#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 18:49 GMT TreeBASE (cc) 1994-2008 Study reference: Divakar P.K., Del-prado R., Lumbsch H.T., Wedin M., Esslinger T.L., Leavitt S., & Crespo A. 2012. Diversification of the Newly Recognized Lichen Forming Fungal Lineage Montanelia (Parmeliaceae, Ascomycota) and its Relation to Key Geological and Climatic Events. American Journal of Botany, 99(12): 2014-2026. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13517] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=61; TAXLABELS Austroparmelina_endoleuca_AENDO69 Austroparmelina_macrospora_AMACROS Austroparmelina_pruinata_CPRUINA Austroparmelina_pseudorelicina_APSE1159 Bulbothrix_apophysata_BUAP1895 Cetraria_hepatizon_CETRHEPA Cetraria_islandica_CETRISLA Cetrariastrum_andense_CEAN199 Cetrariastrum_dulitense_CEDU200 Cetrariella_delesei_CETRDELI Emodomelanelia_masonii_PAMA286 Emodomelanelia_masonii_PAMA287 Everniastrum_nepalense_ENEPAL Flavocetraria_nivalis_FLAVNIVA Flavoparmelia_marchantii_FMARCHAN Flavoparmelia_soredians_FSORED2 Melanelia_disjuncta_MDISJUNCT Melanelia_disjuncta_MEDI637 Melanelia_hepatizon_MEPA1075 Melanelia_panniformis_MEPA1080 Melanelia_panniformis_MEPA1086 Melanelia_soreidata_MESO1076 Melanelia_soreidata_MESO773 Melanelia_soreidata_MESO778 Melanelia_stygia_MSTYGIA Melanelia_tominii_METO776 Melanelixia_fuliginosa_MFULIG3 Melanelixia_fuliginosa_MFULIU11 Melanelixia_fuliginosa_MGLABRAT3 Melanelixia_glabra_MGLABRA2 Melanelixia_glabratuloides_MGLABRTU Melanelixia_pilliferella_MPILIFE Melanelixia_subaurifera_MSUBAURI3 Melanelixia_subaurifera_MSUBAUSA Melanelixia_subaurifera_MSUBAUUK Melanelixia_sugblabra_MSUBGLAB Melanelixia_villosella_MEVI771 Melanohalea_elegantula_MEXASP3 Melanohalea_elegantula_MSP5 Melanohalea_exasperata_MEXASP4 Melanohalea_exasperatula_MEXTULUS Melanohalea_olivacea_MOLIVACEA Melanohalea_septentrionalis_MSEPTEM Melanohalea_subelegantula_MSUBELE Melanohalea_subolivacea_MSUBOLI6 Melanohalea_trabeculata_METR1078 Myelochroa_irrugans_MIRRUGAN Parmelia_saxatilis_PARMSAXA Parmelia_serrana_PSERRAN2 Parmeliopsis_hyperopta_PHYPEROP Parmotrema_reticulatum_RCLAVUL Parmotrema_subtinctorium_CSUBTIN Pleurosticta_acetabulum_PACETA2 Relicina_sydneyensis_RESY663 Remototrachyna_crenata_HCRENATA Tuckermanopsis_chlorophylla_CETRCHLO Vulpicina_pinastri_VULPPINA Xanthoparmelia_isidiovagans_XNEGRA Xanthoparmelia_ovealmbornii_XOVEALBO Xanthoparmelia_stenophylla_XSOMLOEN Xanthoparmelia_tinctina_XTINC8 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15914] TITLE 'Montanelia ITS, nuLSU, mtSSU, MCM7'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2573; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Austroparmelina_endoleuca_AENDO69 ATCATTATTGAGAGAGGGGCCTCGCGCTCCCGGGGACTTCGGTCCCCAACTCTTCACCCTTTGTGTACCTTTGTTGCTTTGGCGGGCCATGCCCGCGCCGGCCTTCGGGTCGGCGAGTGCCCGTCAGAGGCCTATTTAATCCTTTTATCTCGTCCGAGTATACATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATCAATCCCGCTTTGAAAGCGCCGCGGCTGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGATCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGCATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACCTGCCCGCAGGGGATCATCCGCTGTTCTCAGTGGTGTACTC-TCCTGTGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTACCTCTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTGTGCAAGTGTTTGGGCGTTAAACCCATGCGCGGAGTGAAAGCAAACGGAGGTGAGAACCCGTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCACAGCTGGTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTACGGTGGGGCTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTATAATACCTTTTTT-------AAAATAATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTATGTAACAAACAGGATTAGATACCCTATTAGTTTAAGCAGAAAATGATGAATGTCATAGATTAGATGTATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATACCCCGCAAAAAACCTTACCACAACTTGAATATTTATATTTATTTTTTTCTATTAATTTTAATTAAGGCAATAAGATATTTTTACAAGTGTTGCACGGCTGTCTTCAGTTAATGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATCGATGTGGATGTGAAATATTTCAGCCGGTCACGTCAAAGCAATTTACTCCAATGACGGAGTGCCCCTCAGAAGAATGCAAGCAGAACAACTCCAAGGGCCAATTATTTCTGTCAACGCGAGCGTCAAAGTTCTTACCATTCCAAGAAGTCAAGATACAGGAGATGGCCGATCAAGTACCGGTTGGCCATATTCCTCGGACACTAACTGTTCACTGCCATGGAACCTTGACGAGACAGATCAATCCTGGCGACGTAATCGATGTTGCCGGAATCTTCCTTCCGACCCCATACACAGGATTCAAAGCTATCCGTGCCGGCCTTCTGACAGATACCTACCTGGAAGCTCAACATGTCAATCAACACAAAAAAGCATATGATGATTTGGCCTTTGATGCCAAGACGTTCCGCAGAATTGAGAAATACAAGCATTCTGGTCATATGTATGAGTACCTCTCAAGGTCCATCGCTCCAGAGATCTACGGTCACATGTGAAGAAAGCGCTTCTGCTGTTGATCGGTGTCACAAATGGGCGACGGAAT Austroparmelina_macrospora_AMACROS ATCATTACTGAGAGAGGGGCCACGCGCTCCCGGGGAC-TCGGTCCCCAACTCTTCACCCTATGTGTACCTTTGTTGCTTTGGCGGGCCTCGCCCGCGCTGGCTTTCGGGCTGGCGAGCGCCCGTCAGAGGCCCATTTAATTCTTTTATCTTGTCCGAGTAAACACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGATTTAAGCGTAGTAAATATCTCCCGCTTTGAAAGCGTCGTGATCGGCCAAACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGAGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGATCGCGGTCTAAGTCCATTGGAACATGGCGTCTGAGAGGGTGAGAGCCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTATCTCCGGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCATAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAAGGAATGTATAGCAATAGCTACTTGCATCAGTTGAAGGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGTACTAATTTACTAGAGTTACTTACGGTGGGGCATTAAAGTACTGTTGGTGTAGAGATGAAATTCTATCATACCTCTTTTCGAAGAAAAAATCATGGCACTGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTATTAGTTGAAGCAGAAAATGATGAATGTCATAGACTAGATATCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAACCCGCAAAAAACCTTACCACAACTTGAATATTTATATTTATTTTTTTTCTTTTTTTTAAAATAAGGCAAAAAGATATTTTTACAAGTGTTGCACGGCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGATCGATGTGGTTGCGAGATATTTCAGCCTGTTACGTCGAAGCAATTTACTCCGATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGACAGTTATTTCTGTCAACGCGAGCGTCAAAGTTCTTGCCATTCCAAGAAGTCAAGATACAGGAGATGGCCGATCAGGTACCGGTTGGCCATATTCCTCGGACACTGACTGTTCACTGTCATGGGACCTTGACGAGACAGATCAATCCTGGCGACGTGATCGATGTTGCCGGAATCTTCCTTCCAACCCCGTACACAGGCTTCAAAGCCATCCGTGCTGGCCTTCTGACTGATACCTATCTGGAAGCGCAACATGTCAATCAACACAAAAAAGCATATGATGATTTGGTCTTTGATGCCAAGACGTTCCGTAGAATCGAGAAGTACAAGCATTCCGGTCACATGTACGAGTACCTCTCAAAGTCCATCGCTCCAGAAATCTATGGTCACACGTGAAGAAAGCGCTTCTGCTGCTGATCGGTGTCACAAATGGGCGACGGAAT Austroparmelina_pruinata_CPRUINA NNNNNNACTGAGAGAGGGGCCATGCGCTCCCGGGGACTTCGGTCCCCAACTCTTCACCCTATGTGTACCTTTGTTGCTTTGGCGGGCCCCGCCCGCGCTGGCTTTCGGGCTGGCGAGCGCCCGTCAGAGGCCCATTTAATTCTTTTATCTCGTCCGAGTAAACACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTCTGAAAGCGTCGTGATCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGAGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGATCGCGGTCTAAGTCCATTGGAACATGGCGTCTGAGAGGGTGAGAGCCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCCCTACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTATCTCCGGGAGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGCAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATAAGGAATGTATAGCAATAGCTACTTGCATCAGTAGAAGGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAACACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGTACTAATTTACTAGAGTTACTTACGGTGGGGCATTAAAGTACTATTGGTGTAGAGATGAAATTCTATGATACCT-CTTTCGAAAGAAAAATCATGGCACTGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTATTAGTTGGAGCAGAAAATGATGAATGTCATAGACTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAACCCGCAAAAAACCTTACCACAACTTGAATATTTATATTTATTTTATTTCTTT----------AGAACAAGAACATATCTTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTGTGGTTAGTTCCATT-AATTAACGTAAACCCTTACTTTATTTTTACATAGAGTAGTCCCCGCTATATTGGTGCGATCGATGTGGTTGCGAGATATTTCAGCCTGTCACGTCGAAGCAATTTACTCCAATGACGGAATGCCCCTCAGA{AC}GAATGCAAGCAGAACAACTCCAAGGGACAGTTATTTCTGTCAACGCGAGCGTCAAAGTTCTTGCCATTCCAAGAAGTCAAGATACAGGAGATGGCCGATCAAGTACCGGTTGGCCATATTCCTCGGACACTGACTATTCATTGTCATGGGACCTTGACGAGACAGATCAATCCTGGCGACGTAATCGATGTTGCCGGAATCTTCCTTCCAACCCCGTACACAGGCTTCAAAGCCATCCGTGCTGGCCTTCTGACAGATACCTATCTGGAAGCGCAACATGTCAATCAACACAAAAAAGCATATGACGATTTGGTCTTTGATGCCAATACGTTCCGTAGAATCGAGAAGTACAAACATTCCGGTCACATGTACGAGTACCTCTCAAAGTCCATCGCTCCAGAAATCTACGGTCACACGTGAAGAAAGCGCTTCTGCTGTTGATAGGTGTCACAAATGGGCGACGGAAT Austroparmelina_pseudorelicina_APSE1159 ATCATTACTGAGAGAGGGGCCTCGCGCTCCCGGGGACTTCGGTCCCCAACTCTTCACCCTTTGTGTACCTCTGTTGCTTTGGCGGGCCTTGCCCGCGTTGGCTTTCGGGCCGGCGAGCGCCCGTCAGAGGCCCATTTAATTCTTTTATCTCGTCCGAGTAAACACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATATCTCCCGCTTTGAAAGCGCCGCGATCGGCCAGACAACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGATCGCGGTCTAAGTCCATTGGAACATGGCGTCTGAGAGGGTGAGAGCCCCGTATGTGACCGTGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGTGGTGCACTCGCCCTACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTATCTCCGGGAGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGATTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCAAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGGTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGAGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTNCGGTGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGCAAGAAAAATCATGGCACAGGTACAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTATTAGTTGAAGCAGAAAATGATGAATGTCATAGACTAGATAGATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAACCCGCAAAAAACCTTACCACAACTTGAATATTTATATTTATT-TTTTTTCTTGTTTTTAATCAAGGCAAGAACATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTGTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGATCGATGTGGTTGCGAGATATTTCAGCCTGTCACGTCGAAGCAATTTACTCCGATGACGGAATGCCCTTCAGACGAATGCAAGCAGAACAACTCCAAGGGACAGTTGTTTCTGTCAACGCGAGCGTCAAAGTTCTTGCCATTCCAAGAAGTTAAGATACAGGAGATGGCCGATCAAGTCCCGGTTGGCCATATTCCTCGGACACTGACTGTTCACTGTCATGGGACTTTGACAAGACAGATCAATCCTGGCGACGTAATCGATGTTGCCGGAATCTTCCTTCCAACCCCGTACACAGGCTTCAAAGCCATCCGTGCTGGCCTTCTGACAGATACCTATCTGGAAGCGCAACATGTCAATCAACACAAGAAAGCATATGATGATTTGGTCTTTGATGCCAAGACGTTCCGTAGAATCGAGAAGTATAAGCATTCCGGTCACATGTACGAGTACCTCTCAAAGTCCATCGCTCCAGAAATCTATGGTCACACGTGAAGAA{AG}GCGCTTCTGCTATTGATCGGGGTCACAAATGGGGNNNNNNNN Bulbothrix_apophysata_BUAP1895 ATCATTACCGAGAGGGGAGCCCTGGGCTCCCGGGGGCTTCGGCCCTATACTCCTCACCCTCTGTATACATCTGTTGCTTTGGCGGGCATCG---------GCCTCCAGGCCGGTAAGCGCCCGTCAGAGACCCACGATATCCGTTTAATGTGTCCGAGTAGAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCTCGGTATTCCGGGGGGCATACCTGTTCGAGCGTCATTACACCTCTCAAGCCATGCTTGGTCTTGGGGTTCGCCGCGTGGCGTGCCTGAAAAGTGGCGGCCCAGTTCGGGCGTATTAAAATTACAACGCAGTGAAGACGTCGTGGTCGGCCAAGTAACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGTCT-AGTCTATTGGAACATAGCGTCATAGAGGGTGAGAATCCCGTCTGTGGCCGCCATTCGATCCCATGTGAAACCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCGCGTGGGTGATCAGCCGCTGTTCTCAGCGGTGTACTCGCCCTACGATCAGGCCAGCATCGGTTTCGGCGGTTGGATAAAGGCCTTGGGAACGTAGCTCTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCAGCCAGTCGAGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGACCCCTGGAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATTGCTACTTGCATCATTCTAAAAATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTTTGATAATGACATTATCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTAGGACTAATCTGCTAGAGTTACTTCTGAGGGGGCTATAAAGTACTAATGGTGTAGAGATGAAATTCTGTGATACCTTTTTTCGAAAGAAAAGCTATGGCACGGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTATAACGAACAGGATTAGATACCCTGGTAGTTGAGGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGACAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTGTTTTTATCTCATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTATGGTTAGCTCCATT-AATTAACGTAAACCCTTACTTTATTTTTATATAAAGTAGTCACCACTATATTGGTGTGATCGATGTGGCTGCGAAATATTCCAACCTGTCACTTCCAAGCAATTCACCCCAATGACAGAATGCCCGTCAGAGGAATGCCGACAGAACAACTCCAAGGGTCAGTTATTTCTGTCGACGCGAGCATCCAAGTTCCTACCATTCCAAGAAGTTAAGATACAGGAGATGGCAGACCAGGTACCCGTTGGCCATATCCCTCGAACACTGACTGTACATTGCCATGGAACCTTGACGAGACAAATCAATCCGGGCGACGTCATCGATGTTGCGGGAATCTTCCTTCCTACCCCATACACAGGCTTCCAAGCTATTCGGGCTGGTCTTCTGACGGATACCTACCTGGAAGCCCAACATGTTAACCAACACAAAAAGGCGTACGATGACCTGATCTTTGATGCCAAGATGTTCCGAAGAATCGAGCAGTACAAGCATTCTGGTCATATGTATGAATACCTCTCGAGGTCCATCGCTCCGGAAATATATGGTCATATGTGAAGAAAGCGCTTCTGCTCCTGATTGGTGTAACAAATGGGTGACGGTAT Cetraria_hepatizon_CETRHEPA NNNNNNACTGAGAGAGGAGCTTCGCGCTCCCAGGGGTCTCA-TCCCCAACTCTTCACCCATTGTCTATCTTTGTTGCTTTGGCGGACCCCGCTCGCGTCGGCTTTCAGGTCGGCGAGCGCCCGTCAGAGGCTCATTAAATTCTTTTATCATGTCCGAGCGAAACCAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTGTTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGCTTTAAGCGTAGTAAATTCATCCCGCTTTGAAAGCGCCGTGACCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCACAGAGGGTGAGAATCCCGTACGTGACCGTGGCTTGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTCAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCTGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATAATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCAAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTTTTAATTATAAAGAAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTATGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTCCAGCCTGTCACCTCAAAGCAGTTTACCCCAATGACGGAGTGCCCATCAGATGAATGCAAGCAGAACAACTCCAAGGGTCAACTGTTCCTGTCAACGCGAGCATCAAAGTTCCTACCATTCCAAGAAGTTAAGATACAGGAGATGGCTGACCAAGTTCCTGTTGGCCATATTCCTCGGACACTAACTGTTCATTGTCACGGAACTTTGACAAGACAGATCAACCCTGGCGATGTGATCGATGTTGCGGGGATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTGACGGATACATATCTTGAGGCTCAACATGTCAATCAACACAAAAGGGCGTACGATGACCTGGTCTTTGATGCCAAGACGTTCCGAAGAATCGAGCAATACAAGCATTCAGGTCACATGTATGAGTATCTCTCCAGATCCATCGCTCCGGAAATCTATGGCCATATGTGAAGAAAGCGCTTCTGCTCCTGATTGGTGTCACAAATGGGTGATGGAAT