#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 3:19 GMT TreeBASE (cc) 1994-2008 Study reference: De gruyter J., Woudenberg J., Aveskamp M., Verkley G., Groenewald J.Z., & Crous P.W. 2012. Redisposition of Phoma-like anamorphs in Pleosporales. Studies in Mycology, 75: 1-36. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13458] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=20; TAXLABELS Ascochyta.caulina_CBS_246.79_ Ascochyta.caulina_CBS_343.78_ Ascochyta.caulina_CBS_344.78_ Ascochyta.hyalospora_CBS_206.80_ Ascochyta.obiones_CBS_432.77 Ascochyta.obiones_CBS_786.68 Coniothyrium.obiones_CBS_453.68_ Leptosphaeria.clavata_CBS_296.51_ Phoma_glaucispora_CBS_284.7 Phoma_incompta_CBS_526.82 Phoma.betae_CBS_109410 Phoma.betae_CBS_523.66_ Phoma.fallens_CBS_161.78_ Phoma.flavigena_CBS_314.8_ Phoma.incompta_CBS_467.76_ Phoma.lingam_CBS_147.24_ Phoma.lingam_CBS_260.94_ Phoma.typhina_CBS_132.69_ Phoma.typhina_CBS_602.72_ Pleospora.herbarum_CBS_191.86_ ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=87; TAXLABELS Coniothyrium_palmarum_CBS_400.71 Cucurbitaria_berberidis_CBS_363.93 Leptosphaeria_biglobosa_CBS_119951 Leptosphaeria_biglobosa_DAOM_229269 Leptosphaeria_collinsoniae_CBS_120227 Leptosphaeria_doliolums_doliolum_CBS_505.75 Leptosphaeria_dryadis_CBS_643.86 Leptosphaeria_fallaciosa_CBS_414.62 Leptosphaeria_hendersoniae_CBS_113702 Leptosphaeria_libanotis_CBS_113795 Leptosphaeria_macrospora_CBS_114198 Leptosphaeria_nitschkei_CBS_306.51 Leptosphaeria_praetermissa_CBS_114591 Neophaeosphaeria_filamentosa_CBS_102202 Phoma_acuta_acuta_CBS_541.66 Phoma_acuta_errabunda_CBS_125978 Phoma_acuta_errabunda_CBS_617.75 Phoma_acuta_phlogis_CBS_125979 Phoma_acuta_phlogis_CBS_155.94 Phoma_agnita_CBS_121.89 Phoma_agnita_CBS_126584 Phoma_apiicola_CBS_285.72 Phoma_apiicola_CBS_504.91 Phoma_carteri_CBS_101633 Phoma_carteri_CBS_105.91 Phoma_conferta_CBS_375.64 Phoma_congesta_CBS_244.64 Phoma_dimorphospora_CBS_165.78 Phoma_dimorphospora_CBS_345.78 Phoma_doliolum_CBS_125977 Phoma_doliolum_CBS_616.75 Phoma_drobnjacensis_CBS_269.92 Phoma_drobnjacensis_CBS_270.92 Phoma_enteroleuca_enteroleuca_CBS_831.84 Phoma_enteroleuca_influorescens_PD73.1382 Phoma_enteroleuca.enteroleuca_CBS_142.84 Phoma_enteroleuca.influorescens_CBS_143.84 Phoma_etheridgei_CBS_125980 Phoma_glycinicola_CBS_124141 Phoma_glycinicola_IMI_294986 Phoma_herbarum_CBS_615.75 Phoma_heteromorphospora_CBS_115.96 Phoma_heteromorphospora_CBS_448.68 Phoma_intricans_CBS_139.78 Phoma_korfii_CBS_101638 Phoma_leonuri_CBS_125975 Phoma_leonuri_CBS_389.8 Phoma_lingam_CBS_260.94 Phoma_lingam_CBS_275.63 Phoma_lupini_CBS_248.92 Phoma_macdonaldii_386.8 Phoma_macdonaldii_CBS_381.67 Phoma_macrocapsa_CBS_640.93 Phoma_multipora_CBS_353.65 Phoma_multipora_CBS_501.91 Phoma_pedicularis_CBS_126582 Phoma_pedicularis_CBS_390.8 Phoma_pimpinellae_CBS_101637 Phoma_rubefaciens_CBS_223.77 Phoma_rubefaciens_CBS_387.8 Phoma_sclerotioides_CBS_144.84 Phoma_sclerotioides_CBS_148.84 Phoma_septicidalis_CBS_101636 Phoma_septicidalis_CBS_188.71 Phoma_septicidalis_CBS_856.97 Phoma_sydowii_CBS_125976 Phoma_sydowii_CBS_385.8 Phoma_tracheiphila_CBS_127250 Phoma_tracheiphila_CBS_551.93 Phoma_valerianae_CBS_499.91 Phoma_valerianae_CBS_630.68 Phoma_vasinfecta_CBS_539.63 Phoma_veronicicola_CBS_126583 Phoma_veronicicola_CBS_145.84 Phoma_violicola_CBS_100272 Phoma_violicola_CBS_306.68 Phoma_wasabiae_CBS_120119 Phoma_wasabiae_CBS_120120 Plectophomella_visci_CBS_122783 Pyrenochaeta_cava_CBS_257.68 Pyrenochaeta_dolichi_IMI_217261 Pyrenochaeta_dolichi_IMI_217262 Pyrenochaeta_lycopersici_CBS_267.59 Pyrenochaeta_nobilis_CBS_407.76 Pyrenochaetopsis_leptospora_CBS_101635 Pyrenochaetopsis_pratorum_CBS_286.93 Pyrenochaetopsis_pratorum_CBS_445.81 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=40; TAXLABELS Aposphaeria_populina_CBS_130330 Aposphaeria.populina_CBS_543.70 Asteromella.tiliae_CBS_265.94 Beverwykella.pulmonaria_CBS_283.53 Byssothecium.circinans_CBS_675.92 Coniothyrium.fuckelii_CBS_797.95_ Falcisormispora.lignatilis_BCC21118 Herpotrichia.juniperi_CBS_200.31 Massaria.eburnea_CBS_473.64 Massaria.eburnea_H_3953 Massaria.platani_CBS_221.37 Melanomma.pulvispyrius_CBS_371.75 Neottiosporina.paspali_CBS_331.37 Paraconiothyrium.CBS_101461 Paraconiothyrium.minitans_CBS_122786 Paraconiothyrium.minitans_CBS_122788_ Paraphaeosphaeria.michotii_CBS_652.86 Phoma_flavescens_CBS_178.93_ Phoma.capitulum_CBS_337.65 Phoma.lini_CBS_253.92 Phoma.minutispora_CBS_509.91 Plenodomus.fuscomaculans_CBS_116.16 Pleomassaria.siparia_CBS_279.74 Pleurophoma_CBS_130329 Pleurophoma._CBS_131286 Pleurophoma._CBS_131287 Pleurophoma.pleurospora_CBS_116668 Preussia.funiculata_CBS_659.74 Pseudorobillarda_phragmitis_CBS_398.61 Pyrenochaeta.CBS_350.82 Pyrenochaeta.mackinnonii_CBS_110022 Pyrenochaeta.mackinnonii_CBS_674.75 Pyrenochaeta.romeroi_CBS_122784 Pyrenochaeta.romeroi_CBS_252.60 Roussoella.hysterioides_CBS_125434 Sporormiella.minima_CBS_524.5 Thyridaria.rubronotata_CBS_419.85 Trematosphaeria.pertusa_CBS_122368 Trematosphaeria.pertusa_CBS_400.97 Westerdykella.ornata_CBS_379.55 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=18; TAXLABELS Leptosphaeria.doliolum_doliolum_CBS_505.75_ Phoma_acuta_var_errabunda_CBS_617.75 Phoma_macrocapsa_CBS_640.93b Phoma.acuta_CBS_297.51 Phoma.acuta_acuta_CBS_130000 Phoma.acuta_acuta_CBS_504.75_ Phoma.acuta_errabunda_CBS_125978_ Phoma.acuta_errabunda_CBS_129997 Phoma.acuta_errabunda_CBS_129998 Phoma.acuta_errabunda_CBS_129999 Phoma.acuta_errabunda_CBS_541.66_ Phoma.acuta_phlogis_CBS_125979_ Phoma.acuta_phlogis_CBS_155.94 Phoma.pedicularis_CBS_390.80 Phoma.sydowii_CBS_125976_ Phoma.sydowii_CBS_385.80 Phoma.veronicicola_CBS_126583_ Phoma.veronicicola_CBS_145.84 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=48; TAXLABELS Ascochyta.caulina_CBS_246.79 Ascochyta.hyalospora_CBS_206.8 Ascochyta.obiones_CBS_432.77 Chaetosphaeronema.hispidulum_CBS_216.75 Cocliobolus.sativus_DAOM226212 Coniothyrium.fuckelii_CBS_797.95 Coniothyrium.palmarum_CBS_400.71 Cucurbitaria.berberidis_CBS_363.93 Didymella.exigua_CBS_183.55 Leptosphaeria_doliolum_doliolum_CBS_505.75 Leptosphaeria.biglobosa_CBS_119951 Neophaeosphaeria.filamentosa_CBS_102202 Neosetophoma.samarorum_CBS_138.96 Neottiosporina.paspali_CBS_331.37 Paraconiothyrium.minitans_CBS_122788 Paraphaeosphaeria.michotii_CBS_652.86 Paraphoma.radicina_CBS_111.79 Phaeosphaeria.nodorum_CBS_110109 Phoma.betae_CBS_523.66 Phoma.carteri_CBS_105.91 Phoma.cucurbitacearum_CBS_133.96 Phoma.dimorphospora_CBS_165.78 Phoma.doliolum_CBS_616.75 Phoma.drobnjacensis_CBS_269.92 Phoma.glycinicola_CBS_124455 Phoma.herbarum_CBS_615.75 Phoma.heteromorphospora_CBS_448.68 Phoma.leonuri_CBS_389.8 Phoma.lingam_CBS_275.63 Phoma.lycopersici_CBS_378.67 Phoma.paspali_CBS_560.81 Phoma.septicidalis101636 Phoma.tracheiphila551.93 Phoma.typhina132.69 Phoma.vasinfecta539.63 Plectophomella.visci_CBS_122783 Pleospora.herbarum_CBS_191.86 Pyrenochaeta.cava_CBS_257.68 Pyrenochaeta.dolichi_CBS_124140 Pyrenochaeta.lycopersici_CBS_267.59 Pyrenochaeta.mackinnonii_CBS_674.75 Pyrenochaeta.nobilis_CBS_407.76 Pyrenochaeta.romeroi_CBS_252.6 Pyrenochaetopsis.leptospora_CBS_101635 'Pyrenophora tritici-repentis OSC100066' Setomelanomma.holmii110217 Setophoma_terrestris_335.29 Sporormiella.minima524.5 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14607] TITLE 'Figure 3 ITS / ACT/ TUB / CHS'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=1345; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Leptosphaeria.doliolum_doliolum_CBS_505.75_ ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCCGGCCTCCCGAGGCTGCCTCACGTGCGGAGTTCCGCTGCTCT-GAGAGCTCCAGAGAACCACGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCTCCTAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCCAGTGTCATGTGACCCGTGAATGCTAACAAGCGATAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACACTCGACATCAAGAAGGGTGTCGTTGGCGTTAAAAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAACCAGAAGAAGAT Phoma_acuta_var_errabunda_CBS_617.75 ATCATTACCATTACCTCAACGGGGGGGAGTTCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGACGTTACCCATGTCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGGATATCAATCCACCCT-TGAATTTGCAGTCCATGTCTGAAAAATAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCGCTTTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTACAGAGGCTGCCTCAC-----GAATCCCGCCGCCCT-GAGAGCTCCAGAGAACCACGACTAACCAGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGCCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTGATTGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTTTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTGGACATCAAGAAGGGTGTCGTCGGTGTCAAGAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma_macrocapsa_CBS_640.93b ATCATTACCATTACCTCAACGGGGGGGAGTTCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGACGTTACCCATGTCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGGATATCAATCCACCCT-TGAATTTGCAGTCCATGTCTGAAAAATAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCGCTTTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTTTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTACAGAGGCTGCCTCACGTGCGGAGTTCCGCCGCCCT-GAGAGCTCCAGAGAACCACGACTAACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTCCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATTGGCCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTGATTGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTTTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTGGACATCAAGAAGGGTGTCGTCGGTGTCAAGAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.acuta_CBS_297.51 ATCATTACCATTACCTCAACGGGGGGG-TTTCGGCCGTGTATTCGGCTG-ATTCCCGCCTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCACTTGTGCCCCTACGGGATATCAATCCACCCATTGTATTTGCAGTCCATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCG--TCTGACGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCCCCTGCCATCTGGCCTGCCATCTGGCCTACCGAGGCCGCCTCACGTGCGGACTTTCGCTGCCCT-GAGAGCTCCAGAGAACCGCGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGACGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTTCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTAAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCCTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTTAACGGCAAGGATGTGACAGCCCATATTTACGAGTACACCACTCAGATGACCCTCGATATCAAGAAGGGTGTCGTTGGCGTCAAGAAGGGCAACACTCCTGTCCAGATGCTGTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.acuta_acuta_CBS_130000 ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------TCTGCCATCCGGCCTCCCGAGGCTGCCTCACGTGCGGAGTTCCGCTGCTCT-GAGAGCTCCAGAGAACCACGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCTCCTAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCCAGTGTCATGTGACCCGTGAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAACAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACGCTCGACATTAAGAAGGGTGTCGTTGGCGTGAAAAAGGGCAACACCCCTGTTCAGATGCTCTTCTGTCTCAAGGAGAAGAACCAGAAGAAGAT Phoma.acuta_acuta_CBS_504.75_ ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------TCTGCCATCCGGCCTCCCGAGGCTGCCTCACGTGCGGAGTTCCGCTGCTCT-GAGAGCTCCAGAGAACCACGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCTCCTAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCTGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCCAGTGTCATGTGACCCGTGAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAACAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACGCTCGACATTAAGAAGGGTGTCGTTGGCGTGAAAAAGGGCAACACCCCTGTTCAGATGCTCTTCTGTCTCAAGGAGAAGAACCAGAAGAAGAT Phoma.acuta_errabunda_CBS_125978_ ATCATTACCATTACCTCAACGGGGGGGAGTTCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGACGTTACCCATGTCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGGATATCAATCCACCCT-TGAATTTGCAGTCCATGTCTGAAAAATAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCGCTTTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTACAGAGGCTGCCTCAC-----GAATCCCGCCGCCCT-GAGAGCTCCAGAGAACCACGACTAACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGCCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTGATTGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTTTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTGGACATCAAGAAGGGTGTCGTCGGTGTCAAGAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.acuta_errabunda_CBS_129997 ATCATTACCATTACCTCAACGGGGGGGAGTTCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGACGTTACCCATGTCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGGATATCAATCCACCCT-TGAATTTGCAGTCCATGTCTGAAAAATAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCGCTTTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTACAGAGGCTGCCTCAC-----GAATCCCGCCGCCCT-GAGAGCTCCAGAGAACCACGACTAACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGCCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTGATTGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTTTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTGGACATCAAGAAGGGTGTCGTCGGTGTCAAGAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.acuta_errabunda_CBS_129998 ATCATTACCATTACCTCAACGGGGGGGAGTTCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGACGTTACCCATGTCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTATGGGATATCAATCCACCCT-TGAATTTGCAGTCCATGTCTGAAAAATAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCGCTTTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTACAGAGGCTGCCTCAC-----GAATCCCGCCGCCCT-GAGAGCTCCAGAGAACCACGACTAACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGCCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTGATTGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTTTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTGGACATCAAGAAGGGTGTCGTCGGTGTCAAGAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.acuta_errabunda_CBS_129999 ATCATTACCATTACCTCAACGGGGGGGAGTTCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGACGTTACCCATGTCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGGATATCAATCCACCCT-TGAATTTGCAGTCCATGTCTGAAAAATAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCGCTTTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTACAGAGGCTGCCTCAC-----GAATCCCGCCGCCCT-GAGAGCTCCAGAGAACCACGACTAACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGCCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTGATTGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTTTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTAGACATCAAGAAGGGTGTCGTCGGTGTCAAGAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.acuta_errabunda_CBS_541.66_ ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCCGGCCTCCCGAGGCTGCCTCACGTGCGGAGTTCCGCTGCTCT-GAGAGCTCCAGAGAACCACGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCTCCTAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCCAGTGTCATGTGACCCGTGAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACACTCGACATCAAGAAGGGTGTCGTTGGCGTAAAAAAGGGCAACACCCCTGTTCAAATGCTCTTCTGTCTCAAGGAGAAGAACCAGAAGAAGAT Phoma.acuta_phlogis_CBS_125979_ ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCCGGCCTCCCGAGGCTGCCTCACGTGCGGAGTTCCGCTGCTCT-GAGAGCTCCAGAGAACCACGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCTCCTAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCTAGTGTCATGTGACCCGTGAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAACAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACGCTCGACATTAAGAAGGGTGTCGTTGGCGTGAAAAAGGGCAACACCCCTGTTCAGATGCTCTTCTGTCTCAAGGAGAAGAACCAGAAGAAGAT Phoma.acuta_phlogis_CBS_155.94 ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTTTTGCCCCTATGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTGCGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCCGGCCTCCCGAGGCTGCCTCACGTGCGGAGTTCCGCTGCTCT-GAGAGTTCCAGAGAACCACGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCTCCTAGCTCCCTAAAGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCTAGTGTCATGTGACCCGTGAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCTTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAACAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACACTCGACATCAAGAAGGGTGTCGTTGGCGTGAAAAAGGGCAACACCCCTGTCCAGATGCTCTTCTGTCTCAAGGAAAAGAATCAGAAGAAGAT Phoma.pedicularis_CBS_390.80 