#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 20:26 GMT TreeBASE (cc) 1994-2008 Study reference: Capelari M., Karstedt F., & Oliveira J.J. 2013. Favolaschia in remnants of the Atlantic Forest, Brazil. Mycoscience, 55(1): 12–20. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13549] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=31; TAXLABELS Favolaschia_aurantiaca_JX987670 Favolaschia_austrocyatheae_DQ026257 Favolaschia_calocera_DQ026237 Favolaschia_calocera_DQ026238 Favolaschia_calocera_DQ026239 Favolaschia_calocera_DQ026240 Favolaschia_calocera_DQ026248 Favolaschia_calocera_DQ026249 Favolaschia_calocera_DQ026250 Favolaschia_calocera_DQ026251 Favolaschia_calocera_DQ026252 Favolaschia_calocera_DQ026253 Favolaschia_cinnabarina_DQ026242 Favolaschia_cinnabarina_JX987669 Favolaschia_cyatheae_DQ026256 Favolaschia_luteoaurantiaca_JX987667 Favolaschia_peziziformis_DQ026255 Favolaschia_pustulosa_DQ026245 Favolaschia_pustulosa_DQ026254 Favolaschia_sp_DUKE2708_DQ026234 Favolaschia_sp_DUKE2876_DQ026235 Favolaschia_sp_DUKE3195_DQ026236 Favolaschia_sp_JX987668 Favolaschia_sp_TH1018_DQ026241 Favolaschia_sprucei_DQ026246 Favolaschia_tonkinensis_DQ026247 Favolaschia_varariotecta_DQ026243 Favolaschia_varariotecta_DQ026244 Panellus_minimus_DQ026258 Panellus_pusillus_AF289061 Panellus_stypticus_AF289069 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M14868] TITLE Favolaschia_alinhamento; LINK TAXA = Taxa1; DIMENSIONS NCHAR=798; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Favolaschia_aurantiaca_JX987670 TTGAATA-CGATTGG-CACTGATGCTGGCTCTTAACTGAGCATGTGCTCGTG-TC-GTC--TATTTA-TCTTCTCTTGTGCTCATTTTGTAGTCAGTGA----ATTGGAAA--CCTTGCGT-GCTTCCATTAG-TA-CGGTTTGGAGGC-TGATCG--------AACC-----CTGCGTCTGTT-CC---------------------------------------------------------------------TCTGC{GT}CACTCTTT-ATTG-AGTTGCGTTTC--------------------------------------GGGAGTTG-TTAAC-CAAT---TTCTTG-ATTCGCTGA{CT}TATGTTTTCGTATACCCTGTATAAAGTCATAGAAT-AC-AACTTTACTTGATTGCGCTCGTGGTA--GTCGTTAAA---CCT-ATACA{AC}CCATCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTGCACTGAATTGCAGAAGTCAGTGAATCAGGGATGCTTGTT{AT}C{AG}CTCCCT{GT}C{AG}CCCTATGGTATTCCGAAGGTTTTCC{CT}GATTTGAGTGT-C--------------------------------------------------------ATGTGAGGGTTTGCTGGCTTCCTTCA{CT}TGGA-CGGTCTGCTCCCTTTAAAA?????????????????????????????????????????????????????????????????????????????????????? Favolaschia_austrocyatheae_DQ026257 TTGAATAACGATCGGTTACTGATGCTGGCCCTTC-CTGGGTATGTGCTCGTG-CC-GTC-TTATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAATGT----ATTAGAAA--CCATGCGT-GCTTTCATTAG--CGCGGTTTGGGGG-ACTTGGCTTTTCGTTAA-GG----CTTCCCCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTG-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-ATGCGTTGACTATGTTTTCATATACCCTGTA-AAAGTCATAGAATGTT-A-ATCAAGTTGATTGCGCTAGTCGTA--GTCCTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTT---CTCTTG--CTTTGCGGCTCGAGTT---AGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAAAGCATTAGCGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TATGCCGT-TTGACTTTGAAGCAAGCTAATGG? Favolaschia_calocera_DQ026237 TTGAATA-CGATTGG-TACTGATGCTGGCTCTTAACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCT--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTAG--CTT--GC-TTTATTG---CGAGCT-TAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026238 TTGAATA-CGATTGG-TACTGATGCTGGCTCTTAACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCT--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTG--CATTAAATTATCAACCTTAG--CTT--GC-TTTATTG---CGAGCT-TAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026239 