Cetraria_islandica_CETRISLA NNNNNNNCTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCTAACTCTTCACCCTTTGTGTACCTTTGTTGCTTTGGCGGGTCCGACTCGCGCC-GCCCACAGGCCGGCGAGCGCCCGCCAGAGGCCCATTAAAATCTCTTATTATGTCCGAGCAAAAACAAAATAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAAATTATCCCGCTTTGAAAGCCTCGTGGCCTGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAGCCCATGTGAAGCCTTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTTTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTCTCCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACGACTTACGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCGTAATTCGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATAATGGCACAGGTATAGGCGAAAGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCAAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTATTTTTTTTTTTTACTTTAAAGGAGACAAGAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTATGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTCCAGCCTGTCACCTCAAAGCAATTCACCCCAATGACGGAATGCCCCTCGGATGAATGCAAGCAGAACAACTCCAAGGGTCAATTGTTCCTGTCCACACGAGCATCAAAGTTCCTGCCTTTTCAAGAAGTTAAGATACAGGAAATGGCTGACCAAGTACCCGTTGGCCATATCCCTCGGACACTGACTGTTCATTGTCATGGAACTTTGACACGACAGATCAACCCTGGCGATGTCATCGATGTTGCAGGGATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTAACGGACACATACCTCGAGGCTCAACATGTCAATCAACACAAAAAGGCGTACGATGACCTAGTTTTTGATGCCAAGACGTTTCGAAGAATCGAGCAATACAAGCATTCAGGTCACATGTATGAGTACCTCTCGAGGTCCATCGCCCCGGAAATTTATGGCCATATGTGAAGAAAGCGCTTCTGCTCCTAATCGGTGTCACAAATGGGTGACGGAAT Cetrariastrum_andense_CEAN199 ATCATTATCGAGAGAGGGGCTTCGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCATTGTCTACCTATGTTGCTTTGGCGGGCCTCGCTCGCGCTGACCTTCGGGCCAGCGAGCGCCCGCCGAGGGCCCATTATATCCTTTTTCCTCGTCCGAGTAAAAACATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAATAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAGGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTGAAGCGTAGTCATAATCTCCCGCTTTGCAAGCGTCGCGACTTGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAATCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCCGGGGAACGTAGCTCTCGGGGGAGTGTTATAGCCTCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTTAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTTTGACGTGCAAATNNNNNNNNNNNNNNNNNNNNNAGGAATGTATAGCAATAGCTAGTTGCATCATTGTAAAGATGATGCAAGATCGACTATGTTGNATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATTTGCTAGAGTTACTTACGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAACGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTATTTAATGAACAGGATTAGATACCCCAGTAGTGGAAGCAGAAAATGATGAATGTCATAGATTAGCTAGATAGGTTCATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTATCTTCTTAATTTTAACTGAGGCAATAACATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGATCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGAGTTGTCCCCACTATATTGGTGTGATCGATGTGGTTGCGAAATATTTCAGCCTGTCACCTCAAAGCAGTTTACCCCAATGACGGAATGTCCCTCAGAAGAATGCAGGCAAAACAATTCCAAGGGTCAACTATTCCTGTCAACCCGGGCATCCAAATTCTTACCTTTCCAAGAGGTCAAGATACAGGAAATGGCCGATCAAGTACCGGTTGGCCATATTCCTCGGACACTAACGGTTCAGTGTCATGGAACCTTGACAAGACAGATCAATCCGGGCGACGTCATTGACGTTGCGGGAATCTTCCTTCCAACTCCGTATACAGGCTTCAAAGCAATACGTGCTGGTCTTCTGACAGATACCTACCTTGAGGCTCAACATGTCATTCAACATAAGAAAGCATACGACGACTTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAACACAAGCATTCTGGCCACATGTACGAGTATCTCTCGAGATCCATCGCTCCAGAAATATATGGGCATACGTGAAGAAAGCACTTCTCCTTCTGATCGGTGTCACAAATGGGCGATGGAAT Cetrariastrum_dulitense_CEDU200 ATCATTATCGAGAGCGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCATTGTCTACCTTTGTTGCTTTGGCGGGCCCCGCTCGCGCTGACCTTCGGGCCGGCGAGCGCCCGTCGAAGGCCCATTGTATTCTTTTTTCTCGTCCGAGTAAAAACATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAATAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTCAAAATCTCCCGCTTTGAAAGCGTCGCGACTTGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTTTGGCGGCCGGATAAAGGCCCGGGGAACGTAGCTCCCGGGGGAGTGTTATAGCCTCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTTAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATTGTAAATATGATGCAAGATTGGCTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGGACCTAGACGGCAGATCAAGCTTTGGGCTAATTTGCTAGAGTTACTTACGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTTGTAAGAAAAATAATGGCACAGGTATAGGNGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTATTTAATGAACAGGATTAGATACCCCAGTAGTGGAAGCAGAAAATGATGAATGTCATAGATTAGCTAGATAGGTTCATTCTATAAATGAAAGTGTAAGCATTCCCCCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTTTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTT-CCCCAATTTGAATATTTATATTTTTTTTATTTTTTTAATTTTAACTGAGGCAATAACATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGATCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGAGTTGTCCCCACTATATTGGTGTGATCGATGTGGTTGCGAAATATTTCAGCCTGTCACCTCAAAGCAGTTTACCCCAATGACGGAATGTCCCTCAGAAGAATGCAGGCAAAACAATTCCAAGGGTCAACTATTCCTGTCAACTCGGGCATCCAAATTCTTACCTTTCCAAGAGGTCAAGATACAGGAAATGGCCGATCAAGTACCGGTTGGCCATATTCCTCGGACACTAACGGTTCAATGTCATGGAACCTTGACAAGACAGATCAATCCGGGCGACGTCATTGATGTTGCGGGAATCTTCCTCCCAACTCCGTATACAGGCTTCAAAGCAATACGTGCTGGTCTTCTGACAGATACCTACCTTGAGGCTCAACATGTTACTCAACACAAGAAAGCATACGATGACTTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAACACAAGCATTCTGGTCACATGTACGAGTATCTCTCGAGGTCCATCGCTCCAGAAATCTATGGGCATACGTGAAGAAAGCACTTCTCCTCCTGATCGGTGTCACAAATGGGCGGCGGAAT Cetrariella_delesei_CETRDELI NNNNNNNCTGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCTATCTCTTCACCCATTGTCTATCTTTGTTGCTTTGGCGGGTCCTGCTCGCGCCGGCGCACCCGCCGGCGAGTGCCCGCCAGAGGCCCATTAAAATCTCTTATCATGTCCGAGTAAAAAC-AATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAAATCATCCCACTTTGAAAGCCCCGTGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTTTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCT--CCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAAAACTTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAATTTTTGGGACCCGAAAGACAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAAAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATAATGGCACAGGTATAGGCGAAAGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCAAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTTTTTTTCTTTTTAACTTTAAAGGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTATGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTCCAGCCTGTCACCTCAAAGCAATTTACCCCAATGACGGAATGCCCTTCGGATGAATGCAAGCAAAACAACTCCAAGGGCCAATTGTTTTTGTCAACGCGAGCATCAAAGTTCCTGCCATTTCAAGAAGTTAAGATACAGGAGATGGCTGACCAAGTGCCCGTTGGCCATATCCCTCGGACACTGACTGTTCATTGTCATGGAACTTTGACAAGACAGATCAACCCCGGCGATGTCATCGATGTTGCGGGAATCTTCCTCCCAACTCCATACACAGGCTTCAAAGCTATTCGTGCCGGTCTTCTGACGGATACATACCTTGAGGCTCAACATGTCAATCAGCACAAAAAGGCGTACGACGACCTGGTCTTTGATGCTAAGACGTTTCGAAGAATCGAGCAATACAAGCATTCAGGTCACATGTATGAGTACCTCTCCAGGTCCATCGCTCCGGAAATCTATGGCCATATGTGAAGAAAGCGCTTCTGCTCCTAATCGGCGTCACAAATGGGTGACGGCAT Emodomelanelia_masonii_PAMA286 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCTCCACTCTTCACCCATTGTCTACCTTTGTTGCTTTGGCGGACCTCGCCCGCGTCGGCTCTCGGGCCGGCGAGTGTCCGTCAGAGGCCCATAAAATCCTTTTATT---TCCGAGCACAAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGCAGTAAACTCGTTTCGCTTTGAAGGC-CCGCGGCTGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGACCATCCCTGCGAGTGTTTGGGTATCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATGGCTGGTCGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTATTTTCGAAAGAAAAACCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGGTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGCAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTATAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATCGATGTGGATGCGAAATATTTCAGCCAGTCACATCAAAGCAATTTACCCCAATGACGGAGTGTCCCTCAGATGAATGCAAGCAGAACAACTCCAAGGGCCAATTGTTTCTGTCAACACGAGCATCAAAATTCCTGCCATTCCAAGAAGTCAAGATACAGGAGATGGCTGATCAGGTACCTGTTGGCCATGTCCCTCGGACACTGACTGTCCACTGTCATGGAACCTTGACAAGACAGATAAATCCTGGCGATATCATCGATGTTGCCGGAATCTTCCTACCTACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGCCTGCTGACGGACACCTACCTAGAAGCTCAACACGTCAATCAACACAAAAAAGCGTACGATGACTTAGTCTTTGATGCGAGGACGTTTCGAAGAATCGAGCAATACAAGAATTCAGGTCACATGTATGAATACCTCTCGAGGTCAATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGTGTCACAAATGGGCGACGGAAT Emodomelanelia_masonii_PAMA287 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCTCAACTCTTCACCCATTGTCTACCTTTGTTGCTTTGGCGGACCTCGCCGCCGTCGGCTCTCGGGCCGGCGAGTGTCCGTCAGAGGCCCATAAAATCCTTTTATT---TCCGAGTACCAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGCAGTAAACTCGTTTCGCTTTGAAGGCCCCGCGGCTGGCCAGACAACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAAATTGTTGAAAGGGAAGCGCNTGCAACCAGCCCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCCCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCGACCATCCCTGCGAGTGTTTGGGTATCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATGGCTGGTCGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAATGTATAGCA-TAGCTACCTGCATCATTGTAATGATGATGTAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTATTTTCGAAAGAAAAACCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGGTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTATAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTGTCCCTCAGATGAATGCAAGCAGAACAACTCCAAGGGCCAATTGTTTCTGTCAACACGAGCATCAAAATTCCTGCCATTCCAAGAAGTCAAGATACAGGAGATGGCTGATCAGGTACCTGTTGGCCATGTCCCTCGGACACTGACTGTCCACTGTCATGGAACCTTGACAAGACAGATAAATCCTGGCGATGTCATCGATGTTGCCGGAATCTTCCTACCTACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGCCTGCTGACGGACACCTACCTAGAAGCTCAACACGTCAATCAACACAAAAAAGCGTACGATGACTTAGTCTTTGATGCGAGGACATTTCGAAGAATCGAGCAATACAAGCATTCAGGTCACATGTATGAATACCTCTCGAGGTCAATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGTGTCACAAATGGGCGACGGAAT Everniastrum_nepalense_ENEPAL ATCATTATCGAGAGCGGGGCCTCGTGCTCCCGGGGGCTTCGGCCTCCACCTCTTCACCCTTTGCTTACCTTTGTTGCTTTGGCGGGCCCCGCTCGCGCTGGCTTTCGAGTCGGCGAGCGCCCGTCGAAGGCCTATTACATACTTTTTTC--GTCTGAG-CTAAACAAATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAATAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGTATGCCTGTTCGAGCGTCATTACACCTCTCAAGCGTAGCTTGGTATTGGGTCTCGCCCCGCGGCGTGCCTGAAAAGTGGCGGTCCGGTTCGAGCGCAGTAATTTTTTTCCGCTCTGAAAGCGTCGCGGCTGGCCAGATAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGCGAGACCACGGTCTAAGTCTATTGGAACATTGCGTCACAGAGGGTGAGAACCCCGTATGTGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTGGGGAACGTAGCTCTCGGGGGAGTGTTATAGACCCGGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTTAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATTGTAATGATGATGCAATATTGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATTTGCTAGAGTTACTTACGAGGGGGCTTTAAAGTACTAATGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAAATATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTATATAATGAACAGGATTAGATACCCCAGTAGTGGAAGCAGTAAATGATGAATGTCATAAATTAGCTAGATAGGTTCATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTTTTTTTCTTATTAATTTTAATTGAGGCAATAATATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGATCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGAGTTGTCTCCACTATATTGGTGTGATCGATGTGGTTGCGAAATATTTCAGCCTGTCACCTCAAAGCAATTTACACCAATGACGGAATGTCCCTCGGAAGAGTGCAGGCAAAATAACTCCAAGGGTCAATTGTTCCTGTCAACTCGGGCATCGAAATTCTTACCTTTCCAAGAGGTCAAGATACAGGAGATGGCCGATCAAGTCCCCGTTGGCCATATTCCTCGGACACTAACGGTCCATTGTCATGGAACCTTGACAAGACAGATCAATCCAGGCGACGTCATTGATGTTGCGGGAATCTTCCTTCCAACTCCGTATACAGGCTTCAAAGCAATACGTGCTGGTCTTCTGACGGATACCTACCTCGAGGCTCAACATGTTATCCAACACAAGAAAGCATACGATGACATCGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTACGAGTATCTCTCGAAGTCAATCGCTCCAGAAATCTATGGGCACACGTGAAGAAAGCACTTCTCCTCCTGATCGGTGTCACAAATGGGCGACGGAAT Flavocetraria_nivalis_FLAVNIVA NNNNNNNCTGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCTCCAACTCTTCACCCATTGTCTACCTATGTTGCTTTGGCGGGCCTCGCCCGTGTCGGCCTACCGGTCGGCGAGCGCCCGTCGGAGGCCAATCAAATCCTTTTATTATGTCCGAGTAAAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTCTTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTCATCCCGCTTTGAAAGCCCCGTGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCAGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTACGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCGTAGCTGTTGGGACCCGAAAGACAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATAATGGCACAGGTATAGGCGAAAGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCC-AGTAGTCAAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTTTTTTTCTTTTTAACTTTAAAGGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTCTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTCCAGCCTGTCACCTCAAAGCAATTCACCCCAATGACGGAATGTCCCTCGGATGAATGCAGGCAGAACAACTCCAAGGGTCAATTGTTCCTGTCAACACGAGCATCAAAGTTCCTGCCATTCCAAGAAGTTAAGATACAGGAGATGGCTGACCAAGTACCCGTTGGCCATATTCCTCGGACACTGACTGTTCATTGTCATGGAACTTTGACAAGACAGATCAACCCTGGCGATGTCATCGATGTTGCGGGGATCTTCCTCCCAACTCCATACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTGACGGATACATACCTCGAGGCTCAACATGTCAATCAACACAAAAAGGCGTACGATGATCTGATCTTTGATGCCAAGACGTTCCGAAGAATCGAGCAATACAAGCATTCAGGTCACATGTATGAGTACCTCTCCAGGTCCATTGCTCCGGAAATCTATGGCCATATGTGAAGAAAGCGCTTCTGCTCCTAATCGGTGTCACAAATGGGCGACGGAAT