#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:59 GMT TreeBASE (cc) 1994-2008 Study reference: Wheeler E.J., Mashayekhi S., Mcneal D.W., Columbus J., & Pires J.C. 2013. Molecular systematics of Allium subgenus Amerallium (Amaryllidaceae) in North America. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13603] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=81; TAXLABELS Allium_aaseae Allium_abramsii Allium_acuminatum Allium_amplectens Allium_anceps_ Allium_atrorubens Allium_bigelovii Allium_bisceptrum Allium_bolanderi Allium_brandegeei Allium_brevistylum Allium_burlewii Allium_campanulatum Allium_canadense Allium_cepa Allium_cernuum Allium_columbianum Allium_coryi Allium_cratericola Allium_crenulatum Allium_crispum Allium_cuthbertii Allium_diabolense Allium_dichlamydeum Allium_dictuon Allium_douglasii Allium_drummondii Allium_elmendorfii Allium_eurotophilum Allium_falcifolium Allium_fibrillum Allium_fimbriatum Allium_flavum Allium_geyeri Allium_glandulosum Allium_haematochiton Allium_hickmanii Allium_hoffmanii Allium_howellii Allium_hyalinum Allium_jepsonii Allium_kunthii Allium_lacunosum Allium_lemmonii Allium_macropetalum Allium_macrum Allium_madidum Allium_membranaceum Allium_monticola Allium_munzii Allium_nevadense Allium_nevii Allium_obtusum Allium_parishii Allium_parryi Allium_parvum Allium_passeyi Allium_peninsulare Allium_perdulce Allium_platycaule Allium_plummerae Allium_praecox Allium_robinsonii Allium_roseum Allium_runyonii Allium_scilloides Allium_serra Allium_sharsmithiae Allium_shevockii Allium_simillimum Allium_speculae Allium_stellatum Allium_textile Allium_tolmiei Allium_tribracteatum Allium_tricoccum Allium_tuberosum Allium_tuolumnense Allium_unifolium Allium_validum Allium_yosemitense ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15014] TITLE Allium_subgenus_Amerallium; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3164; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Allium_aaseae TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGCTGCGAA---C--GCGCTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTGGCTTGA--ACTGTCACGCGGG-TTTTGGTGCGTCTTGATGTGGATACTGACCCT{CT}CGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGTCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGAGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACGTGG---GG-AAGCCT-TCCCTCTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATCCGTGGCGCATC--------CTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----TTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGAAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTACAGAATACTTT--------TGTTTTAATCAAACAAAAGAGTTGA-AAAG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_abramsii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGTGAGATTGAGAACCTG--TAGCTTT-G-TCCGTC------------------------------------------------TAGGCGGACGCACCT-TTG---CCGCCCTTTG---TGCTTTCGATTCGTTCGAGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGCCGCCTTCTTTTT--GTTGTGCGGTGCGTCCTC--CTAC---TGGTGTCACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGACCGCC-TTCCTGGCATAA--ACTGTTGTGCGGG-TTTCGGTGCGTCCTGATGTGGATATTGACCCTCCCCGCTCTTTTGTGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTGC---CCGTTACTTA-CAAGAAGT-GGAACCCTTAACGACGTTTGCTC-CTTTTGCG-ACGTCGGACCATGACCCCAGGTCAGG-AAAAATAAAAAAAAAAAAAAA-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGT-----TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACAGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTTTCTATATTCTATATTTAGAATATGAAA---ATTTTGCATTAACTTAAACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATCTGAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTAATATGTATAAAATAC------------------TA--TTTATTTCATTTATA------TTTATTTTAATAAAAAAAAGATCT-----TTCTACGTTT-----TTTTATAGGTGTTATT------AACAATTAAAAGAATACTTT--------AGTTTAAATCAAAAAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_acuminatum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCACCTTTTGAAGATTGAGAACGTG--TAGCCTT-T-CCCATC-----GAGAACATGC-TAGTTTCGCAAG---T--GCACTTCTACTTTCTAGATGGATTTCATT--AG---CCGCCTTTGGC-TTGCT-----TT-ATTCGAGGCAACAAAGGAGAGCGGGAATAATA-CACCGGCGTAGTTTACGCCAAGG-ACGG-TTTTGGTT-AGAGTGCATCACCTACATTTT--GTTGTTCGGTGCATTCTC--CCAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCCCGCTTTACGTCACTCGTAGCACC-AACCTAGATTAA--------ACCTGGG-TTTTGGTGCATCTTGATGTGGACATTGACCCTCTGCGCTCTTTTACACGCTGTGGGTCTAAGCGATCGGCGTTGTTG--GGTTTC-AACGCGACGGAATGGTGGG-T--ATATTGTACGCATCAAGCCTCCAGTTGTGCGC-GTGA-CT-CCTAG---CCACGACCTA-CAAGAAGT-GGAACCCATAACAACGTTTGCAA-TTTTTGCA-AGGTCGGACCATGACCCCAGGTCAGG-AAAAAATAAAATAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTATTAATGTGTGT-GCTATGTCAGGCTCCCTGCTTT-TTGCGGCCAACTGACGAGTACCATAA--CT-CTTTCATACCTATGTGCTTA----ATTTT-GCT-----AGG--TTCG-ATGTTGCCATCGTGGACAACTGGCCC-GTAATGGAA-AATT--GTGTTTGATGGTGTTTATCTGTACCC-C-CCCTCGTC--TTA--TCCAAGTGTGTGGGGG{GT}TACAAAGTTGGATA------CT---TTGG-TATTTTTCTTGCTCTATTGTGCTGCATGTTATTTTTATCG----TTGAGTGCTCAAATAGTTTTACGGGTGTTGTCCAT{CG}CTAAA{AG}ATTCTCTG---G--AAGGAT-TCCATTTGG--GCTTT{CT}TAGTTTATTGC--TTGGTTTT-----GCCAGCAC--ATCTCAAAA-AAGG-CCTACATGAGTCGTGGCTCTGC--------TTTA{AGT}---GAATGCAAAGACGTCATT-ATGTAGGTGCATAAAAAAACGTGCTACCTGGTTGATCCTGCCAGTAGTC-ATAAAAAAAAAAATAAATA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATAATTAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCCTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCTTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATT------------------------TTTATAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAA------CATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAATTT-------CTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATAAAAA--AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTTAAGATCAAATTAAATAGGGTTTGGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTAAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATTAACATTAACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATTTACATCTAGACGATTCA-TAAATAATAATAAAAATAA Allium_amplectens ????????????????-????????GATCATTGTCGAGT-CCCCCTTTTGAAGACTGAGAACGTG--TAGCTTG-A-CCCGTC-----TAGAACATGC-CAGGCTTGCGAA---C--GCAACTCTGCTGTCTGGATGGATCTGTTT--TT---CCGCCCCCGGC-TTGCC-----TT-GTTCGAGACAGC-TGGGAGAGCGGGAAGAAGACCCCCGGCGCGGTTCGCGCCAAGG-ACGG-ATTTTGTT-GGGGCGCATCGCCTTCTTCTC--GTTGCGCGGTGCGTTCTC--CCAC---TAGTGTGAGAATGTGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCAAGGGCACGTCTGCCTGGGCGTCACGCCTCGCGTCACTCGGAGCAGC-AGCCCGTCTCAA--------ACCCGGG--TTTGGTGCGTCTTGATGTGGACATTGACCCTCCGTGCTCTTTTACGCGCGGTGGGTCTAAGCGGTCGGCGTTGCTG--GGTTTT-CACGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCCCCAGTCGTGCGC-GTGA-CT-CCTGG---CCGTGACCTG-AAAGAAGT-GGAACCCGTAACGACGTCTGCAG-CTTCTGCA-TGGTCGTACCATGACCCCA?GTCAGG-AAAAAAAAAAATAAAAAAAAA-CGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGT-TCTATGTCAGGCCCCCCGCTTTTTTGCGGCCGACTGATGAGTACCACAT--TC-GTTTCATACCTACGCATTGA----ATTTT-GCT-----AGG--TTAG-GTGTTGCCATCGCTGAAAACAGACCC-AGTTTGGAA-AACG--GTGTTCAATG-TG-TTATTTGTACCG-C-CCCTCCTC--TTG--CGTAAGTGCTTGGGGCGTACAAAGTCGGACA------CT---TCGG-TATTTTGATTGCTCTATTGTGTTGCCTTTCATTTTTACCG----TTGATTGCTTCAAGCGTTTTACGGGTGTTGTCCATGCTAAAGATTTTTTG---G--AAGCAT-TCCATCTGT--GC-TTTCAATATATTGT--TTGGTTTT-----TCCAGCACC-GTATGAAAA????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAAAAAAAAA?A-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAATAAAAAAGAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TCTTTTTTATTTTTTTATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGTAGAGGCTT-AAAATCCTTGTGTCACTGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAATAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAA------CATTAGTTAGAATTAGAACTAGCTG-----CTAT-TTTATGTTGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TATTTTTTCCATTAGGAAAAGAAATAAAATGAAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCC-----------------------------ATTTTAAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTATAATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AATCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTCATTTTAATAAAAAAAATATCTTTCTATTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGCTTCC---------------------------------------TAAAGTATAACTATAT--------TAGATTCTAGAATTTACATCTAGACG?????-AAATAAAAAATATAATAAA Allium_anceps_ TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAAA---C--GCACTTCTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTCATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCTGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ACTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACACGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAGC--CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCACCATAA--CT--TTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GCTTCGGAA-TAAG-AATGATCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCATC--------TTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAATAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA----------------AAAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGA-GACTGAAAATCC-AATAAAAAAA-------?????????AATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAATATAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_atrorubens TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACGTG--TAGCTTT-A-CCCGTC-----GAGAAG--------------------T--GCGCTTTTGCTTTCTAGACGGATGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TTCATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-TCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTC-GGGGTGCGTCGCCTTCTTTTT--GTTAAGAGGCGCGTCCTC--CTAC---TAGTGTCAAAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TGCCTAGCTTAG--GCTGTCGT-----------GTGCGTCTTGATGTGGATATTGACCCTCCGCGCTCTCTTACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTTAAGCCTTCAGCTGTGCAC-GTGA-CTCCCTAGACGCTAGGACCTA-CAAGAAGT-GAAACCCAGAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAATAAAAAAA-?????TGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGTAGCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACAA--CT-TTTTCACGCCTGTGCGATGA----ACTTC-GTC-----AGG--TTTC-GTGTTGCCTTCGTGGAAAACGGACGC-GGTTTGGAA-TGCG--ATGTT{CT}GATGATG-GTGTTTGTACCT-C-CCCTCCTC--TTT--CCCGAGTGTTTGGGGGGTACGATGTTGGAAG------CC---TTGG-TATTTTGATCGCTTCGTTGTGTTGCCAATCATTTTTATCG----TTGGGCGCTCCAATAGTTTTACGGGTGTTGTGCATGCTAAAGATTCATGG---G--AAGCCT-TCCCATTGT--GC-TTTTAATTCGTAGC--TTGGTTTT-----TCCAGCACC-GTCTAAAA--AAGG-CCTGCACGATTCGTGGCGCATCCTAAAAA{AT}TTTAGGACGGTTGCGAA-ACGTTGTT-GTGTAGGTGCC??????????????????????????????????????-TAAAAAAAAAAAAAAATAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACCATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTC--------AAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGCCCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTCTAATGAATATT------AAAACTATTTT-T-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TACGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAATAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TT----------AAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAAAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC------------------------TAATCTAATGTTTCCTAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATT??-AAAAAAAAAAAAAAAAAAA Allium_bigelovii ????????????????-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGCGAGATTGAGAACATG--TAGCTTT-G-CCCGTC-----GGGAAGAGGA-CGGGGTTGCGAG---T--GCGCTTCTCCTCTCTAGACGGACGCCCTT--TG---CCGCCTCTGGC-TTGCT-----TTCATTCGAGGCGAG-GAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGTCGCCTTCTGTTT--GTTGTGCGGTGCGTCCTC--CTAC---TAGTGTCTGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TGCCTAGCATAA--ACTGTCGTGCGGG-TTTCGGTGCGTCTTGATGTGGATATTGACCCTCCGCGCTCTTTTATGCGCGGTGGGTTTAAGTGGTTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTCCGGTTGTGCGC-GTGA-CTCCCTAG---CCATGACTTA-CAACAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACGTCAGGCTCCCCGCTTTGCTGCGGCCAACTGACGAGCACCACAT--CT-TTTTCATACCTATGCGTTGA----ATTTC-GCT-----AGGTTTTTC-ATGTTGCCTTCGTAGAAAACGGACCC-GA-TTGGAA-TACG--ATGTTCGACGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--CCCAAGAGATTGGGGCGGAC-GTGATGGAAA------CC---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCAGTCATTTTTATCG----TTGGGTGCTCCAATAGTTTTACGGATGTTGTGCATGCTAAAGGTACTTCG---G--AAGCCT-TCCCGTTGT--GC-TTTTAATTCGTAGC--TCGGTTTT-----GCCAGCACT-GTCTAAAA--AAGG-CCTACATGATTCGTGGCGCATC---------TTAGGACGAATGCAAA-ACGTCGTT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTATTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGT-AAAAGCCCATTTTACTTCTTTAC------TTTACTATGTTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATGCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTAGATTATTCACAGTCCATCTGATTTTCCTTGCATTCACAAGGAAAGT{CT}--TTCTTTTTGAAAATCGAAAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAAGTTTGAAAATCCTTGTGTCACCGG????????????????????????????????????????????????????????-???????????????????????-AAAAAAAATA-???????????????????????????????AAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATA-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGT-GAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTCTAATGAATATT------AAAACTCTTTTG{GT}-------TTTATTATATGTCTATAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGGTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTTATAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AA--------------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATT??-AAAAAAAAAAAAAAAAAAT Allium_bisceptrum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTCTGTGAGACTGAGAACATG--TAGCTTT-A-CCCATC-------GAAGAGGC-TGGGGTTGCAAG---C--ACGCTTCTCCTCTCTAGATGGATGCCCTT--TG---CCGCCCCTGCC-TTGCT-----TTCGTTCGAGGCGAG-ACAGAGTGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ATGC-TTTTTGTT-GGAGCGCGTTGCCTTCTTTTT--GTTGTGCGATGTGTTC----CTAC---TAGTTTCAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TTCCT------------GTCACGCAGT-TTCTGGTGTATCTTGATGTGGATATTGACCCTCCGCG-----TTATGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTCCGGTTGTGCAC-GTGA-CTCCCTAG---CCATGACTTA-CATGAAGT-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AATAAAAATATAAAATAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCACAT--CT-TTTTCACACCTATGCGTTGA----ATTAC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCC-GGTTCAAAA-CACG--ATGTTCGATGATG-TTGTTTGTACTG-C-CCCTCCTC--TTA--CGCAAGAGTTTGGGGCATACAGTGTTGGAAA------CC---TCGG-TATTTTGATCGCTCCGTCGCGTTGCCAATCATTTTTATCG----TTGAGTGCTCCAATTGTTTTACGGGTGTTGTGCATGCTAAAGGTACTCGG---G--AGTCCT-TCCCTTTGT--GC-TTTCAATTCGTAGC--TTGGTTTT-----TCCAGCACC-GTCTAAAA--AAGG-CCTGCACGATTCGTGGCGCATC---------TTAGGACGAATGCAAA-ACGTCGTT-GTATGGGTTCCTAGGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCATTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------C------AATTCAATATCTTTCTTATTCATTTTACTCTTTCACATTACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATAG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAATTAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACCAATAAGAAAATCTTGGAATAATTGGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACT--------------------------------------------TTAGAACTAGCTG-----TTAT-TTTATGTTGAATACTAATTTA-TCTGTCTACTA-------------GTTTGTTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATTAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATT---------------TTTTA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAA------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTTAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGATAAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-ATAAAAAAAAATAAAAATA Allium_bolanderi ????GTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGC-CCACCTTTTGAAGATTGAGAACGTG--TAGCCTT-A-CCCATC-----GAGAACATGC-TAGTTTTGCAAG---T--GCACTTCTACTTTCTAGATGGATTTCCTT--TG---CCGCCTTTGGC-TTGCT-----TT-ATTCGAGGCAAC-AAGGATAGCGGGAATAAGA-TACCGGCGTAGTTTACGCCAAGG-ACGG-TTTTGGTT-AGAGTGCATTGCCTACTTTTT--GTTGTGCGGTGCATTCTC--CCAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCCCGCTTTAAGTCACTCGTAGCACC-AACTTAGATTAA--------ACCCGGG-TTTTGGTGCATCTTGATGTGGACATTGACCCTCTGCGCTCTTTTACACGCTGTGGGTCTAAGCGATTGGCGTTGCTG--GGTTTC-AACGCGACGGAATGGTGGG-T--AGATTATACGCATCAAGCCTCCTGTTGTGCGC-GTGA-CT-CCTAG---CCATGACCTA-CAAGAAGT-GGAACCCATAACAATGTTTGCAA-CTTTTGCA-AGGTCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAATAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTATTAATGTGTGT-GCTATGTCTGGCTCCCCGCTTTTTTGCGGCCAACTGACGAGTACCATAA--CT-CTATCGTACCTATGTGCTTA----ATTTT-GCT-----AGG--TTCG-ATGTTGCCATCGTGGACAACAGACCCGGGTGTGGAA-TATT--GTGTTTGATGGTGTTTATCTGTTCCT-C-CCCTCGTC--TTA--TCAAAGTGTGTGGGGGTTACAAAGTTGGATA------CT---TTGG-TATTTTTCTTTATCTATTCTGTTGCATGTTATTTTTATCG----TTGAGTGCTCCAATAGTTTTACGGGTGTTGTCCACGCTAAAGATTCTCTG---G--AAGGAT-TCCATTTGG--GCTTTTTAGTTTATTGC--TTAGTTTT-----GCCAGCAC--ATCTCAAAA-AAGG-CCTACATGAGTCGTGGCTCTGC--------TTCAG---GAATGCAAA-ACGTCATT-GTGTAGGTGCCTAAGAAGGCGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAATAAATA-?????????????????????????????????????????????????????????????????????????????----????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????-??????????-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATT------------------------TTTAGAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACTTCCTCAA------CATTAG------------------------TTAT----AAGTCGAATACTAATTT-------CTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATTAAAA--AAAACTATTTTAT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTTAAGATCAAATTAAATAGGGTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTAAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATTAACATTAACAATTTAAAGAATACTTT--------AGTTTAAATTA---------GTTTA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------TGTATTCTAGAATCTACATCTAGACGATTCA-TAAATAATAATAAAAATAA Allium_brandegeei TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-CAGGGTTGCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGTGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTGGCTTGA--ACTGTCACGCGGG-TTTTGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTA--GGTTTC-CATGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCG{CT}-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAGTAGTTGCACGGGTGTTGT{AG}CATGCTAAAGACACTTGG---GG-AAGCCT-TCCCTC-GT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATTCG{GT}GGCGCATC--------CTTAAGTC{AG}AATGCAAA-ACGTCATT-GTGTAGGTGCCTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATATAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGCAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CA????-??????????????-????????-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----TTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTACAGAATACTTT--------TGTTTTAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_brevistylum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GGGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGATGTCCTT-TTG---CCGCCTTTGGC-TTGCT-----TT-TCTCGAGGCAAC-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ATTG-TTGTTGTT-GGAGTGCATCGCCTTCTTTTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGA--ACCGTCATGACGG-TTTCGGTGCATCTTGATGTGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTTTAAGTGATTGGTGTTGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTATACGCATGAAGCCTCCAGTTGCGCAC-GTGA-CT-CCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGCTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-ACTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACATACCTCTTTTCATACCTATGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCATCATGGAAATTGGACCG-GGTTGGGAA-TAGA--ATGTTCAATGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTTTAAGGGGTACAAAGTTGGAAA------CT---TTGG-TATTGTGATTGCTTCATTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---G--AAGCCT-TCCCTTTGT--GC-TTATAATTTATAGC--TCGGTTTT-----GCCAGCACCGATCTGAATA-AAGG-CCTACACGTGTCGTGGCGTAGC--------TTGAGGAGGAATACAAA-ACGTTATT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATTAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGGCGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCCCTC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTCGGAATAATTTGAATTCCGTTATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAATTTTTTTTTTCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTCAATTTAAA----------------ATTTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTAGA------TTTTTTTGAATCAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_burlewii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-{CT}AGGGTTGCAAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TTCATCAGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTATTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ACTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGGCCCTCCGCGCTCTCATACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACAA--CG-TTATCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGTTTAATGATG----TTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TTCCTTTGT--GCTTTTTAATCCATGGC--TTGGTTTT-----GCCAGCACC-ATCAAAAAA-TAGG-CCTGCACGATTCGTGGCGCATC--------TTTAGGTCGAATGCGAA-ACGTCGTT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCGGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTA????????????????????-AATAAAAAAA-CCTTTTCTTTAGCAAAAGCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCTATTAGGAAAAGAAATAAAATGCAATTATGATGA-----------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATA------CTAT-ATTCCA-----ATATGAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAA---------CTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATATTTATTTTTATTTTAATA-AAAAAATATCT-----TT{CT}TAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTTAGTTTAAAAGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_campanulatum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTCTGTGAGACTGAGAACATG--TAGCTTT-A-CCCATC-------GAAGAGGC-TGGGGTTGCAAG---C--ACGCTTCTCCTCTCTAGATGGACGCCCTT--TG---CCGCCCCTGCC-TTGCT-----ATCGTTCGAGGCGAG-ACAGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ATGC-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGATGCGTTC----CTAC---TAGTTTCAAAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TTCCT------------GTCATGCAGT-TTCTGGTGCGTCTTGACGTGGATATTGACCCTCCGCG-----TTATGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTCCGGTTGTGCAC-GTGA-CTCCCTAG---CCATGACTTA-CATGAAGT-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AATAAAAATATAAAATAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCGCAT--CT-TTTTCATACCTATGCGTTGA----ATTTC-GCT-----AGG-TTTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TACG--ACGTTCGATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--CGCAAGAGTTTGGGGCGTACGGTGTTGGAAA------CC---TCGG-TATTTTGATCGCTCCGTCGTGTTGCCAATCATTTTTATCG----TTGAGTGCTCCAATAGTTTTACGGGTGTTGTGCATGCTAAAGGTACTCGG---G--AGTCCT-TCCCTTTGT--GC-TTTCAATTCGTAGC--TTGGTTTA-----TCCGGCACC-GTCTAAAAATAAGG-CCTGCACGATTCGTGGCGCATC--------TTTAGGACGAATGCAAA-ACGTCGTT-GTGTGGGTTCCTAGGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCATTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------C------AATTCAATATCTTTCTTATTCATTTTACTCTTTCACATTACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATAG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAATTAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACCAATAAGAAAATCTTGGAATAATTGGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACT--------------------------------------------TTAGAACTAGCTG-----TTAT-TTTATGTTGAATACTAATTTA-TCTGTCTACTA-------------GTTTGTTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATTAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAG-------TAGGTTT-------CGTTTAC------------------T-AAATATT---------------TTTTA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAA------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTTAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGATAAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-ATAAAAAAAAATAAAAATA Allium_canadense TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCGCTTTACGAGATTGAGAACGTG--TGGCATT-A-CCCATC-----GAGGACAGGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGGTTTCCTTCCTA---CCGCCTTTGGC-TTGCT-----TC-ACTCGGGGCAAC-AACGAGAGCGGGAACAAGA-CCCCGGCGCAGTTCGCGCCAAGG-ACGG-TTTCTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTTCTC--CTTC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTACGTCACTCGGATCACC-TGCGTAGCTTGA--ATCGTCAT{CG}ACG{GT}-TTTCGGTGCATCTTGACGTGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTTTAAGTGATTGGTGTTGCTT--GGTTTT-CACGCGACGGAATGGTGGA-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGAGAAGT-GGAACCTATAACGATGCTTGCAC-CTTTTGTA-AGATCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGC-ACTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTATGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCTTCGTGGAAATCGGACCG-GGTTCGGAA-TAAA--ATGACGGATGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTTTGAGGGGTACCAAGCTGGATA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCTAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTATTTATAGC--TCGGTTTC-----GCCACCACCTGTCTTAATA-AACG-CCTGCACGTGTCATGGAGTGTC--------TTGAGGAGGAATACAAA-ATGTTACT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCA-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGACTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAGAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTT--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAATGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_cepa TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTAGAGT-TCCTTCTCGAACAACTGTGAAATTG--TACTCAT-A-CCCGTC-----GAGAACTACG-TATTTGTGCGG----TTAGCACTTGCGTTGTTTGGATGGGTTTCATT--TG---CTGCCTTCATGTTTGC------TTCAATTGAAGTAAG-ATGTAGAGTAGAACTAAGA-AACCGGCACGGTTTGTGCCAAGG-ACAG-TTGTTGTT-GGAGAGC-TTGCCATCATTTT--GATGTGCTTCGTGTTATT--CCA--------GTGAGCGTCTGAATGACTCCTGGCAATGGATATCTTGGCTCTCGTGTCGATGAAGAACGTAGCGAAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCTCGAGGCCATTAGGTTGAGAGCACGTCTGTTTGGGCGTCATGCCTTGCGTCATTCTAACCATC-CACCTACTGTAA---ACATACTGTGAG-TGATGGCG------GATGTGGAGATTGACCCTCCGTGC-CTTAATTGTGCGGTTGGTTTAAGTGAATGTTGTCGTTA--GGTCTA-CGCGCGGCG-AATGGTGTA-T--CGAGTTAACACACGATGTCTCTAAC{CT}GCGTCC-AGGA-GT-CCTAC---GAACGATGTAACAATAACT-GAAACCATTTTCGACGTTTGCCT-TAGTTGCA-AGCTCGGAACATGACCTCAGATCAGG-AAAAAA?AAAAAAATAAAAAA-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????A-TGAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAGGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGAAGTTGACTACGTTGCGTTGGTAACTCAAATTCTTCTAT-----------------CAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATAGCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCGTTTTACTTCTTTAC------TATAA----TTCTCC---------TTTTTTTTATAAGTGGTTCAAAGAAAACAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATAGACCCAAAGTGAATTATTCACAGCCCATCTCATTTTCCTTACATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-GAAAAATTAGGGAATAGCTCAGTTGT---------------AAAAAT----------------------------------------------------TAGGGATAGCT-CAGTTGTGTAGAGCAGAGGCTTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAGTCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTTCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATATAGAATATGCAA---ATTTTTCATT------AACTTATGTATT---TATTTACCTCCTCAA------GATTAG------TTAGAACTAGCAGACAGATAAG-TTAATATTCGACATAAA------ATAGCTGCTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCTAAT--------------------GGAAAAGAAATAAAATGTAATTATAATGAATATT------AAAACTGTTTTAT----------------------TAT-ATGTCT-----------------------------ATCTCAAGATCAAATGAAA-------TTTGTTT-------TGTTTAC------------GTTTACT-AAGTATTATT------CTAT-AAATAA-------------ATTATGTACATAACAAACAACAAA-------GTAGACTAAAAACAAGATTTTTAGAAAACG----AGTCTTT-TAATTTCTAATTTC--------GTTTATTAA-----------------------ATTTAGTAATTAT------------ATCTTGATATGTATAAAATCATCC---------------TA--TTTATTTAATTTATA------TTTTTTTTTTGATAAAAAAGATCT-----TTCTAAG--------TTTTCTAAGTGTTATT------AAAAATGAAAAGAATACTTT--------AGTTT-----AAACAAAAGAGTTTA-AAAG-----AACCCTTA--------TTCATCC----------------------AT--------TTCC---------------------------------------TAAAGGATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_cernuum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCTTCTTTATGAGATTGGAAACATGAGTAGCTTT-ACCCCATC-----GAGAAGAGGC-TAGTTTTGCAAG---T--GCATTTCTACTTTCTAGATGGATGCCCTT--TG---CCGCCTCTGGC-TTGCT-----TT-ATTCGAGGCAAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACAG-ATTTTGTT-GGAATGCATGGCCTTCATTTT--GTTGCGCGGTGCATCCTC--TTAC---TAGTGCGAGATTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCAGAGCACC-TACCTAGCTTAA--ACAATCATGCGGG-TTTCGGTGTGCCTTGATGTGGATATTGACCCTCCACGCTCTTTTACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGAAATGGTGGA-T--AGATTATACGCTTCAAGCC---AGTTGTGCAC-GTGAACTCCCTAG---CCATGACTTA-CAAGAAGT-GGAACCTAGAACGATGTTTGCAC-CTTTTGCA-AGATCGTACCATGACCCCAGGTCAGG-TTAAAAAAAAAAAAAAAATTA-TGGGCTGTGACCGTGACGGCATATGAGTGGTTATTTATGTGCGT-GCTATGTCAGGCTCCCCGTTTTGTTGCGGCCAACTGACGAGTAGCATAA--CT-CTTTTATACCTATGTGTTGA----ATTTC-ACT-----AGG--TTTC-ATGTTGCCATCATGGAAAACGGACAC-GGTTTGAAA-TATA--ATGTTCAATGATG-CTGTTTGTACCG-C-CCCTCCTC--TTT--CCCAAGTGTTTGTGGGGTACAAAGTTGGAAA------CC---TTGGTTATTTTGATTGCTTCGTTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAATAGTTTTACGGGTGTTGTGCATGTTAAAGATTCTTGG---G--AAGCCA-TCCCTTTGT--GC-TTTTAATTTATAGT--TTGGTTTT-----GCCAGCACC-ATCAAAAAA-AAGG-CCTACATGATTCGTGGCGCGTC---------TTAGGACGATTGCAAA-ACGTCATT-GTGTAGGTGCC-AAGAGGACGTGTTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAATAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTAAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAATAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTAAGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAGATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCTTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATAT-------AAAACTATTTTGTTTTATTATTTAT----------TAT-ATGTCT-----------------------------ATTTAAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTAATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAAAATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCCACATCTAGACGATTCA-AAAAAAAATAAAAAAAAAA