TTGAATA-CGATTGG-CACTGATGCTGGCTCTTAACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CCATGCGT-GCTTTCATTAG-TA-CGGTTTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ATTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCTTATA-AAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GA-CTT--GC-TTTATTG---CGAGCT-CAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAAAG--ATTGA Favolaschia_calocera_DQ026240 TTGAATA-CGATTGG-CACTGATGCTGGCTCCTAACAGGGCATGTGCTCGTG-TC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTTTGGAGGC-TGATTA--------AACC-----CTGCCTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCTTATA-AAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GA-CTT--GC-TTTATTG---CGAGCT-CAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026248 ????????????????????????????????????????????????CGTG-CC------TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCT--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTAG--CTT--GC-TTTATTG---CGAGCT-TAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026249 TTGAATA-CGATTGG-TACTGATGCTGGCTCTTAACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCT--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTAG--CTT--GC-TTTATTG---CGAGCT-TAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026250 ??????????????????????????????????ACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCT--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTAG--CTT--GC-TTTATTG---CGAGCT-TAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026251 ???????????????????TGATGCTGGCTCTT-ACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCT--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTAG--CTT--GC-TTTATTG---CGAGCT-TAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026252 ???????????????????????GCTGGCTCTTAACAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTTTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAT-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCTTATA-AAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GA-CTT--GC-TTTATTG---CGAGTT-CAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCGGTGGA-TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_calocera_DQ026253 ??????????ATTGG-TACTGATGCTGGCTCTTACAAGGGCATGTGCTCGTG-CC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CTATGCGT-GCTTTCATTAG-TA-CGGTTTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ACTG-AGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCTTATA-AAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GA-CTT--GC-TTTATTG---CGAGTT-CAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_cinnabarina_DQ026242 TTGAATA-CGATTGG-CACTGATGCTGGCTCTTTACTGAGCATGTGCTCGTG-TC-GTC--TATTTA-TCTTCTCTTGTGCACCTTTTGTAGTCAGTGA----ATTGGAAA--CCATGCGCAGCTTTCATTAGCTTGCGGTTTGAAGGC-TGAATT------AAAACC-----CTGCCTTTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTTAACTAGAGTTGCGGTCT--------------------------------------GGGAGTTGATTAACACCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACAC--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTTGTCGTA--GTCGTTAAA---CCA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTT---CTC--GC-TTTCGTGGCTTGAGTT---AGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAAAACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAAAG--ATTGA Favolaschia_cinnabarina_JX987669 