ATCATTACCATTACCTCAACGGGCGGG-TTTC--------CTTAAACCG-ATTCCTGCCTGTTTGAAGTTACCCATGCC-TTTTGCGTACAATTTGTTCTCCTAGAAGGGCGTCTTCGCCCCGACAGGATACCAAGTCACCCA-TGTATTTGCAGTCAACGTCTG-AAAACAATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCCGCGCATTTGCGCAGACTCGCCTTAAAACAATTGGCAGCCGGCATGATAGCCTGGAGCGCAGCACATTTTGCGTCTCTTTGTTAGCTTGTTGGCCCCCATCAAGACCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTTCCC------------ATTCCTATCCGGCTAGCTGAGGCCGCCTCACGTGCGAGAATCCGCAGCCCTCGAGGGCTCCAGAGAACCAAGACTGACCCGACCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCACAGCTCTCTTGTGACTGCGAGCTGACACCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCGATCCCCACGCGACGAGACAAGAGCTGACAACATTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACGTCGGATCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTGCGCATTCTCTGCCGCGAAGATCATGTGACCTGTGAATGCTGACAAGTGGCAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCCTTCGGACAGCTCTTCCGTCCCATTGTGGTGTGCGTCGTCAGCGATGGCCGCGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAGGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACTACTCAGATGACTCTGGACATCAAGAAGGGTGTTGTTGGCGTGAAGAAGGGCAACACCCCTGTCCAGATGCTGTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.sydowii_CBS_125976_ ATCATTACCATTACCTCAACGGGGGGG-TTTCGGCCGTGTATTCGGCTG-ATTCCCGCCTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCACTTGTGCCCCTACGGGATATCAATCCACCCATTGTATTTGCAGTCCATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCG--TCTGACGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCCCCTGCCATCTGGCCTGCCATCTGGCCTACCGAGGCCGCCTCACGTGCGGACTTCCGCTGCCCT-GAGAGCTCCAGAGAACCGCGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGACGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTTCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTCCAGCTTGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCCGTAAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCCTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTTAACGGCAAGGATGTGACAGCCCATATTTACGAGTACACCACTCAGATGACCCTCGACATCAAGAAGGGTGTCGTTGGCGTCAAGAAGGGCAACACTCCTGTCCAGATGCTGTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.sydowii_CBS_385.80 ATCATTACCATTACCTCAACGGGGGGG-TTTCGGCCGTGTATTCGGCTG-ATTCCCGCCTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCACTTGTGCCCCTACGGGATATCAATCCACCCATTGTATTTGCAGTCCATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGATTGTCCGCG--TCTGACGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCCCCTGCCATCTGGCCTGCCATCTGGCCTACCGAGGCCGCCTCACGTGCGGACTTCCGCTGCCCT-GAGAGCTCCAGAGAACCGCGACTGACCCGCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGACGCGCCCTTCCCCCAGCTCCCTAGTGACTGCGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTTCATCTGCACGCGACGAGGCGAGAGCTGACAACAGTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCGGATCTTCAGCTTGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAATGTCATGTGACCAGTAAATGCTAACAAGCGACAGGCGTCCGGCAACAAGTTCGTTCCCCGTGCCGTCCTCGTCGATCTCGAGCCCGGTACCATGGACGCTGTCCGCGCTGGTCCCTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAGATGACCCTCGATATCAAGAAGGGTGTCGTTGGCGTCAAGAAGGGCAACACTCCTGTGCAGATGCTGTTCTGTCTCAAGGAGAAGAACCAGAAGAAGAT Phoma.veronicicola_CBS_126583_ ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAACAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTTACGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTATAGAGGCCGCCTCACGTGCGGACTTCCGCCGCCCT-GAGAGCTCCAGAGAACCACAACTGACCCTCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTACGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAAGACTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCAGATCTTCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAAGGTCATGTGACCTGTGAATGCTAACAAGCGACAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCCGTCCTTGTTGATCTCGAGCCCGGTACCATGGACGCTGTTCGCGCTGGTCCCTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAAATGACCCTCGACATCAAGAAGGGTGTCGTTGGCGTCAAAAAGGGCAACACCCCTGTTCAAATGCTGTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT Phoma.veronicicola_CBS_145.84 ATCATTACCATTACCTCAACGGGGGGG-TTTCAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGACGTTACCCATGCCTTTTTGCGTACAGTTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGGATATCAATCCACCCA-TGTATTTGCAGTCAATGTCTG-AAAATTATAATAATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCGCG--TTTCACGCAGACTCGCCTTAAATCAATTGGCAGCCGGCATGTTAGCCTGGAGCGCAGCACATTTTGCGCACCTTGCTGGCGGTGTTGGCCCCCATCAAGTCCATATATTTGCTCTTGACCTCGGATCAGGTAGGGATACCCGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTTTCTCC------------CCTGCCATCTGGCCTATAGAGGCCGCCTCACGTGCGGACTTCCGCCGCCCT-GAGAGCTCCAGAGAACCACAACTGACCCTCTCGCAGCTTCCATCGTTGGCCGACCGCGCCATCATGGGTACGATGCGCCCTTCCCCCAGCTCCCTAGTGACTACGAACTGACAGCGTGGCAGTATCATGATCGGTCGTAAGTTGCACTCCATCTGCACGCGACGAGGCGAGAGCTGACAAGACTTAGGGTAACCAAATCGGTGCCGCCTTCTGGCAAACCATCTCAGGCGAGCACGGCCTCGACGGCTCCGGTGTCTACAATGGCACTTCAGATCTTCAGCTCGAGCGCATGAACGTCTACTTCAATGAGGTGCGCATTCTTTTTCGCGAAGGTCATGTGACCTGTGAATGCTAACAAGCGACAGGCGTCTGGCAACAAGTTCGTTCCCCGTGCCGTCCTTGTTGATCTCGAGCCCGGTACCATGGACGCTGTTCGCGCTGGTCCCTTCGGACAGCTCTTCCGTCCCATCGTGGTTTGCGTCGTCAGCGATGGGCGTGCCAAGATTAACCCGCGTACAAGGGCCGTCTTAGCGGCACTCGGTGTCTACCAGGACGGCATTGCAAAGCAGCAAGTCAACGGCAAGGATGTGACGGCCCATATTTACGAGTACACCACTCAAATGACCCTCGACATCAAGAAGGGTGTCGTTGGCGTCAAAAAGGGCAACACCCCTGTTCAAATGCTGTTCTGTCTCAAGGAGAAGAATCAGAAGAAGAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14603] TITLE 'Figure 1 SSU / LSU'; LINK TAXA = Taxa5; DIMENSIONS NCHAR=2671; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Ascochyta.caulina_CBS_246.79 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCACCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTG Ascochyta.hyalospora_CBS_206.8 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCACCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Ascochyta.obiones_CBS_432.77 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCACCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTG Chaetosphaeronema.hispidulum_CBS_216.75 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTCTTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGATACAGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG--GACATTCAGCTCCCATTCTGCTGACGCCAGAGATAGTCGGGCATCGTCAAGATGTTATGCCGGCTAGTCGATGTACCCGCTTAATTGATGGGAGGGTACCGGCAAGACAACCTGGATCGGGGAAAGCTAAGGTATCTGCAAGATGCTATGCTAATCCCGAGCAGAGCTGCCACGGAGCGATCTGTGGACAGCCTGTGTAGAGCACGCTAAGGTGTCGGCCAACTCACGTAGTTGGCTTAAGGGACGTGCCATTCCCACTTGAAAGAGTGGCTGTTAGCAATAGCGCCCATCACGCGAAGGCTAACAGATCAAACAAAGCGCATGCGATGTTTGAAGTTTCAATAGG-------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGAACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTT--GTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCATGTACCTCTCTTCGGAGAGGCCTTATAGGGG-AGACGACATGTAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTAAGAACCCTTT---GGGTGCATTATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGGCGAAACGCTCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAGAATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Cocliobolus.sativus_DAOM226212 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATT-AAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTT-CCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAA--GGGTGCACCATCGACCGATCCTGAAGTTTACCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTTGTTACTTAATTGAACGCGGGCATTTGAATGAAACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGGGGTTACGGTGCCGGAGTACACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTCACCTATACCCCTCCGCCGGGGCAAAATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Coniothyrium.fuckelii_CBS_797.95 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGATACGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTTCTATTGT-GACCCGCTCGGCACCTTACGAGAAATCAAAGTGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG--GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAGGGG-AGGCGTAATGCAACCAGCCCGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT---GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAGACGTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Coniothyrium.palmarum_CBS_400.71 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATACCCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCGTGTACCTCTCTTCGGGGAGGCCGTATAGGGG-AGGCGTCATACAACCAGCCTGGACTGAGGTCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTAC--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Cucurbitaria.berberidis_CBS_363.93 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCT--TTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTTTA-GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Didymella.exigua_CBS_183.55 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTC--TTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCAGGTTTTT--ACCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTCG--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAGGATTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Leptosphaeria_doliolum_doliolum_CBS_505.75 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCTTTT--GCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Leptosphaeria.biglobosa_CBS_119951 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTA--GGGCGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Neophaeosphaeria.filamentosa_CBS_102202 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCACGTACCCCTCTTCGGGGGGGCCTTATAGGGG-GAACGACATGCAACCAGCCCAGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTAGGAACCCGTTA--GGGCGCACTATCGACCGATCCTGAAGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Neosetophoma.samarorum_CBS_138.96 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGGAAATTCAGCTCCCAAGCTGCTGACGCCAGAGATAGTCGGGCATCTTTTGCGAGATGTTATGCCGGCTAGTCGATGTACCCACTGAACTGATGGGGGGGTACCGGCAAGACAACCTGGATCGGGGAAGGCTAAGGCATCGTCATATGCTACGCTAATCCCGAGCAGAGCTACCGTGGAGCGATCCGCGGATAGCCTGTGTAGAGCACGGAAAGGTGTCGGCCAACTCACGCAGTTGGCTTGAGGGACGTGCCATTCCCACCCGAAAGGGTGGCTGCCAGCAATAGCGCCCATCACGCAAAGGCTGGCAGGTTCAAACGTAGCGGTTTGAAGATTATAATAGG-------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTAGACTTTT--GTCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCCCGCCGCCGGGGCAGAATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Neottiosporina.paspali_CBS_331.37 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATACCTGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGTCAGCCTGAGAAACGGCTGACACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGGACATTCAGCTCCCATTCTGCTGACGCCAGAGATAGTTGGGCATCTCGTCAGAGGTGTTATGCCAACTAGTCGATGTACCCACTAAATTGATGGGGGGGTACCGGCAAGACAACCTGGATCGGGGAAGGCTAAGGTGTCGAATGCGACGCTATGCTAATCCCGAGCAGAGCCCCCATAGAGCGATCTATGGCATGGCCTGTGTAGAGCACGCTAAGGTGTCGGTCAACTCTCGTAGTTGGCTTAAGGGACGTGCCGTTCCCGTTCGAAAGAATGGCTGTCAACAATAGCGCCCATCACGCGAAGGTTGACAGGTTTAGACCTGCCTCGATGCGGGTTTAGATGAATCCAAAAAGGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATATTACAGCATGGAATAATAAAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTACTATTTT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCTCCTTTTAGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGGTAGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGCATGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCACCTAGGCTTTT--GCCTGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGGATAAAGGTCTCTGTCATGTAGCTTTCTTCGGAAAGAACTTATAGGGG-AGACGAAATGCGACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT---GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAGACATTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Paraconiothyrium.minitans_CBS_122788 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGATACGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTTCTATTGT-GACCCGCTCGGCACCTTACGAGAAATCAAAGTGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCCTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG--GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAGGGG-AGGCGCAATGCAACCAGCCCGGACTGAGGTCCGCGCTTCG--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT---GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGCTGAAACAGCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGAGTTACGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACTCCGCCGCTGGGGCAGACGTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Paraphaeosphaeria.michotii_CBS_652.86 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTCTCAGATCGCATGGCTTTACGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATTCCGATACGGAGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTTGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGCACTTGTCCGGCCGGGCCTTTTCTTCTGGAGAACCGCATGCCCTTCACTGGGTGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCGACTAGGGATCGGGCGGTGTTTCTATTGT-GACCCGCTCGGCACCTTACGAGAAATCAAAGTGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCAGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGCTTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTC--GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCACGTATCTTCCTTCGGGATGACCTTATAGGGG-AGGCGTAATGCAACCAGCCCGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTT---AGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGCTGAAACAGCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACATTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGAGTTACGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACTCCGCCGCTGGGGCAGACGTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Paraphoma.radicina_CBS_111.79 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCATTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTT--GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT---GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCCCGCCGCCGGGGCAGAATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phaeosphaeria.nodorum_CBS_110109 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGGAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTATCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCTGGACTTTT--GTCCAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAA-CCTTTT--AGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCCCGCCGCCGGGGCAGAATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.betae_CBS_523.66 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATAATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGTTCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCTTTTA-GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGTGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCACCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTG Phoma.carteri_CBS_105.91 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCAACTTCGGGAGAGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.cucurbitacearum_CBS_133.96 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTC--TTCGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTCT--ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGATCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTCG--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAAGATTTAAGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Phoma.dimorphospora_CBS_165.78 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCTCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGGACATTCAGCTCCCATTCTGCTGACGCCAGAGATAGTCGGGCACCTTGCAAGAGGTGTTATGCCGGCTAGTCGATGTACCCACTGAACCTGATGGGGGGGTACCGGCAAGACAACCTGGATCGGGGAAGGCTAAGGTGTCGAGTGCGACGCTATGCTAATCCCGAGCAGAGCTGCCACAGAGCGATCTGTGGACAGCCTGTGTAGAGCACGCTAAGGTGTCGGCCAACTCATGTAGTTGGCTTAAGGGACGTGCCATTCCCATCTGAAAGGATGGCTGTCAGCAGTAGCGCCCATCACGCGAAGGCTGACAGGTTCAAACAAGGTGCTTGTTTGAGAAGTGTAATAGG-------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTA-GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.doliolum_CBS_616.75 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCTTTT--GCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.drobnjacensis_CBS_269.92 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGG-AGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.glycinicola_CBS_124455 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCAACTTCGGAAGAGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGTAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACTTTT--GTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGATGAAACATCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.herbarum_CBS_615.75 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTC--TTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTT--ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTCG--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAGGATTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Phoma.heteromorphospora_CBS_448.68 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCTCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAATTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCTTTT--GCCCAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTCTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGCCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTTGGGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.leonuri_CBS_389.8 