Flavoparmelia_marchantii_FMARCHAN ATCATTACCGAGAGCGGGGCNTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCTGTGTGTACCTATGTTGCTTTGACGGGCCTCGTTCGCGCCGGGCCTCGGCCCGGTGTGCGCCCGTCAGATGCCCTCCTAATTCTTTTATCTCGTCCGAGTCATAACATATTAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGTCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAACACATCCCGCTTTGAAAGCGTC-AGGCCGGCCAGAAACCCATGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGCGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGTGACCGTGGATTGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGNACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCACGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGAAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGACTAATTCACTAGAGTTACTTACGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGCTAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTATTAGTTGTAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATACGCAAAAAACCTTACCACAATTTGAATATTTAGATCTTATTTTTTATCTTAATTTTAATTAAGGCAATAAGATACATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCACTATATTGGTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCGAAGCAATTCACTCCAATGACGGAGTGCCCCTCAGAGGAATGCAAGCAGAACAATTCCAAGGGTCAATTGTTCCTGTCAACGCGAGCATCGAAATTCTTGCCATTCCAAGAGGTTAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATTCCCAGGACACTAACTGTTCACTGTCATGGAACCTTGACGAGACAGATCAACCCNGGCGATGTTATCGATGTTGCGGGAATCTTTCTTCCGACTCCGTACACAGGCTTTAAGGCTATCCGTGCTGGCCTTCTGACGGACACCTACCTCGAAGCCCAACATGTTAATCAACACAAAAAAGCGTACGACGACTTAGTCTTTGATGCCAAGACATTTCGTAGAATCGAACAGTACAAGCATTCAGGTCACATGTATGAGTACCTCTCGAAGTCTATCGCTCCAGAAATCTATGGTCATATGTGAAGAAAGCGCTTTTGCTCCTGATCGGTGTTACAAATGGGGGATGGAAT Flavoparmelia_soredians_FSORED2 ATCATTACTGAGAGAGGGGCCTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCC-TTGTGTACTTGTGTTGCTTTGGCGGGCCTTGCTTGCGCCGGCTCCCGGGTCGGTGGGCGCCCGTCAGATGCGTTCCTAATCCTTTAATCTTGTCCGAGTTCAAACATATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGTCTCGTCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTCGAGCGTAGTAAACTTTTCCCGCTTTGAAAGCGTC-CGGTCGGCCAG--AAACCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCTTAGAGGGTGAGAATCCCGTACGTGACCGCGGATCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAACCCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATAGTTAATATGATGCAAGCTCGACTAAGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGCTAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGATATCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAAATTGATAACCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTTTTTTTCATCTTAATTTTAATTAAGGCAATAAGATACATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCTCCACTATATTGGTGTGACCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCGAAGCAATTTACTCCCATGACGGAGTGCCCCTCAGAGGAATGCAAGCAGAACAACTCCAAGGGCCAATTGTTCCTGTCAACGCGAGCATCGAAATTCTTGCCATTCCAAGAGGTAAAGATACAAGAGATGGCTGATCAAGTACCTGTTGGCCATATTCCTAGGACACTAACTGTTCACTGTCATGGAACCTTGACGAGACAGATCAATCCTGGCGATGTTATCGATGTTGCGGGAATTTTCCTTCCGACTCCGTATACAGGCTTTAAGGCTATCCGTGCTGGCCTTCTGACGGATACCTACCTCGAAGCCCAACATGTCAATCAACACAAAAAAGCGTACGATGACTTAGTCTTTGATGCCAAGACGTTCCGTAGAATCGAACAGTACAAGCATTCAGGTCACATGTATGAGTACCTCTCGAAGTCCATCGCTCCAGAAATCTATGGTCATATGTGAAGAAAGCACTTTTGCTTCTGATCGGTGTTACAAATGGGGGACGGAAT Melanelia_disjuncta_MDISJUNCT ATCATTACCGAGAGAGGGGCTTCGGGC-CCCGGGGGTTTCAGCCCCCACCTCTGCACCCATTGTGTACCTTTGTTGCTTTGACGGACCGCGCCCGCGCTGGCTTTCGGGCCGGAGAGCGTCCGTCAGAGGCCCATCGAATCCCTTAATCATGTCCGAGTAAAAAC-AGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCCCCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAAACTCTCCTGCTTTGAAAGCCCCGCGGCCGGCTAGAGAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGCGAGACCACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCTAGCATCGGTTTCGGCGACCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCTTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAAT{CT}CTGTCATACCTTTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAAGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGTCAATTATTCTTGTCGACGCGAGCATCGAAATTCCTCCCATTCCAAGAGGTTAAGATACAGGAGATGGCCGATCAAGTACCCGTTGGCCATATTCCTCGGACGCTAACAGTTCATTGTCATGGAACCTTGACGAGACAGATCAATCCCGGCGATGTCATTGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTCCTGACGGATACCTACCTCGAGGCTCAACATGTTAACCAACACAAAAAGGCGTACGATGACCTCGTCTTTGACGCCAAAACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTACGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGTCATACGTGAAGAAAGCGCTTCTACTCCTGATTGGTGTCACAAATGGGCGACGGAAT Melanelia_disjuncta_MEDI637 ATCATTACCGAGAGAGGGGCTTCGGGC-CCCGGGGGTTTCAGCCCCCACCTCTGCACCCATTGTGTACCTTTGTTGCTTTGACGGACCGCGCCCGCGCTGGCTTTCGGGCCGGAGAGCGTCCGTCAGAGGCCCATCGAATCCCTTAATCATGTCCGAGTAAAAAC-AGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCCCCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAAACTCTCCTGCTTTGAAAGCCCCGCGGCCGGCTAGAGAACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAATGTATAGCAATAGCTACCTGCATCATTGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTTTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGCTCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGNTGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGTCAATTATTCTTGTCGACGCGAGCATCGAAATTCCTCCCATTCCAAGAGGTTAAGATACAGGAGATGGCCGATCAAGTACCCGTTGGCCATATTCCTCGGACGCTAACAGTTCATTGTCATGGAACCTTGACGAGACAGATCAATCCCGGCGATGTCATTGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTCCTGACGGATACCTACCTCGAGGCTCAACATGTTAACCAACACAAAAAGGCGTACGATGACCTCGTCTTTGACGCCAAAACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTACGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGTGTCACAAATGGGCGACGGAAT Melanelia_hepatizon_MEPA1075 ATCATTACCGAGAGAGGGGCTTCGGGC-CCCGGGGGTTTCAGCCCCCACCTCTGCACCCATTGTGTACCTTTGTTGCTTTGACGGACCGCGCCCGCGCTGGCTTTCGGGCCGGAGAGCGTCCGTCAGAGGCCCATCGAATCCCTTAATCATGTCCGAGTAGAAAC-AGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCCCCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAGATGAAAAGCCCTT--GAAAGAGAGTC-AACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTT-TCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAAATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTTAATCAAGCTTTGGACTAATTTACNAGAGTNACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAA{GT}ATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAACATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCTT{AG}GCTGGTTTTTTAGACTGCCCAGCCCCGGGAGAATTGGTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGCCAGTTATTTCTATCAACGCGGGCATCGAAGTTCCTGCCATTCCAGGAAGTTAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACACTAACTGTTCACTGTCATGGAACTTTGACGAGACAGATAAATCCTGGCGACGTCATCGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGGGCTGGTCTT{CT}TAACGGATACCTACCTGGAGGCTCAACATGTTAACCAACATAAGAAGGCGTACGATGACCTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGCCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGCGTCACAAATGGGCGACGGCAT Melanelia_panniformis_MEPA1080 ATCATTAACGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCATTGTTTATCTTTGTTGCTTTGGCGGACCCCGCCCGCGTTAGCTTTCGGGCCGGCGAGCGTCCGTCAGAGGCCCATTAAATTCTTTAATCACGTCCGAGTAAAAAAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAGTTTATTCCTCTTTGAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGGCGAGGGAAGCGGCAATAGCTCAAATTGAAAATCCGGCCCC--GGCCCGGAGTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCACGGTTTAAGTCCATTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTGCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAAATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAATGTATAGCAATAGCTACCTGCATCATTGTAAGGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAACATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGCCAGTTATTTCTATCAACGCGGGCATCGAAGTTCCTGCCATTCCAGGAAGTTAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACACTAACTGTTCACTGTCATGGAACTTTGACGAGACAGATAAATCCTGGCGACGTCATCGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGGGCTGGTCTT{CT}TAACGGATACNTACCTGGAGGCTCAACATGTTAACCAACATAAGAAGGCGTACGATGACCTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGCCATATGTGAAGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Melanelia_panniformis_MEPA1086 ATCATTAACGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCATTGTTTATCTTTGTTGCTTTGGCGGACCCCGCCCGCGTTAGCTTTCGGGCCGGCGAGCGTCCGTCAGAGGCCCATTAAATTCTTTAATCACGTCCGAGTAAAAAAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCCCCGTGGCCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCACGGTTTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTGCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAAATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAACATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATCGATGTGGATGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGCCAGTTATTTCT{AGT}TCAACGCGGGCATCGAAGTTCCTGCCATTCCAGGAAGTTAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACACTAACTGTTCACTGTCATGGAACTTTGACGAGACAGATAAATCCTGGCGACGTCATCGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGGGCTGGTCTTCTAACAGATACCTACCTGGAAGCTCAACATGTTAACCAACATAAGAAGGCGTACGATGACCTGGTCTTTGATGCCAAGACATTCCGAAGGATCGAGCAATACAAGCATTCTGGTCACATGTATGA{AG}TACCTGTCGAGGTCCATCGCTCCGGAAATCTATGGCCATATGTGAAGAAAGCGCTTCTACTCCTGATGGGNNNNNNNNNNNNNNNNNNNNNN Melanelia_soreidata_MESO1076 ATCATTACCGAGAGAGGGGCTTCGGGC-CCCGGGGGTTTCAGCCCCCACCTCTGCACCCATTGTGTACCTTTGTTGCTTTGACGGACCGCGCCCGCGCTGGCTTTCGGGCCGGAGAGCGTCCGTCAGAGGCCCATCGAAATCCTTAATCATGTCCGAGT-TAGAAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCCCCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGCGAGACCACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCTAGCATCGGTTTCGGCGACCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCTTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGAAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCAAGATCGACTATGTCGAA-AAATTTCTAGGAGGAATTATGATAATGC--TTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGT-GCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTTTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGCTCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTCTTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGCGTAGTCCCCGNNNNNNNNNTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGTCAATTATTCTTGTCGACGCGAGCATCGAAATTCCTCCCATTCCAAGAGGTTAAGATACAGGAGATGGCCGATCAAGTACCCGTTGGCCATATTCCTCGGACGCTAACAGTTCATTGTCATGGAACCTTGACGAGACAGATCAATCCCGGCGATGTCATTGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTCCTGACGGATACCTACCTCGAGGCTCAACATGTTAACCAACACAAAAAGGCGTACGATGACCTCGTCTTTGACGCCAAAACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTACGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGTGTCACAAATGGGCGACGGAAT Melanelia_soreidata_MESO773 ATCATTACCGAGAGAGGGGCTTCGGGC-CCCGGGGGTTTCAGCCCCCACCTCTGCACCCATTGTGTACCTTTGTTGCTTTGACGGACCGCGCCCGCGCTGGCTTTCGGGCCGGAGAGCGTCCGTCAGAGGCCCATCGAATCCCTTAATCATGTCCGAGTAAAAAC-AGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCCCCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAAACTCTCCTGCTTTGAAAGCCCCGCGGCCGGCTAGAGAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGCGAGACCACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTCTGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCTAGCATCGGTTTCGGCGACCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCTTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCAGCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATC-TTGTAAAGGT-------GAGCAGATGTATGGAATAAAATT---TGGAGAATTATGATAAGCCC-TTGTCTGCCTATGTGTCTTGACCAAATTC---GGCCGCCGTCG-GGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTT-AAGGGTCCCTAGGCGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTTTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGCTCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTCTTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTAGATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACCCCAATGACGGAATGCCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGTCAATTATTCTTGTCGACGCGAGCATCGAAATTCCTCCCATTCCAAGAGGTTAAGATACAGGAGATGGCCGATCAAGTACCCGTTGGCCATATTCCTCGGACGCTAACAGTTCATTGTCATGGAACCTTGACGAGACAGATCAATCCCGGCGATGTCATTGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTCCTGACGGATACCTACCTCGAGGCTCAACATGTTAACCAACACAAAAAGGCGTACGATGACCTCGTCTTTGACGCCAAAACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTACGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTACTCTTGATTGGTGTCACAAATGGGCGACGGAAT Melanelia_soreidata_MESO778 ATCATTACCGAGAGAGGGGCCTCGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCATTGTTTATCTTTGTTGCTTTGGCGGATCCCGCCCGCGCCGGCTCTCGGGCCCGCGAGCGTCCGTCAGAGGCCCATCAAATGCTTTAATTACGTCCGAGTAAAAACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAATAATGTGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCAGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCCCCGCGGCCTGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCACGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCTTGAGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCAAAACAATTCACCCCAATGACGGAATGCCCGTCAGACGAATGCAAGCAGAACAACTCCAAGGGTCAGTTATTTCTATCCACGCGGGCATCGAAGTTCCTGCCATTCCAGGAAGTTAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACACTAACTGTTCACTGTCATGGAACTTTGACGAGGCAGATAAATCCTGGCGACGTCATCGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTAACGGATACCTACCTCGAGGCTCAACATGTTAACCAACATAAGAAGGCGTACGATGACCTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGCCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGCGTCACAAATGGGCGATGGCAT Melanelia_stygia_MSTYGIA NNNNNNACTGAGAGAGGGGCTTCACGCTCCCGGGGGTCTCGGCCCCTAACTCTTCACCCATTGTCTATCTTTGTTGCTTTGGCGGGCCTCGCCCGCGTCGGCCTTCGGGCCGACGAGCGCCCGTCGGAGGCCCATTAAATTCCTTTATCATGTCCGAGCGAAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGCTTCAAGCGTAGTAAATTCATCCCGCTTTGAAAGCGCCGTGGCCGGCCAGACAACCCTGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACTGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTATATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCCGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTATTGGGACCCGAAAGATGATGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAATGTATAGCAATAGCTACTTGCATCATTGAAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATCTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATAATGGCACAGGTATAGGCGAAAGCATCCCCTTATGTGATAAGTGACGTNNAGGGACNAANGCNNTGTGTNGCGAACAGGATTAGATNCCCCAGNAGTCAANGCNNAAAATGATGAATGTCATAGATTAAATATATAAGTTT{AC}TTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGT{AT}ATTTGGCAACATTGGAACTGAAATCATTA{GT}ACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATNTGAATATTTATATTTTNTTGTCCTNCTGAATTTTAAAGGAGGCNATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTATGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTNATATAGAAGAGTCCCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Melanelia_tominii_METO776 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCATTGCTTATCTTTGTTGCTTTGGCGGACCCCGCCCGCACTGGCTTTCGGGCCGGCGAGCGTCCGTCAGAGGCCCATCAAATCCTTTTATTATGTCCGAGTTAAAAC-AGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTCTTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAACTTATCCCGCTTTGAAAGCCTCGCGGCCGGCCAGACAACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAAGGTATAGCAATAGCTCCTTGCATCATTAT-AAAGTGATGCAAGT---GCTATGTGGAATAAATTT----GGAGAATTATGATAATGGC-TTGTCTGCCTATGTGTCTTGACCAAATTA--CGGCCGCCGTCG-GGTAATACGTAGAAG-CTAGTGTTATTCATGTTTAATCGGTTTAAAGGG-ACCTAG-CGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAAAGTATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGCTGCGAGATATTTCAACCTGTCACCTCAAAACAATTTACGCCAATGACGGAATGCCCCTCAGGCGAATGCAAGCAGAACAACTCCAAAGGTCAGCTATTTCTGTCGACGCGGGCATCGAAGTTCCTGCCATTTCAAGA{AG}GTCAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACACTAACTGTTCACTGTTATGGAACTTTGACGAGACAGATAAACCCCGGCGACGTCATAGATGTTGCGGGCATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTAACGGATACCTACCTCGAGGCTCAACATGTTAACCAACACAAGAAGGCGTACGATGACCTGGTCTTTGACGCCAAGACGTTCCGGAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTACTCCTGATTGGTGTCACAAATGGGCGACGGAAT Melanelixia_fuliginosa_MFULIG3 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCGTTGTATACCTTTGTTGCTTTGGCGGACCCCGCCCGCACCGGCTTTCGGGCCGGTGAGTGTCCGTCAGGGGCCCATCACATTCCTTTATCACGTCCGAGTCAAAAAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGTATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCATCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCCCCGTGGCCTGCCGGGTCACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGAGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAACCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAATATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAAATATTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTACAATGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATTTGCTAGAGTTACTTGTGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTCTTCGAAAGAAGAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTCCTTATTAATTTTAACTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNTGCGGCTGCGAGATCTTTCAACCTGTCACTTCAAAACAATTCACCCCAATGACAGAGTGTCCCTCAGACGAATGCAAGCAGAATAATTCAAAGGGTCAATTATTTCTGTCAACACGGGCATCCAAATTCCTCCCATTCCAAGAAGTCAAGATACAGGAAATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACTCTGACCGTTCACTGTCATGGAACCTTGACAAGACAGATAAATCCTGGCGACGTCATAGACGTTGCTGGCATCTTCCTTCCAACGCCGTACACGGGCTTCAAAGCTATACGCGCGGGCCTGCTGACAGATACCTACCTCGAAGCTCAACATGTGAATCAACACAAAAAAGCGTATGACGACTTGGTATTTGATGCAAAAACATTTCGAAGAATCGAGCAGTACAAGCATTCTGGTCACATGTATGAGTATCTCTCAAAATCCATCGCCCCAGAAATCTATGGTCATATGTGAAGAAAGCGCTCTTGCTCCTGATCGGTGTCACAAATGGGCGACGGAAT Melanelixia_fuliginosa_MFULIU11 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGTTTCGGCCCCCGACTCTTCACCCGTTGCATACCTTTGTTGCTTTGGCGGGCCCCGCCCGCGCCGGCCTCTGGGCCGGCGAGCGTCCGCCAGAGGCCCATTACATTCTTTTATCACGTCCGAGTCAAACCAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCATCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAATTTTATCCCGCTTTGAAAGCCCCGTGGCCTGCCAGGTAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGTTCGAACCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGCAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTCTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAATATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTCAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAAATATTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATCTCAATGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATTTGCTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTCTTCAAAAGAAGAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTCCTTATTAATTTTAACTGAAGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGCTGCGAGATCTTTCAACCTGTCACTTCAAAACAATTCACCCCAATGACAGAGTGTCCCTCAGACGAATGCAAGCAGAACAACTCAAAGGGTCAACTGTTCCTGTCAACGCGGGCATCCAAATTCCTCCCATTCCAAGAAGTCAAGATACAGGAAATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACTCTGACCGTTCACTGTCATGGAACCTTGACGAGACAGATAAATCCNGGCGACGTCATAGACGTTGCTGGCATCTTCCTTCCAACGCCGTACACGGGCTTCAAAGCTATACGCGCGGGCCTTCTGACAGATACCTACCTCGAAGCTCAACATGTAAATCAACACAAAAAGGCGTATGACGACTTGGTGTTTGATGCAAAGACATTNCGAAGAATCGAGCAATACAAGCATTCCGGTCACATGTATGAATATCTCTCAAGGTCCATCGCCCCAGAAATCTATGGTCATATGTGAAGAAAGCGCTCTTGCTCCTGATCGGTGTCACAAATGGGCGACGGAAT Melanelixia_fuliginosa_MGLABRAT3 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCGTTGTATACCTTTGTTGCTTTGGCGGACCCCGCCCGCACCGGCTTTCGGGCCGGTGAGTGTCCGTCAGGGGCCCATCACATTCCTTTATCACGTCCGAGTCAAAAAAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGTATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGCAGCTTGGTATTGGGCATCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCCCCGTGGCCTGCCGGGTCACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGAGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGCTCGAACCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAATATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAAATATTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTACAATGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATTTGCTAGAGTTACTTGTGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTCTTCGAAAGAAGAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTCCTTATTAATTTTAACTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGCGGCTGCGAGATCTTTCAACCTGTCACTTCAAAACAATTCACCCCAATGACAGAGTGTCCCTCAGACGAATGCAAGCAGAATAATTCAAAGGGTCAATTATTTCTGTCAACACGGGCATCCAAATTCCTCCCATTCCAAGAAGTCAAGATACAGGAAATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACTCTGACCGTTCACTGTCATGGAACCTTGACAAGACAGATAAATCCNGGCGACGTCATAGACGTTGCTGGCATCTTCCTTCCAACGCCGTACACGGGCTTCAAAGCTATACGCGCGGGCCTGCTGACAGATACCTACCTCGAAGCTCAACATGTGAATCAACACAAAAAAGCGTATGACGACTTGGTATTTGATGCAAAAACATTTCGAAGAATCGAGCAGTACAAGCATTCTGGTCACATGTATGAGTATCTCTCAAAATCTATCGCCCCAGAAATCTATGGTCATATGTAAAGAAAGCGCTCTTGCTCCTGATCGGTGTCACAAATGGGCGACGGAAT Melanelixia_glabra_MGLABRA2 ATCATTACCGAGAGAGGGGCTGCGCGCTCCCGGGGGTTTCGGCCCCCAACTCTTCACCCATTGTGTACCTTCGTTGCTTTGGCGGACCTCGCCCGCGCCGGCTTCCGGGCCGGTGAGTGTCCGTCAGAGGCCCATCAAATTCTTTCACCATGTCCGAGTAAAAACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAATAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTACTGGGTGTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAACTTATCCCGCTTTGAAAGCCCCGTGGCCCGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACTGCGGTCTAAGTCCATTGGAACATGGCGTCCTAGAGGGTGAGAATCCCGTATGTGACCGTGGCTCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGTGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAGGCCTTGGGAATGTACCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCACCATTGTCATAATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTAATCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAAATCAAGCTTTGGACTAATTTGCTAGAGTTACTTATGAGGGGGTTTTAAAGTACTNTTGGTGTAGAGATGAAATTCTGTTATACCTTTCTTCTAAGGGAGAGTGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTACATAATGAACAGGATTAGTTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATATCACGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAACTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTCTGGTTAGTTCCATGAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Melanelixia_glabratuloides_MGLABRTU NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCGGAGAGGGTGAGAATCCCGTACGCGACCGTGGCTCGACCCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGCGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCCCCGCGACCAGGCCAGCATCGGTCCCGGCGGTCGGATAAAGGCTCGGGGAATGTGGCTCTC-GGGGAGTGTTATAGCCCCGGGCGCAATGCGGCCCGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTTGACTATTTACGCGAGTGTTTGGGTGTCAAACCCGGGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTCAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCGTAAACAGTCTGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCGTTATTAAAACGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAAATCAAGCTTTGAACTAATTTGCTAGAGTTACTTATGAGGGGGCTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTGATACCTCTCTTCAAAAGAAGAACTACGGCACAGGTATAGGCGAAGGCATCCCCTTATGGGCTAACTGACGTTGAGGGACGAAGGCTTAG-GTAGCGAACAGGATTAGATACCCTAGTAGTCTAGGCAGTAAATGATGAATGTCATAGATTAG--ATATAAGCTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCCTGAGTAATATGGCAACGTTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATACCCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTCTTTTTTATTAATTAAAAAAAAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGACCGTTGTGGTTGTGAGATCTTCCAACCTGTCACGTCAAAACAATTTACCCCAATGACTGAATGTCCTTCGGAGGAATGCAAGCAGAACAACTCCAAAGGCCAATTGTTCCTGTCAACGCGAGCATCGAAGTTCTTGCCGTTCCAGGAAGTAAAGATACAGGAAATGGCTGATCAAGTACCCGTTGGCCATATTCCTCGTACTCTAACCGTTCATTGCCATGGAACCTTGACGAGACAGATCAATCCTGGCGACGTCATAGACGTTGCTGGCATCTTCCTTCCGACTCCATATACAGGCTTCAAAGCTATCCGTGCGGGCCTTCTGACAGATACCTACCTTGAAGCCCAGCATGTAAATCAACATAAAAAAGCGTATGATGATTTGGTCTTTGATGCGAAGACATTTCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTACGAATACCTCTCAAGGTCCATCGCGCCGGAAATCTATGGTCATATGTGAAAAAAGCGCTTCTGCTCCTGATCGGTGTCACAAATGGGTGACGGAAT Melanelixia_pilliferella_MPILIFE ATCATTACCGAGAGAGGGGCCTCGCGCTCCCGGGGGCTCCGGCCCCCAACTCTTCACCCGCTGTCGACCTTCGTTGCTTTGGCGGGCCCCGTCGGCGCCGGCCGT-AGGCCGGCGAGCGCCCGCCAGAGGCCGCGTACATGCTCTTATCATGTCCGAGACAAACCAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACATCCTTCAAGCATCGCTTGGTGTTGGGCGTCGCCCCGGGGCGTGCCCGAAAGGTGGCGGTCCGGTTTGAGCGTAGTAAACTACCCCCGCTCTGAAAGCCCCGCGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCGCAGAGGGTGAGAATCCCGTATGTGACCGTGGCTCGACCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGCGATCAGCCACTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAGGCCCTGGGAATGTAGCTCTC-GGGGAGTGTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGATCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTTGACTATTTACGCGAGTGTTTGGGTGTGAAACCCAGGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTCAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCGTAAACAGTCTGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCGTTATTATAACGATGCAAGCTCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAAATCAAGCTTTGTACTAATTTGCTAGAGTTACTTACGAGGGGGCTTGAAAGTACTGCTGGTGTAGAGATGAAATTCTGTAATACCTCTCTTCAAAAGAAGAATTACGGCACAGGTATAGGCGAAGGCATCCCCTTATGGGCTAACTGACGTTGAGGGACGAAGGCTTAG-GTAGCGAACAGGATTAGATACCCTAGTAGTCTAGGCAGAAAATGATGAATGTCATAGATTAG--GTATAAGCTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATATGGCAACGTTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGACCGTTGTGGTTGTGAGATTTTCCAACCTGTCACGTCAAAACAGTT{CT}ACCCCAATGATGGAATGTCCTTCGGAAGAATGCAAGCAGAACAACTCCAAGGGCCAATTGTTCCTGTCAACGCGAGCATCGAA{AG}TT{CT}TTGCCATTCCAAGAAGTCAAGATACAGGAAATGGCCGATCAAGT{AT}CCTGTTGGCCATATTCCTCGTACTCT{AT}ACCGTTCATTGCCATGG{AC}ACCTTGACGAG{AT}CAGATCAATCCTGGCGACGTC{AG}TAGACGTTGCTGGCATTTTCCTTCCGACTCCATATACAGGCTTCAAAGCTATCCGTGCGGGCCTTCTGACAGA{CT}ACCTACCTTGAAGCCCAACATGTCAATCATCACAA{AG}AAAGCGTATGATGA{CT}TTGGTCTTTGATGCGA{AG}GAC{AC}{AT}TTCGA{AC}GAATTGAG{CT}AATACAAGCA{GT}TCCGGTCACATGTACGA{AG}TACCTCTCAAGGTCCATCGCGCCGGAAAT{CT}TATGGTCATATGTGAAAAAAGC{GT}CT{AT}CTGCTCCTGATCGGTGT{CT}ACAAATGGGCGAGGGANN Melanelixia_subaurifera_MSUBAURI3 