TTGAATA-CGATTGG-CACTGATGCTGGCTCTT{AT}ACTGAGCATGTGCTCGTG-TC-GTC--TATTTA-TCTTCTCTTGTGCACCTTTTGTAGTCAGTGA----ATTGGAAA--CCATGCGCAGCTTTCATTAGCTTGCGGTTTGAAGGC-TGA{AT}TT------AAA{AC}CC-----{CG}TGCCT{GT}TG{CT}T-{CT}C---------------------------------------------------------------------TCTGC{AG}CACTCTTTAACTAGAGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACAC--TATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTTGTCGTA--GTCGTTAAA---CCA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTT---CTCGC---TTTCGTGGCTTGAGTT---AGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAAAA{CT}ATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAAA--GATTGA Favolaschia_cyatheae_DQ026256 ?????????????????????????????CTTTCACTAGGCATGTGCTCGTG-TC-ATC--TATTTA-TCTTCTCTTGTGCACATCTTGTAGTCAATGC----ATTGGAAA--CTATGCGT-GCTTTCATTAG--CGCGGTCTGGAGGCTTGACTT------------GT---CTGCCTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTA-ACTG-AGCTGCGGTCT--------------------------------------GGGAGTTGCTTAA--CCTT---CTCCTG-CTGCATTGACTATGTTTTCATATACAT--AATAAGGTCATAGAATGTCTA-TTTAAGTCGATTGCGCTTGTCGTA--GTCCTTAAA---CTT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTTGC-TCTTGTGGCTCGAGTT---AGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGCGTTGACTTTGAAGCAAACTAATGG? Favolaschia_luteoaurantiaca_JX987667 TTGAATA-CGATTGG-CACTGATGCTGGCTCTTAACTGAGCATGTGCTCGTG-TC-GTC--TATTTA-TCTCTTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CCATGCGT-GCTTTCATTAG-TA-CGGTTTGGAGGC-TGATTA--------AAAC-----CTGCCTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ATT-GAGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCGCTGACTATGTTTTCATATACCCTGTATAAAGTCATAGAATGTC-A-TTTAACTTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCCATTAAATTATCAACCTTT---CTTGC----TTTTCG---TGAGTT---{AG}GGCTTGGATGTGAGGGTTTGCTGGCTTCCTTCAGTGGA-CGGTCTGCTCCCTTTAAAAACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGA--GATTGA Favolaschia_peziziformis_DQ026255 TTGAATAACGCTAGG-CATTGATGCTGGCCTT-C---GGGCATGTGCTCATG-TC-TTCATTATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAACGC----ATTGGAAA-CCTATGCGT-GCTTTCATTAG--TGCGGTTTGGGAGC-TGCAGC--------AAT-G----CTTCTCCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTC-ATTGG-GTTGCGTTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-ATGCGTTGACTATGTTTTCATATACCCTGTATAAAGTCATAGAATGTCTA--TTAAGTCGATTGCGCTTGTCGTA--GTCCTTAAA---CCA-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTT---CGCTTGCACTTTGCGGCTTGAGTT---AGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAAAGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGT-TTGACTTTGAAGCAAGCTAATGG? Favolaschia_pustulosa_DQ026245 TTGAATAACGATTGGCATTCGATGCTGGCTCTTCACTGGGCATGTGCTCGTG-TC-ATC-TTATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAATGC---AATTGGAAAA-CTATGCGC-GCTTTCATTAG--TGCGGTTTGAGGGT-TGAGTC--------AA--G---TCTTCCCTTGTTTC-----------------------------------------------------------------------CTTCGCGCTTT--------AG-TGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTGAATGCATTGACTATGTTTTCATATACCCTGTATAAAGTCATAGAATGTT-AACTTAAGTTGATTGCGCTAGTCGTA--GTCCTTAAAACCCCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTCGCACTTTGCGGC-TGAGTT---A-GCTTGGATGTGAGGGCTTGCTGGCTTCCTTTAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAA--TTATCTTACGCCGG-TTGACTTTGAAGCAAACTAATGG? Favolaschia_pustulosa_DQ026254 ??????????????????????????????CTTCACTGGGCATGTGCTCGTG-TC-ATC-TTATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAATGC---AATTGGAAAA-CTATGCGC-GCTTTCATTAG--TGCGGTTTGAGGGT-TGAGTC--------AA--G---TCTTCCCTTGTTTCC---------------------------------------------------------------------TTCGCGC--T--TT-A-----G-TGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTGAATGCATTGACTATGTTTTTATATACCCTGTATAAAGTCATAGAATGTTAACTTTAAGTTGATTGCGCTAGTCGTA--GTCCTTAAAA-CCCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTCGCACTTTGCGGCTTGAGTT---AGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTTAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAAT-TTATC-TACGCCGC-CTGACTTTGAAGCAAACTAATGG? Favolaschia_sp_DUKE2708_DQ026234 TTGAATAACGATTGGCATTCGATGCTGGCCCTTCACTGGGCATGTGCTCATG-TCGGTC-TTATTTA-TCTTCTCTTGTGAACATTTTGTAGTCAATGCATTAATAGGAAAACCTATGCGCA-CTTTCATTAG-TTGCGGTCTGAGGGT-TGAGTT--------AA--G---TCTTCCCTTGTTTCCTTTATGCGCGCTCAATCGTTAGTTCGATTGAGCGCGGTCTGGGAGTTGTTAACCCTTCTCCTGAATGCATTCGCGCTTTCATT-A-----G-TGCGGTTTGAGGGTTGAGTCAAGTCTTCCCTTGTTCTTATGCGTCGGGGAGTTG-TTAAC-CCTT---CTCCTGAATGCATTGACTATGTTTTCATATACCCTGTATAAAGTCTTAGAATGTT-AACTTAAGTTGATTGCGCTCGTCGTA--GTCCTTAAAA-CCCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTC-CACTTTGCGGCTTGAGTT---AGGCTTGGATGTGAGGGTTTGCTGGCTTCCTTTAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAAT-TTATC-TACGCCGC-TTGACTTTGAAGCAAACTAATGG? Favolaschia_sp_DUKE2876_DQ026235 TTGAATAACGATTGGCATTCGATGCTGGCCCTTCACTGGGCATGTGCTCATG-TCGGTC-TTATTTA-TCTTCTCTTGTGAACATTTTGTAGTCAATGCATTAATAGGAAAACCTATGCGCA-CTTTCATTAG-TTGCGGTCTGAGGGT-TGAGTT--------AA--G---TCTTCCCTTGTTTCCTTTATGCGCGCTCAATCGTTAGTTCGATTGAGCGCGGTCTGGGAGTTGTTAACCCTTCTCCTGAATGCATTCGCGCTTTCATT-A-----G-TGCGGTTTGAGGGTTGAGTCAAGTCTTCCCTTGTTCTTATGCGTCGGGGAGTTG-TTAAC-CCTT---CTCCTGAATGCATTGACTATGTTTTCATATACCCTGTATAAAGTCTTAGAATGTT-AACTTAAGTTGATTGCGCTCGTCGTA--GTCCTTAAAA-CCCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTC-CACTTTGCGGCTTGAGTT---AGGCTTGGATGTGAGGGTTTGCTGGCTTCCTTTAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAAT-TTATC-TACGCCGC-TTGACTTTGAAGCAAACTAATGG? Favolaschia_sp_DUKE3195_DQ026236 TTGAATAACGATTGGCATTCGATGCTGGCCCTTCACTGGGCATGTGCTCGTG-TCGGTC-TTATTTA-TCTTCTCTTGTGAACATTTTGTAGTCAATGCATTAATAGGAAAACCTATGCGCA-CTTTCATTAG-TTGCGGTCTGAGGGT-TGAGTT--------AA--G---TCTTCCCTTGTTTCCTTTATGCGCGCTCAATCGTTAGTTCGATTGAGCGCGGTCTGGGAGTTGTTAACCCTTCTCCTGAATGCATTCGCGCTTTCATT-A-----G-TGCGGTTTGAGGGTTGAGTCAAGTCTTCCCTTGTTCTTATGCGTCGGGGAGTTG-TTAAC-CCTT---CTCCTGAATGCATTGACTATGTTTTCATATACCCTGTATAAAGTCTTAGAATGTT-AACTTAAGTTGATTGCGCTCGTCGTA--GTCCTTAAAA-CCCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTC-CACTTTGCGGCTTGAGTT---AGGCTTGGATGTGAGGGTTTGCTGGCTTCCTTTAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAAT-TTATC-TACGCCGC-TTGACTTTGAAGCAAACTAATGG? Favolaschia_sp_JX987668 ??????????ATTGG-CACTGATGCTGGCTCTTAACTGGGCATGTGCTCGTG-TC-ATC-TTATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAT--CCATGCGT-GCTTTCATTAG--TGCGGTTTGGAGGT-TGAAGT---TGCTTAACCGCCTTCTTCCTCTGTT-CC---------------------------------------------------------------------TCTG{CT}GCACTCTTA-ACT-GAGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACCCT-TATAAAGTCTTAGAATGTC-A{AT}TTTAACTTGATTGCGCTTGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-G--CTCGC---TTTCGTGGCTTGAGTT---AGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCGAA--GATTGA Favolaschia_sp_TH1018_DQ026241 TTGAATA-CGATTGG-CACTGATGCTGGCTCTTAACTGAGCATGTGCTCGTG-TC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAA--CCATGCGC-GCTTTCATTAG--TGCGGTCTGGAGGC-TGATTA--------AACC-----CTGCTTCTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTTAACTACAGTTGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-CTTCACTGACTATGTTTTCATATACAC-GTATAAAGTCATAGAATGTC-AATTTAA-TTGATTGCGCTCGTCGTA--GTCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTGAATTATCAACCTTA----TA---C---TCTTG---CGAGTTGTAAGGCTTGGATGTGAGGG-CTGCTGGCTTCCTTCAGTGGA-TGGTCTCCTCCCTTTAAATGCATTAGTGGGATTCTCTTTGTGG-ACCGTCACTTGGTGTGATAA--TTATCCTACGCCGC-TTGACTT----GCAGAG--ATTGA