Allium_columbianum ?TCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-{CT}AGGGTTGCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGTGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTGGCTTGA--ACTGTCACGCGGG-TTTTGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTA--GGTTTC-CATGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCG{CT}-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCG-----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TGAG-AATGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--ATA--TCTAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGCGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GG-AAGCCT-TCCCTTTGT--GC-TTCAAATCCATGGC--CCGGTTT------GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCGTC--------CTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAATAAAATAAAATAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAAATGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTCAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAAAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTAAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA--TTTTTTTTCATTAGGAAAAGAAATAAAATGCAATTATAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTCTC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTT--------TTTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAAT--ATAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_coryi TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGTGACATTGAGAACCTG--TAGCATT-G-GCCGTC-----GAGAACGAGC-TGGTTTTGCAAT---C--GCACTTCTGCTTTCTCGATGGCTGTCTTT-TTG---CCGCCTTTGGC-TTGCT-----TC-ATTCGAGGCAAC-GATGAGAGCGGGAAGAGGA-CCCCGGCGCAGTCTGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTTCTC--CTGC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-TTCCTGGATTGA--AACGTCCTGACGG-TTTCGGTGCATCTTGATGTGGATATTGACTCTTCGCGCAC-TTCCCGCGCGGTGGGTCTAAGTGATTGGTGTTGTTG--GGTTTC-CACGCGACTGAATGGTGGG-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCCAG---CCATGGCTTA-CGAGAAGT-GGAACCCATAACGACGCTTGCGC-CTTTTGCA-AGATCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCGGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------A-TTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATATACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGCATTTATA------TTTATTTGAATTAAAAAAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAAAAAATAAAA Allium_cratericola TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGTGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAGA---T--GCACTTTTGCTTTCTAGACGGATTCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-TAAAGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAGC--CCACGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAATAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTCTGTTGCGGCCAACTGACGAGCACCATTA--CT--TTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGGTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCGAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCA----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTTCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCATC--------TCTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCTTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAATAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAGAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCTAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCCGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCC--------------------ATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAATATAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AAAAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAATAAAAAAAAAAAA Allium_crenulatum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAAA---C--GCACTTCTGCTTTCTAGACGGACGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTTGGGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGCGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCAACAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ACTGTCATGCGGG-CTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGTTCTTATACGCGCGGTGGGTTTAAGTGATCGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGGCTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAATAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-G{CT}TACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTGCCATAA--CT-TTTTCTCGCCTACGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACTGACCC-GGTTTGGAA-TAAG-AATGTTCAATGATG-TTGTCTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACGATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AATCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--ATTGTTTT-----GCCAGCACC-ATCTAAAA--AAGG-CCTGCACGATTCGTGTC{CG}CATC--------TTTAAGTC{CG}AATGCGAA-ACGTCATC-{CG}TGTA{AG}GTGCCTAA{AG}A{AG}GACGTGCTACCTGGTTGATCCTGCCAGTA{AG}TC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTT----TTTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCG{GT}GAGGTTTCAAGTC??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????-AATAAAAA??-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAAACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTT?TAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_crispum ????????????????-??????????????????????????????????????TGAGAACGTG--TGGCTTT-G-CCCGTC-----GAGATCATGG-TGGTCTTGCAAT---T-AGGAGTGCTGCTTTCTCGACGGGTTCCCTT--TG---CCGCCTCTGGA-TCGCC-----TT-GCTCGGGGCAAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGTTCCGCCTGCTTCTT--GCTGTGCGGTGCGTTTTC--CCAATAGTAGTGTGAC{GT}GTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCAAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-AGCCCGGCTTGA--------ACCCGGG-TTTTGGCGCGTCTTGATGTGGACATTGACCCTCCGTGCTGTTTTACGTGCGGTGGGTCTAAGCGGTGTGCGTTGCTG--GGTTTC-CGCGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCTCCAGTTGTGCGC-GCGA-CT-CCTGG---CCGTGAACTA-CAAGAAGT-GGAACCTGTAACGACGTCTGCAG-CTTTTGCA-AG????????????????????????-AAAAAAAAATATAAAAAAAAA-CGGGTTGTGACCGTGACGGCATGTGAGTGGTGATTGTTGTGTGT-GCTATGTCAGGCTCCCCGCTTA-TTGCGGCCAACTGACGAGTCCCACAA--AT-TTTTCCTGCCTGTGTGTTGG----AAGAC-GCT-----AGG--TTCTCAGGTTGCCATCGTAGAAAACAGACCC-GGTCTGGAA-TA----GTGTTCG{AG}AGATG-TTATTTGTACCG-C-CCCTCCTC--TTG--TCCGAGTGCTTG-GGGGTACAGAGTTGGACG------CT---TCGG-TATTTTGATTGCTCTGTTACGTTGCCTGTCATTTTTATCG----TTGATTGCTCCAATAGTTGTCCGGGTGTTGTCCATGTTAAGGAATCTTTG---G--AAGCTT-TTCGTTTGTACGCTTTCAAATTTTTTGC--TTGGTTTT-----GCCAGCACC-ATCTAAGAA-AAGG-CCTGCATGAGGCGTTGCGCGGC-----------AG---GAACGCGGG-ACGTC{GT}TT-GTGCAGGTGCCTAA?AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-ATAAAAAAAAAAATAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TCTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAAAAAATTAAATATTTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGA-CTCCTCAA------CTTTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTTT----------------------------------AAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------TAAAATATTATT------CTAT-ATTTAA-----ATATGAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTAGAATTTC--------ATTTATTAA-----------------------ATTT---------------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTTAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTAC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATCTACATCTAGACGATTCA-AATAAAAAATTAAAAAAAA Allium_cuthbertii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCGCTTTACGAGATTGAGAACGTG--TGGCATT-A-CCCATC-----GAGGACGAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGTTTTCATT-TTA---CCGCCTTTGGC-TTGCT-----TC-ACTCGAGGCAAG-AACGAGAGCGGGAACAAGA-CCCCGGCGCAGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTACGTCACTCGGATCACC-TGCCTAGCTTGA--ATCGTCACGACGG-TTTCGGTGCATCTTGACGTGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTCTAAGTGATTGGTGTTGCTT--GGTTTT-CACGCGACGGAATGGTGGA-T--AGATCGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGAGAAGT-GGAACCTACAACGATGCTTGCAC-CTTTTGTA-AGATCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????AGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TA------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATATAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCCAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTTTG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTTT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATTAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAA????????????????????????????????????????????????????-AAAAAAAAAAAAAAAAAAA Allium_diabolense TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTCGCGAGATCGAGAACGTG--TCGCTTT-G-CCCGTC-----GAGAAG-----------------------------TTGCTTTCTGGACGGGCGCCCTT--TG---CCGCCTCCGGC-TCGCT-----TTCGTTCGAGGCGAG--AAGGGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGGCGCGTCCTC--CTAC---TGGTATCACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TTCCAAGCATGC--ACTGTCGTGCGGG-TTTCGGTGCGTCCTGATGCGGATACTGACCCTCCGTGCTCTTTCGTGCGCGGTGGGTTCAAGTGACTGGCGGCGATG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---TCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCACGT--CT-TTTTAACGCCTACGCGTTGA----ATTTC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCG-GGTTTGGAA-TACG--ATGTTCGATGGTG-TTGTTTGTACCG-C-CCTTCATC--TTA--CCCAAGTGTTTGGGCGGTACGTAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTCCGTCGTGTTGCCA{AT}TCATTTTTATCG----TCGGGTGCTCCGATAGTTTTACGGGTGTGGTGCATGGTGAGGGCACTCGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTAGAA--AAGG-CCTGCACGGTTCGTGGAGCGTC--------TTAAGGACGGACGCGAG-ACGTCGTC-GTGCGGGAGCCTGAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTT-TTTTTT-------AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTGTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATTTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATAAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACACTTAAAAGAATACTGT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_dichlamydeum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTATTAAATACTGAGAACGTG--TGTCTTT-T-CCCGTC-----GAGAGCATGG-CAGTCTTGCAA----TGCGCGCTTCTGCTTTCTCGACGGGTTCCCTT--TG---CCGCCTCTGGC-TCGCC-----TT-GTTCGGGGCGAG-ACGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCCGCTTCTT--GCTGTGCGGCGCGTTCTC--CCACTAGTAGTGTGACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAACACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-AGCCCGGCTTGG--------ACCCTGG-TTTTGGCGC-TATTGATGTGGACATTGACCCTTCGTGATGTTTTACGCGCGGTGGGTCTAAGCGGTGTGCGTTGCTG--GGTTTC-CGCGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCTCCAGTTGTGCGC-GCGA-CT-CCTGG---CCGTGACCCA-CAAGAAGT-GGAACCCGTAACGACGTCTGCAT-CTTTTGCA-AGGTCGTACCATGACCCCAGGTCAGG-AAAATAAAATATAAAAAAAAA-CGGGTTGTGACCGTGACGGCATGTGAGTGGTGATTGTTGTGTGT-GCTATGTCAGGCCCCCCGCTTT-TTGCGGCCGACTGATGAGACCCACAA--AT-TTTTCGTACCTATGTGTTGG----AAGAC-GCT-----AGG--TTCTCAGGTTGCCATCGTAGAAAACGGACCC-GGTCTGGAA-TA----GTGTTCGGTGATG-TTGTTTGTACCG-C-CCCTCCTC--TTG--TCCAAGTGCTTGGGGGGTACAGAGTTGGACG------CT---TCGG-TATTTTGATTGCTCTGTTACGTTGCCTATCATTTTTCTCG----TTGATTGCTCCAATAGTTTTGCGGGTGTTGTCCATGTTAAGGAATCTTTG---G--AAGAGT-TTCGTTTGT--GCTTTCAAATTTTTTGC--TTGGTTTT-----TCCAGCACC-ATCTAAGAA-AAGG-CCTGCACGAGGCGTTGCGCGGC--------------AGGAACGCTAG-ACGTCGTC-GTGCAGGTGCCTAAGAAGACGTGCTACCTGGTG????????????????-ATAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TCTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTAAATATCTTTCTTATTCATT------------------------------------------------------CCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCCTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATAGA-CTCCTCAA------CTTTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCGAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTTT----------------------------------AAGATCAAATTAAATAGGTTTTAGGTTT-------TGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTTCTT-TAATTTAGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTAC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATCT????????????????