ATCATTACCGAGAGAGGGGCTTCGGGCTCCGGGGGGTTTCGGCCCCCGACTCTTCACCCGTTGCATATCTTTGTTGCTTTGGCGGACCCCGCCCGCGCTGGTTTTCGGGCCGGCGAGTGTCCGTCAGAGGCCCATTACATTCTTTTATTACGTCCGAGTTAAACCAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACAC{CT}CCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGGGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCTCCGCGGCTGGCCAAGTAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGCTTGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTTTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCCCGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTGTACCACATATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATATTTGGTGCGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTACAATGGTGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATATGCTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTCTTCAAAAGAAGAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGCAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACNATTTGAATATTTATATTTTTTTTTCCTTATTAATTTCAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTCTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGCTGCGAGATCTTTCAACCTGTCACTGCAAAACAATTCACCCCAATGACGGAATGTCCCTCAGACGAATGCAAGCAGAACAACTCAAAGGGTCAATTATTTCTGTCAACGCGGGCATCCAAATTTCTCCCATTCCAAGAAGTCAAGATACAAGAAATGGCTGATCAAGTACCTGTCGGCCATATTCCTCGGACTCTGACCGTTCACTGCCATGGAACCTTGACAAGACAAATAAACCCTGGCGATGTCATAGACGTTGCTGGCATCTTCCTTCCAACGCCGTACACGGGCTTCAAAGCTATACGCGCGGGCCTTCTAACAGATACCTACCTCGAAGCTCAGCATGTAAACCAACACAAAAAAGCGTATGATGACTTAGTATTTGATGCAAAGACATTCCGGAGAATCGAGCAATACAAGCACTCTGGTCACATGTATGAATATCTTTCAAGGTCCATCGCCCCGGAAATCTACGGTCATACGTGAAGAAAGCACTCTTGCTCCTGATTGGTGTCACAGATGGGCGACGGAAT Melanelixia_subaurifera_MSUBAUSA ATCATTACCGAGAGAGGGGCTTCGGGCTCCGGGGGGTTTCGGCCCCCGACTCTTCACCCGTTGCATATCTTTGTTGCTTTGGCGGACCCCGCCCGCGCTGGTTTTCGGGCCGGCGAGTGTCCGTCAGAGGCCCATTACATTCTTTTATTACGTCCGAGTTAAACCAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGGGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCTCCGCGGCTGGCCAAGTAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGCTTGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTTTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCCCGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTGTACCACATATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATATTTGGTGCGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTACAATGGTGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATATGCTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTCTTCAAAAGAAGAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGCAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTCCTTATTAATTTCAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTCTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGCTGCGAGATCTTTCAACCTGTCACTGCAAAACAATTCACCCCAATGACGGAATGTCCCTCAGACGAATGCAAGCAGAACAACTCAAAGGGTCAATTATTTCTGTCAACGCGGGCATCCAAATTTCTCCCATTCCAAGAAGTCAAGATACAAGAAATGGCTGATCAAGTACCTGTCGGCCATATTCCTCGGACTCTGACCGTTCACTGCCATGGAACCTTGACAAGACAAATAAACCCTGGCGATGTCATAGACGTTGCTGGCATCTTCCTTCCAACGCCGTACACGGGCTTCAAAGCTATACGCGCGGGCCTTCTAACAGATACCTACCTCGAAGCTCAGCATGTAAACCAACACAAAAAAGCGTATGATGACTTAGTATTTGATGCAAAGACATTCCGGAGAATCGAGCAATACAAGCACTCTGGTCACATGTATGAATATCTTTCAAGGTCCATCGCCCCGGAAATCTACGGTCATACGTGAAGAAAGCACTCTTGCTCCTGATTGGTGTCACAGATGGGCGACGGAAT Melanelixia_subaurifera_MSUBAUUK ATCATTACCGAGAGAGGGGCTTCGGGCTCCGGGGGGTTTCGGCCCCCGACTCTTCACCCGTTGCATATCTTTGTTGCTTTGGCGGACCCCGCCCGCGCTGGTTTTCGGGCCGGCGAGTGTCCGTCAGAGGCCCATTACATTCTTTTATTACGTCCGAGTTAAACCAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTCAGCTTGGTATTGGGCCTCGCCCCGGGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCTCCGCGGCTGGCCAAGTAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGCTTGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTTTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCCCGGGAACGTAGCTTTCGGGGGAGTCTTATAGCCCGGGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTGTACCACATATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATATTTGGTGCGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTACAATGGTGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTTGGACTAATATGCTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTCTTCAAAAGAAGAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGCAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTCCTTATTAATTTCAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTCTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGCTGCGAGATCTTTCAACCTGTCACTGCAAAACAATTCACCCCAATGACGGAATGTCCCTCAGACGAATGCAAGCAGAACAACTCAAAGGGTCAATTATTTCTGTCAACGCGGGCATCCAAATTTCTCCCATTCCAAGAAGTCAAGATACAAGAAATGGCTGATCAAGTACCTGTCGGCCATATTCCTCGGACTCTGACCGTTCACTGCCATGGAACCTTGACAAGACAAATAAACCCTGGCGATGTCATAGACGTTGCTGGCATCTTCCTTCCAACGCCGTACACGGGCTTCAAAGCTATACGCGCGGGCCTTCTAACAGATACCTACCTCGAAGCTCAGCATGTAAACCAACACAAAAAAGCGTATGATGACTTAGTATTTGATGCAAAGACATTCCGGAGAATCGAGCAATACAAGCACTCTGGTCACATGTATGAATATCTTTCAAGGTCCATCGCCCCGGAAATCTACGGTCATACGTGAAGAAAGCACTCTTGCTCCTGATTGGTGTCACAGATGGGCGACGGAAT Melanelixia_sugblabra_MSUBGLAB ATCATTATCGAGAGAGGGGCCTCGCGCTCCGGGGGGCTTCGGCCCTCGACTCTTCACCCACTGTGGCCCTTCGTTGCTTTGGCGGGCCTTGTCCGCGCCGGCTTTCGGGTCGGTCAGCGCCCGCCAGAGGTTTATCCAATTCTTTTATCCCGTCCGAGTAAAAACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCACCCCTCAAGCTTGGCTTGGTGTTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGCCCGGTTCGAGCGTAGTAAATCTATCCCGCTGTGAACGCTCCGCGACCGGCCAGACAACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGGTCCGAGTTGTAATTTGTAGAGGGTGCTTCGGGGGAGGCGGCGGTCTAAGTCCATTGGAACATGGTGTCACAGAGGGTGAGAATCCCGTATGCGACCGCGGCG-GAACCCAGGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCGGGGGAGTCTTATAGCCCTCGGCGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTATACCATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAGCCCTTTAGGGTGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGGTGTGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGAATNAAATTNTAGGTAGAATTAAGATAGTGNCATTGTCTGCCTATGTGTC-TGGCCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAAACCAAGCTTTGGACTAGTTTGCTAGAGTTACTTTTGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTATCTTCAAAGGAAGAATCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTAG-GTAGCGAATTGGATTAGATTCCCCGGTAGTCTAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCGAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGACCCGCAAAGAACCTTACCACAATTTGAATATTTATATTATTTTTTTCTTATTAATTTTAATTAAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGAGAGACTTTGGTTAGTTCCCTTANATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGATCGATGTGGTTGTGAGATTTTCCAACCTGTCACTTCAAAACAATTTACCCCAATGACGGAATGTCCTTCGGACGAATGCAAGCAGAACAACTCCAAGGGTCAGTTGTTTCTGTCGACGCGAGCATCGAAATTCTTGCCATTCCAAGAAGTCAAGATACAGGAAATGGCCGATCAAGTACCTGTTGGCCATATTCCTCGCGCTCTAACCATTCATTGCCATGGAACCTTGACGAGACAGATCAACCCTGGTGACGTCGTAGACGTTGCTGGCATCTTCCTTCCAACTCCATACACAGGCTTCAAAGCTATCCGTGCGGGTCTTCTGACAGATACCTACCTTGAAGCTCAGCATGTAAATCAACATAAAAAAGCGTACGATGACTTGGTCTTTGACGCGAAGACTTTTCGAAGAATCGAGCAGTACAAGCATTCTGGTCACATGTATGAATACCTCTCAAGGTCTATCGCTCCGGAAATATATGGTCATATGTGAAGAAAGCGCTTCTGCTCCTGATTGGTGTCACAGATGGGCGACGGAAN Melanelixia_villosella_MEVI771 ATCATTACCGAGAGAGGGGCTTCGCGCTCCCGGGGGTTTCGGCCCTCAACTCTTCACCCATTGTGTACCTTCGTTGCTTTGGCGGACCTCGCCCGCACTCGCTTTCGGGCCGGTGAGTGTCCGTCAGAGGCCCATCAAATTCCTTCATTATGTCCGAGTAAAAACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAATAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGTGTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTATCCCGCTTTGAAAGCCCCGTGGCCTGCCAGACAACCCCGGGATTGC-TCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCACAGAGGGTGAGAATCCCGTATGTGACCGTGGCTCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCCGGCGGTCGGATAAAGGCCTTGGGAATGTACCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCCCCATTGTCATAATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTAATCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAAATCAAGCTTTGGACTAATTTGCTAGAGTTACTTATGAGGGGGTTTTAAAGTACTATTGGTGTAGAGATGAAATTCTGTTATACCTTTCTTCTAAGGGAGAGTGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTACATAATGAACAGGATTAGTTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGTCACGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAACTTAAACTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTCTGGTTAGTTCCATGAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTTCCCGGGATATTGGNNNGATCGATGTGGCTGCGAGATTTTTCAGCCTGTCACTTCGAAACAATTCACCCCAATGACTGAATGTCCCTCAGACGAATGCAAGCAGAACAACTCCAAGGGCCAATTGTTTCTATCAACGCGAGCATCGAAATTCCTGCCATTCCAAGAAGTCAAGATACAGGAAATGGCTGATCAAGTACCTGTTGGCCATATTCCTCGGACTCTAACCGTTCACTGTCATGGGNCCTTGACGAGGCAGATAAATCCTGGCGA{CT}GTCATAGATGTTGCTGGCATCTTCCTTCCAACTCCATACACAGGCTTCAAAGCTATCCGCGCGGGCCTTCTGACAGATACCTACCTTGAAGCTCAACATGTAAATCAACACAAAAGAGCGTACGATGACTTGGTCTTTGATGCGAAGACATTTCGAAGAATCGAGCA{AT}CACAAGCATTCTGGTCACATGTATGAATATCTCTCGAGGTCCATCGCCCCGGAAATCTATGGTCATATG{CT}GAAGAAAGCGCTT{CG}TGCTCTTGATTGGCGTCCCAAATGGG{CG}GACGGAAT Melanohalea_elegantula_MEXASP3 ATCATTACTGAGAGAGGGGCTTCGCGCTCCC-GGGGTTTCGGTCCTAACCTCTTCACCCATTGTGTACCTTTGTTGCTTTGGCGGACCTTGCCCGCTCCGGCTTTGTCGCCGGTGAGTGTCCGTCAGAGGCCCATCAAAACCCTGTATCATGTCCGAGCCAAAATAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTTTGAAAGCCCCGCGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGCGGCTCGAGCC{CT}ATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTC{GT}GGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATGGCTGGTGGGACCCGAAAGA{CT}GGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATTGTTACGATGATGCAACATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTACTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGAAGGCACAGGTATAGGCGAAGGCATCTCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGTTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGATCGATGTGGTTGTGAGATATTTCAGCCCGTCACCTCAAAGCAATTTACACCAATGACGGAATGTCCCTCGGACGAATGCAAGCAGAACAACTCGAAGGGTCAATTGTTTCTGTCGACTCGAGCATCGAAGTTCCTGCCGTTCCAGGAAGTCAAGATACAGGAGATGGCCGACCAAGTACCTGTTGGCCATATTCCCCGGACTCTAACCATACACTGTCATGGAACTCTGACGAGGCAGATAAATCCTGGCGACGTCGTAGACGTTGCTGGCATTTTCCTTCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCGGGCCTTCTAACAGATACCTATCTTGAGGCTCAACATGTTAATCAACACAAAAAAGCATACGATGACTTGGTATTTGATGCCAAAACCTTCCGAAGGATCGAACAATACAAGCATTCTGGTCATATGTACGAGTACCTCTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCATTGCTGCTTCTGATCGGTGTCACGAATGGGCGACGGAAT Melanohalea_elegantula_MSP5 ATCATTACTGAGAGAGGGGCTTCGCGCTCCC-GGGGTCTCGGCCCTGAACTCTTCACCCATTGTGAACCTTTGTTGCTTTGGCGGACCTTGCCCGCCCCGGCTATGTGGCCGGTGAGTGTCCGTCAGAGGCTTATCAAAACCCCGTATCATGTCCGAGTCAAAATTAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGTCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTTTGAAAGCCCCGTGGCCGGCCAGACAACCCCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATGGCTGGTGGGACCCGAAAGACAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATTGTAACGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTACTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGAAGGCACAGGTATAGGCGAAGGCATCTCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGTTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATCTTGGTGCGATCGATGTGGGT{AG}TGAAATCTTC--ACCGATCACTACCTAACAGTTCACGCCAATGCAAGT{AT}TGCCCCTCGCACGA{AG}TGCGAAGC{AG}AACAACTCCAAAGGCCAATTGT{AT}TCTGTCGACGCG{AC}GCATCGAAATTCCTGCCATTTCAAGAGGTCAAAATCCAAGAGATGGCCGATCAAGTACCTGTTGGACATATTCCGAGACAATTGACCATCAACTGTCACGGATCCCTCACGAGGCAGATCAATCCTGGCGATGTGGTCGATATTGC{AC}GGA{AG}T{CT}TTC{CT}T{GT}CCCACTCCGTACACCGGTTTCCAAGCAAT{CT}CGGGC{CG}GGTCTTCTTACAGACACGTACCTCGAGGC{AT}CAGAACTTTACCCAGCATAAAAAAGCCTACCAGGATCTTGTGATGGACGCCGAGGCATTTCGAAGAATTGAGCAGTACAAGCA-TCTGG{ACT}CACATGTACGAATACTTGGCTCGGTCGATTGCTCCGGAAATTTATGGCCACATGTGAAAAAAGCACTCCTGTCTCTTATTGGGGTCA{AC}AGATTGGAGACGGCAT Melanohalea_exasperata_MEXASP4 ATCATTACTGAGAGAGGGGCTTCGCGCTCCC-GGGGTTTCGGCCCTAACCTCTTCACCCATTGTGTACCTTTGTTGCTTTGGCGGATCTTGCCCACTCCGGCTTCGTCGCCGGCGAGCGTCCGTCAGAGGCTCAATCAAACCCTGTATTATGTCCGAGTCAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCTTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTTTGAAAGCCCCGCGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGCGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCGGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGCGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATGGCTGGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATTGTAACGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTACTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGAAGGCACAGGTATAGGCGAAGGCATCTCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGTTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--ATGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTCTTTTTCTTCTTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCACTATATTGGTGCGATAGATGCGGATGTGAGAT-TTTCAGCCG-TGACTACCAAACAATTC{AT}CCCCAATGGT{GT}GAATGTCCCTCAGAAGAATGC{AC}AGAAGAATAACTCCAAGGGGCAACTTTTTCTCTC{GT}ACGCGCGCCTCGAAGTTCCTACC-TTTCAAGAAGTCAAGATTCAAGAGATGGC{AG}GATCAAGTTCC{AC}GT{CT}GG{AT}CACATTCCTCGGCAGCTGAC{AG}ATTCATTGCCACGGT{AG}{CG}TCTGGT{GT}CGGCA{AG}ATCAA{CT}CCTGGAGATGTG{AG}TTGACGT{AG}GC{CG}GG{AC}ATTTTCCTGCCCACTCC{GT}TACACCGGCTTCAAAGC{AT}ATCAGAGC{GT}GGACTGCTCACAGACAC{AT}TACCTCGAAGCTCA{AG}CACGTT{AC}{AG}{CT}CAGCACAAGAAAGC{CG}TA{CT}{CG}A{AT}GAC{AC}TG{AG}TC{CG}TTAG{CG}ACTC{CG}{AT}ACCATCCG{AC}CGAATGGA{CG}{CG}AAC{AT}T{AG}AACAGTC{AT}GGTCACATGTATGAATA{CT}CTGTC{AC}CGCTCCAT{AT}GCCCCAGAAATCT{AT}CGGTCATA{CT}GTCAAGAAGGCGCTT{CT}TGCTGCTGATTGGAGT{AC}ACAGATGGGAGACGGCAT Melanohalea_exasperatula_MEXTULUS