Favolaschia_sprucei_DQ026246 TTGAATG-CTATCGG-CACTGATGCTGGCTCTTAACTGAGCATGTGCTCGTG-TC-GTC--TATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAGTGG----ATTGGAAA--CTATGCGT-GCTTTCATTAG--TGCGGTCTGGGGGTTTGAATT--------AA---TTTTCTACCCCTGTT-CC---------------------------------------------------------------------ACTGCGCACTCTTT-ACTG-AGACGCG{AT}TCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTG-ATTCATTGACTATGCTTTCATATACTC-GTATAAAGTCTTAGAATGTC-ATTTTAAGTTGATTGTGCTTGTCGCA--GTCCTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-G--CTC--GC-TTTCGTGGCTCGAGTT---AGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAA--TTATCTTACGCCGT-TTGACTTTGAAGCAAGCTAATGG? Favolaschia_tonkinensis_DQ026247 TTGAATAACGATTGGCATTCGATGCTGGCCCTTCACTGGGCATGTGCTCGTG-TC-GTC-TTATTTA-TCTTCTCTTGTGCACATTTTGTAGTCAATGC---AATTGGAAAA-CTATGCGC-GCTTTCATTAG--TGCGGTTTGAGGGT-TGAGTC--------AA--G---TCTTCCCTTGTTTC-----------------------------------------------------------------------CTTCGCGCTTTTT------AG-TGCGGTCT--------------------------------------GGGAGTTG-TTAAC-CCTT---CTCCTGAATGCATTGACTATGTTTTCATATACCCTGTATAAAGTCATAGAATGTTAAACTTAAGTTGATTGCGCTAGTCGTA--GTCCTTAAAAC-CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTCT---CTCTCGCACTTTGCGGCTTGAGTT---GGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTTAGTGGA-TGGTCTGCTCCCTTTAAATGCATTAGTGGGAT-CTC-TTGTGG-ACCGTCACTTGGTGTGATAATATTATC-TACGCCGC-TTGACTTTGAAGCAAACTAATGG? Favolaschia_varariotecta_DQ026243 TTGAATA-CGATTGG-CACTGATGCTGACTCCTTTGTGGGTATGTGCTCGTG-TC-ATC-TTATTTATTCTTCTCTTGTGCACATTTTGTAGTCAGTGA----ATTGGAAT--CTATGCGCA-CTTTCATTAG-TTGCGGTCTTAGAGA-TGATTA--------AACC-----CTTCTCTTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ATTG-AGTTGTGGTCT--------------------------------------GGGAGTTG---------------------CTTCACTGACTATGTTTTTATCTACAC-GTATAAAGTCATAGAATGTT-TTTTTAACTTGATTGTGCTTGTC--ACGATCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTT---CTC--GC-TTTTGTGGCTTGAGTT---AGGCTTGGATGTGAGGG-TTGCTGGCTTTT----G-----TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCCTTCTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--GTTGA Favolaschia_varariotecta_DQ026244 TTGAATA-CGATTGG-CACTGATGCTGACTCCTTTGTGGGTATGTGCTCGTG-TC-ATC-TTATTTATTCTTCTCTTGTGCACATTTTGTAGTCAGAGA----ATTGGAAT--CTATGCGCA-CTTTCATTAG-TTGCGGTCTTAGAGA-TGATTA--------AACC-----CTTCTCTTGTT-CC---------------------------------------------------------------------TCTGCGCACTCTTT-ATTG-AGTTGTGGTCT--------------------------------------GGGAGTTG---------------------CTTCACTGACTATGTTTTTATCTACAC-GTATAAAGTCATAGAATGTT-TTTTTAACTTGATTGTGCTTGTC--ACGATCGTTAAA---CCT-ATACAACTTTCAGCAACGGATCTCTTGGCTCTCCTATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTTT---CTC--GC-TTTTGTGGCTTGAGTT---AGGCTTGGATGTGAGGG-TTGCTGGCTTTT----G-----TGGTCTGCTCCCTTTAAATACATTAGTGGGATTCCTTCTGTGG-ACCGTCACTTGGTGTGATAA--TTATC-TACGCCGC-TTGACTT----GCAGAG--GTTGA Panellus_minimus_DQ026258 ????????????????????GATGCTGGCCTTT--CGGGGCATGTGCTCGCACTCAATC--TATTTA-TCTTCACTTGTGCACCTCTTGTAGTC-----------------------------------------------TTCAGAGT------------------------CGTCTTCCGCT-GC-----------------------------------------------------------------------------------AA----A--TGCGGGTT-------------------------------------TTGGGGTT--TTCATGCCCTGGACTCTTGAA------GACTATGTTTTCATATACCTTAAA-AATGTTATAGAATGCT---TT----TT-ATCG-----GTCGAAAGGCCTTTAAA---CCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GAAGTTTTTT-CTTCTTG--------------GCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGATTGGTCTGCTCCCTTTAAATGCATTAGTGGGAT--CTCTTGTGG-ACCGTCACTGGGTGTGATAA--TTATC-TACGCCGT-TTGACTT-----CAA-G??????? Panellus_pusillus_AF289061 