-AATAAAAAATTAAAAAAAA Allium_dictuon TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCACCTTTTGAAGATTGAGAACGTG--TAGCCTT-T-CCCATC-----GAGAACATGC-TAGTTTTGCAAG---T--GCACTTCTACTTTCTAGATGGATTTCATT--AG---CCGCCTTTGGC-TTGCT-----TT-ATTCGAGGCAACAAAGGAGAGCGGGAATAATA-CACCGGCGTAGTTTACGCCAAGG-ATGT-TTTTGGTT-AGAGTGCATCACCTACTTTAT--GTTGTTTGGTGCATTCTC--CCAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCCTGGGCGTCCCGCTTTACGTCACTCGTAGCACC-AACCTAGATTAA--------ACTTGGG-TTTTGGTGCATCTTGATGTGGACATTGACCCTCTGCGATCTTTTACACGCTGTGGGTCTAAGCGATTGGCGTTGTTG--GGTTTC-AACGCGACGGAATGGTGGG-T--ATATTGTACGCATCAAGCCTCCAGTTGTGCGC-GTGA-CT-CCTAG---CCACGACCTA-CAAGAAGT-GGAACCCATAACAACGTTTGCAA-TTTTTGCA-AGGTCGGACCATGACCCCAGGTCAGG-AAAAAATAAAATAAAAAAAAA-T{GT}GGTTGTGACCGTGACGGCATGTGAGTGGTTATTAATGTGTGT-GCTATGTCAGGCTCCCTGCTTT-TTGCGGCCAACTGACGAGTACCATAA--CT-CTTTCATACCTATGTGCTTA----ATTTT-GCT-----AGG--TTCG-ATGTTGCCATCGTGGACAACTGGCCC-GGTATGGAA-TATT--GTGTTTGATGGTGTTTATCTGTACCG-C-CCCTCGTC--TT{AG}--TCCAAGTGTGTGGGGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-ATAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATAATTAATTGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAACCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCCTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATATGGCTCTTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATT------------------------TTTATAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAA------CATTAG------TTATAACTAGCTG-----CTAT-TTTATGTCGAATACTAATTT-------CTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATTAAAA--AAAATTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTTAAGATCAAATTAAATAGGGTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTAAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATTAACATTAACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATTTACATCTAGACGATTCA-TAAATAATAATAAAAATAA Allium_douglasii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTATTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TGGGGTTGCGAA---C--GCACTTCTGCTTTCTGGACGGATGCCCTT-TTG---CCGCCTCCCGC-TTGCT-----TTTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCATGCCTTGCGTCACTCGGAGCACC-CACCTAGCTTGA--ACTGTCACGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAAT-GGAACCCAGAACGATGCTTGCGC-CTTTCGCA-AGATCGGACAATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCG-----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TGAG-AATGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--ATA--TCCAAGTGTTTGGGGGGTACAATGCTGGAAA------CC---TTGG-TATTTTGATCGCTACATCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GG-AAGCCT-TCCCTTTGT--GC-TTCAAATCCATGGC--CCGGTTT------GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCATGGCGCGTC--------CTTAAGTTGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAA{AG}AGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAATAAAATAAAATAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGGCCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTA--------AGTTTTAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_drummondii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGTGACATTGAGAACCTG--TAGCATT-G-GCCGTC-----GAGAACGAGC-TGGTTTTGCAAT---C--GCACTTCTGCTTTCCCGATGGCTGTCTTT-TTG---CCGCCTTTGGC-TTGCT-----TC-ATTCGAGGCAAC-GATGAGAGCGGGAATAAGA-CCCCGGCGCAGTCTGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTTCTC--CTGC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-TTCCTGGATTGA--AACGTCCTGACGG-TTTCGGTGCATCTTGATGTGGATATTGACTCTTCGCGCAC-TTCCCGCGCGGTGGGTCTAAGTGATTGGTGTTGTTG--GGTTTC-CACGCGACTGAATGGTGGG-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCCAG---CCATGGCTTA-CGAGAAGT-GGAACCCATAACGACGCTTGCGC-CTTTTGCA-AGATCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGGGC-ACTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACATGCCT-CTTTCATTCCTACGTGTTGA----ACTTC-ACT-----AGG--TTTG-ATGTTGCCTTCGCGTAAATTGGCCCG-GGTTCGGAA-TATA--GTGTCGGATGATGCCTATTTGTACCG-C-CCCTCGTC--TTC--TCCAGGCGTTTAGGGGGTACCAAGATGGACG------CT---TCGG-TATTTTGATTGCTTCGTTGCGTTGCCTGTCATTTTTACCG----CTGAGTGCTCCAAAGATTTTACGGGTGTTGTGCATGCTAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGC--AC-TCGTCGCTTATGTC--TCGGTTTT-----TCCACCGTCCCTCTTAGTA-AAGG-CCTGCGCGTGTCGTGGCGTGTC--------TTGAGGAGGAACACGAC-GCGTTGTC-GCGTGGGCGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CGAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------A-TTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATATACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATTTAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAATGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCG----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCGAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_elmendorfii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGG-CCCCCTTCATGAGATTGAGAACGTG--TAGCATC-A-GCCATC-----GAGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTCCTAGATGGTTGTCTTT-TTA---CCGCCCTTGGC-TTGCT-----TT-ACTCGAGGCAGT-AGTGAGGGCGGGAACAATA-CCCCGGCGCAGTTTGCGCCAAGG-ACGG-TTTATGAC-GGAGTGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTTCTC--CTAG---CAGTGTGA-AATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAG{AG}CCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTGGCGTCACTCGGATCACC-TGCCTAGATTGA--AACATCACGACGG-TTTTGGTGCATCTTGATGTGGGTATTGACTCTTCGCGCAC-TTCACGCGCGGCGGGTCTAAGTGGTTGGTGTTGCTT--GGTTTA-CACGCGACGGAATGGTGGA-T--AGATTGTACGCATCGAACCTCCAGTCATACAC-GTGA-CT-CCAAG---CCGTGGCTTA-CGAGAAGT-GGAACCTACAACGATGCTTGCAC-CTTTTGTA-AGATCGGACAATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-CGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCAC-ACTACGTCAGGCTCCCTGCTTTGCTGCAGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTACGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCTTCATGGAAATTGGATCG-GGTTCGGAA-TATA--ATGACGGATGATGTTTATTTGTACTG-C-CCCTCGTC-TTTG--TCCAAGCGTTTAAGGGGTACCAAGCTGGGTA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTTTTATCG----TCGAGTGCTCCAAAAAATTTACGGGTGTTGTGCATGCCAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTATTCATAGC--TCGGTTTT-----TCCTCCACCCATGTTAATA-AACG-CCTACACGTGTCGTGGCGTATC--------ATGAGGAGGAATACAAA-ACGTTAAT-GTGTAGGTGTTTGAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAATAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TA------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGGACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTTTG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TATTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCC-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTATAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATTAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATGCTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATTT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_eurotophilum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCGCTTTATGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GGGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGATGTCCTT-TTG---CCGCCTTTGGC-TTGCT-----TT-TCTCGAGGCAAC-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACTG-TTGTTGTT-GGAGTGCATCGCCTTCTTTTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGA--ACCGTCATGACGG-TTTCGGTGCATCTTGATGTGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTTTAAGTGATTGGTGTTGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATCATACGCATCAAGCCTCCAGTTGTGCAC-GTGA-CT-CCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGCTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-ACTACGTCAGGCTCCCTGCTTTGTTGCGGCCAACTGACGAGTACCACGTACCTCTTTTCATACCTATGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCATCATGGAAATTGGACCG-GGTTCGGAT-TAGA--ATGTTCAATGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTTTAAGGGGTACAAAGTTGGAAA------CT---TTGG-TATTGTGATTGCTTCATTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAAAGATTTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---G--AAGCCT-TCCCTTTGT--GC-TTATAATTTATAGC--TCGGTTTT-----GCCAGCACCGATCTGAATA-AAGGCCCTGCACGTGTCGTGGCGTAGC--------TTGAGGAGGAATACAAA-ACGTTATT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATTAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTCGGAATAATTTGAATTCCGTTATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAATTTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATTTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTAGA------TTTTTTTTAATAAAAAAAAGATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_falcifolium TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAAA---C--GCACTTCTGCTTTCTAGACGGACGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTTGGGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGCGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCAACAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ACTGTCATGCGGG-CTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGTTCTTATACGCGCGGTGGGTTTAAGTGATCGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAATAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTGCCATAA--CT-TTTTCTCGCCTACGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACTGACCC-GGTTTGGAA-TAAG-AATGTTCAATGATG-TTGTCTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACGATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAGTCATTTTTATCG----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AATCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTTGTTTT-----GCCAGCACC-ATCTGAAA--AAGG-CCTGCACGATTCGTGTCGCATC--------TTTAAGTCGAATGCGAA-ACGTCATC-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTTTTTTTTTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTTTT{CT}TAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGT-GATTATTCACAGTCCATCTCATTTTCCTTGCTTTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------CATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTA----AAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATGTAAGGAATACCAT--------AGTTTAAATAAAACAAAAAAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_fibrillum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-T-CCCGTC-----GAGAAGAGGC-TAGGGTTGCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTGTCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTGGCTTGA--ACTGTCACGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCCGTGGGTTTAAGTGATTGGCTGTGCTG--GGTTTC-CACGCGGCG{GT}AATGGTGGA-A--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCGG-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTTAATGATG-TCGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GGAAAGCCT-TCCCTTTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATTCGTGGCGCATC--------CTTAAGTCGAATGCGAA-ACGCCATT-GTGCAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATTAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATGCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC-TTTTTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAAAGCAAAGGACTGAAAATCC-AATAAAATAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGGCCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTTT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATCCTATATCTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAAATTTAGTAATTACATTTTGATATATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATAT-----TTCTAAGTTT-----TTTTATAA----TATT------AACAATTTAAAGAATACTTG--------AGTTTTAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTC?-AAAAAAAAAAAAAAAAAAA Allium_fimbriatum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTCGCGAGATCGAGAACGTG--TCGCTTT-G-CCCGTC-----GAGAAG-----------------------------TTGCTTTCTGGACGGGCGCCCTT--TG---CCGCCTCCGGC-TCGCT-----TTCGTTCGAGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGGCGCGTCCTC--CTAC---TGGTGTCACAGTATGCATGACTCCTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TTCCA{AG}GCATGC--ACTGTCGTGCGGG-TTTCGGTGTGTCCTGATGCGGATACTGACCCTCCGTGCTCTTTCGTGCGCGGTGGGTTCAAGTGATTGGCGGCGATG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTACACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---TCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCA{CT}GT--CT-TTTTAACGCCTACGCGTTGA----ATTTC-GCT-----AGG-TTTTC-ATGTTGCCTTCGTGGAAAAC{AG}GACCA-GGTTTGGAA-T{AT}CG--ATGTTCGATGGTG-TTGTTTGTACCG-C-CCTTCATC--{CT}TA--CCCAAGTGTTTGGGCGGTACGTAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTC{CT}GTC{AG}TGTTGCCAATCATTTTTATCG----TCGGGTGCTCCGATAGTTTTACGGGTGTGGTGCATGGTGAGGGCACTCGG---G--AAGCCT-TCCCTTTGT--GC-TTT?GATTCGTAGC--TCGGTTTT-----TCCAGCACT-GTCTAGAA--AAGG-CCTGCACGGTTCGTGGCGCATC--------TTAAGGACGGATGCGAG-ACGTCGTC-GTG{CT}GGGAGCCTGAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCATTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTACTATACTTATACTATATTCTCC-TC----TTTTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTA--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTGGGGATAGCT-CAGTTG-GAAAAGCAAAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTAGTTTGGTTCACTAGTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAA{GT}GCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAAATATTATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAA------------ATTTTGATATGTATAAAATACTATTTATTGAAAAAATACTA--TTTATTGAATTTATA------TTTATTTTAAT---AAAAAT---------TTCTACGTTTTTATATTTTATAAGTGTTATT------AACAATTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAATAAAAAAAAAAAAA Allium_flavum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTAGAGT-CCCTTTTCGAACAATCGTGAAGCCG--TAGTCGT-A-CCCGTC-----GAGAACAAGAGCATGGCTA----------GCACTTGCGATGTTCGGACGGGTTCCAAC--CG---CTACCTCCCTCTTCGC------TACAACTGAAGCAAG-AAGGGGTGTAGAAAAAAGA-AACCGGCACGGTTTGTGCCAAGG-ACAG-TTGTTGTT-GGAGCACGCTGCCGTCAGTTT--GACGCGCTTCGTGCTATG--CTAA--------CGAGAGTTTAAACGACTCCTGGCAATGGATATCTTGGCTCTCGTGTCGATGAAGAACGTAGCGAAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCTCGAGGCCATTAGGCCGAGAGCACGTCTGTTTGGGCGTCATGCCTTGTCTCACCCTTACCGTC-----AAGTGCGGTCAACGTACTACCGA-TGGCGGTG------GGCGTGGAGACTGACCCTCCGTGCTC-TGCCTGCGCGGTCGGTTCAAGTGCATGTTGTCGCCA--GGTCCA-CGCGCGGCG-AGTGGTGTA-T--CGAGTTAACGCACGATGTCTCTAGCCGCGTCC-AGGG-GA-CCTAA---GGACGACGCAGCATGAACT-GAAACCATTTTCGATGTATAGCC-------------TCGGACCATGACCCCAGATCAGA-AAAAAA?AAAAAAATATAAAA-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????A-TGAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGC{CT}ATCCTGAGCCAAATCTTTTTT--TTTTTTTGAA----AAAGAAGGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTAGTAACTCAAATTCTTCTAT-----------------CAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTTGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCGTTTTACTTCTTTAC------TATAA----TTCTCC---------TTTTTTTTATAAGTGGTTCAAAGAAAACAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATAGACCCAAAGTGAATTATTCACAGCCCATTTCATTTTCCTTATATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTCGTGTCACCGGTTC----------------AAATTTGGCTCCTGAATTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAGTCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTTCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT------ATCTATATATAGAATATGAAA---ATTTTTTATT------AACTTATGTATT---TATTTACCTCCTCAA------GATTCG------TTAGAACTAGCAG-----TTAT-TTTATGTCGAATATTAACTTA-TCTGTCTGCTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA--TTTTTTTCCATTAGGAAAAGAAATAAAATGTAAATATAATAAATATG------AAAACTGTTTTAT----------------------TAT-ATGTCT-----------------------------ATCTCAAGATCAAATGAAA-------TTTGTTT-------TGTTTACGAAATTTGTTTTGTTTACT-AAGTATTATT------CTAT-ATTTAA-------------ATTATGTACATAACAAACAACAAA---------------------------CTAGGA----------------TAATT-------------------------------------------------ACTATATAATTAT------------ATTTTGATATGTATAAAATTATCT---------------TA--TTCATTTAATTTCTA------TTTTTTTTT-------TAAGATCT-----TTCTAAG--------TTTTTTAAGTGTTATT------AAAAATGAAAAGAATACTAA--------AGTTT-----AAACAAAAGACTTTA-AAAG-----AATCCTTA--------TTAATCT----------------------AT--------TTCC---------------------------------------TAAAGGATAACTATAT--------CGAATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_geyeri TTCCGTAGGTGAACCTGGCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GGGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGCTGTCTTT-TTG---CCGCCTTTGGC-TTGCT-----TT-ACTCGAGGCAAC-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTGTTGTT-GGAGTGCATCGCCTTCTTTTTTCGTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTAGCGTCACTCGGAGCACC-TACCTAGCTTGA--AACGTCATGACGG-TTTCGGTGCATCTTGATGTGGACATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTTTAAGTGATTGGTGTTGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTATACGCATCAAGCCTCCAGTTATGCAC-GTGA-CT-CCCAG---CCATGGCTTA-CAAGAAGT-GGAACCCAGAACGATGCTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-ACTACGTCAGGCTCCCCGCTTTGCTGCGGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTATGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGATGCCTTCGTTGAAATCGGACCG-GGTTCGGAA-TAGA--ATGTTGGATGATGCTTATTTGTACCG-C-CCCTCGTC--TTA--TCCAAGCGTTTAAGGGGTACCAAGCTGGATA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAACAATTTTACGGGTGTTGTGCATGCCAAAGAGTCTTGG---G--AAGCCT-TTCCTTTGT--GC-TTGTTATTTATAGC--TCGGTTTC-----GAGACCACCCATCTTAATA-AAGG-CCTACACGTGTCGTGGCGTATC--------TTGAGGAGGGATACAAA-ACGTTATT-GTGTAGGTGTTTTAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGAAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCTATTTGAAGATCAAATTTTATTATATGTCTATTTGAAGATCAAATTTAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATGAAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_glandulosum ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTATTGATGTGTGT-ACTACGTCAGGCTCCCCGCTTAGTTGCGGCCAACTGACGAGCACCACATAACT-CTTTCGTACCTATGTGTTGA----TTTTC-ACT-----AGG--TTTT-GTGTTGCCATCATGGAATTTGGATCG-AGTTCGGAA-TTGA--TTGTTCAGTGATGCTTATTTGTACCG-C-CCTTCCTC--TTA--TCCAAGCGTTTGGGGGGTACAACGTTGGAAA------CC---TTGT-TATTTTGATTGCATCGTTGTGATGCCTATCATTCTAATCG----TTGAGTGCTCCAACAATTTTACGGGTGTTGTGCATGTTAAAGATTCTTGG---G--AAGCCT-TTCCATTAT--GC-TTATAATTTATAGC--TCGGCTTT-----GCTCGTGCT-ATTTGAATA-AAAG-CCTACACGATTCGTGGCGTAGC--------ATGGGGAGGAATGCAAA-ACGTAATT-GTGTTGGTTCTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-?????????????????????????????????????????????????????????????????????????????----????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????-??????????-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTAGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTTTTTTTG---TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAACTGCAATTATGATGAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT------------------------AGTCTATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTCGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--GTTATGGAATTTATA------TTCATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACGATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAAGTATATAACTTTATTGGATTCTAGAATCTAC??????????????-AAAAAAAAAAAAAAAAAAA Allium_haematochiton TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACATG--TAGCTTT-A-CCCATC-----GAAAGGAGGC-TGGGGTTGCAAAAAGT--GCACTTTTGCTTCCTAGATGGATGCCGTT--TG---CCGCCTTTGGC-TTGCC-----TTTATTCGAGGCAAG-AAGGAGAGCGGGAATAAGA-TCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTTTTT-GTTAAGCGATGCATCCTC--CTAC---TAGTTTCAGAATATGCACGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCGCC-CACCTTGCTTGA--ACTGTCATGCGGG-TTTCGGCGCATCTTGATGTGGATATTGACCCTCCGCGCTCTTTTATGCGCGGTGGGTTTAAGTGATTTGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--GGATTATACGCTTCAAGCCTTCAGCTGTGCAC-GT{GT}A-CTCCCTAG---CCATGACTTA-CAAGAAGT-GGAACCTAGAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTATTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACAA--CG-TTTTCACACCTATGTGTTGG----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAAAGGACCC-GGTCTGGAA-TATA--ATGTTCAATGATG-TTGTTTGTACCG-C-CCCTTTTC--TTA--TCCAAGTGCTTTGGGGGTACAGTGTTGGAAA------CT---TTGG-TATTTTGGTCGCTCCGTTGTGTTGCCAATCATTTTTATCG----TTGAGTGCTCCAATAGTTTTACGGATGTTGTGCATGCTAAAAATTCTTGG---G--AAGCCCTTCCCATTGT--GC-CTTTAATTCATGGC--TTGGTTTT-----GCCATCACC-ATCTAAAA--AAGG-CCTACACGATTCGTGGCGCATC--------TTTAGGACGAATGCAAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCCTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AATTTACG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATGAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TCATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATATACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_hickmanii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTTTTGAAGACTGAGAACGTG--TGGCTTG-A-CCCGTC-----TAGAACATGC-CAGGCTTGCGAA---C--GCAACTCTGCTGTCTGGATGGATCTGTTT--TG---CCGCCCCCAGC-TTGCC-----TT-GTTCGAGACAGC-TGGGAGAGCGGGAAGAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGG-ATTTTGTT-GGGGCGCATCGCCTTCTTCTC--GTTGCGCGGTGCGTTCTC--CCAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCAAGGGCACGTCTGCCTGGGCGTCACGCCTCGCGTCACTCGGAGCAGC-AGCCCGTCTCAA--------ACCCGGG--TTTGGTGCGTCTTGATGTGGACATTGACCCTCCGTGCTCTTTTACGCGCGGTGGGTCTAAGCGGTCGGCGTTGCTG--GGTTTT-CACGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCCCCAGTCGTGCGC-GTGA-CT-CCTGG---CCGTGACCTG-AAAGAAGT-GGAACCCGTAACGACGTCTGCAG-CTTCTGCA-AGGTCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAATAAAAAAAAA-CGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGT-TCTATGTCAGGCCCCCCGCTTTTTTGCGGCCGACTGATGAGTACCACAT--TC-GTTTCATACCTACGCATTGA----ATTTT-GCT-----AGG--TTAG-GTGTTGCCATCGCTGAAAACAGACCC-AGTTTGGAA-AACG--GTGTTCAATG-TG-TTATTTGTACCG-C-CCCTCCTC--TTG--CGTAAGTGCTTGTGGCGTACAAAGTCGGACA------CT---TCGG-TATTTTGATTGCTCTATTGTGTTGCCTTTCATTTTTACCG----TTGATTGCTTCAAGCGTTTTACGGGTGTTGTCCATGCTAAAGATTTTTTG---G--AAGCAT-TCCATCTGT--GC-TTTCAATATATTGT--TTGGTTTT-----TCCAGCACC-GTATGAAAA-AAGG-CCTACGCATGTCGTCACGCATT--------------AGGAGTGCAAG-ACTTCATT-CTGTAGGTGCCTAA{AG}AAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAACAAGAGAATAAAAAAGAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTTATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGTAGAGGCTT-AAAATCCTTGTGTCACTGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AAATAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAA------CATTAGTTAGAATTAGAACTAGCTG-----CTAT-TTTATGTTGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TATTTTTTCCATTAGGAAAAGAAATAAAATGAAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCC-----------------------------ATTTTAAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTATAATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AATCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTCATTTTAATAAAAAAAATATCTTTCTATTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGCTTCC---------------------------------------TAAAGTATAACTATAT--------TAGATTCTAGAATTTACATCTAGACGATTCA-AAATAAAAAATATAATAAA Allium_hoffmanii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTT-GCGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAGA---T--GCACTTTTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACA-TACCTAGCTTGG--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-TAAAGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAGC--CCATGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCAC-CTTTTGCA-AGGTCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAATAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCACCAT{AT}A--CT--TTTCTCGCCTATGC{AG}T{CT}GA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGATCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCGAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCATC--------TCTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGC?TAAGAGGACGTGCTACCTGGT?????????????????-AAAATAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTA{AG}AAATCG{GT}GAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTTCGTGATTTAAAGAACTTT-------TCTATATTAAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTTGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------------AGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------TTTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_howellii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTCGCGAGATCGAGAACGTG--TCGCTTT-G-CCCGTC-----GAGAAG-----------------------------TTGCTTTCTGGACGGGCGCCCTT--TG---CCGCC{CT}CCGGC-TCGCT-----TTCGTTCGAGGCGAG--AAGGGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGGCGCGTCCTC--CTAC---TGGTGTCACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TTCCAAGCATGC--ACTGTCGTGCGGG-TTTCGGTGCGTCCTGA{CT}GCGGATACTGACCCTCCGTGCTCTTTCGTGCGCGGTGGGTTCAAGTGACTGGCGGCGATG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---TCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCACGT--CT-TTTTAAGGCCTACGCGTTGA----ATTTC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCG-GGTTTGGAA-TACG--ATGTTCGATGGTG-TTGTTTGTACCG-C-CCTTCATC--TTA--CCCAAGTGTTTGGGCGGTACGTAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTCCGTCGTGTTGCCAATCATTTTTATCG----TCGGGTGCTCCGATAGTTTTACGGGTGTGGTGCATGGTGAG{AG}GCACTCGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTAGAA--AAGG-CCTGCACGGTTCGTGGAGCGTC--------TTAAGGACGGACGCGAG-ACGTCGTC-GTGCGGGAGCCTGAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTT-----TTTTTT--A----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATT{CT}TT{CT}TATAAAAAAAAATGATTAATAAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATT{CT}TCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATTTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-???????????????????????-TAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTTCTT-TAATTTTGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATATC------------ATTTTGATATGTATAAAATACTATTTATTTTATTGAATTTATATTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACACTTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_hyalinum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTTTTGAAGACCGAGAACGCG--TAGCTTG-A-CCCATC-----GGGAACACGC-CAGGGTTGCAAG---C--GCAACTCTGCTGTCTGGATGGATCTCTTT--CG---CCGCCCCCGGC-TCGCC-----TC-ATTCGAGACAAC-CGGGAGAGCGGGAAGAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGGGCGCATCGCCTTCTTCTT--GTCGCGCGGTGCGTTCCC--CCAC---TATTGTGAGAACATGCATGACTCTTGGCAACGGATATCTTGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCCGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCTCGCGTCACTCGGAGCACC--AACTGGCTCAA--------ACCAGGG-TCTTGGTGCGTCTCGACGTGGACATTGACCCTCCGTGATCTTTTACGCGCGG?GGGTCTAAGCGGTCGGCGTTGCTG--GGTTTC-CACGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCCCCAGTCGTGCGC-GTGA-AT-CCCGG---CCGTGAACCG-AAAGAAGT-GGAACCCGTAACGACGTCTGCAG-CTTTTGCA-AGGTCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAATAAAAAAAAA-CGGGTGGTGACCGTGACGGCATGTGAGTGGTTATTGATGTGTGT-GCTATGTCAGGCCCCCCGCTTTTTTGCGGCCGACTGACGAGCCTCACAA--TC-GTTTCGTACCTACGCATTGA----ATTTT-GCT-----AGG--TTCG-GTGTTGCCGTCGCAGAAAACAGACCC-GGTTTGGAA-AATG--G{CT}GTTCAATGATG-TTATTTGTACCG-C-CCCTCCTC--TTG--CCTAAGTGTTTGGGGCGTACAAAGTCGGACA------CT---TCGG-TATTTTGATTGCTCGATCGTGTTGCCTTTCATTTTTACCG----TTGGTTTCTCCAACCGTTTTACGGGCGTTGTCCATGCTAAAGATTCTTTG---G--AAGCAT-TCCATCTAT--GC-TTCCAATTTGTCGT--TTGGTTTT-----GCCAGCACC-ATATCAAAA-AAGG-CCTACAGAAGTCGTCGCGCAGT--------------AGGAATGCAAG-ACTTCATT-CTGTAGGTGTCTACGAAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-G-AAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTAAA----AAACAAAGG------TTTAAAAAAGAGAATAAAAAAGAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTTATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGAACCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATC--AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGTAGAGGCTT-AAAATCCTTGTGTCACTGGTTA----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAATAAAAAT-CCTTTTCCTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGT---------------------------ATTTAGAATATGAAA---AATTTTAATT------TACTTATG-------TATTGACCTCCTCAA------CATTAGTTAGAATTAGAACTAGCTG-----TTAT-TTTATGTTAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TATCTTTTCCATTAGGAAAAGAAATAAAATGAAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTTAAGATCAAATTAAATAGGTTTTAGGTTT-------CCTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAA-AT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AATCCTT-TAATTTATAATTTT--------ATTTATTAG-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TAT-TTTATTGAATTTATA------TTTATTTTAAT-AAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTAGAT-------GTAGATTCTAGAATCTACATCTAGACGATTCA-AAATAAAAAATAAAAAAAA Allium_jepsonii ?????????????????????????????????????????????????????????????????--???????-???????????????????????????????????????????????????????????????????????