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCTTTT--GCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.lingam_CBS_275.63 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCTTTT--GTCCAGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTTA-GGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.lycopersici_CBS_378.67 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTC--TTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTTTTT--ACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGATCTTATAGGGG-AGACGAAATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTCG--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCCCGCCGCTGGGGCAAGATTTAAGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Phoma.paspali_CBS_560.81 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTCACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTC--TTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAACCAGACTTGCCTGCAGTTGCTCATCTGGACTTTT--GTCCAGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGG-AGACGACATGTAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCGCAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTGACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTCACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAGGATTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTG Phoma.septicidalis101636 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCAACTTCGGGAGAGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCATGTACCTCTTTTCGGGGAGGCCTTATAGGGG-AGATGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTA--GGGTGCACCATCGACCGATCCTGATGTCT-TTGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAAATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.tracheiphila551.93 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGATGTCACAGAGGGTGAGAACCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTTA-GGGCGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Phoma.typhina132.69 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATTATACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCGCGACTTCGGAAGCGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTAATTGGTGATTCACAATAACTTTACGGATCGCTTGGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTT-CCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGACGTGCGTCCCTATTTTGTTGGTTTCTAGGAACGCCGTAATGATTGATAGGGACTGTTGGGGCCATTAGTATTCAGTAGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGGCAAAGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACAATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTAGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGAGAACCCTTT---GGGTGCATCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACATTTGAATG-AACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGGGGTTACGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAATTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAATTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCTATACCCCTCCGCCGGGGCAAAATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGTCCGTG Phoma.vasinfecta539.63 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGATGTCACAGAGGGTGAGAACCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTTA-GGGCGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Plectophomella.visci_CBS_122783 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCAACTTTGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTTGGGGCTTCTTGGCGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCTCTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGTAT--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Pleospora.herbarum_CBS_191.86 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTT-CCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAA--GGGTGCACCATCGACCGATCCTGAAGTTT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGCCCTTTGTTACTTGATTGAACGCGGGCATTTGAATGAAACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGGGGTTACGGTGCCGGAGTACACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTCACCTATACCCCTCCGCCGGGGCAAAATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Pyrenochaeta.cava_CBS_257.68 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAAGGAGCCCGAGAAACGGCTACTACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGTAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCT--TTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAGGCTCTT-TGCCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGG-AGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTTA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCTCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Pyrenochaeta.dolichi_CBS_124140 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCTCAACTTCGGAAGAGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACTTTT--GTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGATGAAACATCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Pyrenochaeta.lycopersici_CBS_267.59 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTAGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTTTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTTA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Pyrenochaeta.mackinnonii_CBS_674.75 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGAACTTTCAGCTAGTTCCATTCTGCTGACGCCAGAGATAGTCGGGCGCCTCAGGGCGTTATGCCGGCTAGTCGAGCACCCACTGATCTGATGGGGGGGTGCCGGCAAGACAACCTGGATCGGGGAAGGCTAAGGCGCAAGCTAAGCTGATCCCGAGCAGAGCCTTCGCGGAGCGATCCACGATATGGCCTGTGTAGAGCACGGTAAGGTGTCGGCTGGCTCACGTAGTCAGCTTAAGGGACGTGCCATTCCCACCCGAAAGGGTGGCCGCCAGCAATAGCGCCCATCTCGCGAAGGCTGACGGGTCCAAACAGCGGTTTGGATGCATCTCAAAAGG--------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCCGGTCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTTCTGGAGATCCTCATGCCCTTCACTGGGTGTGTTGGGGAACCAGGACTTTTACTGTGAACAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--TTCAGGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGACAGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGACTTTT--GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCTGGATAAAGGCCTCTATCACGTATCTTCCTTCGGGATGACCTTATAGGGG-AGGTGTAATGCAGCCAGCCTGGATTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGATTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTAC--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACATTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCCCGCCGCCAGGGCAGAAATTATGCCCTGGCGAGTAGGCAGGCGTGGAGGCTTGTG Pyrenochaeta.nobilis_CBS_407.76 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Pyrenochaeta.romeroi_CBS_252.6 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCTCGACTTCGGAAGAGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTCTCAGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGACCGGCCGGGCCTTTCCTTCTGGAGAACCTCATGCCCTTCACTGGGTGTGCTGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTCTATCTT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTATTTTGGAGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCGTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCGGTTGCTCATCCGGGCTCTT--GCCCGGTGCACTCTTCCGTAGGCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGCCTCTGTCATGTACCTTCCCTCGGGAAGGCCTTATAGGGG-AGGCGTAATGCAGCCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTGCGGGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCGGACATTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCCCGTG Pyrenochaetopsis.leptospora_CBS_101635 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTTCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTTTTGACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCACGTACCTTCTCTCGGGAAGGCCTTATAGGGG-AGGCGTCATGCAACCAGTCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCGCAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG 'Pyrenophora tritici-repentis OSC100066' ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATTCGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTT-CCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTTGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCACCCGGGCCTCTGTGCCCGGTGCATTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGGCGACATACCACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAA--GGGTGCACCATCGACCGATCCTGATGTCT-TCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATA?GGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTGTTT-GTTGCTTAATTGAACGTACACATTTGAATGAAACGTTATTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGAGGGGTTAAAGTGCCGGAATATACGCTCATCAGACACCACAAAAGGTGTTGGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACTTATACCCCTCCGCCGGGGCAAAATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Setomelanomma.holmii110217 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCAACTTCGGGAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGCCTT-CCTTCTGGAGAACCTCATGCTCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTATCCGGACTTTT--GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGG-AGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT---GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAGAATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Setophoma_terrestris_335.29 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAACCCCGACTTACGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTTCTTGGTGATTCATGATAACTTTACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCAGGTCCGCCTCACCGCGTGTACTTGTCCGGCCGGGTCTT-CCTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGTTGGGGA-CCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCT--TTCAGAGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGGTAGTTGCGGTCTAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTATGTGGTCGCTACTTATCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTACCTAGACTTTT--GTCTGGGGTACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGG-AGACGTCATACAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCATACGCGTAATGAAAGTGAACGGAGGTGGGAACCTTA----GGGTGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTGATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCCCGCCGCCGGGGCAGAATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTG Sporormiella.minima524.5 ACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGCTAATACATGCTAAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGGATCGCATGGCCTTGCGCCGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTG?CA?TAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCAGCCGCGGTAA-TCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGCTGG?CG?TCCGCCTCACCGCGTGTACTGGTCCGGCCGGGCCTTTCCTTCTGGAGATCCCCATGCCCTTCACTGGGCGTGCGGGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAGAATAGGACGTGCGGTCCTATTTTGTTGGTTTCTAGGACCGCCGTAATGATTAATAGGGACAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTTTTATCTT-GACTCGCTCGGCACCTTACGAGAAATCAAAGTTCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCT--TTCAGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGT?GGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGCCAGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT--GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTCCCAGCGGTTGGATAAATGTCTGTTGAACGTACCTCTCTTCGGGGAGGACTTATAGCTTCAGGCGGCATACAACCAGCCGGGATTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTCG--GGGCGCACCATCGACCGATCCTGATGTCT-TCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTGACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTT-GTTACTTAATTGAACGTGGACATTTGAATGTACCGTCACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGCTACCCATACCCCGCCGCCAG?GCAAAAATTACGCCCTGGCGAGTAGGCAGGCGTGGAGGTTTGTG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14604] TITLE Figure_4_ACT; LINK TAXA = Taxa1; DIMENSIONS NCHAR=252; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . ] Ascochyta.caulina_CBS_246.79_ CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTT---CCCATCTCAGCGCCATC---------------------------------------------------GCGACAAGCAATTTTCTGACAGCTCTGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCCCT-----AGTAGCTTCC--CCCCGAGCTCCTCCCCCCGAACTGACA-ACATGGCAGTATCATGATTGGT Ascochyta.caulina_CBS_343.78_ CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTT---CCCATCTCAGCGCCATC---------------------------------------------------GCGACAAGCAATTTTCTGACAGCTCTGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCCCT-----AGTAGCTTCC--CCCCGAGCTCCTCCCCCCGAACTGACA-ACATGGCAGTATCATGATTGGT Ascochyta.caulina_CBS_344.78_ CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTT---CCCATTCCAGCGCCATG---------------------------------------------------GCGACCAGC-ATTTTCTGACGGCTCTGCAGCTTCCATTGTCGGCCGACCGCGCCACCACGGGTACGGCCATCCCCT-----AGTAGCTTCC--CCCCAAGCT----CCCCCGAACTGACA-ACATGGCAGTATCATGATTGGT Ascochyta.hyalospora_CBS_206.80_ CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTT---CCCATTCCAGCGCCATG---------------------------------------------------GCGACCAGC-ATTTTCTGACGGCTCTGCAGCTTCCATTGTCGGCCGACCGCGCCACCACGGGTACGGCCATCCCCT-----AGTAGCTTCC--CCCCAAGCT----CCCCCGAACTGACA-ACATGGCAGTATCATGATTGGT Ascochyta.obiones_CBS_432.77 CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTT---CCCATCTCAGCGCCATC---------------------------------------------------GCGACAAGCAATTTTCTGACAGCTCCGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCCCT-----AGTAGCTTCC--CCCCGAGCT---CCCCCCGAACTGACA-ACATGGCAGTATCATGATTGGT Ascochyta.obiones_CBS_786.68 CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTT---CCCATCTCAGCGCCATC---------------------------------------------------GCGACAAGCAATTTTCTGACAGCTCCGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCCCT-----AGTAGCTTCC--CCCCGAGCTCCTCCCCCCGAACTGACA-ACATGGCAGTATCATGATTGGT Coniothyrium.obiones_CBS_453.68_ CGGTGACGATGCGCCCCGAGCAGTCTTCCGTAAGTCTTCTCCCCATGCTCGCCCCGTC---------------------------------------------------GTGAAAACC-GTTTCCTGACAGCTCCGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCCCCC--T-AGTAGCTCCC---CCGTGTCCCCCAGACCCAAACTGACA-GCATGGCAGTATCATGATTGGT Leptosphaeria.clavata_CBS_296.51_ CGGTGACGATGCGCCCCGAGCAGTCTTCCGTAAGTACC---TCCATTTCCGCCTC-CCAGCTGCGGCGGGATCAAACGCCATC--------------------------TCGAGAG---CACTTCTGACAGCTTTGCAGCTTCCATCGTTGGCCGACCGCGTCACCATGGGTACGATGAACCCCC-----CGTAGCCCCT---ACGCAC------TCCGCCGTCTAACA-ACA-AACAGTATCATGATTGGT Phoma_glaucispora_CBS_284.7 CGGTGACGATGCGCCCCGAGCAGTCTTCCGTAAGTACC---TCCCTGCTTGCCTCGTCCGCTGAGGCCGCATCAGAAGCGCCA------TACTTCGGCCTCTGGTGTCTTTTCGAACC-AACATCTGACAATTCCGCAGCTTCCATTGTCGGCCGACCGCGCCATCATGGGTACGATGCCCTAC------AGCAGCTCCC---ACGCAT------TCCGCGCGCTGACA-CCATGATAGTATTATGATCGGT Phoma_incompta_CBS_526.82 CGGTGATGATGCGCCCCGAGCAGTCTTCCGTAAGTACC---CCCATTCCTGCCTCGCCAGCTGAGGCTGCACCGAGAGCGCCT-----------------CCAGGACCGTTGAGAAGC-AGCGTCTGACAGCTTCGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCTCCTAGTGACTGACTCCC---ACGTAG------TCCGCGAACTGACA-ATATCCCAGTATTATGATTGGT Phoma.betae_CBS_109410 CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTTGCCCCCATCTCAGCGCCATC---------------------------------------------------GCGAGAAGC-CTCTTCTAACAGCTCTGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCCTCCCCT-----AGTAGCTCCCTCCCCCGAAGT----CCCCCGAACTGACA-AGATGGCAGTATCATGATTGGT Phoma.betae_CBS_523.66_ CGGTGACGATGCGCCCCGTGCAGTCTTCCGTAAGTCTTGCCCCCATCTCAGCGCCATC---------------------------------------------------GCGAGAAGC-CTCTTCTGACAGCTCTGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCCTCCCCT-----AGTAGCTCCCTCCCCCGAAGT----CCCCCGAACTGACA-ACATGGTAGTATCATGATTGGT Phoma.fallens_CBS_161.78_ CGGTGACGATGCGCCCCGAGCAGTCTTCCGTAAGTACC---TCCCTGCTTGCCTCGTCCGCTGAGGCCGCATCAGAAGCGCGA------TGCTTCGGCCTCTGCTGT-TTCTTGAACC-AACATCTGACAATTCCGCAGCTTCCATTGTCGGCCGACCGCGCCATCATGGGTACGATGCCCTAC------AGCAGCTCCC---ACGCAT------TCCGCACGCTGACA-CCATGATAGTATTATGATCGGT Phoma.flavigena_CBS_314.8_ CGGTGACGATGCGCCCCGAGCAGTCTTTCGTAAGTTTT---CCCGCTCATGTCGCGCCTCCTGCGCCCGCACCGAGTGCACGC----CTTGCTTTGGCCTCCGATAGCTGCGAACATC--CTGTCTGACAATCCTGCAGCCTCCATTGTCGGCCGACCGCGCCATCATGGGTACGACAATCCCTCA--C-AACAGCTCCC--TCCGTGA------TCTGCCAGCTGACA-ACGTGGCAGTATTATGATTGGT Phoma.incompta_CBS_467.76_ CGGTGATGATGCGCCCCGAGCAGTCTTCCGTAAGTACC---CCCATTCCTGCCTCGCCAGCTGAGGCTGCACCGAGAGCGCCT-----------------CCAGGACCGTTGAGAAGC-AGCGTCTGACAGCTTCGCAGCTTCCATTGTCGGCCGACCGCGCCACCATGGGTACGACCATCCTCCTAGTGACTGACTCCC---ACGTAG------TCCGCGAACTGACA-ATATCCCAGTATTATGATTGGT Phoma.lingam_CBS_147.24_ CGGTGACGATGCGCCCCGTGCAGTCTTTCGTAAGTCTC---CCTCCA--CGCCTCCATGGACGCGCAGGAAACAGATTTTTTGCGTGCTTCTGCCGGCTCTAGCGCA--TCGAAATGT-ACATGCTAACTCAATTCCAGCTTCCATTGTCGGCCGACCGCGCCATCACGGGTAGGACGATCTCTCC--GGACCGGCTATG---ACGTGG------CTTGTGAGCTGACAGAAACCGCAGAATCATGATTGGT