NNNNNNNNNNNNNNNNNNNNNNNNCGCTCCC-GGGGTTTCGGCCCTAACCTCTTCACCCATTGTGTACCTTCGTTGCTTTGGCGGACCTTGCCCGCTCCGGCTTTGCAGCCGGCGAGTGTCCGTCAGAGGCCCATCAAAACCCTGTATCATGTCCGAGTTCAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGAAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTTTGAAAGCCCCGCGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGCGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCGGGCGGTTGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGCTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACCATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATGGCTGGTGGGACCCGAAAGATGATGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAAGGAATGTATAGCAGTAGCTAGTTGCATCATTGTAACAATGATGCAACATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTACGAGGGGGCATTAAAGTACTACTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGAAGGCACAGGTATAGGCGAAGGCATCTCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGTTACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGCGATCGATGCGGATGTGAGGTTTTCCAGCC{GT}ATCACCACAAAGCAATTCACACCAATGATNGAATGCCCTTCG{ACG}CAGAATGCAAACAGAATAACTCGAA{AG}GGTCAACTTTTCCTATCCACAAGAGCTTCAAA{AG}TTTCTTCCTTTCCAAGAAGTCAAGATCCAAGAAATGGCCGATCAGGTGCCCGTTGGTCACATCCCGCGAACTTTGACCGTACATTGCCACGGAACTCTCACAAGACAGATCAACCCGGGAGATGTGGTTGACATTGGTGGAATATTCCTACCTACGCCTTA{CT}ACCGGTTTCAAAGCCATCAAAGCAGGTCTGCTAACAGACACCTACCTAGAAGCGCAACAGGTCAACCAGCATAAGAAAGCTTATGACTCC{AT}TGGTTTTCGATGCC{AG}AGACCTTCCGAAGAATGGAGCAATTCAAGCATTCTGGCCA{AT}ATGTACGAATACTTTCCAAGGTCCA{AT}TGCTCCGGAAATTTATGGCCATGTGCAAGAAAGGCATTTTTGCTCTA{AC}ATTGGTGTGACAGATGGGTGATGGNNN Melanohalea_olivacea_MOLIVACEA ATCATTACTGAGAGAGGGGC-TCACGCTCCC-GGGGTTTCGGCCCTAAACTCTTCACCCATTGTTTACCTTTGTTGCTTTGGCGGACCTCGCCCGCGCTGGCTTTCGGGCCGGTGAGCGTCCGTCAGAGGCCCATTCAAACTCTGTATCATGTCCGAGTACAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATATCTCCCGCTCT-AAAGCCCCGTGGCTGGCCAGTCAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCACCCGTTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCCGGCGGGCGGATAAAGGTCTTGGGAATGTAGCTCTCGGGGGAGTCTTATAGCCCTCGATGCAATGCGCCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATTTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAATGGAGGTGAGAACCCTTATGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCAGAAATGTTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCGTCTTAAGGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTGTGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAAGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAATTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGGTCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTCTTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Melanohalea_septentrionalis_MSEPTEM ATCATTATCGAGAGAGGGGC-TCACGCTCCC-GGGGCTTCGGCCCTGAACTCTTCACCCATTGTTTACCTTTGTTGCTTTGGCGGACCTCGCCCGCGCTGGCTTCCGGGTTGGTGAGCGTCCGTCAGAGGCCCATTAAAATTCTGTATCACGTCCGAATAAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTCT-AAAGCCCCGCGGCTGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACTGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGCGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGCGATCA{AG}CCGTTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCGGGCGGGCGGATAAAGGTCTTGGGAATGTAGCTC{CT}CGGGGGAGTCTTATAGCCCTCGATGCAATGCGCCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATNTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTATGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCAGAAATGTTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCGTTGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTCCTTATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTGGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTT{AT}ATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAA{GT}TACCCCCAATG--GGTAGACCCC---GGCGATCGCAAAGGCAACAAAATCAAGGGTCAATTATTCNTGTCGACTCG{AT}GCTTCAAAGTTCCTACCCTTCCAAGAAGTCAAGATACAAGAAATGGCGGATCAAGTCCCTGTTGGCCACATTCCTAGGACATTGACTGTACACTGCCATGGTNCTCTGACAAGACAGATCAATCCCGGGGACGTCATTGATGTTGCCGGGATCTTCCT{CT}CCAACTCCATACACCGGCTTCAAGGCCATCCGTGCAGGTTT{AG}CTGACAGATACTTATCTTGAAGCTCAACATGTCAATCAACATAAGAAAGCCTA{CT}GACAATAT{AG}{AG}CATTTGACGCCAAAACTTTTCGAAGGATCGAACAAT{AT}CAAGAACTCCGGCCA{CG}ATGTATGAATATCTNTCGCGTTCCANNNCGAGGGNNNTCNNGGGTN--A{AT}GTCAAGAAAGCACNNCTCCTNCTANNAGGNTGNACANNTGGGTGATGGGAT Melanohalea_subelegantula_MSUBELE ATCATTATCGAGAGAGGGGC-TCACGCTCCC-GGGGTTTCGGCCCCGAACTCTTCACCCATTGTTTACCTTTGTTGCTTTGGCGGACCTCGCCCGCGCTGGCTTTCGGGCTGGTGAGCGTCCGTCAGAGGCCCATCAAAACCCTGTATCATGTCCGAGTAAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCGGGTTTAAGCGTAGTAAATTTCTCCCGCTCT-AAAGCCCCGCGGCTGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACTGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGTGACCGCGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGCGATCACCCGTTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCGGGCGGGCGGATAAAGGTCTTGGGAATGTAGCTCTCGGGGGAGTCTTATAGCCCTCGATGCAATGCGCCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATTTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCAGAAATGTTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCC{AC}CCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCNCAATTTGAATATTTATATTTTTTTTTTCTTATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Melanohalea_subolivacea_MSUBOLI6 ATCATTACCGAGAGAGGGGCTCCGCGCTCCC-GGGGTTTCGGCCCCGAACTCTTCACCCTTTGTTTACCCTTGTTGCTTTGGCGGACCTCGCCCGCGCTAGCCTCCGGGCCGGTGAGCGTCCGTCAGAGGCCCATCCAAACCCTGTATCACGTCCGAGCAAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAATAAAATTTTCCCGC-TTGCAAGCCCCGCGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCCCAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAACCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCAGGCCAGCATCGGTTCGGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTGTCGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATACTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATCTTAAGGATGATGCAAAATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTTCTATCAATAGAAAAAAGACGGCACGGGTATAGGCGAAGGCATCTCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGTTACCCCAGTAGTCTAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTATCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATTATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTTATAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTACAGTTAATGTCGTGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCTCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Melanohalea_trabeculata_METR1078 ATCATTATCGAGAGAGGGGCTTCGCGCTCCC-GGGGCTTCGGCCCCGAACTCTTCACCCTTTGTCTACCTTTGTTGCTTTGGCGGACCCCGCTCGCGCTGGCTTCCGGGCCGGTGAGCGTCCGTCAGAGGCCCATTAAAACCCTGTATTACGTCCGAG-AAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGGGGCGAGCCCGAAAAGTGGCGGGCCGGTTTAACCGCGGGAATCATAGCCCGC--TGAACTCGCCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACCCATGAGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCACCTCTAAATGGGTGGTAAATTTCATCTANAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACG{CT}GAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCACCCGCTGTTCTCAGCGGTGCACTCGTTCTGCGATCGGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCTTGGGAACGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTTGGGTGTCAA{AC}CCCATGCGCGAAATGAAAGTAAACGGAGGTGAGAACCCATTTGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCGTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGT-CTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAG--AGGTAATTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTCTTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG{CT}GACCGATGCGGCTGCGAAATCTTCCAACCTGTC{AT}CTACTAAGCAATTCACTCCCATGAGATG{CG}TG{CT}CCTTCCGAGGA{AG}TG{CT}ACC{AC}AGAACAA{CG}{AT}CCAA{AG}GGTCAA{CT}TGTTCCC{AT}TCCACTCGCGCCTCCAA{AG}TTCCTTCC{AT}TT{CT}CA{AG}GAAAT{CT}AAGATTCAAGAGATGGCCGATCAGGTGCCCGTTGGTCACATTCCCAG{AG}CAACTGACCATTCACTG{CT}CACGGCAGTCTC{AG}CTCG{CG}CAAATCAATCCCGG{CT}GA{CT}GTGGTGGACATTGCCGGCATTTTCCTACCCACTCCCTACACTGGCTTTCGAGCCATCCG{AT}GCAGGCCTATTGACAGATACCTACCTCGAAGCACA{AG}CATATCACTCAGCACAAAAAGGCCTACCAGGATCTGAAGATGGATCCTCGCGTGATCCGACGCATCGAGTCTTTCAAAGC{CT}TCTGGACATATGTACGAATA{CT}CTGGCTCGCTC{AG}ATCGCCCCTGAAATCTACGGACATATGTCAAGAAAGCTCT{CT}CTCCTGCTGATCGG{CT}GT{AG}ACCAATGGGCGACGGCAT Myelochroa_irrugans_MIRRUGAN ATCATTACCGAGAGA-GAGCTCCGCGCTCCCGGGGGCTTCGGCCCTCAACTCTTCACCCGTTGTCTACCCCCGTTGCTTTGGCGGGCTCCGCCCGCG----------------------CCCGTCGGAGGGCCATCTAATCC-GTTATAACGTCCGAGTCACTAT-AATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTACTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTCTTGGGCTTCGCCGCGCGGCGGGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATAGATCCCGCTCTGAA-GCCCCGGGTCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGCAGAGAGTGCTTCGGGCGAGACCGCGGTCTAAGTCCCTTGGAACATGGCGTCAGAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAGCCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCCAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCCCCACGATCAGGCCAGCATCGGTTTCGGCGGCTGGATAAAGGCCCTGGGAATGTAGCTTTCGGGGGAGCCTTATAGCCCTCGGCGCAATGCGGCCCGCCGAGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCGATGCGAGTGTTTGGGTGTCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATCGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATANNNNNNNNNNAGCAATAGCTACTTGCATCATTGCAAAGATGATGTAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTGCTAGAGTTACTTATGAGGGGGTTATAAAGTACTGGTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCCAAAGAAAAGTCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGACCAGGATTAGATACCCCAATAGTCGGAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGACCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTATTCTTGTTAATTTTAATTGAGGCAGTAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGTTGCGAGATATTCCAGCCTGTCACCTCAAAGCAATTTACCCCAATGACGGAATGCCCGTCAGAAGAATGCAAGCAGAACAATTCCAAGGGTCAACTGTTTTTGTCAACTCGAGCATCGAAATTTCTGCCATTCCAAGAAGTCAAAATACAGGAGATGGCAGATCAGGTACCCGTTGGCCATATTCCACGGACACTGACTGTTCACTGTCATGGATCCTTGACGAGACAAATCAATCCCGGCGACGTCGTTGACATTGCGGGGATCTTCCTCCCAACTCCATATACCGGATTTAAAGCTATTCGGGCTGGTCTTCTGACGGACACCTACCTGGAAGCTCAATACGTAAATCAACACAAAAAGGCATACGATGACCTAGTCTTTGATGCCAGGACGTTTCGAAGAATCGAGCAATACAAACATTCTGGTCATATGTATGAGTACCTCTCAAAGTCCATCGCTCCCGAAATCTATGGCCACATGTGAAGAAAGCACTTCTACTCCTGATCGGTGTAACAAATGGGGGACGGCAT Parmelia_saxatilis_PARMSAXA NNNNNNNTCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCTTACCTCTTCACCCATTGCTAATTCTTGTTGCTTTGGCGGATCGCGCTCGCGTCGATCTACCGATCGGTGAGCGTCCGCCAGAGGCTTATTAAATTCTTTTATTACGTCCGAGTAAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATACCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGTCTCGCCCCGCGGCATGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGTTTTGAAAGCCCTGTGGCCTGCCAGACAACCCTGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGAGTGCGGTCTAAGTCCGTTGGAACACGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGCGGCTCGAGCCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTTGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATTCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATANGAATAGCTACTGGCATCATCGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCTAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGTTCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTGTTTTCATTAGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGGTGTGGTTGCGAGATCTTCCAACCTGTTACCTCAAAACAATTCACCCCAATGACAGAATGTCCCTCAGAAGAATGCAAGCAGAACAATTCCAAGGGTCAGCTATTCTTGTCAACACGTGCATCAAAGTTTTTGCCATTCCAAGAAGTCAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCACATCCCTCGGACATTAACTGTTCATTGTCATGGAACCTTGACAAGACAGATTAATCCTGGCGACGTCATTGATGTTGCGGGAATCTTCCTCCCAACTCCTTACACAGGCTTCAAAGCTATTCGGGCTGGTCTTCTGACGGACACCTACCTCGAGGCTCAACATGTTAACCAGCACAAAAAGGCGTACGATGACCTAGTCTTTGATGCCAAGACGTTTCGAAGAATTGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTCTCGAGGTCCATCGCTCCGGAAATCTATGGTCATACGTGAAGAAAGCGCTTCTGCTCCTGATTGGTGTCACAAATGGGCGACGGGAT Parmelia_serrana_PSERRAN2 ATCATTATCGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCTACCTCTTCACCCATTGCTAATTCTTGTTGCTTTGGCGGATCGCGCCCGCGCCGATCTACCGGTCGGTGAGCGTCCGCCAGAGGCCTATTAAACTCTTTTATTACGTCCGAGTAAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATACCTGTTCGAGCGTCATTGCACCCCTCAAGCGCAGCTTGGTATTGGGTCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTTCTCCCGCTTTGAAAGCCCCGTGGCCTGCCAGATAACCCTGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGAAGAGTGCGGTCTAAGTCCGTTGGAACACGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGCGGCTCGAGCCCGTGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGTCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGACCCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCAAAGTAAAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATGATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCTAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGTCCCGCAAAAAACCTTACCACAATTTGAATATTTATATTTTTTTTTTCTTATTGTTTTCATTAGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGGTGTGGTTGCGAGATATTCCAACCTGTCACCTCAAAACAATTTACCCCAATGACAGAATGTCCCTCAGAAGAATGCAAGCAGAACAATTCCAAGGGTCAGCTATTCTTGTCAACACGTGCATCAAAGTTTTTGCCATTCCAAGAAGTCAAAATACAGGAGATGGCTGATCAAGTACCTGTTGGCCACATCCCTCGGACACTAACTGTTCATTGTCATGGAACCTTGACAAGACAGATCAATCCTGGCGACGTCATTGATGTTGCAGGAATATTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATTCGGGCTGGTCTTCTGACGGACACCTACCTCGAGGCTCAACATGTCAACCAGCACAAAAAGGCGTACGATGACCTAGTCTTTGATGCCAAGACATTTCGAAGAATTGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTTTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTGCTTCTGATTGGTGTCACAAATGGGCGACGGGAT