT--AT--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAATATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGACGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--ATGGGTGGGGGGGGGG---TAAAAGAAAGAGA Astrolepis_integerrima_5709 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAAAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTTT--AT--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAATATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGACGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--ATGGGTGGGGGGGGGG---TAAAAGAAAGAGA Astrolepis_integerrima_5710 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAAAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAAACACCCAGGAAAAGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAAAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATATTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATCTCCCTAAGGATTTTTTT--AT--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGTGAAATTAGTTCTTTCCC-TCCTAGTTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGAGGAATATATCATAGGTACTTGCCCCCTTTAAGTGAAAT-----AAAGGGAAGCAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAATTTCGAACCAAAATTATCCTATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------CGTGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCAACTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGACGCACTCATACACAAGTGCAAGAGACTTTAATCGGGAA--ATGGGTGGGGGGGGGG---TAAAAGAAAGAGA Astrolepis_integerrima_5724 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5725 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5726 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5727 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5728 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAGAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTTTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTTTCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGG------TGAAAGAAAGAGA Astrolepis_integerrima_5995 -------------TTCATAACAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_6131 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCCACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGGG---TGAAAGAAAGAGA Astrolepis_integerrima_6155 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_integerrima_6156 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCCACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTAAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCGTATCG----TATATAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGGG---TGAA--------- Astrolepis_laevis_5829 --------------------------------------------------------TCAACCAAATTGACTG?AAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACT?TGAGAGAGAAAGTTCAAATGAATCAATT?TGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTTTAG-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAATCGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTATCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGTGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_laevis_6111 --------------------CAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCTGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTTTAGAAAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAATTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGTGGGGGGGGGG---TGAAAGAA----- Astrolepis_laevis_6217 --------------------------------------------------------TCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTCTTTTTTAG--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTA----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAATCGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGTGGGGGGGGGG---T------------ Astrolepis_laevis_6891 -------------------------------------------TCCAAACCGGATATCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATTAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTTTAGAAAAAAAAAA-TAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTGCC-CCCTAATTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTCAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCAACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTACTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGTGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_laevis_6892 --------------------------------------------------------TCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATTAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTTTAGAAAAAAAAAA-TAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTGCC-CCCTAATTGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTCAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCAACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTACTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTTGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGTGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_laevis_6895 -----------------------TTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTTTAG-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAATCGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTATCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGTGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_laevis_7167 ---------------------------------------------------GGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGAAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCTACTGTTTCAACGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTTTTAG--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAATCGGG-----AAAAAGATTCCTTGTGAAACGTGGAGTCTGAAAACCCCGTGTCTCACACTGAAGTAAAGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTGGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCAATTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTAGGTGGGGGGGGGG---------------- Astrolepis_obscura_6142 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGGAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_obscura_6143 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTTCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGGTTGAGCAGTATCTACTGCTTCAACGACTCGGTGAAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTATCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_obscura_6251 -----------------------TTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCAACCAAATTGACTGAAAAAAACTTTATTTTTTCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGAGAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGAAAAGGGAAAAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATTCTGGTTTGCCAGAACTGTTGAATACTTA------CTTGATTGAGCAGTATCTACTGCTTCAACGACTCGGTGAAAAATATTTCCCTAAGGATTTCTTTT-AGAAAAAGAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAAGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCC-CCCTAGTTGAG-----AAAAAGATTCTTTGTGAAACGTGGAGTCTGAAAACCCCGTATTTCACACTGAAGTAGGGGAGTCTATCATAAGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTATCCACTGTCCCAGCTCTTCTTTAAAAGGTTCGTCTAATTGAATAGACGTATTAGGCAAATCTCAACTAATTTCGAAGCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAAAGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCATTACTCATGCTGGTAATATTCCTCG---------TATACAGCCCCTCCTCTGAAAAGTCAAACTAATGTTCTATCCGCCGATTTTGTCTCTATCCGCC-------------------GACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGTGCACTCATACATAAGTGCAAGAGACTCTAATGGGGAA--GTGGGAGGGGGGGGG----TGAAAGAAAGAGA Astrolepis_sinuata_mexicana_2955 AAGTGTGATTCGTTTCGTAGCAATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGATAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACAGCATCTACTGCTTCACCGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTT--AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTGGAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGGTTGGGAAAAAGATTCCTTGTGAAATGTAGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCGTAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACTTATTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCATCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCGACTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGGG---TAAAAGAAAGAGA Astrolepis_sinuata_mexicana_6126 ----------------------ATTTGGGTAGTTGAGGGATCTTCCAAACCGGATCTTGACCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGATAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACAGCATCTACTGCTTCACCGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTT--AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTGGAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGGTTGGGAAAAAGATTCCTTGTGAAATGTAGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCGTAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACTTATTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCATCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCGACTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGGGGG-TAAAAGAAAGAGA Astrolepis_sinuata_mexicana_6212 ----------------------------------------------------------GACCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGATAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACAGCATCTACTGCTTCACCGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTT--AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTGGAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGGTTGGGAAAAAGATTCCTTGTGAAATGTAGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCGTAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACTTATTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCATCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCGACTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGGGGG-------------- Astrolepis_sinuata_mexicana_6907 ------------------------------------------------------------CCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGATAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACAGCATCTACTGCTTCACCGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTT--AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTGGAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGGTTGGGAAAAAGATTCCTTGTGAAATGTAGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCGTAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACTTATTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCATCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCGACTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGGGG--------------- Astrolepis_sinuata_mexicana_7166 ------------------------------------------------------------CCAAATTGACTGAAAAAA-CTTTATTTTTGCAGAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTTGGAAGCTAGATAAGTTGGTGACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTAGACACCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAAAAAACTCTGAGAAAGAAAGTTCAAATAAATCAATCCTGGTTTGCCAGGATTATTGAATACTTA------CTTGGTTGAACAGCATCTACTGCTTCACCGACTCGGTGGGAAATATTTCCCTAAGGATTTTTTT--AT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCTAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCGCCTTTCGCTTTCTGGAAGCGAAATGAATTCTTTCCC-CCCTAGTTGGGTTGGGAAAAAGATTCCTTGTGAAATGTAGAGTCTGAGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCGTAGGTACTTGCCCCCTTTAAGTGAAAT-----GAAGGGAAGTAGCCACTGCCCCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACTTATTAAGCAAATCTCAACTAATTTCGAACCAAAATTCTCCAATAAAGGAGCCGAATGGGCCGAAACGCCCAAGTTCGGTTCTGAATTAGCGGTGCCATTATCATTTATTGGCATCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTCAT-------GCTAGTAATATTCCTCG---------TATGCAGCCCCTCCTCTGAAAAGTCAAACTAATATTCTATCCGCCGACTTTGTCTCTATCCGCCAACTTTGTCTCTATCCGCCGACTATGTCGTGAACAAACAAGAGCTTTCGTCTGTTCACGATTCGGCGCACTCATACATAAGTGCAAGAGACTTTAATTGGGAA--GTGGGTGGGGGGGGGGGG-------------- Pellaea_pringlei_5028 ---TGTGATTCGTTTCATAGCAATTTTGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAGTTGGCTGAAAAAA-CTTTATTTATGTATAAGTAAATATGTGTGTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCTCGTCACTCATCTACTTCGTAAGCGAGAGAAGTTGGTAACGAAGCAGAATTGTATAAGTACCCCGAAAAATACTTGGGTTAATTTATACCCCCAGGAAAGGAAAGAATCTATGGGTAGACATCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAAGATTGTCGAATACTTATACTTACTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGGAAAATATTTACCTAAGGATTTTTTTTAAT-AAAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCCAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATATGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCATCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCCCCTCTAGTTGGG-----AAAAAAATTCCTTGTGAAATGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTATTTGCCCACTTTAAGTGAAAT-----GAGGGGAAACAGCCACTGTCCCAGCTCTTCTTTAGAAGGTTCTACTAATTGAGTAGACCTATTAGGTAAATCTCAACTAATTTCAAACCGAAATTCTCCCATAAAGGAGCCGAATGGGCCGAAACGTCCAAGTTCGGTTCTGAATTAGCGGTGCCATGATCATTTGTTGGCATCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTTAT-------GCTGGTAATACTCCTCGTAATATAATACTGCAGTCACTGCTATGAAAAGTCAAACTAATACTCTATCCGCTAACTTTGTCTCTATCCACC-------------------GACTGTATCGTGAACAAACAAGAGCTTTCGTTTGTTCACGATTCAGCGTACTCATACATAAGTGTAAGAGACTTAAATTGGGAA--GCGGGTGGGAGGGAAGGGGGGGGCGAAAGAA- Pellaea_sagittata_5029 ---TGTGATTCGTTTCATAGCGATTTTGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTATGTATAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCTCGTCACTCATCTACTTCGGAAGCTAGAGAAGTTGGTAACGAAGCAGAATTGTATCAGTACCCCGAAAAATACTTGGGTTAATTTA-ACCCCCAGGAAAGGAAAGAATCTATGGGTAGACATCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAAAAAGTTCAAATGAATCAATCCTGGTTTGCCAAGATTGTTGAATACTTA------CTTGGTTGAGCAGCATTCACTGCTTCAACGACTCGGTGGGAAATATTTACCTAAGGATTTTTTTTAAT--AAAAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTAACACTAAATTTCCTCCCAAGGGATCATCTGAGAAGTATATCCTTG----GTATACGGCATACGGCTAGGATGCATACAAAACCGACATAGATGTTATGAGCATCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCCCCTCTAGTTGGG-----AAAAAAATTCCTTGTGAAACGTGGAGTCTGGGAACCCCGTGTTTCACACTGAAGTAGGGGAGTCTATCATAAGTATTTGCCCACTTTAAGTGAAAT-----GAGGGGAAACAGCCACTGTCTCAGCTCTTCTTTAGAAGATTCGTCTAATTGAGTAGACGTATTAGGCAAATCTCAACTAAATTCAAACCAAAATTCTCCCATAAAGGAGCCGAATGGGCCGAAACGTCCAAGTTCGGTTCTGAATTAGCGGTGCCATGATCATTTGTTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTTAT-------GCTGGTAATACTCCTCGTAATATAATACTGCAGCCACTGCTATGAAAAGTCAAACTAATAATCTATCCGCTAACTTTGTCTCTC-------------------------AACTGTATCGTGAACAAACAAGAGCTTTCGTTTGTTCACGATTCGGCGCACTCCTACATAAGTGCAAGAGACTTAAATTGGGAA--GCGGGTGGGAGGGAAGGGGGGGTCGAAAGAA- Pellaea_truncata_3137 