Phoma.lingam_CBS_260.94_ CGGTGACGATGCGCCCCGTGCAGTCTTTCGTAAGTCTC---CCTCCA--CGCCTCCATGGACGCGCAGGAAACAGATTTTTTGCGTGCTTCTGCCGGCTCTAGCGCA--TCGAAATGT-ACATGCTAACTCAATTCCAGCTTCCATTGTCGGCCGACCGCGCCATCACGGGTAGGACGATCTCTCC--GGACCGGCTATG---ACGTGG------CTTGTGAGCTGACAGAAACCGCAGAATCATGATTGGT Phoma.typhina_CBS_132.69_ CGGTGATGATGCGCCCCGAGCAGTCTTCCGTAAGTACTCC-CCCATTCCTGTCTTGCTGGATGGAACCACACCAAGAGCGCCATTACCGGCCTCCAGAAAAGGCTTTTTGTGAGCATC-CGATGCTGACGCCCTCGCAGCTTCCATTGTCGGTCGGCCGCGCCACCATGGGTATGAAAGCCCTCAC----CGCATCTCCT---GCGTAG------TCCGCGAACTGACA-ACATGGCAGTATTATGATTGGT Phoma.typhina_CBS_602.72_ CGGTGATGATGCGCCCCGAGCAGTCTTCCGTAAGTACTCC-CCCATTCCTGTCTTGCTGGATGGAACCACACCAAGAGCGCCATTACCGGCCTCCAGAAAAGGCTTTTTGTGAGCATC-CGATGCTGACGCCCTCGCAGCTTCCATTGTCGGTCGGCCGCGCCACCATGGGTATGAAAGCCCTCAC----CGCATCTCCT---GCGTAG------TCCGCGAACTGACA-ACATGGCAGTATTATGATTGGT Pleospora.herbarum_CBS_191.86_ CGGTGATGATGCGCCCCGAGCAGTCTTCCGTAAGTACC---CCAGCACCCGCCTCTCGAGCTGGCGCTGCCCCGAGAGAGCGA-----------------CCACGCCGTGAAAGAGCC-CGTTTCTGACAGCGCTGCAGCTTCCATTGTCGGCCGACCGCGTCACCATGGGTACGACCAAGCTCCT----AGTAACCCTCTCCGCGTAG------CCCCCAAGCTGACA-AAGCGCCAGTATCATGATTGGT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14605] TITLE 'Figure 2 LSU / ITS'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1921; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Coniothyrium_palmarum_CBS_400.71 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCGTGTACCTCTCTTCGGGGAGGCCGTATAGGGGAGGCGTCATACAACCAGCCTGGACTGAGGTCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACTATATCTCGGGGGG--CCGGACCCAAGGTGCGAGCGTACACGGCGTTTAACCACGCTGTGGCATTCGACATCTTG--ACCCGCCCTGTCTGAATA--TATACCCCTGTT-TATTGCGTACTA-CTTGTTTCCTTGGTGGGCT-TGCCCGCCAAAAGGAC-A--CCTATAAAACC-TCTTGTAATTGCAGTCAGCGTCAGAAAA--AC-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCCGT-----GTTATGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCGTGGAGCAGC-AGTACATTCAGCTCTCTACA-CCATA--AAGT-TGGCATCCATCAAGTCTAT-ACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Cucurbitaria_berberidis_CBS_363.93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTTT-AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCAATTTTCGGGGGGA-----------------------------------------------------------------CTTCGGTCCCTGTC----TGAACCCTTGTC-TTTTGCGTACCA-TTTGTTTCCTCGGCGGGCTCTGCCTGCCGATAGGAT-A--CTATAACAACC-CTTTGTAATTGCAATCAGCGTCAGAAAAC-AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCCG----TTTTATGCGC----GGGACTCGCCTCAAAGCAATTGGCAGCCGGCGTA-CTCGCCTTGGAGC-GC-AGCACATCTTGCGTCCCTTG-GCCTGA-ACGC-TTGCGTCCACAAAGCCTAT-ACTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_biglobosa_CBS_119951 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGTCAGCAGTTGAGCCT---------------------T-TGGCTTAATTTCTGT--CCCTTTCCTTTCTGAT----TCTACCCATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAAAAGGAC----AATT-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGA-A-TGTTCTCT--GTGCTTGCGCA-GAC-TGGACTCGCCTGAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTATGA-TTGT-TGGCATCCATCAAGATA-TTTTATTAGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_biglobosa_DAOM_229269 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGTCAGCAGTTGAGCCT---------------------T-TGGCTTAATTTCTGT--CCCTTTCCTTTCTGAT----TCTACCTATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAAAAGGAC----AATT-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGA-A-TGTTCTCT--GTGCTTGCGCA-GAC-TGGACTCGCCTGAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTATGA-TTGT-TGGCATCCATCAAGATA-TTTTATTAGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_collinsoniae_CBS_120227 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TCTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTACCCTTTCTATC-GGGGG-GTTGACACCAGCGCTCTGGGCT-------------------C-T-TGCTTGGTTCACTGG--CTCAATCCTTTCTGAT----TCTACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCAACAGGAC-A--CACC-ACAACC-TCTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTTCCCT--GCGCTTGCGCT-ATCGGGGACTCGCCTCAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGG-TTGT-TGGCATCCATCAAGGAC-TTTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_doliolums_doliolum_CBS_505.75 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCGCG----TTTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_dryadis_CBS_643.86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACT-TTTGTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACCTTCAT--CGGGGG-GCTGGATCCAGACTGTAGAGCT-------------------T---CGGCCCTGCTTTCTG--CCCTACCCTTTCTGAT----TACACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCGATAGGAC-A--TTAT-TAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGT-----TTCTCGCG-----TGGACTCACCTTAAAGCAATTGGCAGCCGGCATA-TTGGCT-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-TTGT-TGGCATCCATCAAGACTAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_fallaciosa_CBS_414.62 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCT-CCTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ACTGGGGCCAGCGGGCCAGGCT-------------------TTG-GCTGAAGCCCGCTGGACTTTTGATCCCCTTGAT----TCTACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGCGGGCT-TGCCTGCCGATAGGAC-T--CACC-AAAACC-TCTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTATTGGGCGT-C-TGTTCTCC--GCTCGG----------GGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACAATTTGCGCCCCTTG-CCATGC-TTGT-TGGCACCCATCAAGACCTTTTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_hendersoniae_CBS_113702 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTTCATC-AGGGG-ACTGACGTCAGTGTTCGGGGCT-------------------C-T-TGCTCTGTTCTCTGG--CCCATTCCTTTCTGAT----TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAATAGGAC-A--AACT-AAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-A-TGTTCTCT--GTGCTTGCGCA-GAT-TGGACTCGCCTTAAAACAATTGGCAGCCGGCACA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTTG-TCATGG-TTGT-TGGCATCCATCAAGATC-TTTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_libanotis_CBS_113795 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCAGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTTCATC-AGGGG-ACTGGTGTCAGCGTTCGGGGCT-------------------C-T-TGCTCTGTGTGTTGG--CCCATTCCTTTCTGAT----TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCGATAGGAC-A--AACC-AAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGC-ATTGTCCTCT--GCCCTTGGGCA-GGC-TGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-GTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CCATGG-TTGT-TGGCATCCATCAAGACT-TTTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_macrospora_CBS_114198 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACT-TCTGTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTAGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGTAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-AATATCAT--TGGGGG-GTTGGATCCAGCTGGTTAGGCT-------------------T---CGGTCTTGCCTTCTG--CCCTTCCCTTACCGAT----TTTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCGATAGGAC-A--TCAT-TAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACTCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTTCGCG-----TGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-TTGT-TGGCATCCATCAAGACCAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_nitschkei_CBS_306.51 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACT-TTTGTCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--TGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CATATTAT--CGGGGG-GTTGGATACAGATTGCTGGGCT-------------------T---CGGTCTGGCCTTCTG--CCCTTCCCTTACTGAT----TTTACCCATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCGATAGGAC-A--TTAT-TAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTTCGCG-----TGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGTTTCTTG-TCATGA-TTGT-TGGCATCCATCAAGACCAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Leptosphaeria_praetermissa_CBS_114591 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACT-TTTGTCCGGTGCATTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACCTTCAT--CGGGGG-GCTGGACCCAGACTGTAGAGCT-------------------T---CGGCCCTGCTTTCTG--CCCAACCCTCTTTGAT----TATACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCGATAGGAC-A--TCAT-TAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGT-----TTCTCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-TTGT-TGGCATCCATCAAGACTAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Neophaeosphaeria_filamentosa_CBS_102202 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGATCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTTTCTGTCACGTACCCCTCTTCGGGGGGGCCTTATAGGGGGAACGACATGCAACCAGCCCAGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTAGGAACCCGTT--AGGGCGCACTATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-AACATATTTCCAGGGGGTTTGGGTCTAGGGCGCGCCCAC-----------------------AAAGCGTGCCCTAGC--CTCAGCCTTGTCTGAATAT-TATACCCATGTCTATTTGCGTACCG-TTTGTTTCCTTGGTGGGCT-CGCCTGCCAAAAGGAC-A--CCTA-TAAAAC-TCTTGTAATTGCAATCAGCGTCAGTTAAAACAAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGCGTCT-TGTCCCGC-----TTTACGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCATAGAAGC-GC-AGCACATTTTGCGTCTCTTG-TCCTTC-ATGC-TGGCATCCAGTAAGCCTAA-CTTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_acuta_acuta_CBS_541.66 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCGCG----TTTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_acuta_errabunda_CBS_125978 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGAGT--------------------------------TCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGAC----GTTACCCATGTCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGG-ATATCAA-TCCACC-CT-TGAATTTGCAGTCCATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-T-TGTCCGCGCTT--TTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_acuta_errabunda_CBS_617.75 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGAGT--------------------------------TCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGAC----GTTACCCATGTCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGG-ATATCAA-TCCACC-CT-TGAATTTGCAGTCCATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-T-TGTCCGCGCTT--TTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_acuta_phlogis_CBS_125979 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCGCG----TTTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_acuta_phlogis_CBS_155.94 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCATTTTTGCCCCTATGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCGCG----TTTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_agnita_CBS_121.89 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCT-CCTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ACTGGGGCCAGCGGGCCAGGCT-------------------CTG-GCTGAAGCCCGCTGGACTCTTTTTCCCCATGAT----TCTACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGCAGGCT-TGCCTGCCGATAGGAC-T--CACC-AAAACC-TCTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTATTGGGCGT-C-TGTTCTCC--ACTTGG----------GGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACAATTTGCGCCCCTTG-CCATGC-TTGT-TGGCACCCATCAAGACCTTTTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_agnita_CBS_126584 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCT-CCTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ACCGGGGCCAGCGGGCCAGGCT-------------------CTG-GCTGAAGCCCGCTGGACTCTTTTTCCCCATGAT----TCTACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGCAGGCT-TGCCTGCCGATAGGAC-T--CACC-AAAACC-TCTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTATTGGGCGT-C-TGTTCTCC--ACTTGG----------GGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACAATTCGCGCCCCTTG-CCATGC-TTGT-TGGCACCCATCAAGACCTTTTTATCAGCTCTTGACCTCGGATCAGGTAG------- Phoma_apiicola_CBS_285.72 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTCT-CAGGGG-GTTGGACGCAGTGAGTTGGGCT-------------------T---CGGTCAGGCTCTCTG--CCCCTCCCTTTCTGAA----TTTACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGTAGGCT-TGCCTGCCGATAGGAC-A--CCCA-TCAACC-TTTTGCAATTGCAGTCAGCGTCAGAAAAACAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----CTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCACA-ATGGCC-TGGAGC-GC-AGCACAATTTGCGCCTCTTG-TCATGC-ATGT-TGGCATCCATCAAGACCAC--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_apiicola_CBS_504.91 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTCT-CAGGGG-GTTGGACGCAGTGAGTTGGGCT-------------------T---CGGTCAGGCTCTCTG--CCCCTCCCTTTCTGAA----TTTACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGTAGGCT-TGCCTGCCGATAGGAC-A--CCCA-TCAACC-TTTTGCAATTGCAGTCAGCGTCAGAAAAACAC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----CTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCACA-ATGGCC-TGGAGC-GC-AGCACAATTTGCGCCTCTTG-TCATGC-ATGT-TGGCATCCATCAAGACCAC--TTTTTGCTCTTGACCTCGGATCAGGTAGG------ Phoma_carteri_CBS_101633 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCCATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-AACATATTACGGGGGG--CCGGACCCAAGGTGCGTGGAT------------------------TTCCATGTGCTTTG--ACCCGCCCTGTCTGAATAT-TCTACCCATGTC-TTTTGCGTACTA-TTCGTTTCCTCGGTGGGCT-TGCCTGCCGATAGGAC-A--CTAT-AAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAATAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGT-T-TGTCCCGC-----GTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGCTTCTAG-TCATGA-ATGT-TGGCATCCATTAAGCCTAT-ACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_carteri_CBS_105.91 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-AACATATTACGGGGGG--CCGGACCCAAGGTGCGTGGAT------------------------TTCCATGTGCTTTG--ACCCGCCCTGTCTGAATAT-TCTACCCATGTC-TTTTGCGTACTA-TTCGTTTCCTCGGTGGGCT-TGCCTGCCGATAGGAC-A--CTAT-AAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAATAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGT-T-TGTCCCGC-----GTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGCTTCTAG-TCATGA-ATGT-TGGCATCCATTAAGCCTAT-ACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_conferta_CBS_375.64 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTTCATC-AGGGG-ATTGGTTCCAGGGCTCAGGGCT-------------------TAT-TGCTCTGCGCCTTGG--GCCGGTCCTGTCTGAT----TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTAGGCT-TGCCTGCCAATAGGAC-A--AACT-ACAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTTCTCT--GCGCTTGCGTG-GAA-TGGACTCGCCTTAAAACAATTGGCAGCCGGCATGTTTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCAATG-CTGT-TGGCATCCATCAAGATC-TTTT-TTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_congesta_CBS_244.64 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATAAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTTGATC-AGGGG-ATGGGCGTTGTTAGT-AGGGCT-------------------C-T-TGCCCCACGTATGGC--GCCCATTCTCACTGAT----TTCACCCATGTC-CTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCTATAGGAC-T--CACA-AAACCC-ACTTGTAATTGCAGTCAGCGTCAGTAAACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-A-TGTCTGCT--GCCCTTGGGCACGC--CAGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TCAGCC-TGGAGC-GC-AGCACATTTTGCGTCCCTTG-CTGACC-GTGT-TGGCATCCATCAAGACGATTTTATCAGCTCTTGACCTCGGATCAGGTAGGG----- Phoma_dimorphospora_CBS_165.78 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCAT--CAGAGA-GCTGGGTTTT-----------------------------------GGGCTTCCCGCTCTG--CCCAGCCCTCTCTGAC----TCTACCCATGTC-TTTTGCGTACTA-TCTGTTTCCTTGGTGGGCT-TGCCTGCCAATAGGAC-A--CCCCTACAACC-TTTTGCAATTGCAGTCAGCGTCAGTACAA-AA-TAATG-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCTGC----CTCTGCGTA-----TGGACTCGCCTGAAAGCAATTGGCAGCCGGCACA-TTGGCC-CGTAGC-GC-AGCACATTTTGCGCCGCTGG-TTGAGG-TTGT-CGGCGTCCATGAAGCCTGTCTTTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_dimorphospora_CBS_345.78 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCAT--CAGAGA-GCTGGGTTTT-----------------------------------GGGCTTCCCGCTCTG--CCCAGCCCTCTCTGAC----TCTACCCATGTC-TTTTGCGTACTA-TCTGTTTCCTTGGTGGGCT-TGCCTGCCAATAGGAC-A--CCCCTACAACC-TTTTGCAATTGCAGTCAGCGTCAGTACAA-AA-TAATG-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCTGC----CTCTGCGTA-----TGGACTCGCCTGAAAGCAATTGGCAGCCGGCACA-TTGGCC-CGTAGC-GC-AGCACATTTTGCGCCGCTGG-TTGAGG-TTGT-CGGCGTCCATGAAGCCTGTCTTTTTTGCTCTTGACCTCGGATCAGGTAGG------ Phoma_doliolum_CBS_125977 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACTGG---CGGGTTT---------------------------------------CAATTTCGATTG-ACTCCCACCTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCTTTACGGCCCCTACGGG-ATATCAA-TCCACC-CATTGTATTTGCAGTCAATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCCGCGCTCTTTTGCGC------GAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTTG-CTTGCTTGTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_doliolum_CBS_616.75 