Parmeliopsis_hyperopta_PHYPEROP ATCATTATCGAGAG--GGGCCTCGTGCTCCCGGGGGTTTCGGCCCCTAACTCTTCACCCATTGTTTATCTTTGTTGCTTTGGCGGGCCACGCCCGCGCTGGCTCTTGGGCCGGCGAGCGCCCGTCAGAGGCCCATCAAATTCTTTTATTTTGTCCGAGTAAACGCAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCGTAGCTTGGTATTGGGCGTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTGAGCGAAGTAAACAAATCCCGCTTTGAAAGCGCTGCGGCCTGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGCGGCGCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTGGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGTTCCGCGATCAGGCCAGCATCGGTTCTGGCGGTTGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTTAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGCACAGATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAAATCAAGCTTTGTACTAATTTGCTAGAGTTACTTATGAGGGGGTTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTTTTTTCAAAAGAAAAATTATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTATTTTTTTCTTATTAATTTTAATTGAGACAATAAGATATATCTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGTTGCGAGATATTTCAGCCTGTCACCTCAAAACAATTTACTCCAATGACGGAGTGCCCCTCAGATGAATGCAGGCAAAATAATTCCAAGGGTCAATTATTCCTATCAACGCGAGCATCCAAATTCCTGCCATTCCAAGAGGTCAAGATACAGGAAATGGCCGATCAAGTACCTGTTGGCCACATCCCTCGGACACTGACTGTTCACTGTCATGGCAGCTTGACGAGACAAATTAATCCTGGTGACGTTATCGACGTTGCAGGAATCTTCCTTCCAACTCCGTACACAGGCTTCAAAGCTATTCGTGCTGGTCTTCTGACGGATACCTATCTCGAGGCTCAACATGTTAATCAACACAAAAAGGCGTACGATGACTTGGTCTTTGATGCTAAGACGTTCCGAAGAATCGAGCAATACAAGCATTCTGGTCATATGTATGAGTACCTATCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTCTTCTCCTGATTGGCGTCACAAATGGGCGACGGAAT Parmotrema_reticulatum_RCLAVUL ATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGATCTCGGCCCCCAACTCTTCACCCTGTGTGTATCTTTGTTGCTTTGGCGGACCTTGTCCGCACCGGCTTTCGGGTCGGTGAGTGTCCGTCAGAGTCCTATTTAATTCTTTTATCCCGTCCGAGTTAAACTAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTTAGCTTGGTATTGGGCCTCGTCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGATTTAAGCGTAGTAAATCAATCCCGCTTTGAAAGCGTCGTGGCTCGCCAGACAACCCTGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGTGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGCCCGTAGGCGATCAGTCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGTATCATTAAT-----GATGCAAGCTCGACTATGTTGAATAAAGTTCTAGGTAGAATTATGATGATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGACTAATTCGCTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAATAATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCGTGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTCTTTTTATCTCATTAATTTTGATTGAGGCAATAACATATATGTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGTTGCGAGATCTTTCAGCCTGTCACTTCGAGGCAATTCACTCCAATGACAGAATGCCCCTCAGAAGAATGCAAGCAGAACAACTCAAAGGGTCAATTGTTTCTGTCAACGCGAGCATCGAAGTTCTTGCCATTTCAAGAAGTTAAGATACAGGAAATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACCCTAACCGTTCACTGTCATGGAAGCTTGACGAGACAGATAAATCCTGGGGATGTCATAGACGTTGCGGGAATCTTCCTTCCGACCCCATATACAGGCTTTAAAGCCATCCGTGCTGGTCTTCTGACAGATACCTATCTCGAAGCTCAACATGTCAACCAACACAAGAAAGCCTACGATGACTTGGTCTTTGATGCCAAGACGTTCCGCAGAATCGAGCAGTACAAACATTCAGGTCACATGTACGAGTACCTCTCGAGGTCCATCGCTCCAGAAATCTATGGTCATATGTAAAAAAAGCACTTTTGCTGTTGATCGGTGTCACAAATGGGTGACGGAAT Parmotrema_subtinctorium_CSUBTIN ATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCATCTCCTCACCCTGTGTGTATCTTTGTTGCTTTGGCGGACCTCGCTCGCACTGGCTTTAGGGTCGGTGAGCGTCCGTCAGAGGCCCATTTAATTCTTTTATTTCGTCCGAGTCAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCATTCAAGCTTGGCTTGGTATTGGGCCTCGCCCTGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATCAATCCCGCTTTGAAAGCGTCGAGGCTTGCCAGGCAACCCCGGGATTACCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGGGGGACCGCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGTGACCGCGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTCGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGTATCATTAAT-----GATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTGAATCAAGCTTTGGACTAATTCGCTAGAGTTACTTACGAGGGGGCTTTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAGAATAACGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTCATGTAACAAACAGGATTAGATACCCTAGTAGTTGAAGCAGAAAATGATGAATGTCATAGATTAGACGTCTAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAATTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTATTTTTATCTTATTAATTTTAATTGAGGCAATAACATATATCTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTAGATTGGTGTGATCGATGTGGTTGCGAGATATTTCAGCCTGTCACTTCGAGGCAATTCACTCCAATGACAGAATGCCCCTCAGAAGAATGCAAGCAGAACAACTCAAAGGGTCAATTATTTCTATCGACGCGAGCATCGAAGTTCTTGCCGTTTCAAGAAGTCAAGATACAGGAAATGGCCGATCAAGTACCTGTTGGCCATATCCCTCGGACACTAACTGTTCACTGTCATGGAAGCTTGACGAGACAGATAAATCCTGGGGATGTCATAGATGTTGCGGGAATCTTCCTTCCGACCCCATATACAGGCTTTAAGGCCATCCGTGCTGGTCTTTTAACGGATACTTACCTCGAAGCTCAACATGTCAATCAACACAAGAAAGCGTACGATGACTTGGTCTTTAATGCCAAAACGTTTCGCAGAATCGAGCAGTACAAGCATTCAGGTCACATGTATGAGTACCTCTCGAGGTCCATCGCTCCAGAAATCTATGGTCATATGTAAAGAAAGCGCTTCTGCTGTTGATTGGTGTCACAAATGGG-GACGGAAT Pleurosticta_acetabulum_PACETA2 ATCATTACCGAGAGAGGGGCTTCGTGCTCCCGGGGGCCTCGGCCCCCAACTCTTCACCCATTGTTTATCTTTGTTGCTTTGGCGGGCCTCGCCCGCGCTGGCTTTCGGGCCGGTGAGCGCCCGCCGGAGGCCCATTAAACCCGTTAATCACGTCCGAGCAAAAAC-AGTAAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCTTAGCTTGGTATTGGGCTTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTCAAGCGTAGTAAATTTATCCCGCTTCGAAAGCCCCGCGGCTTGCCAGACAACCCCGGGNNTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGGGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGATCGAACCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTGGCAACCAGACCTGTCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGCGCTGCGATCAGGCCAGCATCGGTTTTGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTCTCAGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTCAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTATAAAAATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCTTTGGACTAATTTACTAGAGTTACTTACGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAATTACGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATGTTTTT-ATTTCTTATTAATTTTAATTGGGGCAATAAAACATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Relicina_sydneyensis_RESY663 ATCATTATCGAGAGGGGAGCCTCGTGTCCCCGGGGGTTTCGACCTCCTACCCTCTACCCGTTGTCTACTTTTGTTGCTTTGGCGGGCTCGGCCCGCGTCGGTATC--GTCCGGCGAGCGCCCGTCAGAGGCCCATTAAATTCCTTGATCGCGTCCGAGTGTGTACTGTTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATCGCACCCCTCAAGCCCAGCTTGGTATTGGGTCTCGCCCTTTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGCAGTAAATTCATCCCGCTTCGAAAGCTCCGCGACTGGCCAGATAACTCCGGGATTGCTTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCTCGGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGGCCGAGCCCATATGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGCGGGCGATCAGCCGCTGTTCTCAGCGGTGCACTCGTTCCGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTCTTGGGGGAGTTTTATAGCCCTTGGTGCAATGCGTCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGGTGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTATCAAACCCACACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTGAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGGGTATGAGCATAGCTGTTGCGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAATGATGATGCAAGCTCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGCGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATAAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGCATTAAAGTACTGCTGGTGTAGAGATGAAATTCTTTTATACCTATTCTGTATGGGGACAT-ATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTATAGCGAACAGGATTAGATACCCTAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATGTATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTATCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAACCCGCAAAAAACCTTACCACAACTTGAATATTTATAATTAG-CTTTTTTTTT-----------AGGCAATACATTGTATTTACAAGTGTTGCACGGCTGTCTTCAGTTAATGTCGTGAGATGTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCACTAGATTGGTGTGATCGATGCGGTTGCGAGATATTTCAGCCTGTAACCTCAAGGCAATTTACGCCAATGACGGAATGCCCCTCGGAAGAATGCAAGCAGAACAATTCCAAGGGTCAGCTATTCTTGTCAACACGAGCATCGAAATTTCTGCCGTTCCAGGAAGTGAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATCCCTCGGACACTGACTGTTCATTGTCATGGAACCTTGACAAGACAGATCAATCCTGGCGATGTCATCGATGTTGCGGGAATCTTTCTACCGACTCCCTACACAGGCTTCAAAGCTATCAGGGCCGGTCTCCTAACGGATACCTACCTCGAGGCTCAAAGTGTTAATCAACACAAAAAGGCGTACGACGACCTAGTCTTTGATGCCAAGACGTTCCGAAGAATCGAGCAATATAAGCATTCTGGTCATATGTATGAGTACCTCTCGAGGTCCATTGCTCCAGAGATCTATGGTCATATGTGAAGAAAGCACTTCTGCTCTTGATCGGTGTCACAGATGGGCGACGGAAT Remototrachyna_crenata_HCRENATA ATCATTATCGAGAAGGGGGTTT---ACCCCCAGGGGCTTCGG-TCCTTACTCTTCACCCTATGTTAACCTTTGTTGCTTTGGCGGGTGCCG------CTACCCTT------------CGCCCGCCAGAGGCCTACCAAATTCATTGATCTAGTCCGAGT-CAAACATATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCCTTGCTTGGTATTGGGCTTCGCC-TGAGGCGTGCCCGAAAAGTGGCGG-CCGATTTGAGCGCATTCAA---ATCCTTCTCAGGAAACCCTGTGGCCTGCCAACGAACCCCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCCCCTGGGTCCGAGTTGTAATTTGTAGAGAGTGTTTCGGGTGAGTCCGCGGTCTAAGTCTATTGGAACATAGTGTCACAGAGGGTGAGAATCCCGTATGTGGCCGCGGTACGAGTCCATGTGAAACCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGTTTGCAACCAGACTTGCCCGTAGGCGATCAGTCGCTGTTCTCAGCGGTGTACTCGTCCTATGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGTAATGCGGCCAGCCGAGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAACGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGATCCCTCGAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTACATTATAGTAATAATGATGTAAGATCGACTTAGTCGAATAAAGTTCTAGGTATAATTTTGATAATGACATTATATGCCTATGTGTCTTGACCAA-TTACGTGCCAGCAGTCGCGGTAATACGTATAAGGCTAGCGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGCAGATCAAGCTTAGGACTAATCTGCTAGAGTTACTAGTGAGGGGGCTATAAAGTACTGCTGGTGTAGGGATGAAATATTTTGATACCT-----------GAAAATTATGGCACAGGTAAAGGCGAAGGCATCCCCTTATGAGATAACTGACGTTGAGGGACGAAGGCTTCGGACCACGAACAGGATTAGAGACCCTGGTAGTTGAAGCAGTAAACGCTGAATGTCATAGATTAGATATATAAGTTTCTTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAATTAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAGAACCTTACCACAATTTGAATATTTACATTGCTTTTATGTCATTAGTTTCAGTTGAAGCAATAACATGTACTTACAAGCGTTGCACGGCTGTCGTCAGTTGATGTCGCGAGACTGTGGTTTACTCCACT-AATCAACGTAAACCCTCGCTTTATTTTTAGATAAAGCAGTCACCGATATGGTGGTGCGATCGATGCGGTTGCGAGATATTCCAGCCTGTCACCGCCAAGCAATTTACCCCAATGACAGAATGCCCATCAGAAGAGTGCAAACAAAACAACTCAAAAGGTCAGTTGTTTTTGTCGACGCGAGCATCCAAGTTTCTACCATTCCAAGAAGTCAAGATACAGGAGATGGCAGACCAGGTACCTGTTGGCCATATTCCTCGGACACTGACTGTACATTGCCAAGGAACCCTGACAAGACAAATCAATCCAGGCGACGTCATCGATGTTGCGGGGATCTTCCTTCCTACCCCATATACAGGCTTCAAAGCTATTCGGGCTGGTCTTCTGACGGATACGTACCTGGAGGCCCAACATGTTAATCAACATAAGAAGGCGTACGATGACCTGATATTTGATGCCAAGATGTTCCGAAGAATCGAGCAGTACAAGCATTCTGGTCACATGTATGAGTATCTTTCGAGGTCTATCGCTCCGGAAATCTATGGCCATATGTGAAAAAAGCGCTTCTACTCCTGATTGGTGTGACAAATGGGCGACGGTAT Tuckermanopsis_chlorophylla_CETRCHLO NNNNNNACTGAGAGAGGGGC-----------------TTCGGTTCCCAACTCTTCACCCATTGTCTACCTATGTTGCTTTGGCGGGCCTCGCCCGTGTCGGCTTACCGGTCGGCGAGCGCCCGTCAGAGGCCCATTAAATTCTTTTATCACGTCTGAGCAAAAACAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAATTCATCCCGCTTTGAAAGCCCCGTGGCCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCAGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGTGACTGTGGTTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGTGGCGCACTCGCTCTACGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTCTCCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTACGCGAGTGTTTGGGTGTTAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCGTAGCTGTTGGGACCCGAAAGACAGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAACAATGGCACAGGTATAGGCGAAAGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCAAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAATTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTTTTTTTCTTTTTAACTTTAAAGTAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTATGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTCCAGCCTGTCACCTCAAAGCAATTTACTCCAATGACGGAATGCCCCTCGGATGAATGCAAGCAGAACAATTCCAAAGGGCAATTGTTCCTGTCAACGCGAGCATCAAAATTCCTGCCATTTCAAGAAGTTAAGATACAGGAGATGGCTGACCAAGTACCCGTTGGCCATATCCCTCGGACACTGACTGTCCATTGTCATGGAACTTTGACAAGACAGATCAACCCTGGCGATGTCATCGATGTTGCAGGGATCTTCCTCCCAACTCCATACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTGACGGATACATACCTCGAGGCTCAACATGTTAATCAACACAAAAAGGCGTATGATGACCTTGTCTTTGATGCCAAGACGTTCCGAAGAATCGAGCAATACAAGCATTCAGGCCACATGTATGAGTACCTCTCCAGATCCATTGCTCCGGAAATTTATGGCCATATGTGAAGAAGGCGCTTCTGCTTCTAATTGGTGTCACAAATGGGCGACGGAAT Vulpicina_pinastri_VULPPINA