TTGAATACGCTTTGGGTGCTGATGCTGGCCTTT--CGGGGCATGTGCTCGCATTC-AAA-CTATTTAATCTTCACTTGTGCACCTTTTGTAGTC----------------------------------------------TTTGAG-G-------------------------TTGTCTCCGCT-GC-----------------------------------------------------------------------------------AA----A--TGCGGGTT------------------------------------TTCAGGGTTGACTTG--CTCT---CCCTGGGCTTCAAAGACTATGTTTTCATATACATT-TGAAAAGTTATTGAATGTC---TTCTTATCGGCCGCAA---------GGCCTTTAAA---CTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GAAG----GC-TTTTGT--------CTTCTAGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGATTGGTCTGCTCCCTTCAAATGCATTAGTGGGAT--CTCTTGCAGAACCGTCACTTGGTGTGATAA--TTATC-TACGCCTC-CTGACTT----GC-----AATTGA Panellus_stypticus_AF289069 TTGAATACGCTTTGGGTGTTGACGCTGGCCTTT--CGAGGCATGTGCTCGCATTC-AAAACTGTTTAATCTTCACTTGTGCACCTTTTGTAGTC------TT--TT-GAA-------G-------------------------------------------------------TCATCTCCGCT-GC-----------------------------------------------------------------------------------AA----A--TGCGGGTT-----------------------------------TTTGGGAGTCT-------GTCT---CCCTGGGCTTTAAAGACTATGTTTTCATATACAT--TGAAAAGTTACAGAATGTC---TTCTTATCGGCCGCGA---------GGCCTTT-ATAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGT-CATTAAATTATCAACCTT-GAAG----GC-TTTTGTGG-T----CTTCTAGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGATTGGTCTGCTCCCTTTAAATGCATTAGTAGGAT-CCTCTTGTGGAACTGTCGCTCGGTGTGATAA--TTATC-TACGCCGTATTGACTT----GC-----AATGAG ; END; BEGIN TREES; TITLE Favolaschia_ML; LINK TAXA = Taxa1; TRANSLATE 1 Favolaschia_cinnabarina_JX987669, 2 Favolaschia_luteoaurantiaca_JX987667, 3 Favolaschia_sp_JX987668, 4 Favolaschia_sp_DUKE2708_DQ026234, 5 Favolaschia_sp_DUKE2876_DQ026235, 6 Favolaschia_sp_DUKE3195_DQ026236, 7 Favolaschia_tonkinensis_DQ026247, 8 Favolaschia_pustulosa_DQ026245, 9 Favolaschia_pustulosa_DQ026254, 10 Favolaschia_sprucei_DQ026246, 11 Favolaschia_peziziformis_DQ026255, 12 Favolaschia_austrocyatheae_DQ026257, 13 Favolaschia_cyatheae_DQ026256, 14 Favolaschia_calocera_DQ026238, 15 Favolaschia_calocera_DQ026250, 16 Favolaschia_calocera_DQ026239, 17 Favolaschia_calocera_DQ026240, 18 Favolaschia_calocera_DQ026252, 19 Favolaschia_calocera_DQ026253, 20 Favolaschia_calocera_DQ026251, 21 Favolaschia_calocera_DQ026248, 22 Favolaschia_calocera_DQ026249, 23 Favolaschia_aurantiaca_JX987670, 24 Favolaschia_calocera_DQ026237, 25 Favolaschia_sp_TH1018_DQ026241, 26 Favolaschia_varariotecta_DQ026243, 27 Favolaschia_varariotecta_DQ026244, 28 Favolaschia_cinnabarina_DQ026242, 29 Panellus_minimus_DQ026258, 30 Panellus_pusillus_AF289061, 31 Panellus_stypticus_AF289069; TREE MLT = [&R] (((((1:0.0,28:0.0):0.018684,((2:0.007179,23:0.120721):0.011471,((((((14:0.0,20:0.0,21:0.0,22:0.0,24:0.0):0.00178,15:0.0):0.003587,(18:0.003725,19:0.003691):0.001761):0.001805,16:0.005161):0.003418,17:0.00199):0.013811,25:0.021243):0.004701):0.013481):0.009483,(3:0.009228,(26:0.0,27:0.00183):0.078968):0.002688):0.027219,(((((((4:0.0,5:0.0):0.001425,6:0.0):0.020622,9:0.00786):0.004291,(7:0.002857,8:0.004036):0.004115):0.030068,(11:0.032153,12:0.039024):0.01557):0.008466,13:0.044072):0.014406,10:0.039728):0.005809):0.142523,29:0.044683,(30:0.026748,31:0.049869):0.084107):0.0; END;