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACTGG---CGGGTTT---------------------------------------CAATTTCGATTG-ACTCCCACCTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCTTTACGGCCCCTACGGG-ATATCAA-TCCACC-CATTGTATTTGCAGTCAATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCCGCGCTCTTTTGCGC------GAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTTG-CTTGCTTGTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_drobnjacensis_CBS_269.92 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTCT-CAGGGG-GATGGACGCAACAGGT--------------------------------TCACGCTTGTTG--CTCCGCCCTTTCTGAA----TATACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTCGGCAGGCT-TGCCTGCCGATAGGAC-A--TCAT-TAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----CTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-ATGT-TGGCATCCATCAAGACTAT-ATTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_drobnjacensis_CBS_270.92 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCGGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTCT-CAGGGG-GATGGACGCAACAGGT--------------------------------TCACGCTTGTTG--CTCCGCCCTTTCTGAA----TATACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTCGGCAGGCT-TGCCTGCCGATAGGAC-A--TCAT-TAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----CTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-ATGT-TGGCATCCATCAAGACTAT-ATTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_enteroleuca_enteroleuca_CBS_831.84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGCAAGTCATCAGGGCT-------------------T-C-TGCTCTGGTTTCTCG--CCCAGTCCTTTCTGAT----TTTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCGATAGGAC-A--AACT-AAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-A-TGTCCTCT--GCGCTTGCGTG-GAT-GGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATAG-TTGT-TGGCATCCATCAAGACC-TCACATAAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_enteroleuca_influorescens_PD73.1382 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-GGGGG-ATTGACGCCAGTGCTC---------------------------C-TTCTCGGCACACTGG--CTCTCTCCTTTCTGAT----ATCACCCATGTC-TTTTGCGTACTA-CTTGTTTCCTTGGTGGGCT-TGCCCGCCAACTGGACAA--AACA-AAAACC-TTTTGCAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-A-TGTCTCCT--GCGCTTGCGCT-GTTGGAGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-TTGT-TGGCACCCATCAAGACC-TCTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_enteroleuca.enteroleuca_CBS_142.84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGCAAGTCATCAGGGCT-------------------T-C-TGCTCTGGTTTCTCG--CCCAGTCCTTTCTGAT----TTTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCGATAGGAC-A--AACT-AAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-A-TGTCCTCT--GCGCTTGCGTG-GAT-GGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATAG-TTGT-TGGCATCCATCAAGACC-TCACATAAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_enteroleuca.influorescens_CBS_143.84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-GGGGG-ATTGACGCCAGTGCTC---------------------------C-TTCTCGGCACACTGG--CTCTCTCCTTTCTGAT----ATCACCCATGTC-TTTTGCGTACTA-CTTGTTTCCTTGGTGGGCT-TGCCCGCCAACTGGACAA--AACA-AAAACC-TTTTGCAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-A-TGTCTCCT--GCGCTTGCGCT-GTTGGAGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-TTGT-TGGCACCCATCAAGACC-TCTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_etheridgei_CBS_125980 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTTTTTACGGGGG-GCCGGATCCAAAGTTTGGGGCT-------------------T---CGGTCTCGCTCTTTG--CCCCGCCCTGTCTGAA----TCTACCCATGTT-TTTTGCGTACTC-TCTGTTTCCTTGGTGGGCT-TGCCCGCCACAAGGAC-ACTATAA-CAACCT-TTTTGCAATTGCAGTCAGCGTCAGAAAA--ACAATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC----TTCTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTCG-CCTTGA-TTGT-TGGCATCCATCAAGCCCAT-TTATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_glycinicola_CBS_124141 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACT-TTTGTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGATGAAACATCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CACATATTACGGGGGG-TCGGATCCCAAGGTACGTGTAA------------------------CCCATGTGCTTTGG--ACCTGCCCTGTCTGAATAT-TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGCAGGCT-CGCCTGCCAATAGGAC-A--TTAT-ACAACC-TCTTGTAATTGCAATCAGCGTCAGTTAAAAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTCT-TGTCTCGC-----GTTGCGCG-----TAGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGCTTCTAG-TCATGA-ATGT-TGGCGTCCATTAAGCCTAT-ACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_glycinicola_IMI_294986 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACT-TTTGTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGATGAAACATCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CACATATTACGGGGGG-TCGGATCCCAAGGTACGTGTAA------------------------CCCATGTGCTTTGG--ACCTGCCCTGTCTGAATAT-TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGCAGGCT-CGCCTGCCAATAGGAC-A--TTAT-ACAACC-TTTTGTAATTGCAATCAGCGTCAGTTAAAAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTCT-TGTCTCGC-----GTTGCGCG-----TAGACTCGCCTCAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGCTTCTAG-TCATGA-ATGT-TGGCGTCCATTAAGCCTAT-ACTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_herbarum_CBS_615.75 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCATTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTTACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGTT-TTTACCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGAACTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTC--GGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACAGTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCTGGGGCAGGATTTATGCCCCAGCGAGTAGGCAGGCGTGGAGGTCCGTGACGAAGCCTTGGATCATTA-CCTAGAGTTTGTGGGC---------------------------------------------------------------------TTTGCCTGCTATCTCTTACCCATGTC-TTTTGAGTACT--TACGTTTCCTCGGTGGGTT-CGCCCGCCGATTGGAC----AATT-TAAACC-CTTTGCAGTTGCAATCAGCGTCTGAAAA--AC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCATTGCTTGGTGTTGGGTGT-T-TGTCTCGC----CTTTGCGTG-----TAGACTCGCCTTAAAACAATTGGCAGCCGGCGTA-TTGATTTCGGAGC-GC-AGTACATCTCGCGCTTTGCA-CTCATA-ACGA-CGACGTCCAAAAGTACATT--TTAACACTCTTGACCTCGGATCAGGTAGGGATACC Phoma_heteromorphospora_CBS_115.96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAATTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCT-TTTGCCCAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGCCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTTGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCAT--CAGAGA-GCTGGGTCGC-----------------------------------GGGCTTCTCGCTCTG--CCCAGCCCTCTCTGAC----CCCACCCATGCC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCAGCAGGAC-A--CCCCTACAACC-TTTTGCAATTGCAGTCAGCGTCAGTACAACAG-TAATA-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCTGC----CTCTGCGCA-----CGGACTCGCCTGAAAGCAATTGGCAGCCGGCACT-TTGGCC-TGTAGC-GC-AGCACATTTTGCGCCGCTGGTTTGAGG-TTGT-TGGCGTCCATGAAGCCTAT-ATTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_heteromorphospora_CBS_448.68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAATTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCT-TTTGCCCAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGCCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTTTTGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCAT--CAGAGA-GCTGGGTCGC-----------------------------------GGGCTTCTCGCTCTG--CCCAGCCCTCTCTGAC----CCCACCCATGCC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCGCCAGCAGGAC-A--CCCCTACAACC-TTTTGCAATTGCAGTCAGCGTCAGTACAACAG-TAATA-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCTGC----CTCTGCGCA-----CGGACTCGCCTGAAAGCAATTGGCAGCCGGCACT-TTGGCC-TGTAGC-GC-AGCACATTTTGCGCCGCTGGTTTGAGG-TTGT-TGGCGTCCATGAAGCCTAT-ATTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_intricans_CBS_139.78 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTTCATC-AGGGG-ACTGGCGTCAGTGTTCGGGGCT-------------------C-T-TGCTCTGTTCTCTGG--CCCATTCCTTTCTGAT----TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAATAGGAC-A--AACT-AAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-A-TGTTCTCT--GTGCTTGCGCA-GAT-TGGACTCGCCTTAAAACAATTGGCAGCCGGCACA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGG-TTGT-TGGCATCCATCAAGATC-TTTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_korfii_CBS_101638 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACCTTCAT--CAGCGG-ACCGGATCCAGGTGGTAAGGCT-------------------CTTGTAGCCGAGCTCTCTG--CCCGGTCCTAACTGAC----TATACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCGATAGGAC-A--TTAT-TAAACC-TCTTGTAATTGCAGTCAGCGTCAGAATA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTCCGCG-----TGGACTCGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGA-CTGT-TGGCATCCATCAAGACTAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_leonuri_CBS_125975 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACAGG---TGGGTTC---CAGCTGTTCT--------------------------TCGGTTCAGCTG-CCTCCTACTTGCTTGAC----GTTACCCATGCC-TTTTGCGTACAA-TTTGTTTTCCCAGCAGGGC-ATTCTGCCCCTACGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCTGCGCT--TTTGTGC------GAGACTCGCCTTAAATCTATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTAGCGATTGT-TGGCCCCCATTAAATCTAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_leonuri_CBS_389.8 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACAGG---TGGGTTC---CAGCTGTTCT--------------------------TCGGTTCAGCTG-CCTCCTACTTGCTTGAC----GTTACCCATGCC-TTTTGCGTACAA-TTTGTTTTCCCAGCAGGGC-ATTCTGCCCCTACGGG-ATATCAA-TTCACC-CA-TGTATTTGCAGTCAATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCTGCGCT--TTTGCGC------GAGACTCGCCTTAAATCTATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTAGCGATTGT-TGGCCCCCATTAAATCTAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_lingam_CBS_260.94 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCT-TTTGTCCAGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCATTTTCA-AAGCA---------------------CT-------------------GCC-GCCTCGATCAGTGGC--GGCAGTCTACTTTGAT----TCTGCCCATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCACCAATTGGAT-C--CCCT-AAAACC-ACTTCCAATTGCAGTCAGCGTCAGTA-ACAAT-GTAATAAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTTCCAC--TT--------------GGGACTCGCCTTGAAACAATTGGCAGCCGGCACA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGG-TTGT-TGGCATCCATCAAGACA-CTTTTTAAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_lingam_CBS_275.63 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCT-TTTGTCCAGTGCACTCTTCTACAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCACGTACCTCCCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCATTTTCA-AAGCA---------------------CT-------------------GCC-GCCTCGATCAGTGGC--GGCAGTCTACTTTGAT----TCTGCCCATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCCACCAATTGGAT-C--CCCT-AAAACC-ACTTGCAATTGCAGTCAGCGTCAGTA-ACAAT-GTAATAAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTTCCAC--TT--------------GGGACTCGCCTTGAAACAATTGGCAGCCGGCACA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCATGG-TTGT-TGGCATCCATCAAGACA-CTTTTTAAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_lupini_CBS_248.92 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCT-CTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGAACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCCATCAGGGGA-ACGGGAACCAGCAGGCTAGGCT-------------------TTG-GCTGAACCTTGCTGGGCTTCTGATCCTCTTGAT----TCTACCCATGTT-TTTTGCGCACTA-TTTGTTTCCTTGGCGGGCT-TGCCTGCCAATTGGAC-T--TACC-AAAACC-TCATGCAATTGCAGTCAGTGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGT-C-TGTTCTCC-----CTCCGGGG-----GGGACTTGCCTTAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACAATTTGCGCCTCTCG-TCATGT-TTGT-TAGCACCCATCAAGACC-TTTTATCAGCTCTTGACCTCGGATCAGGTA-------- Phoma_macdonaldii_386.8 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCCTTTTATCGGGGGG-GTTGATGCCGGTACTCTGGGTC-------------------TTT-TGCTCCATGTACCAG--CTCACCTCTTTCTGAT----TCTACCCATGTT-TTTTGCGTACTA-CTTGTTTCCTCGGCGGGCT-TGCCCGCCGATAGGAC-A--AAAC-AAAACC-TTTTGCAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCATTGCTTGGTGTTGGGTGT-A-TGTTTCCC----CCTTGG--------GAAACTCGCCTCAAAACAATTGGCAGCCGGCATA-TGAGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTTTGA-TTGT-TGGCATCCATCAAGACC-TTTTATTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_macdonaldii_CBS_381.67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCCTTTTATCGGGGGG-GTTGATGCCGGTACTCTGGGTC-------------------TTT-TGCTCCATGTACCAG--CTCACCTCTTTCTGAT----TCTACCCATGTT-TTTTGCGTACTA-CTTGTTTCCTCGGCGGGCT-TGCCCGCCGATAGGAC-A--AAAC-AAAACC-TTTTGCAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCATTGCTTGGTGTTGGGTGT-A-TGTTTCCC----CCTTGG--------GAAACTCGCCTCAAAACAATTGGCAGCCGGCATA-TGAGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTTTGA-TTGT-TGGCATCCATCAAGACC-TTTTATTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_macrocapsa_CBS_640.93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGAGT--------------------------------TCAGCAGTGTATTCGGCTGAACTCCCGCCTGATTGAC----GTTACCCATGTCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCCTTTGTGCCCCTACGGG-ATATCAA-TCCACC-CT-TGAATTTGCAGTCCATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-T-TGTCCGCGCTT--TTTGCG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_multipora_CBS_353.65 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGAGAAAGGTCTCTATCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGCCGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-AACATATTACAGGGGG-GCCAGGCCCAAGGTGCGTGTTA----------------------ACCCATGCGCCTTTGG--CCTTGCCCTTTCTGAATATCTCCACCCGTGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAGTAGGAC-A--CTATAAAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAT-AAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGT-T-TGTCCCGC-----GTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACAATTTGCGCTTCTTG-TCATGA-TTGT-TGGCGTCCATTAAGCCTGT-ATATTTGCGCTTGACCTCGGATCAGGTAGGGATACC Phoma_multipora_CBS_501.91 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCTTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGAGAAAGGTCTCTATCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGCCGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-AACATATTACAGGGGG-GCCAGGCCCAAGGTGCGTGTTA----------------------ACCCATGCGCCTTTGG--CCTTGCCCTTTCTGAATATCTCCACCCGTGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAGTAGGAC-A--CTATAAAAACC-TTTTGTAATTGCAGTCAGCGTCAGAAAT-AAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGT-T-TGTCCCGC-----GTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACAATTTGCGCTTCTTG-TCATGA-TTGT-TGGCGTCCATTAAGCCTGT-ATATTTGCGCTTGACCTCGGATCAGGTAGGGATACC Phoma_pedicularis_CBS_126582 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---CGGGTTT-----------------------------------------CCTTAAACCG-ATTCCTGCCTGTTTGAA----GTTACCCATGCC-TTTTGCGTACAA-TTTGTTCTCCTAGAAGGGCGTCTTCGCCCCGACAGG-ATACCAA-GTCACC-CA-TGTATTTGCAGTCAACGTCTGAAA---ACAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGCGCA--TTTGCGC-------AGACTCGCCTTAAAACAATTGGCAGCCGGCATG-ATAGCC-TGGAGC-GC-AGCACATTTTGCGTCTCTTT-GTTAGC-TTGT-TGGCCCCCATCAAGACCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_pedicularis_CBS_390.8 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---CGGGTTT-----------------------------------------CCTTAAACCG-ATTCCTGCCTGTTTGAA----GTTACCCATGCC-TTTTGCGTACAA-TTTGTTCTCCTAGAAGGGCGTCTTCGCCCCGACAGG-ATACCAA-GTCACC-CA-TGTATTTGCAGTCAACGTCTGAAA---ACAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGCGCA--TTTGCGC-------AGACTCGCCTTAAAACAATTGGCAGCCGGCATG-ATAGCC-TGGAGC-GC-AGCACATTTTGCGTCTCTTT-GTTAGC-TTGT-TGGCCCCCATCAAGACCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_pimpinellae_CBS_101637 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGTCAGTGTTTCAGCCT---------------------T-TGGCTCAGATTCTGG--CGCTTTCCTTTCTGAT----TCTACCCATGAT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAAAAGGAC----AATT-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-A-TGTTCTCT--GTGCTTGCGCA-GAC-TGGACTCGCCTGAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTATGA-TTGT-TGGCATCCATCAAGATA-TTTTATTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_rubefaciens_CBS_223.77 