AAGTGTGATTCGTTTCGTAGCGATTTCGGTAGTTGAGGGATCTTCCAAACCGGATCTCGACCAAATTGGCTGAAAAAA-CTTTATTTTTGTAAAAGTAAATATGTGTCTTTCTACTACTTTTCTGGTGTTAGGGGGAAATTCATCAATCCCGTCACTCATCTACTTCGGAAGCTAGAGAAGTTGGTGACGAAACAGAATTGTATCAGTACCCCGAAAAATACTTGTGTTAATTTAGACCCCCAGGAAAGGGAAGAATCTATGGGTAGACGTCTAAGATATCTGTGTCATCGTCACTGAACCTTGGAGAAAACTCTGAGAGAGAAAGTTCAAATGAATCAATCCTGGTTTGCCAGGATTGTTGAATACTTA------CTTGGTTGAGCAGCATCCACTGCTTCAACGACTCGGTGAGAAATATTTCCCTAAGGATTTTTTT--ATTTTAGAAAAAATAAGGAACGAATTAAAGGGAAGGATCTGTACCACTAAATTTCCTCCCAAGGGATCATCTGAGAAGTCTATCCTTG----GTATATGGCATACGGATAGGATGCATACAAAACCGACATAGATGCTACGAGCGCCTTTCGCTTTCTAGAAGCGAAATTAGTTCTTTCCTCC-CTAGTTGGT-----AAAAAGATTCCTTGTAAAACGCGGAGTCTGGGAACCCCGTGTTTCACCCTGAAGTAAGGGAATCGATCATAGGTACTTGCCCCCTTTAAGTGAAATGAAATGAGGGGAAGCAGCCACTGCCTCAGCTCTTCTTTAGAAGGTTCGTCTAATTGAGTAGACGTATTAGGAAAATCTCAACTAATTTTGAACCAAAATTCTCCCATAAAGGAGCCGAATGGGCCGAAACGTCCAAGTTCGGTTCTGAATTAGCGGTGCCATGACCATTTCTTGGCGTCGACTATAACCTTTAGCCTTCCAAGCTACTGATGCGGGTTCGATTCCCGCTACCCGCTATTACTTAT-------GCTGGTAATACTCCTCGTAATA-----CTGCAGCCCCTCCTCTGGAAAGTCAAACTAATATTCTATCCGCC--------------------------------------GACTATGTCGTGAACAAACAAGAGGTTTCGTCTGTTCACGATTCGGCGCAGTCATACAGAAGTGCAAGAGACTTTAATTGGGAAAAGCAGGTGGGGGGGGGTGAAAGAAAGAGA---- ; END; BEGIN SETS; CHARSET JUNK (CHARACTERS = trnGR) = 1-58 438-449 1007-1016 1196-1215; END; BEGIN TREES; TITLE trnGR_MPT; LINK TAXA = Taxa1; TRANSLATE 1 Pellaea_truncata_3137, 2 Pellaea_pringlei_5028, 3 Pellaea_sagittata_5029, 4 Astrolepis_integerrima_5635, 5 Astrolepis_integerrima_5637, 6 Astrolepis_integerrima_5638, 7 Astrolepis_integerrima_5636, 8 Astrolepis_integerrima_5642, 9 Astrolepis_integerrima_5656, 10 Astrolepis_cochisensis_chihuahuensis_4716, 11 Astrolepis_cochisensis_chihuahuensis_4718, 12 Astrolepis_cochisensis_chihuahuensis_5651, 13 Astrolepis_cochisensis_chihuahuensis_7107, 14 Astrolepis_integerrima_3159, 15 Astrolepis_integerrima_5708, 16 Astrolepis_integerrima_5710, 17 Astrolepis_integerrima_5709, 18 Astrolepis_sinuata_mexicana_2955, 19 Astrolepis_sinuata_mexicana_6126, 20 Astrolepis_sinuata_mexicana_6212, 21 Astrolepis_sinuata_mexicana_7166, 22 Astrolepis_sinuata_mexicana_6907, 23 Astrolepis_integerrima_5645, 24 Astrolepis_integerrima_5646, 25 Astrolepis_integerrima_5660, 26 Astrolepis_integerrima_5644, 27 Astrolepis_obscura_6142, 28 Astrolepis_obscura_6143, 29 Astrolepis_obscura_6251, 30 Astrolepis_integerrima_6131, 31 Astrolepis_integerrima_6156, 32 Astrolepis_integerrima_4719, 33 Astrolepis_integerrima_5648, 34 Astrolepis_integerrima_5995, 35 Astrolepis_integerrima_6155, 36 Astrolepis_integerrima_5668, 37 Astrolepis_integerrima_5686, 38 Astrolepis_integerrima_5665, 39 Astrolepis_integerrima_5640, 40 Astrolepis_integerrima_5724, 41 Astrolepis_integerrima_5725, 42 Astrolepis_integerrima_5726, 43 Astrolepis_integerrima_5727, 44 Astrolepis_integerrima_5728, 45 Astrolepis_integerrima_5677, 46 Astrolepis_integerrima_5643, 47 Astrolepis_integerrima_5675, 48 Astrolepis_integerrima_5647, 49 Astrolepis_deltoidea_5828, 50 Astrolepis_deltoidea_6144, 51 Astrolepis_deltoidea_6884, 52 Astrolepis_laevis_5829, 53 Astrolepis_laevis_6895, 54 Astrolepis_laevis_6217, 55 Astrolepis_laevis_7167, 56 Astrolepis_laevis_6111, 57 Astrolepis_laevis_6891, 58 Astrolepis_laevis_6892; TREE PAUP_1 = [&R] (1:22.0,((2:20.0,3:8.0):30.0,(((4:0.0,5:0.0,6:0.0,7:0.0,8:0.0,9:0.0,10:0.0,11:0.0,12:0.0,13:0.0):1.0,(14:0.0,15:0.0,16:0.0,17:0.0):4.0):17.0,(((18:0.0,19:0.0,20:0.0,21:0.0,22:0.0):7.0,((49:0.0,51:6.0):5.0,50:3.0):2.0):9.0,(((23:0.0,24:0.0,25:0.0,26:0.0,27:0.0,(28:0.0,29:2.0):3.0,(40:0.0,41:0.0,42:0.0,43:0.0,44:0.0,45:0.0,46:0.0,47:0.0,48:0.0):4.0):1.0,((30:0.0,31:0.0):1.0,32:0.0,33:0.0,34:0.0,35:0.0,36:0.0,37:0.0,38:0.0,39:0.0):3.0):15.0,(((52:0.0,53:0.0):1.0,54:2.0,55:1.0):1.0,56:1.0,(57:0.0,58:0.0):6.0):7.0):11.0):7.0):11.0):5.0):0.0; END;