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ACTCTTGGCAACGGATAT{AC}TAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTT{CG}GTGTGAA{CT}TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGT{CT}GAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGACCGCC-TTCCTCGCATAA--ACTCTCGTGCGGG-TTTCGGTGCGTCCCGATGTGGATATTGACCCTCC{AC}TGCTCTTTTATGCGCGGTGGGTTCAAGTGATCGGCGGCGC{CG}G--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTGC---CCGTGACTTA-CAAGAAAA-GGAACCCGTAACGACGT{AT}{CT}GCG--CCTTTGCG-ACGTCGGACCA???????????????-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACTTCAGGCTCCCCGCTTCGTTGCGGCCAACTGACGAGCGCCACGT--CT-TTTTCACGCCTGTGCGTTGA----ATGAC-GCT-----AGG--CTTCGGTGTTGCCTTCGTGGAAAACGGAACC-GGTTTGGAA-TACG--ATGTTCAATGGTG-TTGTTTGTACCG-C-CCCTCCTC--TCG--CCCGAGCGTTAGGGGGGTACGACGTTGGAAA------CC---TCGG-TATTTTGATCGCTCCGTCGTGTTGCCGGTCATTTTTATCG----GTGGGTGCTCCGATGGTTTTACGGGTGTGGTGCATGCTAAAGGTACTCGGGAAG--AAGCCT-TCCCTATGT--GC-TTTCGGTTCGTAGC--TTGGTTTT-----TCCGGCACC-GTCTGAAA--AAGG-CCCGCACGGTTCGTGGCGCGTC--------TTGGGGACGGATGCGAG-A?????????????????????????????????????????????????????????-AAAAAAAAATAAAAAAAAA-????????????????????????????????????AATGGGCAATCCTGAGCCAAATCTTTT-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATAATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTG??????????????????????????????????????????????????????????????????????????????????????????-???????????????????????-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAAATTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATCTCGAATACTAATTTA-TCTGTCTACTAGTTTGGTTCACTAGTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTATTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTACATTTTGATATGTATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACAATTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCCACATCTAGACGATTCA-AAAAATAAAAAAAAAAAAA Allium_kunthii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GAGAACAAGC-TAGTTTTGCAAG---T--GCACTTTTGCTTTCTAGATGGATGTCCTT-TTG---TCGCCTCTGGCTTTGCT-----TT-ATTCAAGGCAAC-AAGGAGAGCGGGAATAAGA-CCCCGGCGCTGTTTGCGCCAAGG-ACGG-TTGTTGTT-GGAGCGCACCGCCTTCTTTTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGAAGCGCA-TACCTAGCTTGA--ACTATCATGCAGGTTTTCTATGCGTCTTGATGTGGATATTGACCCTTCGCGCAC-TTCACGCGCGGTGGGTTTAAGTGATCGGTGTTGCTG--GGTTTC-CACGCGACGGAACGGTGGA-T--AGATTATACGCATCAAGCCTCCAGTCGTGCAC-GTGA-CT-CCTAG---CCATGACTTC-CAGGAAGT-GGAACCCAGAACGATGTTCGCAC-CTTTTGGA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGATGTGACCGTGACGGCATGTGAGTGGTTATTGATGTGTGT-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATAACT-CTTTCATACCTATGTGTTGA----ACTTC-ACT-----AGG--TTTG-ATGTTGCCATCATGGAAATTGGACCG-GGTTCGGAA-TAAA--ATGTTTAGTGATGCTTATTTGTACCG-C-CCCTCCTC--TTA--TCCAAGCGTTTGGGGGGTACAAAGTTGGAAA------CT---TTGG-TGTTTTGATTGCTTCATTGTGTTGCCTATCATTTTTATCG----TTAAGTGCTCCAAAAAGTTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---G--ACGCCT-TCCCTTTAT--GC-TTATAATTTATAGC--TCGGTTTT-----GCCAGCACC-ATTTGAATA-AAGG-CTTACACGAATCGTGGCGTAGC--------TTGGGGA{AG}GAATGCAAA-ACGTTATC-GTGTAGGTGCTTAAACGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCCTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTAGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTTTG-------TATTGACCTCCTCAA------GATTAG------TCAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTCGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTCAATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_lacunosum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTTTCAAAGACCGAGAACGTG--TGGCTTTCA-CCCGTC-----GAGAACATGC-CAGGCTTGCAAG---C--GCGCTTCTGCTTTCTCGACGGGCAACCTT--TG---TCGCCTCCGGC-TTGCC-----TC-ATCGGGGGCAGC-AAGGAGAGCGGGAACAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTCTGTT-GGGGCGCGCCGCCTGCTTCTT--GCCGCGCGGTGCGTTCCC--CCAC---TAGTGTGAGAATACGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGTCAAGGGCACGTCTGCCTGGGCGTCACGCCTCGCGTCACTCGGAGCACCGATCCCGGCCTAA--------ACCCCCG-TTTCGGTGCGTCTTGACGTGGACATTGACCCTCCGCGCTCTATCACGCGCGGTGGGTCCAAGCGGTTGGCGTTGCTG--GGTTTC-CACGCGACGGAGTGGTGGA-C--AGATTGTACGCATGAAGCCTCCAGTCGTGCGC-GCGA-CT-CCTAG---CCGTGGCCTA-CAAGAAGT-GGAACCCATAACGACGTCTGCAT-TGTTTGCA-AGGTCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAATAAAAAAAAA-????????GACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCCCCCCGCTTTTTTGCGGCCGACTGATGAGCCCCACAA--TC-GTTTCATACCTACGCGTTGA----ATTTC-GCT-----AGG--TTCG-GTGTTGCCGTCGTCGAAAACAGGCCC-GTTTTGGAA-AATG--GTGTTCGATGATG-TTAATTGTACCG-C-CCCTCCCCACTTG--TCCAAGTGTTTGGGGCGTGCAGAGTTGGACG------CT---TCGG-TATTTTGATCGCTATATTACGTCGCCTTTCATTGTTACCG----TCGATTGCTCCGAAAGTTTTACGGGTGTCGTCCACGTTAAAGATTCTTTG---G--AAGCAT-TCCATCTGT--GC-TTTCAGTTTATTGA--TTGGTTTC-----GCCAGCACC-ATACGAAA--AAGG-CCTACACGATTCGTCGCGCGGC--------TTTAG---GAACGCAAG-ACGTCGTC-GTGTAGGTGCCTTAAAAGACGTGCTACCTGGTTGATCCT??????????-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTT-AAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAATCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCCATATTTAGAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAA------CATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTTA-------TTTAT----------TAT-ATGTTT----------------------------------AAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAGAGTCAGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAT------------------TA--TTTATTGAATTTATA------TTTATTTTAAT-AAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTTATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATCTACATCTAGACGATT??-AAAAAAAAATTAAAAAAAA Allium_lemmonii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATCGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-CAGGGTTGCAAA---C--GCACTTCTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTCATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGAGCGCCGCCTTCTTTGT--GTCGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-CACCTAGCTTGGATATTGTCATGCGGG-TGTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTGATACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCCAGC--CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGG{AC}GA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCATGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTACATGCTATAGACACTTGG---GG-AAGCCT-TCCCTTTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGAGCATC--------CTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGAACCCGAAGTGGATTATTCACAGTCCATCTAATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATGAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATATAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_macropetalum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GAGAACAAGC-TAGTTTTGCAAT---T--GCATTGCTGCTTTCTAGATGGTTGTCTTT-TTA---CCGCCTTTGGA-TTGCT-----TT-ACTCGAGGCAAC-AACGAGAGCGGGAACAAGA-CCCCGGCGCAGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGCATGAGAATAAGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTG{CT}GTCACTCGGATCACC-TGCCAATCATGA--ATCGTCCTGACGG-TTTTGGTGCATCTTGACGTGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTCTAAGTGATTAGTGTTGCTT--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGACAAGT-GGAACCTATAACGATGCTTGCAC-CTTTTGTA-AGGTCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTATGTGTTTA----ACTTC-ACT-----AGG--TTTG-ATGTTGCCTTCGTTGAAATTGGACAG-GGTTCGGAA-TATA--ATGATGGTTGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTATGAGGGGTACCAAGCTGGGTA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCAGTATTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCCAAAGAGCCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTACTTATATC--TCGGTTTC-----GCCACCACTTGTCTTAATA-AACG-CCTGCACGTGTCGTGGCGTGCC--------CTGAGGAGGATTACAAA-ACGTTACT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCACTATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTGAAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCC-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAAATTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTTAATCAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT---------------AACAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_macrum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGT{GT}GCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGGC-TTGCT-----TTTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCGTCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGA--ACTGTCACGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGAGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGCTTGC??????????????????????????????????????-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGCCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAATGGACCC-GGTTTGGAA-TAAG-AACGTTCAATGATG-CTGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GG-AAGCCT-TCCCTCTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTTAAAA-AAGG-CCTGCATGATTCGTGGCGCATC--------CTCAAGTTGAATGCGAA-ATGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTTAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCA{AG}AGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATATGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTTCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATG------AAAA----------------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAATAAAAA Allium_madidum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTGTCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTGGCTTGA--ACTGTCACGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCCGTGGGTTTAAGTGATTGGCTGTGCTG--GGTTTC-CACGCGGCGTAATGGTGGA-A--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCGG-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGCTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTTAATGATG-TCGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GGAAAGCCT-TCCCTTTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATTCGTGGCGCATC--------CTTAAGTCGAATGCGAA-ACGCCATT-GTGCAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATTAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTTAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCC{AC}TTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CCAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAG{CT}GGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGT{CT}TTTTTTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGT--------------------------------------------------------------------------------------------GTAGAGCAGAGGCTTTCAAATCC-AAAAAAATAA-?????TCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGGCCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTTAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTA?????????-AAAAAAAAAAAAAAAAAAA Allium_membranaceum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTCTGTGAGACTGAGAACATG--TAGCTTT-A-CCCATC-------GAAGAGGC-TGGGGTTGCAAG---C--ACGCTTCTCCTCTCTAGATGGATGCCCTT--TG---CCGCCCCTGCC-TTGCT-----TTCGTTCGAGGCGAG-ACAGAGTGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ATGC-TTTTTGTT-GGAGCGCGTAGCCTTCTTTTT--GTTGTGTGATGCGTTC----CTAC---TAGTTTTAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TTCCT------------GTCACGCAGT-TTCTGGTGTATCTTGATGTGGATATTGACCCTCCGCG-----TTATGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTCCGGTTGTGCAC-GTGA-CTCCCTAG---CCATGACTTA-CATGAAGT-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AATAAAAATATAAAATAAAAA-????????GACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCGCAT--CT-TTTTCACACCTATGCGTTGA----ATTAC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCC-GGTTCAGAA-CACG--ATGTTCGATGATG-TTGTTTGTACTG-C-CCCTCCTC--TTA--CGCAAGAGTTTGGGGCGTACAGTGTTGGAAA------CC---TCGG-TATTTTGATCGCTCCGTCGCGTTGCCAATCATTTTTATCG----TTGAGTGCTCCAATTGTTTTACGGGTGTTGTGCATGCTAAAGGTACTCGG---G--AGTCCT-TCCCTTTGT--GC-TTTTCAT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCATTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------C------AATTCAATATCTTTCTTATTCATTTTACTCTTTCACATTACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATAG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AAAAATTAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACCAATAAGAAAATCTTGGAATAATTGGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACT--------------------------------------------TTAGAACTAGCTG-----TTAT-TTTATGTTGAATACTAATTTA-TCTGTCTACTA-------------GTTTGTTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATTAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATT---------------TTTTA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAA------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTTAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGATAAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-ATAAAAAAAAATAAAAATA Allium_monticola TTCCGTAGGTGAACGT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATCGAGAACGTG--TAGCTTT-G-CCCGTC-----GAGAAG--------------------T--GCGCTTCTGCTTTCTAGACGGACGCCCTT--TG---CCGCCTCTGGC-CTGCT-----TTTATTCGAGGCAGG-AAGGAGAGCGGGAATAAGA-TCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGTCGCCTTCTTTTT--GTTAAGCGGTGCGTCCTC--CTGC---TAGTGTAAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-CGCCTAGCTTAA--GCTACCGT-----------GTGCGTCTTGATGTGGATATTGACCCTCCGCGCTCTTTTACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTTAAGCCTTCAGCTGTGCAC-GTGA-CTCCCTAG---CCGTGACCTA-CAACAAGT-GGAACCCAGAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAATAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGTAGCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTGCCACAA--CT-TTTTCACACCTATGCGATGA----ACTTC-GTT-----AGG--TTTC-GTGTTGCCTTCGTGGAAAACGGACGC-GGTTTGGAA-TGCG--ACGTTCGATGATG-GTGTTTGTACCT-C-CCCTCCTC--TTA--CCCGAGTGTTTGGGGGGTACGGTGTTGGAAA------CC---TTGG-TATTTTGATCG{CT}TCCGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATTCGTAGC--TTGGTTTT-----TCCAGCACC-GTCTAAAA--AAGG-CCTGCACGATTCGTGGCGCATCCTAAAAAATTTAGGACGTTTGCGAA-ACGTCGTT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-TAAAAAAAAAAAAAAATTA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACCATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTTCATT------AACTTATG-------TATTGAACTCCTCAA------GATTAG------TTAAAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATTCAATTCTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TATAATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TACGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGCACATA------AATAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTCAT--TTATATTTATTAA-----------------------ATTTAGTAATTAC------------CTTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA-------TTA-------AAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTATTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAAAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_munzii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTCGTGAGATCGAGAACGTG--TCGCTTT-G-CCCGTC-----GAGAAG-----------------------------TTGCTTTCTGGACGGGCGCCCTT--TG---CCGCCTCCGGC-TCGCT-----TTCGTTCGAGGCGAG-AAGGAGGGCGGGAA{AT}AAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGGCGCGTCCTC--CTAC---TGGTGTCACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTC{AG}GAGCACC-TTCCAAGCATGC--ACTGTCGTGCGGG-GTTCGGTGTGTCCTGATGCGGATACTGACCCTCCGTGCTCTTTCGTGCGCGGTGGGTTCAAGTGACTGGCGGCGATG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---TCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCACGT--CT-TTTTAACGCCTACGCGTTGA----ATTTC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAATGGACCG-GGTTTGGAA-TACG--ATGTTCGATGGTG-TTGTTTGTACCG-C-CCTTCATC--{CT}TA--CCCAAGTGTTTGGGCGGTACGTAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTCCGTCGTGTTGCCAATCATTTTTATCG----TCGGGTGCTCCGATAGTTTTACGGGTGTGGTGCATGGTGAG{AG}GCACTGGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTAAAA--AAGG-CCTGCACGGTTCGTGGAGCGTC--------TTAAGGACGGACGCGAG-ACGTCGTC-GTGCGGGAGCCTGA{AG}AGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTT--TTTTTTTTT--A----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATTTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGT--------------------------------------------------------------------------------------------GTAGAGCAGAGGCTTGAAAATCC-TAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACACTTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_nevadense ????????????????