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTCT-CGGGGG-GCCGGACCCAGCATTCAAGGCG-------------------T---TTGCCCTGCTTGTTG--ACCCGCCCTGTCTGAA----TAAACCCATGTT-TTTTACGCACCA-TTTGTTTCCTCGGTGGGCT-TGCCTGCCGATAGGAC-AACCCAA-TCAACC-TTTTGTAATTGCAGTCAGCGTCAGTACA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGT-T-TGTCCCGC---GTTTTCCGCG-----TGGACTCGCCTTAAAACAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCTCTC-TTGT-TGGCACCCATCAAGCCCAT-TTATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_rubefaciens_CBS_387.8 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTCT-CGGGGG-GCCGGACCCAGCATTCAAGGCG-------------------T---TTGCCCTGCTTGTTG--ACCCGCCCTGTCTGAA----TAAACCCATGTT-TTTTACGCACCA-TTTGTTTCCTCGGTGGGCT-TGCCTGCCGATAGGAC-AACCCAA-TCAACC-TTTTGTAATTGCAGTCAGCGTCAGTACA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGT-T-TGTCCCGC---GTTTTCCGCG-----TGGACTCGCCTTAAAACAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCTCTC-TTGT-TGGCACCCATCAAGCCCAT-TTATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_sclerotioides_CBS_144.84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACTGG---CGGG--TTTTCAGCGGTGCT--------------------------TTTGTGCCACTG-ATGCCCACCTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCGTTACTGCCCCTACGGG-ATATCAA-TCCACC-CATTGTATTTGCAGTCAATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCCGCGCTCTTTTGCGC------AAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTTG-CTTGCTTGTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_sclerotioides_CBS_148.84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTTCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTTATGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACTGG---CGGGT-TTTTCAGCGGTGCT--------------------------TTTGTGCCAATG-ATGCCCACCTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCGTTACTGCCCCTACGGG-ATATCAA-TCCACC-CATTGTATTTGCAGTCCATGTCTGAAAA--ATAATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCCGCGCTCTTTTGCGC------AAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTTG-CTTGCTTGTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_septicidalis_CBS_101636 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGATCTCTGTCATGTACCTCTTTTCGGGGAGGCCTTATAGGGGAGATGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTTGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAAATTTACGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACTATACGAAGGGAGG-------------------------------------------------GTTGGGCTTCGG--CCTGCCCCTCTCTGACTAT-TCTACCCGTGTCTTTTTGCGTACCA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCGATAGGAC-A--CTATAAAAACC-TTTTGTAATTGCAGTCAGCGTCAGTAAA-AAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTTT-TGTCCCGC----GTTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGCTTCTGG-TCCTGA-ATGT-TGGCGTCCATTAAGCCTATAACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_septicidalis_CBS_188.71 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACTATATGAGGGGAGG-------------------------------------------------GCTGGGCTTCGG--CCTGCCCCTCTCTGACTAT-TCTACCCGTGTC-TTTTGCGTACTA-TTTGTTTCCTCGGTGGGCT-TGCCCGCCGATAGGAC-A--CTATAAAAACC-TTTTGTAATTGCAGTCAGCGTCAGTAAA-AAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCCGC----GTTTGCGTG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACAATTTGCGTTTCTAG-TCATGA-ATGT-TGGCGTCCATTAAGCCTATAACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_septicidalis_CBS_856.97 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACTATATGAGGGGAGG-------------------------------------------------GCTGGGCTTCGG--CCTGCCCCTCTCTGACTAT-TCTACCCGTGTC-TTTTGCGTACTA-TTTGTTTCCTCGGTGGGCT-TGCCCGCCGATAGGAC-A--CTATAAAAACC-TTTTGTAATTGCAGTCAGCGTCAGTAAA-AAC-TTAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCT-TGTCCCGC----GTTTGCGTG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACAATTTGCGTTTCTAG-TCATGA-ATGT-TGGCGTCCATTAAGCCTATAACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_sydowii_CBS_125976 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CGGCCGTGTATTCGGCTG-ATTCCCGCCTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCACTTGTGCCCCTACGGG-ATATCAA-TCCACC-CATTGTATTTGCAGTCCATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-T-TGTCCGCG----TCTGACG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_sydowii_CBS_385.8 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTTGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CGGCCGTGTATTCGGCTG-ATTCCCGCCTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCACTTGTGCCCCTACGGG-ATATCAA-TCCACC-CATTGTATTTGCAGTCCATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-T-TGTCCGCG----TCTGACG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_tracheiphila_CBS_127250 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGATGTCACAGAGGGTGAGAACCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATGGGCGCCAGCCTTCGGGGCT-------------------CTT-GCTTCGCTTGGCTGC--GTCTGTCTCTTCTGAT----TCTACCCATGTC-TTTTGCGCACCC-TTTGTTTCCTTGGTGGGCT-TGCCTGCCTGTAGGAC-A--CACC-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTACACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCACT--GCCCTTGTGCA-GGA-CGGACTCGCCTTAAAACAATTGGCAGCCGGCAGA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTGG-TCGACA-CTGT-TGGCATCCATCAAGACC-TTCTTTTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_tracheiphila_CBS_551.93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGATGTCACAGAGGGTGAGAACCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATGGGCGCCAGCCTTCGGGGCT-------------------CTT-GCTTCGCTTGGCTGC--GTCTGTCTCTTCTGAT----TCTACCCATGTC-TTTTGCGCACCC-TTTGTTTCCTTGGTGGGCT-TGCCTGCCTGTAGGAC-A--CACC-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTACACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCACT--GCCCTTGTGCA-GGA-CGGACTCGCCTTAAAACAATTGGCAGCCGGCAGA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTGG-TCGACA-CTGT-TGGCATCCATCAAGACC-TTCTTTTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_valerianae_CBS_499.91 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-CTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTAT-CAGGGG-GCTGGAGGCAGTTGGCGGGGCT-------------------C---TTGTCCTGCTCTCTG--CCCTACCCTTTCTGTA----TATACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGCGGGCT-TGCCTGCCGGTAGGAC-A--ATCC-TTAAAC-CCTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGATC-GCGAGCACATATTGCGAC-CTTG-CCATGA-TTGTCTGGCGTCCATCAAGACTAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_valerianae_CBS_630.68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-CTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--CGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTAT-CAGGGG-GCTGGAGGCAGTTGGCGGGGCT-------------------C---TTGTCCTGCTCTCTG--CCCTACCCTTTCTGTA----TATACCCATGTC-TTTTGCGCACTA-TTTGTTTCCTCGGCGGGCT-TGCCTGCCGGTAGGAC-A--ATCC-TTAAAC-CCTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGATC-GCGAGCACATATTGCGAC-CTTG-CCATGA-TTGTCTGGCGTCCATCAAGACTAT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_vasinfecta_CBS_539.63 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGATGTCACAGAGGGTGAGAACCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTTT-AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATGGGCGCCAGCCTTCGGGGCT-------------------CTT-GCTTCGCTTGGCTGC--GTCTGTCTCTTCTGAT----TCTACCCATGTC-TTTTGCGCACCC-TTTGTTTCCTTGGTGGGCT-TGCCTGCCTGTAGGAC-A--CACC-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTACACAAT-GTAAT-TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCACT--GCCCTTGTGCA-GGA-CGGACTCGCCTTAAAACAATTGGCAGCCGGCAGA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCCCTGG-TCGACA-CTGT-TGGCATCCATCAAGACC----TTTTAGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_veronicicola_CBS_126583 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAACAGGGCATTCTTGCCCCTACGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGT-T-TGTCCGCG----TTTTACG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_veronicicola_CBS_145.84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCATCCAGGCT-TTTGCCTGGTGCATTCTTCTATGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTC--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCATTACCTCAACGGG---GGGGTTT---------------------------------CAGCTGTTTATTCAGCCG-ATTCCCGCTTGTTTGAC----GTTACCCATGCCTTTTTGCGTACAG-TTTGTTTTCCCAGCAGGGCATTCTTGCCCCTACGGG-ATATCAA-TCCACC-CA-TGTATTTGCAGTCAATGTCTGAAA---ATTATAAT-AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCGCG----TTTCACG-------CAGACTCGCCTTAAATCAATTGGCAGCCGGCATG-TTAGCC-TGGAGC-GC-AGCACATTTTGCGCACCTTG-CTGGCG-GTGT-TGGCCCCCATCAAGTCCAT-ATATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_violicola_CBS_100272 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTAT-CAGAGG-GTTGGACGCAGCGTGCAGGGCT-------------------T---CGGTCTCGCGCTCTG--CCCCGCCCTTTCTGAT----TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTCGGCGGGCT-TGCCTGCCGATCGGAC-A--TTAT-TCAACC-CTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----CTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCAGGA-TTGT-TGGCATCCATCAAGACTCT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_violicola_CBS_306.68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTAT-CAGAGG-GTTGGACGCAGCGTGCAGGGCT-------------------T---CGGTCTCGCGCTCTG--CCCCGCCCTTTCTGAT----TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTCGGCGGGCT-TGCCTGCCGATCGGAC-A--TTAT-TCAACC-CTTTGTAATTGCAGTCAGCGTCAGAAAA--AC-ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----CTTGCGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-TCAGGA-TTGT-TGGCATCCATCAAGACTCT--TTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Phoma_wasabiae_CBS_120119 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGTCAGCATTTCGGCCT---------------------T-TGGCTTACTTTCTGG--CCCTTTCCTTTCTGAT----TCTACCCATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAAAAGGAC----AATT-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-A-TGTTCTCT--GTGCTTGCGCA-GAC-TGGACTCGCCTGAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTATGA-TTGT-TGGCATCCATCAAGATA-TTTTATTAACTCTTGACCTCGGATCAGGTAGGGATACC Phoma_wasabiae_CBS_120120 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTATCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT--AGGGCGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCCTTCTATC-AGGGG-ATTGGTGTCAGCATTTCGGCCT---------------------T-TGGCTTACTTTCTGG--CCCTTTCCTTTCTGAT----TCTACCCATGTT-TTTTGCGTACTA-TTTGTTTCCTTGGTGGGCT-TGCCTGCCAAAAGGAC----AATT-CAAACC-ACTTGTAATTGCAGTCAGCGTCAGTA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTTTGCTTGGTGTTGGGTGA-A-TGTTCTCT--GTGCTTGCGCA-GAC-TGGACTCGCCTGAAAACAATTGGCAGCCGGCATA-TTGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CTATGA-TTGT-TGGCATCCATCAAGATA-TTTTATTAACTCTTGACCTCGGATCAGGTAGGGATACC Plectophomella_visci_CBS_122783 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTGGGCT-CTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT-TGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGTA--TGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCCTTTTATT-GGGGA-TTAGCTGCTAGTGCACTGGGCT-------------------T-C-TGCTCTGCC--------TGGCATTCTCCCTAAT----TCTACCCATGTC-TTTTGCGTACTA-CTTGTTTCCTTGGTAGGCT-TGCCTGCCACTAGGAC-A--CACC-AAAACCTTTTTGTAATTGCAGTCAGCGTCAGCA-ACAAT-GTAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCACTGCTTGGTGTTGGGCGT-C-TGTTCTCTTTGCGCTTGCGTACATGGGGGACTTGCCTCAAAACAATTGGCAGCTGGCACA-ATGGCC-TGGAGC-GC-AGCACATTTTGCGCCTCTTG-CCATGG-TTGT-TGGCATCCATCAAGAAC-TCTTATCAGCTCTTGACCTCGGATCAGGTAGGGATACC Pyrenochaeta_cava_CBS_257.68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCTAGGCTCTTTGCCTAGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTCTAGGCGGTTGGATAAAGGCCTCTGTCATGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGGCGTAATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTATTACCCATACCTCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CCAATTTCGGGGGACT---------------------------------------------------------------TCGGTCCCTGTCTGAA-------ACCCTTGTC-TTTTGAGTACCA-TTTGTTTCCTTGGTAGGCTTTGCCTACCATTAGGAC-A--CCAC-TTAACC-TCTTGTAATTGCAATCAGCGTCAGAAAA--AC-ATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTATCTTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTGTGCG-----TGGACTCGCCTTAAAGCAATTGGCAGCCGGCGTA-CTAGTCTGGGAGC-GC-AGCACAATTTGCGCCTCTGA-ACCTGA-ACGC-TTGCGTCCATGAAGTCTAT-ACTTTTGCTTTTGACCTCGGATCAGGTAGGGATACC Pyrenochaeta_dolichi_IMI_217261 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACT-TTTGTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGATGAAACATCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CACATATTACGGGGGG-TCGGACCCCAAAGTGCGTGTAA------------------------CCCATGTGCTTTGG--ACCTGCCCTGTCTGAATAT-TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTAGGCT-TGCCTGCCAATAGGAC-A--TTAT-ACAACC-CTTTGTAATTGCAATCAGCGTCAGTAAAAAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-TGTCTCGC-----GTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGTTTCTTG-TCATGA-ATGT-TGGCATCCATTAAGCCTAT-ACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Pyrenochaeta_dolichi_IMI_217262 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGAGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAACCTTCGCCGTGTAAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGAACT-TTTGTTCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCATGGGGGATGAAACATCCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTGATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-CACATATTACGGGGGG-TCGGACCCCAAAGTGCGTGTAA------------------------CCCATGTGCTTTGG--ACCTGCCCTGTCTGAATAT-TCTACCCATGTC-TTTTGCGTACTA-TTTGTTTCCTTGGTAGGCT-TGCCTGCCAATAGGAC-A--TTAT-ACAACC-CTTTGTAATTGCAATCAGCGTCAGTAAAAAAT-TTAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTTT-TGTCTCGC-----GTTGCGCG-----TGGACTCGCCTTAAAGCGATTGGCAGCCGGCATA-TTGGCCTTGGAGC-GC-AGCACATTTTGCGTTTCTTG-TCATGA-ATGT-TGGCATCCATTAAGCCTAT-ACATTTGCTCTTGACCTCGGATCAGGTAGGGATACC Pyrenochaeta_lycopersici_CBS_267.59 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGCCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTAGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGTTTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGTCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCAAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTT--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-ACTGTATTA-CGGGGG-GCCGG-CGTGGGATTGCGTGCT-------------------T---TGGTGCGCCTTCCCT--CCCCGCCCTGTCTGAT----ACTACCCGTGTC-TTTTGCGTACCA-ATTGTTTCCTCGGTAGGCT-TGCCTGCCGGCCGGAC-A--CCAT-AAAACC-TTTTGTGATTGCAGTCAGCGTCGGAAAA--CT-ACAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCGC-----TTTGCGCG-----TGGACTCGCCTCAAAGCAATTGGCAGCCGGCAAT-CTGGTTATAGAGC-GC-AGCACATTTTGCGCTTCTTG-CCACGG-ATGT-CGGCGTCCATCAAGCCTAC-ACTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Pyrenochaeta_nobilis_CBS_407.76 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGGCCTCTGTCATGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATGCAACCAGCCTGGACTGAGGTCCGCGCATTT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTATTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTACCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATATACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCAATTTACAGCGGAC-------------------------------------------------------------------TTCGGTCCTGTC----TGCACCCTTGTC-TTTTGCGTACTATTTTGTTTCCTTGGTAGGCT-TGCCTGCCAAAAGGAC-C--ACAT-CAACCC-TTTTGTAATTGCAATCAGCGTCAGAAAA--ACTATAAT-AGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCTCTGCTTGGTGTTGGGTGT-T-TGTCCCCG-------TTTGCG-----AGGACTCGCCTTAAAGCAATTGGCAGCCGGCATA-CTAGCCTTGGAGC-GC-AGCACATTTTGCGCCTCTTG-ACTTGA-ATGA-CGGCGTCCATCAAGCCTACAATTTTTGCTCTTGACCTCGGATCAGGTAGGGATACC Pyrenochaetopsis_leptospora_CBS_101635 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGACCTACACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGACGGTTGGATAAAGGCCTCTGTCACGTACCTTCTCTCGGGAAGGCCTTATAGGGGAGGCGTCATGCAACCAGTCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCGCA--AGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTAAGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCAA-AACAGCGGACT--------------------------------------------------------------------TCGGTCCTTGC----TGCACCCTTGTC-TTTTGCGTACCG-TATGTTTCCTCGGCGGGCT-TGCCTGCCGGTTGGAC-A--ATAT-CAAACCTTTTTGTAGTTGCAATCAGCGTCAGAAAACAA--ATAAT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTTGTACCCTCAAGCACTGCTTGGTGTTGGGCGT-T-TGTCCTGC-----------AA-----AGGACTCGCCTGAAAGCGATTGGCGGCCAACGTA-CTGGTGGTAGAGC-GC-AGCACAATTTGCGTCTCTC--CCTTCT-ACGT-CGGCGTCCATGAAGCCTT--ATTCAAACGTTTGACCTCGGATCAGGTAGGGATACC