NNNNNNNCTGAGAGAGGGGCTTCGCGCTCCCGGGGGTCTCGGCCCCCAACTCTTCACCCATTGTGTACATTTGTTGCTTTGGCGGGCCCCGCTCGCGCT-GCCTACAGGGCGGCGAGCGCCCGCCAGAGGCCCATCAAAATCTTTTATCGTGTCCGAG-GAAAACAAATCAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCTCGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATACCCCTCAAGCGTAGCTTGGTATTGGGCCTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAAAATCATCCCGCTTCGAAAGCCTCGCGACCGGCCAGACAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAGTTGTAATTTGTAGAGAGTGCTTCGGGTGAGACCGCGGTCTAAGTCCATTGGAACATGGCGTCATAGAGGGTGAGAATCCCGTATGCGACTGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGTCCGTAGGTGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTCTGGCGGTCGGATAAAGGCCTTGGGAATGTAGCT--CCGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCTGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTACAACTTATGCGAGTGTTTGGGTGTTAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAATTCGTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAA{AG}CCAGA{AG}GAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATTGTAAATATGATGCAAGATCGACTATGTCGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAAATCAAGCCT-GGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAATAGAAAAATAATGGCACAGGTATAGGCGAAAGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCAAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATCTTTTTTTTCTTTTTAACTTTAAAGGAGACAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTATGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGATGCGAGATATTCCAGCCTGTCACCTCAAAGCAATTTACCCCAATGACGGAATGCCCCTCGGATGAATGCAAGCAGAACAACTCTAAGGGTCAATTGTTTCTCTCAACGCGAGCATCAAAATTTCTGCCATTTCAAGAAGTTAAGATACAGGAAATGGCTGACCAAGTTCCCGTTGGCCATATCCCTCGGACACTGACTGTTCATTGTCATGGGACTTTGACACGACAGATCAACCCTGGCGATGTCATCGATGTTGCGGGGATCTTCCTCCCAACTCCGTACACAGGCTTCAAAGCTATCCGTGCTGGTCTTCTGACGGATACATATCTCGAGGCTCAACACGTCAATCAACACAAAAAGGCGTACGATGACCTAGTTTTTGATGCTAAGACGTTTCGAAGAATTGAACAATACAAGCATTCAGGTCACATGTATGAGTACCTTTCCAGGTCCATCGCTCCGGAAATTTATGGCCATATGTGAAGAAAGCGCTTCTGCTCCTAATCGGTGTCACAAATGGGTGACGGAAT Xanthoparmelia_isidiovagans_XNEGRA ATCATTACCGAGAGAGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCTAACTCTTCACCCTTTGCGTATCTTTGTTGCTTTGACGGGCCCGACTCGCGTCGACT-------CGGCGAGTGTCCGTCAGAGGCCCATTCAATTCTTTCATTACGTCTGAGTCAATACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGCAGCTTGGTGTTGGGCCTCGCCCCGCGGCGTGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAACATTCTCCCGCTCT-AGAGCGCCGTGGCCGGCCAAAGAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAATTGTAATTTGTAGAGAGTGCTTCGGGCGAGACCTCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGTACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGACCTTGGGAATGTAGCTTTCGGGGAAGTCTTATAGCCCTCGGTGTAATGCGGCCAGTCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATAGTAGATATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTGGACTAGTTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAACCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGTCCCGCAAAAAACCTTACCACAATTTGAATATTTATATTGTTTTTTTATTATTAATTTTAATTAAAGCAATAAGATATAATTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGNNNNNNNNNNGTGGTTGCGAGATATTTCAGCCTGTCACCTCGAAACAATTCACCCCAATGACCGAATGTCCCTCCCTAGAATGCCAGCAAAACAACTCCAAGGGTCAATTATTCCTGTCAACGCGAGCATCGAAATTCTTGCCGTTCCAAGAAGTCAAAATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATTCCTCGGACACTAACTATCCACTGTCATGGAACCTTGACAAGACAGATAAACCCAGGCGACGTCATTGATGTTGCAGGGATCTTCCTCCCTACTCCTTACACAGGCTTCAAAGCTATTCGTGCTGGCCTTCTAACAGATACCTACCTCGAAGCTCAACATGTTAATCAACATAAAAAAGCGTACGATGACTTGGTCTTTGATGCCAAGACGTTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTATCTCTCGAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTTTGCTCTTGATTGGCGTCACAAATGGGTGACGGAAT Xanthoparmelia_ovealmbornii_XOVEALBO NNNNNNATCGAGAGAGGGGCTTCGCGCTCCCGGGGGTTTCGGCCTCAAACTCTTCACCCCATGCGTACCTTTGTTGCTTTGGCGGTCCCGACTCGCGCCGGCTCTCGCGTTGGCGAGCGTCCGTCAGAGGCCTATTTCATCCACTTA--AAGTCCGAGTAAAAACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGCAGCTTGGTATTGGGCTTCGCCCCGTGGCGTGCCCGAAAAGTGGCGGTCCGGTTCGAGCGTAGTAAAATCTTCCCGCTCTGAA-GCGCCGCGGCTGGCCAGAGAA-CCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAATTGTAATTTGTAGAGAGTGCTTCGGGCGAGGCTTCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGTGGTGCACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGCCGGATAAAGGCCTTGGGAATGTAGCTTCCGGGGAAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGAAATGAAAGTGAACGGAGGTGAGAACCCTCAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATTGTAGATATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTAAGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTTTTAATGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCGAAAGAAAAACCATGGCACGGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTACATAGCGAACAGGATTAGATACCCCAGTAGCCGAGGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCAAGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATAATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTATTTTTTTATTATTAATTTTAATTGAGGCAATAAGATATATTTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGTTGCGAGATATTTCAGCCTGTCACCTCGAAGCAATTCACTCCGATGACGGAATGCCCGTCAGACGAATGCAGGCAAAACAACTCCAAGGGCCAACTGTTTCTGTCAACGCGAGCATCGAAGTTCTTGCCATTCCAAGAAGTCAAGATACAGGAGATGGCTGACCAGGTACCTGTTGGCCATATTCCTCGGACACTTACTGTTCATTGTCATGGAACCTTGACGAGACAGATAAACCCTGGCGATGTGATTGATGTCGCAGGGATCTTCCTCCCCACTCCTTATACAGGCTTCAAAGCTATTCGTGCTGGACTTCTAACAGATACCTACCTCGAAGCTCAACATGTCAATCAACACAAGAAAGCGTACGATGACTTGGTTTTTGATGCGAAGACATTCCGAAGAATCGAGCAACACAAGCATTCTGGTCATATGTATGAGTACCTTTCGAAATCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTTTGCTCCTGATTGGCGTCACAAATGGGGGACGGAAT Xanthoparmelia_stenophylla_XSOMLOEN ATCATTACCGAGAGAGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCTAACTCTTCACCCTTTGCGTACCTTTGTTGCTTTGGCGGGCCCGACTCGCGCCGACTCTTCGGCCGGCGAGTGTCCGTCAGAGACCCATTTAATTCTTTCATTACGTCTGAGTCAATACAAGTAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGCAGCTTGGTATTGGGCCTCGCCCCGCGGCGTGCCTGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAATATCTTCCCGCTCT-AGAGCGCCGTGGCCGGCCAAAGAACCCCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCGGGGTCCGAATTGTAATTTGTAGAGAGTGCTTCGGGCGAGACCTCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGTACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGTAATGCGGCCAGCTGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATACGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTACTTGCATCATAGTAGATATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTGGACTAATTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAACCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGATCCGCAAAAAACCTTACCACAATTTGAATATTTATATTGTTTTTTTATTATTAATTTTAATTGAAGCAATAAGATATAATTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGTTACGAGATATTTCAGCCTGTCACCTCGAAGCAATTCACCCCAATGACCGAATGCCCCTCCCCAGAATGCCAGCAAAACAACTCCAAGGGTCAATTATTCCTGTCAACGCGAGCATCGAAGTTCTTGCCGTTCCAAGAAGTCAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATTCCTCGGACACTAACTGTTCACTGTCATGGAACCTTGACAAGACAGATAAATCCTGG{CT}GACGTCATTGATGTTGCAGGGATCTTCCTCCCTACCCCTTACACAGGTTTTAAAGCTATTCGTGCTGGCCTTCTGACAGATACCTATCTCGAAGCTCAACATATCAATCAACACAAAAAAGCGTA{CT}GATGACCTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTCTCAAGGTCCATCGCTCCGGAAATCTATGGTCATATGTGAAGAAAGCGCTTTTGCTCTTGATTGGCGTCACAAATGGGTGACGGAAT Xanthoparmelia_tinctina_XTINC8 ATCATTACTGAGAGAGGGGCCTTGTGCTCCCGGGGGCTTCGGCCCCCAACTCTTCACCCTTTGCGTACCTTTGTTGCTTTGGCGGATCCGGCTCGCGCCGACCTTGGGGCCGGCGAGCGTCCGTCAGAGGCCCATTTAATCCTTTTTCCATGTCCGAGTAAACACAAATAAAAACTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTGCACCCCTCAAGCGCAGCTTGGTATTGGGTCTCGCCCCGTGGCGCGCCCGAAAAGTGGCGGTCCGGTTTAAGCGTAGTAACTTTTTCCCGCTCTGAA-GCGCCGTGGCCGGCCAATTAACCCAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCGGGGTCCGAATTGTAATTTGTAGAGAGTGCTTCGGGCGAGGCCTCGGTCTAAGTCCATTGGAACATGGTGTCATAGAGGGTGAGAATCCCGTATGCGACCGTGGCTCGAGCCCATGTGAAGCCTCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACCTGCCCGTAGGCGATCAGCCGCTGTTCTCAGCGGTGTACTCGCTCTGCGATCAGGCCAGCATCGGTTTCGGCGGTCGGATAAAGGCCTTGGGAATGTAGCTTTCGGGGGAGTCTTATAGCCCTCGGTGCAATGCGGCCAGCCGGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAACCCATGCGCGGAATGAAAGTGAACGGAGGTGAGAACCCTTAAGGGCGCATCATCGACCGATCCAGATGTCTTCGGATGGATTTGAGTATGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAAGGAATGTATAGCAATAGCTAGTTGCATCATAGTAGATATGATGCAAGATCGACTATGTTGAATAAAATTCTAGGTAGAATTATGATAATGACATTGTCTGCCTATGTGTCTTGACCAAATTACGTGCCAGCAGTCGCGGTAATACGTAGAAGACTAGTGTTATTCATGTTTAATCGGTTTAAAGGGTACCTAGACGGTAGATCAAGCTTTGGACTAGTTTACTAGAGTTACTTATGAGGGGGTATTAAAGTACTGCTGGTGTAGAGATGAAATTCTGTCATACCTCTTTTCAAAAGAAAAACCATGGCACAGGTATAGGCGAAGGCATCCCCTTATGTGATAACTGACGTTGAGGGACGAAGGCTTTGTGTAGCGAACAGGATTAGATACCCCAGTAGTCGAAGCAGAAAATGATGAATGTCATAGATTAGATATATAAGTTTATTCTATAAATGAAAGTGTAAGCATTCCACCTCATGAGTAATTTGGCAACATTGGAACTGAAATCATTAGACCGTTTCTGAAACCAGTAGTGAAGTATGTTGTTTAATTTGATGTTCCGCAAAAAACCTTACCACAATTTGAATATTTATATTGTTTTTTTATTATTAATTTTAATTGAAGCAATAAGATATAATTACAAGCGTTGCACGGCTGTCTTCAGTTAATGTCGCGAGACTTTGGTTAGTTCCATTAAATTAACGTAAACCCTTACTTTATTTTTATATAGAGTAGTCCCCGCTATATTGGTGTGATCGATGTGGTTACGAGATATTCCAGCCTGTGACCTCGAAGCAATTCACCCCAATGACCGAATGCCCCTCCGCAGAATGCCAGCAAAACAACTCCAAGGGTCAATTATTCCTGTCAACGCGAGCATCGAAGTTCTTGCCGTTCCAAGAAGTCAAGATACAGGAGATGGCTGATCAAGTACCTGTTGGCCATATTCCTCGAACACTAACTGTTCACTGTCATGGAACCTTGACAAGACAGATAAATCCAGGCGACGTCATTGATGTTGCAGGGATCTTCCTCCCTACTCCTTACACAGGCTTCAAAGCTATTCGTGCTGGCCTTCTGACAGATACCTACCTCGAAGCTCAACATGTTAATCAACATAAAAAAGCGTACGATGACCTGGTCTTTGATGCCAAGACATTCCGAAGAATCGAGCAATACAAGCATTCTGGTCACATGTATGAGTACCTCTCGAGGTCGATCGCTCCGGAAATCTATGGTCATATGTAAAGAAAGCGCTTTTGCTCCTGATTGGCGTCACAAATGGGTGACGGAAT ; END; BEGIN TREES; TITLE 'Montanelia ITS, nuLSU, mtSSU, MCM7'; LINK TAXA = Taxa1; TRANSLATE 1 Austroparmelina_endoleuca_AENDO69, 2 Austroparmelina_macrospora_AMACROS, 3 Austroparmelina_pseudorelicina_APSE1159, 4 Bulbothrix_apophysata_BUAP1895, 5 Cetrariastrum_andense_CEAN199, 6 Cetrariastrum_dulitense_CEDU200, 7 Tuckermanopsis_chlorophylla_CETRCHLO, 8 Cetrariella_delesei_CETRDELI, 9 Cetraria_hepatizon_CETRHEPA, 10 Cetraria_islandica_CETRISLA, 11 Austroparmelina_pruinata_CPRUINA, 12 Parmotrema_subtinctorium_CSUBTIN, 13 Everniastrum_nepalense_ENEPAL, 14 Flavocetraria_nivalis_FLAVNIVA, 15 Flavoparmelia_marchantii_FMARCHAN, 16 Flavoparmelia_soredians_FSORED2, 17 Remototrachyna_crenata_HCRENATA, 18 Melanelia_disjuncta_MDISJUNCT, 19 Melanelia_disjuncta_MEDI637, 20 Melanelia_hepatizon_MEPA1075, 21 Melanelia_panniformis_MEPA1080, 22 Melanelia_panniformis_MEPA1086, 23 Melanelia_soreidata_MESO1076, 24 Melanelia_soreidata_MESO773, 25 Melanelia_soreidata_MESO778, 26 Melanelia_tominii_METO776, 27 Melanohalea_trabeculata_METR1078, 28 Melanelixia_villosella_MEVI771, 29 Melanohalea_elegantula_MEXASP3, 30 Melanohalea_exasperata_MEXASP4, 31 Melanohalea_exasperatula_MEXTULUS, 32 Melanelixia_fuliginosa_MFULIG3, 33 Melanelixia_fuliginosa_MFULIU11, 34 Melanelixia_glabra_MGLABRA2, 35 Melanelixia_fuliginosa_MGLABRAT3, 36 Melanelixia_glabratuloides_MGLABRTU, 37 Myelochroa_irrugans_MIRRUGAN, 38 Melanohalea_olivacea_MOLIVACEA, 39 Melanelixia_pilliferella_MPILIFE, 40 Melanohalea_septentrionalis_MSEPTEM, 41 Melanohalea_elegantula_MSP5, 42 Melanelia_stygia_MSTYGIA, 43 Melanelixia_subaurifera_MSUBAURI3, 44 Melanelixia_subaurifera_MSUBAUSA, 45 Melanelixia_subaurifera_MSUBAUUK, 46 Melanohalea_subelegantula_MSUBELE, 47 Melanelixia_sugblabra_MSUBGLAB, 48 Melanohalea_subolivacea_MSUBOLI6, 49 Pleurosticta_acetabulum_PACETA2, 50 Emodomelanelia_masonii_PAMA286, 51 Emodomelanelia_masonii_PAMA287, 52 Parmelia_saxatilis_PARMSAXA, 53 Parmeliopsis_hyperopta_PHYPEROP, 54 Parmelia_serrana_PSERRAN2, 55 Parmotrema_reticulatum_RCLAVUL, 56 Relicina_sydneyensis_RESY663, 57 Vulpicina_pinastri_VULPPINA, 58 Xanthoparmelia_isidiovagans_XNEGRA, 59 Xanthoparmelia_ovealmbornii_XOVEALBO, 60 Xanthoparmelia_stenophylla_XSOMLOEN, 61 Xanthoparmelia_tinctina_XTINC8; TREE con_all_compat = [&R] (57:0.071371,10:0.089289,((((((((((1:0.17639,((2:0.05621,11:0.06272)1.00:0.035128,3:0.065713)1.00:0.103118)1.00:0.173059,((12:0.106141,55:0.10955)1.00:0.135747,(15:0.13502,16:0.102738)1.00:0.141263)0.99:0.033191)1.00:0.046176,((5:0.068242,6:0.054396)1.00:0.08266,13:0.186982)1.00:0.237565)1.00:0.035348,(((58:0.069504,60:0.044564)1.00:0.04481,61:0.078605)1.00:0.063897,59:0.202324)1.00:0.109788)1.00:0.023693,((((27:0.598292,48:0.150826)0.96:0.092678,((38:0.108227,40:0.088247)0.97:0.041517,46:0.01053)1.00:0.215487)0.96:0.064401,(29:0.098989,((30:0.229044,41:0.28962)0.90:0.071721,31:0.31401)0.97:0.09461)0.97:0.111215)1.00:0.101069,((((28:0.050025,34:0.053588)1.00:0.127684,((36:0.163379,39:0.083057)1.00:0.281545,47:0.2539)1.00:0.096117)0.64:0.020838,(((32:0.002625,35:0.006777)1.00:0.083356,33:0.062657)1.00:0.047413,((43:0.002504,44:0.002673)0.35:0.002645,45:0.004852)1.00:0.173039)1.00:0.093073)1.00:0.070747,(50:0.018699,51:0.01479)1.00:0.217602)0.97:0.030596)0.95:0.018727)0.95:0.022926,(((((18:0.007548,(23:0.028901,24:0.052151)0.99:0.008728)0.48:0.004109,19:0.005955)1.00:0.14654,(((20:0.104219,(21:0.034734,22:0.020488)1.00:0.042061)0.80:0.030953,25:0.057732)0.80:0.032117,26:0.127095)0.64:0.0229)0.93:0.042593,53:0.205355)0.30:0.019817,(49:0.181421,(52:0.061567,54:0.037208)1.00:0.216312)0.70:0.035659)0.44:0.025056)0.13:0.009863,(((4:0.280673,17:0.517668)1.00:0.285185,37:0.31042)1.00:0.066436,56:0.482103)0.37:0.015764)1.00:0.10381,(9:0.08983,42:0.117344)1.00:0.031548)1.00:0.049173,(7:0.075022,14:0.052995)1.00:0.032735)1.00:0.05479,8:0.080142)1.00:0.039991); END;