Pyrenochaetopsis_pratorum_CBS_286.93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTAACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGACCTCTGTCACGTACCTTCTCTCGGGAAGGCCTTATAGGGGAGGTGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCAATATCAGCGGGCT--------------------------------------------------------------------TCGGCCCCTGC----TATACCCTTGTC-TTTTGCGTACCA-CTTGTTTCCTCGGCGGGCT-TGCCTGCCGATAGGAC-A--AACA-CAAACC-CTTTGTAGTTGCAATCAGCGTCAGAAAA--AA-ACAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCAATGCTTGGTGTTGGGTGC-T-TGTCCGCC-----------AG-----CGGACTCACCTAAAAGCTATTGGCAGCCGCCGCA-TAGGCAGCAGAGC-GC-AGCACATTACCGCGTCTCTG-CCCTCC-GCGA-CGGCATCCACAAGCCCT----TTTCAACGTTTGACCTCGGATCAGGTAGGGATACC Pyrenochaetopsis_pratorum_CBS_445.81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTAACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCT-TTTGCCCGGTGCATTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTTGGATAAAGACCTCTGTCACGTACCTTCTCTCGGGAAGGCCTTATAGGGGAGGTGTCATGCAACCAGCCTGGACTGAGGTCCGCGCATCT--GCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGATCCCTTA--CGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATCGAACTATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGTAACGTTTTCAGTTTTATGAGGTAAAGCGAATGATTAGAGGCCTGGGGGTTGAAACAACCTTCACCTATTCTCAAACTTTAAATATGTAAGAAGTCCTTGTTACTTAATTGAACGTGGACACTTGAATGTATCGTTACTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGCGGGGTTAAGGTGCCAGAATGCACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCATACCCCGCCGCCGGGGCAAGATTTATGCCCCGGCGAGTAGGCAGGCGTGGAGGCTCGTGACGAAGCCTTGGATCATTA-TCAATATCAGCGGGCT--------------------------------------------------------------------TCGGCCCCTGC----TATACCCTTGTC-TTTTGCGTACCA-CTTGTTTCCTCGGCGGGCT-TGCCTGCCGATAGGAC-A--AACA-CAAACC-CTTTGTAGTTGCAATCAGCGTCAGAAAA--AA-ACAAT-AATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGAAAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCA-TTTGTACCTTCAAGCAATGCTTGGTGTTGGGTGC-T-TGTCCGCC-----------AG-----CGGACTCACCTAAAAGCTATTGGCAGCCGCCGCA-TAGGCAGCAGAGC-GC-AGCACATTACCGCGTCTCTG-CCCTCC-GCGA-CGGCATCCACAAGCCCT----TTTCAACGTTTGACCTCGGATCAGGTAGGGATACC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14606] TITLE Figure_5_LSU; LINK TAXA = Taxa3; DIMENSIONS NCHAR=808; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aposphaeria_populina_CBS_130330 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCTGTAGTTGCTCATCTGGGGAGTT-CCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Aposphaeria.populina_CBS_543.70 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCTGTAGTTGCTCATCTGGGGAGTT-CCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Asteromella.tiliae_CBS_265.94 CGGCTACAGCTCAAATTTGAAATCTGGCCCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCCTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGC-CTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTCTC-GCCTGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGG-ATAAAGGCCTCTGTCATGTACCACCCTTCGGGGTGGCCTTATAG-GGGAGGCGTAATGCGACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Beverwykella.pulmonaria_CBS_283.53 CGGCAATAGCTCAAATTTGAAATCTGGCCCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGTAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-CTGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCATCTGGGGTTTT-CCCCAGTGCACTCTTCTGTGGGCAGGCCAGCATCAGTTCAGGCGGTTGG-AGAAAGACCTGTGTCATGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCTTGAACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCG--TTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Byssothecium.circinans_CBS_675.92 CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTATG----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGTGTTGGTGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGC-ATGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCGGGCGTAT-GCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGG-ATAAAGGCCTCTGTCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGCGACATGCGACCAGCCCGGACTGA-GGTCCGCGCTTCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTT-----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Coniothyrium.fuckelii_CBS_797.95_ CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGC-CTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAG-GGGAGGCGTAATGCAACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Falcisormispora.lignatilis_BCC21118 CGGCAACAGCTCAAATTTGAAATCTGGATTCCTTTACT--GGGTCCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCGGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCACTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCGGTTGCTCAGCCGGGCTCCGTGCCCGGTGCACTCTTCCGCGGGCAGGCCAGCATCAGTTTGGGCGGCTGG-AGAATGGCCTCTGTCATGTACTGCCCTTCGGGGTAGCCTTATAG-GGGAGTCGTAATGCAGTCAGCCTGGACTGA-GGTCCGCGCTTCGGCGAGGATGCTGGCGTAATGGCCGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTCTTCT----GGGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Herpotrichia.juniperi_CBS_200.31 CGGCAATAGCTCAAATTTGAAATCTGGCCCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGGGTTTT-CCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAACTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGAACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Massaria.eburnea_CBS_473.64 CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTAGGCGGCGGTCTAAGTTCCTTGGAACAGGGCATCGCAGAGGGTGAGAATCCCGTATGTGGTCGC-CTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTT-GCCTGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTCGGCGGTCGG-ATAAAGGTCTCTCTCACGTACCTGCCTACGGGT-AGCCTTATAG-GGGAGACGACATGCGACCAGCTGGGACTGA-GGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCTTA-----------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Massaria.eburnea_H_3953 CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTAGGCGGCGGTCTAAGTTCCTTGGAACAGGGCATCGCAGAGGGTGAGAATCCCGTATGTGGTCGC-CTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATAAGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTT-GCCTGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTCGGCGGTCGG-ATAAAGGTCTCTCTCACGTACCTGCCTACGGGT-AGCCTTATAG-GGGAGACGACATGCGACCAGCTGGGACTGA-GGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCTTA-----------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Massaria.platani_CBS_221.37 CGGCAATAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGACGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGC-CAGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGACTTTT-GCCCGGAGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGCTGG-ATAAAGACCTCTGTCATGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGTGTAATGCAGTCAGCCTGGACTGA-GGTCCGCGCATTCGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTCT-C------GGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Melanomma.pulvispyrius_CBS_371.75 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGGGATTT-CCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC---------GGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Neottiosporina.paspali_CBS_331.37 CGGCAATAGCTCAAATTTGAAATCTGGCTCCTTTTA----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGGTAGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTTTGTGGTCGC-ATGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGTAGTTGCTCACCTAGGCTTTT-GCCTGGGGCATTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGG-ATAAAGGTCTCTGTCATGTAGCTTTCTTCGGAAAGAACTTATAG-GGGAGACGAAATGCGACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Paraconiothyrium.CBS_101461 CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGC-CTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTCGG-ACAAAGGCCTCTGTCAAGTATCTCCCTTCGGGGTGACCTTATAG-GGGAGGCGTAATGCGACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Paraconiothyrium.minitans_CBS_122786 CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGC-CTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAG-GGGAGGCGCAATGCAACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Paraconiothyrium.minitans_CBS_122788_ CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGC-CTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAG-GGGAGGCGCAATGCAACCAGCCCGGACTGA-GGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Paraphaeosphaeria.michotii_CBS_652.86 CGGCAACAGCTCAAATTTGAAATCTGGCTCTCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGATGCTTTGGCATTGGCAGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGC-TTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTC-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGCGTAATGCAACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCTTTT----------AGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Phoma_flavescens_CBS_178.93_ CGGCAAAAGCTCAAATTTGAAATCTGGCTCTCTATG----GGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGC-CTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTCCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCGGTTGTT------------------------TTCTTCCGTGGGCAGGCCAGCATCAGTTTGGGCGATCGG-ATAAAGGCCTCTATCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGCGTAATGCGATCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTCT-C------GGGGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Phoma.capitulum_CBS_337.65 CGGCAACAGCTCAAATTTGAAATCTGGCCCTCTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGATGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGC-CAGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCGGGGCTCTT-GCCCCGGGCACTCTTCTACGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAATGCCTGCTACATGTACCTCTCTTCGGGGAGGACTTATAG-GGTAGGCGACATACAGCCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Phoma.lini_CBS_253.92 CGGCAACAGCTCAAATTTGAAATCTGGCCCTCTTTG----GGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTGGCATTGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGC-CTGCCTTTGCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCTAGGCTTTG-GCCTGGGGCACTCTTCTGTGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAG-GGGAGGCGCAATGCAACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Phoma.minutispora_CBS_509.91 CGGCAACAGCTCAAATTTGAAATCTGGCCCTCTT------AGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGC-CAGCCTCCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCTTGGCTTCT-GCCTTGGGTACTCTTCTACGGGCAGGCCAGCATCAGTCCGGACGGTTGG-ATAAATGCCTGCGGAATGTACCTCTCTTCGGGGAGGACTTATAGCCGCGGGCGTCATGCAGCCAGTCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGAAGTTTACGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Plenodomus.fuscomaculans_CBS_116.16 CGGCAACAGCTCAAATTTGAAATCTGGCTCCTTT------GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCATCGGCGGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGGCGC-CTGCCTTTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGTACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCACCCAGGCTCCG-GCCTGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTTGGGCGGTTGG-ATAAAGGCCTCTGTCACGTATCTCCCTTCGGGGTGACCTTATAG-GGGAGGCGCAATGCAACCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTTT----------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pleomassaria.siparia_CBS_279.74 CGGCAATAGCTCAAATTTGAAATCTGGCCCCTTT------GGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGAGTTGGCTGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGTTGC-ATGCCTTCGCCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCCGCAGTTGCTCATCCGGGGTTCT-CCCCGGTGCACTCTTCTGTGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCATGTAGCTGTTCTCGGGC-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCTCGAACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pleurophoma_CBS_130329 CGGCAACAGCTCAAATTTGAAATCTGGCCTCCCTTG----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACATCACAGAGGGTGAGAATCCCGTACGTGGTCGC-CTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTCGTAGTTGCTCACCTGGG--TCC-GCCCGGGGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGGCGACCGG-ATAAAGGCCTCTGTCATGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGCGTAATGCGGCCAGCCCGGACTGA-GGTCCGCGCTTCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTCT-CC----GGGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pleurophoma._CBS_131286 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCATCCGGGGTTCT-CCCCGGTGCACTCTTCTGTGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-AGAAAGACCTGTGTCATGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pleurophoma._CBS_131287 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCGTCGGCAGCAGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCATCCGGGGTTCT-CCCCGGTGCACTCTTCTGTGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-AGAAAGACCTGTGTCATGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pleurophoma.pleurospora_CBS_116668 CGGCAACAGCTCAAATTTGAAATCTGGCCTCCTTTG----GGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACATCGCAGAGGGTGAGAATCCCGTACGTGGTCGC-CTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTCGTAGTTGCTCATCCGGG--TAC-GCCCGGAGCACTCTTCTGCGAGCAGGCCAGCATCAGTTTGGGCGACCGG-ATAAAGGCCTCTGTCATGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGCGTAATGCGGCCAGCCCGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCTCT-CC----GGGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Preussia.funiculata_CBS_659.74 CGGCAACAGCTCAAATTTGAAATCTGGCTCTTTT------AGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCAAAGGTTGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGC-CAACCCGCGCTATGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTCTT-GCCTGGTGCACTCTTCTATAGGCAGGCCAGCATCAGTCTTGGCGGTCGG-ATAAATGCGTGCTAAACGTACCTCTCTTCGGGGAGGACTTATAG-GGCACGCGGCATACGACCAGCCGGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC---------GGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pseudorobillarda_phragmitis_CBS_398.61 CGGCAATAGCTCAGATTTGAAATCTACTTCTTTC------AGAAGTCGAGTTGTAATCTGTAGAGGATGTTTCGGTGTTGGCTCCGGCCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGG-TCTCCTTCACCATGTGAAACTCCTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAACGGGAGGTAAATTTCTTCTAAAGCTAAATACCTGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTATATCGGCTTATCCAAGCTTCTGGCTTGGTGCACTCCTTTATATACAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCTCTAGGAATGTAGCTCGCCTCGGTG-AGTGTTATAGCCTAGAGTGCAATGCAGCCTGCCTGGACTGA-GGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTAAAACTCATACGCGTAATGAAAGTGAACGGAGGTGGGAACCGCA-----------AGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCGTGGGTAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pyrenochaeta.CBS_350.82 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCTGTAGTTGCTCATCTGGGGAGTT-CCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pyrenochaeta.mackinnonii_CBS_110022 CGGCAACAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGA-CAGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGACTCTT-GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGTGTAATGCAGCCAGCCTGGATTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGATTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTCA-C--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pyrenochaeta.mackinnonii_CBS_674.75 CGGCAACAGCTCAAATTTGAAATCTGGCCCTTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGTGTTGGCTGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGA-CAGTCTTCACCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGCCTGTAGTTGCTCATCTGGACTTTT-GTCCGGTGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCAGGCGGCTGG-ATAAAGGCCTCTATCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGTGTAATGCAGCCAGCCTGGATTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGATTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTA-C--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pyrenochaeta.romeroi_CBS_122784 CGGCAACAGCTCAAATTTGAAATCTGGCTCTATTTT----GGAGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGC-GTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCGGTTGCTCATCCGGGCTCTT-GCCCGGTGCACTCTTCCGTAGGCAGGCCAGCATCAGTTTGGGCGGCTGG-ATAAAGGCCTCTGTCATGTACCTTCCCTCGGGAAGGCCTTATAG-GGGAGGCGTAATGCAGCCAGCCTGGACTGA-GGTCCGCGCATTTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT-------GCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Pyrenochaeta.romeroi_CBS_252.60 CGGCAACAGCTCAAATTTGAAATCTGGCTCTATTTT----GGAGTCCGAGTTGTAATTTGTAGAGGGCGCTTTGGCGTCGGCAGCGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGC-GTGCCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGCGGTTGCTCATCCGGGCTCTT-GCCCGGTGCACTCTTCCGTAGGCAGGCCAGCATCAGTTTGGGCGGCTGG-ATAAAGGCCTCTGTCATGTACCTTCCCTCGGGAAGGCCTTATAG-GGGAGGCGTAATGCAGCCAGCCTGGACTGA-GGTCCGCGCATTTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTGAACGGAGGTGGGAACCCTTT-------GCGGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Roussoella.hysterioides_CBS_125434 CGGCAACAGCTCAAATTTGAAATCTGGCCCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTCGGCCGTGGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCCGC-CGGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGATAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGCAGTTGCTCACCCGGGCTCTC-GCCCGGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-ATAAAGGCCTCTATCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGCGCAACACGGCCAGCCCGAACTGA-GGACCGCGCATTCGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGACGCGCAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGAAGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGGGGAAACCCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Sporormiella.minima_CBS_524.5 CGGCAACAGCTCAAATTTGAAATCTGGCCCTTTC------AGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGT?GGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGC-CAGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCATCCGGGCTTTT-GCCCGGTGCACTCTTCTATGGGCAGGCCAGCATCAGTCCCAGCGGTTGG-ATAAATGTCTGTTGAACGTACCTCTCTTCGGGGAGGACTTATAGCTTCAGGCGGCATACAACCAGCCGGGATTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Thyridaria.rubronotata_CBS_419.85 CGGCAACAGCTCAAATTTGAAATCTGGCTCTTTT------AGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTTGGCGTTGGCAGCAGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGCTGC-ATGTCTTCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTCACCCGGGCTCTT-GCCTGGGGCACTCTTCTACGGGTAGGCCAGCATCAGTTTGGGCGGCTGG-AGAAAGGCCTCTGTCACGTATCTCCCTCCGGGGTGACCTTATAG-GGGAGGCGTAATGCAGCCAGCTCAGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCTTC------------GGGGGCACCATCGACCGATCCTGATGTCTT-GGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAAGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Trematosphaeria.pertusa_CBS_122368 CGGCAACAGCTCAAATTTGAAATCTGGCCCTCCTTCTTGGGGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGTTGGTGGCGGTCTAAGTTCCTTGGAACAGGCCATCGCAGAGGGTGAGAATCCCGTATGTGGTCGC-CCGCCTTCGCCGTGTAAAGCCCCCTCGACGAGTCGCGTTGTTTGGGAATGCAGCGCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGTCTGCGGTTGCTCAGCCGGGCTCCC-CCCCGGTGCACTCTTCCGCAGGCAGGCCAGCATCAGTTTGGGCGACTGGTAGAAAGACCTCTGTCACGTATCTTCCTTCGGGATGACCTTATAG-GGGAGGTGTAATGCAGCCAGCCTGGACTGAGGGACCGCGCTTCGGCGAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGGGCGCGCAATGAAAGTAAACGGAGGTGGGAACCCCTCCTTGCGGGGGGGGCGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Trematosphaeria.pertusa_CBS_400.97 CGGCAATAGCTCAAATTTGAAATCTGGCTCTTTC------AGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGTGTCGGCAGCGGCCTAAGTTCCTTGGAACAGGTCATCATAGAGGGTGAGAATCCCGTATGTGGCTGC-TTGTCTTCACCGTGTAAAGCCCCTTCGATGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACGTGCCCGTAGTTGCTCATCTGGGGATTT-CCCCAGTGCACTCTTCTATGGGCAGGCCAGCATCAGTTCGGGCGGTTGG-AGAAAGACCTGTGTCACGTAGCTCTCTTCGGGG-AGTGTTATAG-GGCAGGTGGAATGCAACCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCCTC-G--------GGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT Westerdykella.ornata_CBS_379.55 CGGCAACAGCTCAAATTTGAAATCTGGCCCTCTC------AGGGTCCGAGTTGTAATTTGCAGAGGGTGCTTTGGCGATGGCTGTGGTCTAAGTTCCTTGGAACAGGACGTCGCAGAGGGTGAGAATCCCGTATGTGGCCGC-CAGCCTACGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCCTGTAGTTGCTTACCAGGGCTCTT-GCCCTGGGCACTCTTCTGCGGGCAGGCCAGCATCAGTCCGGGCGGTTGG-ATAAATGCCTTCTGCATGTACCTCTCTTCGGGGAGGACTTATAGGGGTTGGCGCCATACAGCCAGCCTGGACTGA-GGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTGAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGAACCCCTC---------GGGGTGCACCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGT ; END; BEGIN TREES; TITLE LSU_ITS; LINK TAXA = Taxa2; TRANSLATE 1 Phoma_violicola_CBS_100272, 2 Phoma_carteri_CBS_101633, 3 Pyrenochaetopsis_leptospora_CBS_101635, 4 Phoma_septicidalis_CBS_101636, 5 Phoma_pimpinellae_CBS_101637, 6 Phoma_korfii_CBS_101638, 7 Neophaeosphaeria_filamentosa_CBS_102202, 8 Phoma_carteri_CBS_105.91, 9 Leptosphaeria_hendersoniae_CBS_113702, 10 Leptosphaeria_libanotis_CBS_113795, 11 Leptosphaeria_macrospora_CBS_114198, 12 Leptosphaeria_praetermissa_CBS_114591, 13 Phoma_heteromorphospora_CBS_115.96, 14 Leptosphaeria_biglobosa_CBS_119951, 15 Phoma_wasabiae_CBS_120119, 16 Phoma_wasabiae_CBS_120120, 17 Leptosphaeria_collinsoniae_CBS_120227, 18 Phoma_agnita_CBS_121.89, 19 Phoma_intricans_CBS_139.78, 20 Phoma_enteroleuca.enteroleuca_CBS_142.84, 21 Phoma_enteroleuca.influorescens_CBS_143.84, 22 Phoma_sclerotioides_CBS_144.84, 23 Phoma_veronicicola_CBS_145.84, 24 Phoma_sclerotioides_CBS_148.84, 25 Phoma_acuta_phlogis_CBS_155.94, 26 Phoma_dimorphospora_CBS_165.78, 27 Phoma_septicidalis_CBS_188.71, 28 Phoma_rubefaciens_CBS_223.77, 29 Phoma_congesta_CBS_244.64, 30 Phoma_lupini_CBS_248.92, 31 Pyrenochaeta_cava_CBS_257.68, 32 Phoma_lingam_CBS_260.94, 33 Pyrenochaeta_lycopersici_CBS_267.59, 34 Phoma_drobnjacensis_CBS_269.92, 35 Phoma_drobnjacensis_CBS_270.92, 36 Phoma_lingam_CBS_275.63, 37 Phoma_apiicola_CBS_285.72, 38 Pyrenochaetopsis_pratorum_CBS_286.93, 39 Leptosphaeria_nitschkei_CBS_306.51, 40 Phoma_violicola_CBS_306.68, 41 Phoma_dimorphospora_CBS_345.78, 42 Phoma_multipora_CBS_353.65, 43 Cucurbitaria_berberidis_CBS_363.93, 44 Phoma_conferta_CBS_375.64, 45 Phoma_macdonaldii_CBS_381.67, 46 Phoma_sydowii_CBS_385.8, 47 Phoma_macdonaldii_386.8, 48 Phoma_rubefaciens_CBS_387.8, 49 Phoma_leonuri_CBS_389.8, 50 Phoma_pedicularis_CBS_390.8, 51 Coniothyrium_palmarum_CBS_400.71, 52 Pyrenochaeta_nobilis_CBS_407.76, 53 Leptosphaeria_fallaciosa_CBS_414.62, 54 Pyrenochaetopsis_pratorum_CBS_445.81, 55 Phoma_heteromorphospora_CBS_448.68, 56 Phoma_valerianae_CBS_499.91, 57 Phoma_multipora_CBS_501.91, 58 Phoma_apiicola_CBS_504.91, 59 Leptosphaeria_doliolums_doliolum_CBS_505.75, 60 Phoma_vasinfecta_CBS_539.63, 61 Phoma_acuta_acuta_CBS_541.66, 62 Phoma_tracheiphila_CBS_551.93, 63 Phoma_herbarum_CBS_615.75, 64 Phoma_doliolum_CBS_616.75, 65 Phoma_acuta_errabunda_CBS_617.75, 66 Phoma_valerianae_CBS_630.68, 67 Phoma_macrocapsa_CBS_640.93, 68 Leptosphaeria_dryadis_CBS_643.86, 69 Phoma_enteroleuca_enteroleuca_CBS_831.84, 70 Phoma_septicidalis_CBS_856.97, 71 Leptosphaeria_biglobosa_DAOM_229269, 72 Pyrenochaeta_dolichi_IMI_217261, 73 Pyrenochaeta_dolichi_IMI_217262, 74 Phoma_glycinicola_IMI_294986, 75 Phoma_tracheiphila_CBS_127250, 76 Phoma_enteroleuca_influorescens_PD73.1382, 77 Plectophomella_visci_CBS_122783, 78 Phoma_veronicicola_CBS_126583, 79 Phoma_acuta_errabunda_CBS_125978, 80 Phoma_leonuri_CBS_125975, 81 Phoma_pedicularis_CBS_126582, 82 Phoma_acuta_phlogis_CBS_125979, 83 Phoma_agnita_CBS_126584, 84 Phoma_doliolum_CBS_125977, 85 Phoma_sydowii_CBS_125976, 86 Phoma_etheridgei_CBS_125980, 87 Phoma_glycinicola_CBS_124141; TREE Figure_2 = [&R] (63:0.31681,((3:0.07904,(38:0.002094,54:0.002012)1.00:0.132795)1.00:0.106346,(31:0.092823,43:0.04995)0.99:0.019773,52:0.051277)0.91:0.05144,(((((1:0.001441,40:0.00137)1.00:0.014317,((34:0.001509,35:0.002922)1.00:0.022551,((37:0.001576,58:0.001459)1.00:0.034504,(56:0.001533,66:0.001613)1.00:0.055129)0.61:0.012337)0.66:0.008482)0.77:0.008856,(((5:0.009756,(14:0.00129,71:0.002527)1.00:0.007011,(15:0.00131,16:0.001298)0.94:0.003611)1.00:0.044333,(9:0.003748,19:0.001426)0.94:0.006594,(10:0.02315,(29:0.072309,(60:0.001365,62:0.001427,75:0.001456)1.00:0.049545)0.98:0.028144)0.56:0.011718,(17:0.022963,((((18:0.001452,83:0.003836)1.00:0.011399,53:0.001565)1.00:0.018341,30:0.039161)1.00:0.052909,77:0.066074)0.99:0.022246,((21:0.0015,76:0.001397)1.00:0.024419,(45:0.001521,47:0.001469)1.00:0.050329)1.00:0.017409)0.83:0.016371,(32:0.003318,36:0.001677)1.00:0.104135,44:0.034891)0.67:0.014654,(20:0.001324,69:0.001317)1.00:0.020435)1.00:0.059616,(6:0.03689,((11:0.019613,39:0.016494)1.00:0.017504,(12:0.010033,68:0.005814)1.00:0.009644)1.00:0.010496)0.99:0.016448,((13:0.001815,55:0.001897)1.00:0.035396,(26:0.001596,41:0.001469)1.00:0.014163)1.00:0.093372)0.71:0.016894,(((((((22:0.001525,24:0.003807)1.00:0.011536,(64:0.001483,84:0.00147)1.00:0.012787)0.98:0.009117,((((23:0.004194,78:0.003064)0.91:0.002664,59:0.001397,61:0.001401,82:0.001465)0.98:0.002689,25:0.002779)0.82:0.00415,((46:0.002754,85:0.001485)1.00:0.008904,(65:0.001494,67:0.001427,79:0.001504)1.00:0.016341)1.00:0.010494)1.00:0.023116)0.62:0.007231,(49:0.002812,80:0.002901)1.00:0.02968)0.92:0.018662,(50:0.001696,81:0.001824)1.00:0.041898)1.00:0.159918,(28:0.001479,48:0.001373)1.00:0.042052)0.87:0.017943,86:0.037855)0.90:0.012132)0.70:0.011119,(((((2:0.002722,8:0.001471)1.00:0.022628,((72:0.001456,73:0.001445)0.92:0.00638,(74:0.004102,87:0.002676)1.00:0.016489)1.00:0.051829)0.64:0.007953,51:0.093137)0.64:0.007554,((4:0.025935,(27:0.001565,70:0.001655)0.97:0.009191)1.00:0.032712,(42:0.0015,57:0.001527)1.00:0.042311)0.96:0.01696)1.00:0.028608,7:0.14503)0.51:0.015094,33:0.097118)0.53:0.025863); END; BEGIN TREES; TITLE Pleosporaceae_ACT; LINK TAXA = Taxa1; TRANSLATE 1 Phoma.betae_CBS_109410, 2 Phoma.betae_CBS_523.66_, 3 Ascochyta.hyalospora_CBS_206.80_, 4 Ascochyta.caulina_CBS_344.78_, 5 Ascochyta.caulina_CBS_246.79_, 6 Ascochyta.caulina_CBS_343.78_, 7 Ascochyta.obiones_CBS_786.68, 8 Ascochyta.obiones_CBS_432.77, 9 Coniothyrium.obiones_CBS_453.68_, 10 Phoma.typhina_CBS_132.69_, 11 Phoma.typhina_CBS_602.72_, 12 Phoma.fallens_CBS_161.78_, 13 Phoma_glaucispora_CBS_284.7, 14 Pleospora.herbarum_CBS_191.86_, 15 Phoma.incompta_CBS_467.76_, 16 Phoma_incompta_CBS_526.82, 17 Leptosphaeria.clavata_CBS_296.51_, 18 Phoma.flavigena_CBS_314.8_, 19 Phoma.lingam_CBS_147.24_, 20 Phoma.lingam_CBS_260.94_; TREE Figure_4 = [&R] (20:0.005161,19:0.006069,(((((1:0.020023,2:0.012274)0.99:0.050539,(3:0.007022,4:0.006561)1.00:0.05976,5:0.00632,6:0.006317,(7:0.006885,8:0.007278)0.70:0.011305)0.99:0.131823,9:0.100123)0.52:0.049934,(((10:0.00513,11:0.005422)1.00:0.332964,(14:0.278387,(15:0.005176,16:0.005692)0.99:0.07276)0.69:0.048428)0.52:0.044234,((12:0.025519,13:0.014575)1.00:0.205553,17:0.243903)0.79:0.071183)0.88:0.097354)0.75:0.136797,18:0.207573)1.00:0.735168); END; BEGIN TREES; TITLE Outgroup_LSU; LINK TAXA = Taxa3; TRANSLATE 1 Paraconiothyrium.CBS_101461, 2 Coniothyrium.fuckelii_CBS_797.95_, 3 Phoma.lini_CBS_253.92, 4 Paraphaeosphaeria.michotii_CBS_652.86, 5 Paraconiothyrium.minitans_CBS_122788_, 6 Paraconiothyrium.minitans_CBS_122786, 7 Plenodomus.fuscomaculans_CBS_116.16, 8 Asteromella.tiliae_CBS_265.94, 9 Neottiosporina.paspali_CBS_331.37, 10 Pleurophoma.pleurospora_CBS_116668, 11 Pleurophoma_CBS_130329, 12 Phoma_flavescens_CBS_178.93_, 13 Pyrenochaeta.romeroi_CBS_252.60, 14 Pyrenochaeta.romeroi_CBS_122784, 15 Pyrenochaeta.mackinnonii_CBS_110022, 16 Pyrenochaeta.mackinnonii_CBS_674.75, 17 Massaria.platani_CBS_221.37, 18 Roussoella.hysterioides_CBS_125434, 19 Phoma.capitulum_CBS_337.65, 20 Phoma.minutispora_CBS_509.91, 21 Sporormiella.minima_CBS_524.5, 22 Byssothecium.circinans_CBS_675.92, 23 Herpotrichia.juniperi_CBS_200.31, 24 Beverwykella.pulmonaria_CBS_283.53, 25 Pyrenochaeta.CBS_350.82, 26 Aposphaeria.populina_CBS_543.70, 27 Aposphaeria_populina_CBS_130330, 28 Trematosphaeria.pertusa_CBS_400.97, 29 Pleurophoma._CBS_131286, 30 Pleurophoma._CBS_131287, 31 Pleomassaria.siparia_CBS_279.74, 32 Massaria.eburnea_CBS_473.64, 33 Massaria.eburnea_H_3953, 34 Thyridaria.rubronotata_CBS_419.85, 35 Pseudorobillarda_phragmitis_CBS_398.61, 36 Falcisormispora.lignatilis_BCC21118, 37 Melanomma.pulvispyrius_CBS_371.75, 38 Preussia.funiculata_CBS_659.74, 39 Westerdykella.ornata_CBS_379.55, 40 Trematosphaeria.pertusa_CBS_122368; TREE Figure_5 = [&R] (35:0.447224,(15:0.006825,16:0.005137)0.95:0.039412,((((((((((1:0.007201,8:0.037519)0.82:0.007539,2:0.002505)0.57:0.003803,7:0.024165)0.97:0.007524,3:0.008728)0.94:0.0062,5:0.006629,6:0.002331)0.97:0.014451,4:0.009952)0.99:0.022563,(9:0.039137,22:0.020842,(32:0.00362,33:0.004143)0.99:0.07267)0.94:0.014931,(10:0.009871,11:0.010568)0.99:0.032039,12:0.054715)0.55:0.01383,((13:0.00358,14:0.002474)1.00:0.036129,(36:0.058322,40:0.075258)0.99:0.025318)0.91:0.017391,17:0.049993)0.62:0.017191,34:0.061357)0.83:0.021231,18:0.061733,((((19:0.007457,39:0.028553)0.99:0.015076,20:0.042486)0.99:0.030241,(21:0.031062,38:0.052517)0.92:0.016093)0.99:0.038272,((23:0.008252,((25:0.002417,26:0.002656,27:0.002703)0.99:0.006472,28:0.002679,37:0.002497)0.98:0.008682)0.86:0.01191,24:0.011069,(29:0.002769,30:0.002798)0.92:0.010077,31:0.038128)0.99:0.077295)0.73:0.032472)0.64:0.033442); END; BEGIN TREES; TITLE ssu_lsu; LINK TAXA = Taxa5; TRANSLATE 1 Ascochyta.caulina_CBS_246.79, 2 Ascochyta.hyalospora_CBS_206.8, 3 Ascochyta.obiones_CBS_432.77, 4 Phoma.betae_CBS_523.66, 5 Phoma.carteri_CBS_105.91, 6 Chaetosphaeronema.hispidulum_CBS_216.75, 7 Cocliobolus.sativus_DAOM226212, 8 Coniothyrium.fuckelii_CBS_797.95, 9 Coniothyrium.palmarum_CBS_400.71, 10 Phoma.cucurbitacearum_CBS_133.96, 11 Cucurbitaria.berberidis_CBS_363.93, 12 Didymella.exigua_CBS_183.55, 13 Phoma.dimorphospora_CBS_165.78, 14 Phoma.doliolum_CBS_616.75, 15 Phoma.drobnjacensis_CBS_269.92, 16 Phoma.glycinicola_CBS_124455, 17 Phoma.herbarum_CBS_615.75, 18 Phoma.heteromorphospora_CBS_448.68, 19 Phoma.leonuri_CBS_389.8, 20 Leptosphaeria.biglobosa_CBS_119951, 21 Leptosphaeria_doliolum_doliolum_CBS_505.75, 22 Phoma.lingam_CBS_275.63, 23 Phoma.lycopersici_CBS_378.67, 24 Neophaeosphaeria.filamentosa_CBS_102202, 25 Neosetophoma.samarorum_CBS_138.96, 26 Neottiosporina.paspali_CBS_331.37, 27 Paraconiothyrium.minitans_CBS_122788, 28 Paraphaeosphaeria.michotii_CBS_652.86, 29 Paraphoma.radicina_CBS_111.79, 30 Phoma.paspali_CBS_560.81, 31 Phaeosphaeria.nodorum_CBS_110109, 32 Plectophomella.visci_CBS_122783, 33 Pleospora.herbarum_CBS_191.86, 34 Pyrenochaeta.cava_CBS_257.68, 35 Pyrenochaeta.dolichi_CBS_124140, 36 Pyrenochaeta.lycopersici_CBS_267.59, 37 Pyrenochaeta.mackinnonii_CBS_674.75, 38 Pyrenochaeta.nobilis_CBS_407.76, 39 Pyrenochaeta.romeroi_CBS_252.6, 40 Pyrenochaetopsis.leptospora_CBS_101635, 41 'Pyrenophora tritici-repentis OSC100066', 42 Phoma.septicidalis101636, 43 Setomelanomma.holmii110217, 44 Setophoma_terrestris_335.29, 45 Sporormiella.minima524.5, 46 Phoma.tracheiphila551.93, 47 Phoma.typhina132.69, 48 Phoma.vasinfecta539.63; TREE Figure_1 = [&R] (45:0.046346,37:0.026908,((((((1:8.7E-4,2:0.00166,3:8.75E-4)1.00:0.004882,4:0.001891)0.99:0.005124,(((7:0.003019,33:0.004716)1.00:0.012701,41:0.018425)1.00:0.022516,47:0.031888)1.00:0.028116)1.00:0.009271,((5:0.004956,(16:0.004018,35:0.001073)1.00:0.011427)0.93:0.003407,42:0.008974)0.77:0.003918,((6:0.028074,25:0.004576,31:0.006694,44:0.032043)0.88:0.003017,(29:0.003789,43:0.0038)0.80:0.00253)1.00:0.009009,9:0.007589,((((11:0.006759,34:0.016169)0.68:0.002391,(38:0.00221,40:0.019443)0.81:0.002709)0.99:0.003486,36:0.008493)1.00:0.005211,(14:0.00102,(19:0.00175,21:0.001746)0.89:0.001624)1.00:0.014035)0.54:0.003772,(((((13:0.003381,18:0.009317)1.00:0.005684,15:0.007804)0.64:0.005102,22:0.005835)0.56:0.002388,20:0.005116)0.60:0.00331,32:0.01021,(46:8.82E-4,48:8.49E-4)1.00:0.00459)0.57:0.003559,24:0.016682)0.81:0.008519,(((10:0.004689,23:0.005616)1.00:0.005885,12:0.00275,17:0.001286)1.00:0.012552,30:0.019791)1.00:0.013683)0.99:0.022946,(((8:0.004009,(27:0.003594,28:0.007689)1.00:0.008223)1.00:0.023412,26:0.03922)1.00:0.028465,39:0.023614)0.97:0.007925)1.00:0.026596); END; BEGIN TREES; TITLE Acuta_ITS_ACT_TUB_CHS; LINK TAXA = Taxa4; TRANSLATE 1 Phoma.veronicicola_CBS_145.84, 2 Phoma.acuta_phlogis_CBS_155.94, 3 Phoma.acuta_CBS_297.51, 4 Phoma.sydowii_CBS_385.80, 5 Phoma.pedicularis_CBS_390.80, 6 Leptosphaeria.doliolum_doliolum_CBS_505.75_, 7 Phoma.acuta_errabunda_CBS_541.66_, 8 Phoma_acuta_var_errabunda_CBS_617.75, 9 Phoma_macrocapsa_CBS_640.93b, 10 Phoma.veronicicola_CBS_126583_, 11 Phoma.acuta_acuta_CBS_504.75_, 12 Phoma.acuta_errabunda_CBS_125978_, 13 Phoma.acuta_phlogis_CBS_125979_, 14 Phoma.acuta_errabunda_CBS_129999, 15 Phoma.acuta_errabunda_CBS_129997, 16 Phoma.acuta_acuta_CBS_130000, 17 Phoma.acuta_errabunda_CBS_129998, 18 Phoma.sydowii_CBS_125976_; TREE Figure_3 = [&R] (5:0.141115,(1:0.005864,10:0.005349)0.99:0.019512,(((2:0.01148,((11:0.00248,16:0.002661)0.99:0.003976,13:0.002556)0.92:0.003251)0.97:0.004627,6:0.003772,7:0.002665)0.99:0.01514,(((3:0.003451,18:0.002878)0.83:0.003273,4:0.007024)0.99:0.01854,(8:0.003321,9:0.006129,12:0.00302,14:0.00297,15:0.002985,17:0.002964)0.99:0.023789)0.98:0.010153)0.52:0.004685); END;