-???????????????????????????????????GATTGAGAACATG--TAGCTTT-G-CCCGTC-----GAGAAGAGGA-TGGGGTTGCACG---T--GCGCTTATCCTTTCTAGACGGACGCCCTT--TGCCGCCGCCTCTGCC-TTGCT-----TTCGTTCGAGGCGAG-GAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGTCGCCTTCTTTTT--GTTGTGCGGCGCGTCCTC--CTAC---TAGTGTATGGATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TGCCTA{AG}CGTAA--ACTTTCGTGCGGG-TTTCGGTGCGTCTTGATGTGGATATTGACCCTCCGCGCTCTTTTATGCGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGGTTATACGCTTTAAGCCTCCGGTTGTGCGC-GGGA-CTCCCTAG---CCATGACTTA-CAAGAAGC-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCA???????????????-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGTTGTGTGT-GCTACGTCAGGCTCCCCGCTTTG{CT}TGCGGCCAACTGACGAGCACCACAG--CT-TTTTCACACCTATGCGTTGA----ATTTC-GCT-----AGGTTTTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TACG--ATGTTCGATGGTG-TTCTTTGTACCG-C-CCCTCCTC--TTA--CCCAAGTGAATGGGGCGGACGGTGATGGAAA------CC---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCAGTCATTTTTATCG----TTGGGTGCTCC{AT}ATAGTTTTACGGGTGTTGTGCATGCTAAAGGTACTCGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTAAAA--AAGG-CCTACACGATTCGTGGCGCGTC---------TTAGGATGAATGCAAA-ACGTCGTT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTATTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTAGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCGAAAAAAATTAGAGAATAGCTCAGTTGTGTAGAGCAAAGGTTTGAAAATCCTTGTGTCACCGGTTC----------------AAATATGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATGTATTGACTATTGACCTCCTCAA------AATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTACTCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAA--TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATAATTAATATG------AAAACTATTTT------------------------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGGTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-ATAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AA--------------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAT Allium_nevii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTGGCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGGC-TTGCT-----TTTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGC{AG}TCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGA--ACTGTCACGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGAGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGCTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGC-AAAAAAAAAAAAAAAAAAAAA-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GG-AAGCCT-TCCCTCTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTTAAAA-AA?????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAATAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGCGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATATTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATG------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TT---------AAAAAAAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAAAAAAAAAAA Allium_obtusum TTCCGTAGGTGAACCT-GCGGGAAGGATCATTGTCGAGT-CCCTCTTTGTGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAGA---T--GCACTTTTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGTGCTCTTATACGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-TAAAGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAGC--CCACGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCA-GACCCCA?GTCAGG-AAAAAAAAAAAAAAAAATAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTCTGTTGCGGCCAACTGACGAGCACCATTA--CT--TTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGATCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--CTA--TCCGAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCA----TTGGGTGCTCCAATAGTTGTACGGGTGTCGTGCATGCTGAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCATC--------TCTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCTTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAATAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAGAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCTTCAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCTAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCC--------------------ATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAATATAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AAAAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAATAAAAAAAAAAAA Allium_parishii TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGCGAGATCGAGAACGTG--TAGCTTT-G-CCCGTC-----GAGACGGGGC-TGGGGCCGCGGG---T--GCCCTTTTGCTTTCTCGACGGGCGCCCTT--TG---CCGCCTCCGGC-TCGC------TTCGTTCGGGGCGAG-AGGGAGTGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGGATTTTTGTC-GGAGCGCGTCGCCTTCTTCTT--GTTGCGCGGCGCGTCCTC--CTAC---TGGTGTCACATTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TTCCTGGCACTA-CAATGTCGTGCGGG-TTTCGGTGCGTCTTGATGCGGATATTGACCCTCCGTGCTCTTTCGCGCGCGGTGGGTTCAAGTGATTGTCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---CCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-??????????CCGTGACGGCATGTGAGTGGTTGT---TGTGTGC-GCTACTTCAGGCTCCCCGCTTTGCTGCGGCCAACTGACGAGCGCCGCGT--CT-TTTTAACGCCTACGCGTTGA----ATTAC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TACG--ATGTTCGATGGTG-TTGTTTGTACCG-C-CCCTCCTC--TTA--CCCAAGTGTTTGGGGCGTACGGAGTTGGAAG------CCTCGTCGG-TATTTTGATCG--TCGTCGTGTTGCCAATCATTTTTATCG----TCGGGTGCTCTGATAGTTTTGCGGGTGTGGTGCATGGTGAGGGCGCTCGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTTGAA--AAGG-CCTGCACGGTTCGTGGCGCACC--------TCTAGGGCGGATGCGAA-ACGTCGTCTGTGTGGGATCCTGAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAT-GAAAACTTCCAAATTCAGAGAAACCCCGGAACTAAAAAAGGGCAATCCTGAGCCAAATTTTTT---TTTTTTTT-------AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATTTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTTCTT-TAATTTTGAATTTT--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACACTTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_parryi ?????????????????????????????????????????????????????????????????--???????-???????????????????????????????????????????????????????????????????????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-GCTACGTCAGGCTCCCCGCTTTGCTGCGGCCAACTGACGAGCGCCGCGT--CT-TTTTAACGCCTGCGCGTTGA----ATTAC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCC-GGTTAGGAA-TACG--ATGTTCGATGGTG-TTGTTTGTACTT-C-CCCTCCTC--TTA--CCCAAGTGTTTGGGGCGTACGGAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTCCGTCGTGTTGCCAATCATTTTTACCG----TCGGGTGCTCTGATAGTTTTGCGGGTGTGGTGCATGGTGAGGGCGCTCGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTTGAA--AAGG-CCTGCACGGTTCGTGGCGCATC---------CTAGGGCGGATGCGAT-ACGTCGTCTGTGTGGGATCCTGAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAT-?????????????????????????????????????????????????????????????????????????????----????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????-??????????-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTA{AG}------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTAGTTTGGTTCACTGGTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTACTAAATATTATCCTATATTT-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTT{AT}TA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACAATTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAG{AT}TGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAATAAAAAAAAAAAAA Allium_parvum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-CAGGGTTGCAAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TTTATCCAAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ACTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTGTACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGGCTTA-CGAGAAGT-GGAACCCAGAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CG-TTTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGTTCGACGATG-TTGTTTGTACCGCC-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-----------------TTGTTTTT-----GCCAGCACC-ATCTAAAAA-TA{AG}G-CCTGCACGATTCGTGGCGCATC--------TTT{AT}A{GT}TCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTCTTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT--------------------------------------TTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTAAAA------TTTATTTTAATA-AAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CTGATTCTAGAATCTACA?????????????-AAAAAAAAAAAAAAAAAAA Allium_passeyi TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACGCG--TAGCATT-A-CCCATC-----AAGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGTTATCCCT-TTA---CCGCCTT{CT}GGC-TTGCT-----TT-ACTCGAGGCAAC-AACGAGAGCGGGAACAAGA-TCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGA-AATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGATCACC-TTCCTAGCTTGA--A--------ACGG-TTTTGGTGCATCTTGATGTGGATATTGACCCCTCGCGCAC-TTCACGCGCGGTGGGTCTAAGTGATTGGTGTTGCTT--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGAGAAGT-GAAACCTATAACGATGCTTGCAC-CTTTTGTA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAATAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGC-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTATGTGTTGA----ATTCC-ACT-----AGG--TTTG-ATGTTGCCTTCGTTGAAATTGGACCG-GGTTCGGAA-TATA--ATGATGGATGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTTTGAGGGGTACCAAGCTGGATA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTATTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCCAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTATTTATATCTGTCGGTTTT-----GCCACCAT{CT}TGTCTTAATA-AACC-CCTGCACGTGTCGTGGCGTGCC--------TTGAGGAGGATTACAAA-ACGTTATT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAATAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTCCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATGCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTGGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTATTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT---------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATTGAATTTCTA------TTTATTTGAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAATGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTACACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_peninsulare TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTTTTAAAGACTGAGAACGTG--TGGCTTT-G-CCCGTC-----GAGAGCTTGG-CAGTCTTGCAAC------GCGCGCTTCTTTTCTCGACGGGTGCCCTT--TG---CCGCCTCCGGC-TCGCC-----TT-GTTCGGGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGTCGCCTGCTTCTT--GCTGTGCGGCGCGTTCTT--CCACTAGTAGTGTGACATTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-A{GT}CCC{GT}GCTTGA--------ACCCGGG-TTTTGGCGCGTCTTGATGTGGACATTGACCCTCCGTGCTGTTTTACGTGCGGTGGGTATAAGCGGTGTGCGTTGCTG--GGTTTT-CGCGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCTCCAGTTGTGCGC-GCGA-CT-CCTGG---ACGTGACCTA-CAAGAAGT-GGAACCCGTAACGACGTCTGCAG-CTTTTGCA-AGGTCGTACCATGACCCCAGGTCAGG-AAAAAAAAATATAAAAAAAAA-CGGGTTTTGACCGTGACGGCATGTGAGTGGTGATTGTTGTGTGT-GCTATGTCAGGCCCCCCGCTTT-TTGCGGCCGACTGACGAGACCCACAA--AT-TTTTAGTACCTACGTGTTGG----AAGAC-GCT-----AGG--TTCTCAGGTTGCCATCGTAGAAAACGGACCC-GGTCTGGAA-TA----GTGTTCGGTGATG-TTATTTGTACCG-C-CCCTCCTC--TTG--TACAAGTGCTTGGGGGGTACAGAGTTGGACG------CT---TCGG-TATTTTGATTGCTCTGTTACGTTGCCTATCATTTTTATCG----TTGATTGCTCCAATGGTTTTGCGGGTGTTGTCCATGTTAAGGAATCTTTG---G--AAGCGT-TTCGTTTGT--GC-TTTCAATTTTTTGC--TCGGTTTT-----TCCAGCACC-ATCTGAGAA-AAGG-CCTGCACGAGGCGTTGCGCGGA--------TTTAG---GAACGCTAG-ACGTCGTT-GTGCAGGTGCCTAAGAAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-ATAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TCTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTAAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAA-----TT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGA-CTCCTCAA------CTTTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTTT----------------------------------AAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTAGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTAC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATCTACATCTAGACGATTCA-AATAAAAAATTAAAAAAAA Allium_perdulce TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACGCG--TAGCATT-A-CCCATC-----GAGAACAAGC-TAGTTTTGCAAT---T--GCACTGCTGCTTTCTAGATGGTTGTCTTT-TTA---CCGCCTTTGGC-GTGCT-----TC-ACTCGAGGCAAC-AAAGAGGGCGGGAACAAGA-CCCCGGCGCAGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTTCTC--CTAC---TAGTGTGAGAATAAGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGATCACC-TGCCAATCATGA--ATCGTC{CT}TGACGG-TTTTGGTGCATCTTGACGTGGACATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGT{CT}TAAGTGGT{CT}AGTGTTGCTT--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGAGAAGT-GGAACCTATAACGATGCTTGCAC-CTTTTGTA-AGGTCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTATGTGTTTA----ACTTC-ACT-----AGG--TTTG-ATGTTGCCTTCGTTGAAATTGGACCG-GGTTCGGAA-TATA--ATGATGGTTGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTATGAGGGGTACCAAGCTGGGTA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTATTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCCAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTACTTATATC--TCGGTTTC-----GCCACCACCTGTCTTAATA-AACG-CCTGCACGTGTCGTGGCGTGCC--------CTGAGGAGGATTACAAA-ACGTTACT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTTCGTGATTTAAAGAATTTT-------TCTATATTTATAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------ATTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCC-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAAATTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTTA-AAAAAAAAAAAAAATAAAA Allium_platycaule TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGCTTAGGGTTGCAAA---C--GCACTTTTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCAAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGTGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTAAAGCCTTCGGTTGCGCAC-GTGA-CTACCTAGC--CCATGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCCCCATAA--CG--TTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAA-AATGATCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCGAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCG----CTGGTTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCAC{AG}ATTCGTGGCGCATC--------TTTAAGTC{AG}AATGC{AG}AA-ACGTCATT-GTGTAGGTGCCTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAATAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGCCTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTCGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTTTGTTTACTGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATGAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTTATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATAAAAAAAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_plummerae TTCCGTAGGTGAACCT-GCGGAAAGGATCATTGTCGAGT-CCCGCTTTATGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GGGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGATGTCCTT-TTG---CCGCCTTTGGC-TTGCT-----TT-TCTCGAGGCAAC-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACTG-TTGTTGTT-GGAGTGCATCGCCTTCTTTTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGA--ACCGTCATGACGG-TTTCGGTGCATCTTGATGAGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTTTGAGTGATTGGTGTTGCTG--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTATACGCATCAAGCCTCCAGTTGTGCAC-GTGA-CT-CCTAG---CCATGACTTA-CAAGAAGT-GGAACCCATAACGATGCTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCA?GTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGC-ATTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACATACCTCTTTTCATACCTATGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCATCATGGAAATTGGACCG-GGTTCAGAA-TAGA--ATGTTCAATGATGCTTATTTGTATTG-G-CCCTCGTC--TTA--TCCAAGCGTTTAAGGGGTACAAAGTTGGAAA------CT---TTGG-TATTGTGATTGCTTCATTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAAAAAATTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---G--AAGCCT-TTCCTTTGT--GC-TTATAATTTATAGC--TCGGTTTT-----GCCAGCACCGATCTGAATA-AAGG-CCTGCACTTGTCGTGGTGTAGC--------TTGAGGAGGAATACAAA-ACGTTATT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATTAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCTTCAGTTG-GTAGAGCAGAGGACTG???????-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTCGGAATAATTTGAATTCCGTTATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCGAAGTATTATTTTATTTCTTTTCCCAGTAGAAATTTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATTTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTAGA------TTTTTTTTAATCAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTG--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_praecox TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGTCCCCCCTTTTCAAGACCGAGAACGTG--TGGCTTC-A-CCCATC-----CAGAACATGC-CAGGGTTGCAA{CG}---C--GCAATTCTGCTGTCTGGATGGATGTCTTT--TG---CCGCCCCCCGGCTTGCC-----TT-ATTCGAGACAAC-TGGGAGAGCGGGAATTA{AG}A-CCCCGGCGTGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGGGCGCATCGCCTACTTCTC--GTTGCGCGGTGCGTTCTC--CCAA---TAGTGTGA{AG}AATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCAAGGGCACGTCTGCCTGGGCGTCACGCCTCGCGTCACTCGGAGCAGC-AACCTGGCTCAA--------ACCTGGG-TTTTGGTGCGTCTTGATGTGGACATTGACCCTCCGTGCTCTTTTACGCGCGGTGGGTCTAAGCGGTCGGCGTTGCTG--GGTTTT-CACGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCCCCAGTCGTGCGC-GTGA-CT-CCTGG---CTGTGACCTG-AAAGAAAT-GGAACCCGTAACGACGTCTGCAG-CTTTTGCA-TGGTCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAATAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGTTGTGTGT-GCTACGTCAGGCTCCCCGCTTTG{CT}TGCGGCCAACTGACGAGCACCACAG--CT-TTTTCACACCTATGCGTTGA----ATTTC-GCT-----AGGTTTTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TACG--ATGTTCGATGGTG-TT{CT}TTTGTACCG-C-CCCTCCTC--TTA--CCCAAGTGAATGGGGCGGACGGTGATGGAAA------CC---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCAGTCATTTTTATCG----TTGGGTGCTCC{AT}ATAGTTTTACGGGTGTTGTGCATGCTAAAGGTACTCGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTAAAA--AAGG-CCTACACGATTCGTGGCGCGTC---------TTAGGATGAATGCAAA-ACGTCGTT-GTGTAGGTGCCTAA?AGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAATAAAAAAGAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATG-AATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTTATAAGTGGTT---------CAAAGAAAATTCAATATTTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTATAGAGCAGAGGCTT--AAATCCTTGTGTCACTGGCTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AAATAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCTGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAACATTAGCATTAGTTAGAATTAGAACTAGCTG-----CTAT-TTTATGTTGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TATTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCTATT---------------------TTAAGATTTTAAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAA----AGTCCTT-TAATTTTGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATATATAAAATACAATAC-------------TA--TTTATTGAATTTATA------TTTACTTTAATAATATAAATATCT-----TTCTAAGTTTTA---TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATAAAACAAAAAAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------TAGATTCTAGAATCTACATCTAGACGATTCA-AAATAAAAAATAAAAAAAA Allium_robinsonii TTCGGTAGGTGAAC-T-GCGG-AAGGATC-TTGTCGAGT-CCCTCTTTATGAGATCGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCGAA---C--GCACTTCTGCTTTCTAGACGGATGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TTTATCCGAGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGCCGCCTTCTTCTA--GTTGTGCGGTGCGTCCTCCTCTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCAGAGCACC-TGCCTAGCTTGA--ACTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGG-CTACCTGG---CCATGACTTA-CAAGAACT-GGAACCCATAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAGAAACGTTCAATGATG-TTGTTTGTACCA-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGTTAAAGACACTTGG---GG-AAGCCT-TCCCTTTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAA--AAGG-CCTGCACGATTCGTGGCGCATC--------CTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATAATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCGGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAAAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAA----ATC------CTAT-ATTTCA-----ATATTTAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAAT--AAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_roseum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCAAGT-CCCTCTTTGAGAGTTCGAGAACGCG--TAACATT-A-ACCGTG-----CGGAGCAAGC-CAGCTTTGCGGT------GCAATTCTGCTTTCCGTACGGACGTCCTA-TCG---TCGCATCCGGC-TTGCA-----TC-CTTCGAAGCAAG-CAGGAGTGCGGGAATGAAGACCTCGGCGCGGTTTGCGCCAAGG-ACGG-ATGTTGTT-GGAGCACGCCGCCCACTTTCC--GTGGTGCGGTGCGTCCTC--CAAA---CGGTGTGAGAATACGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTAAGACCGTCAGGTCAAGGGCACGTCTGCTTGGGCGTCGCGCCTTACGTCACTCCAAACCCC-TACCATGCGTAA--ACCGCTATGGTGG-TAAGGGTGCGTGCGGATGTGGATAGTGACCCTTCGTGCT-TCCGGTGCGCGGTGGGTTTGAGTGATGGTCGTTGCTA--GGTTTCGCACGCGGCG-AATGGTGGATT--AGAGTATGCGC-------CTCCGGTTGTGCAC-AAGA-CT-CCCAG---CCACGACTTA-CGAGAAGTAAAAACCTGTGACGGTGCTTGCAC-GTTACGCA-AGCTCGGACCATGACCTCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-AGGGTTGCGGCCGTGGCGGCATGTGAGTGGTTATCGATGTGAGT-TCTTTGTCAGGCTCCCCGCTTCTGAGCGGCCAACTGGCGAATTCCACAT--CT-CTTTCATACCGGC-CGTTAATTTATTTTCGGCT-----GGG--TTTT--TTTTGCCTTC{CG}CGGGAAACC{CG}A{AG}CG-CGTTCGTAAGTGAGCGCCGAACGA{AT}GTTG-CTGTCTGTCCT----CCCTCCTC--TTA--TTCAAGTG{CG}ATAGGGCGTACGTAGTTGGATT------{AC}TTC{AC}{GT}TGG-TGGTTC{CG}G--GTTTCGTTCGGAAATCTGT--TTTCCATCG----TTGAAG{CG}TCCCGAATGTTTTGCGGATGCTGTGCATGCTCAGGTTCTTGGG---G--ACGGCT-TCCTAAGGA--TC-GTACGAT---------TCGGTTTT-----GTCCGCACT-TCATGAGA--GACG-CCTGCATGAGTCGTGGCGCTCC--------TTTTGGAGGAGTGCGTG---GCCTTTTGTGTGGGTGCCTACGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGTAATCCTGAGCCAAATCTTTA----TTTTTTT-AA----AAACAAAGG------TTT-----AGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAA---TTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGATTTTAGAAATCATGAGGGTTCAAGTCCCTCTATCCCCAGTAAAA-GCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTAGTT---------CAAAGAAAATTAAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACTTGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTTAAATCTAAATAAATCTAAATCTGGCTGCTGAATTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-TAAATAAAAA-CCTTTTCTTTAGCAAAGTCAGTTTCTACGGGAAATTCTAAAAGTTTTTTTGTGCGGCAAACAAATAAAAAAATCTTGGAATAATTAGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGAATT------AACTTATG-------TATTGA-CTTCTCAA------GATTAG------TTAGAACTCGCTA-----CTATATTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TATTTTTTTTATTAGGAAAAGAAATAAAATGTAATTATGATGAATATGAATATGAAAACTATTTTGT-------TTTAT----------TAT-ATGTAC-----------------------------ATCTGAAGATTAAATTAAA-------TTCGTTT-------CGTTTAC------------------T-AAATATTATC--------AT------------ATATTTAAATTATGTACATAACAAACAACAAAGAGCAT-GGAGACTAAAAACAAGATTTTAAGAAAAAG----AGTCCTT-TTATTTCTAATTTTCTAATTTAATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATTC------------------TA--TTTATGGAATTTATA------TTTTTTTTATT-AAAAAAATATCT-----TTCTAAG--------TTTTTAAAGTGTTATT------AACAATTTAAAGAATACTTC--------AGTTTAAATTAAACAAAAGAATTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAATATAACTATAT--------CAAATTCTAGAATCGCCATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_runyonii ?????????????????????????????????????????????????????????????????--???????-???????????????????????????????????????????????????????????????????????????---?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????-CGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCAC-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTACGTGTTGA----ATTTC-ACT-----AGG--TTTG-ACGTTGCCTTCATGGAAATTGGATCG-GGTTCGGAA-TATA--ATGACGGATGATGTTTATTTGTACTG-C-CCCTCGTC-TTTG--TCCAAGCGTTTAAGGGGTACCAAGCTGGGTA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTTTTATCG----TCGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCCTAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTATTTATAGC--TCGGTTTT-----GCC{AT}CCACCCATGTTAATA-AACG-CCTACACGTGTCGTGGCGTATC--------ATGAGGAGGAATACAAA-ACGTTAAT-GTGTAGGTGTTTGAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAATAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TA------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATATAGCTCCTGGACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTTTG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TATTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCC-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATTAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATGCTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATTT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_scilloides ???????????AACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCGAA---C--GCACTTCTGCTTCCTAGACGGATGCCCTT--TG---CCGCCTCCGTC-TTGCT-----TTTATCCGAGGCGAG-AAGGGGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGCGCATCCTA--CTAC---TAGTGTGAGAACATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGA--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGC???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGGTGTGTGT-GCTATGTCAGGCTCCCTGCTTTGTTGCGGCCAACTGACGAGTACCACAA--CT-TTTTCTCACCTATGCGGCGA----ACTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAATGGACCC-GGTTTGGAA-TAAG-AATGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTATGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTCCGTTGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATTCGTGGCGCATC--------TTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCTTAA{AG}AGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTATTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTC-TATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAAT{AC}TGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCTAATGAAAA-----ATTTCTACTGGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTAT-----------------------------ATTTGAAGATCAAATTTAA-------TAGGTTT-------TGTTTAC-------------------------TTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------C-GATTCTAGAATCCACATCTGGACGATTCA-AAAAAAAAAAAAATAAAAA Allium_serra TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCCCTTTTAGATACTGAGAACGTG--TGGCTTT-G-CCCGTC-----GAGAGAATGG-CAGTCTTGCA-A---CGCGCGCTTCTGCTTTCTCGACGGGTTCCCTT--TG---CCGCCTCTGGC-TCGCC-----TT-GTTTGGGGCGAG-ACGGGGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGTCGCCCGCTTCTT--GCTGTGCGGCGCGTTCTC--CCACTAGTAGTGTGACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-ATCCCGGCTTGG--------ACCCAGG-TTTTGGCGCGTCTTGATGTGGACATTGACCCTCCGTGCTCTTTTACGCGCGGTGGGTCTAAGCGGTGTGCGTTGCTG--GGTTTC-CGCGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAACCTCCAGTTGTGCGC-GCGA-CT-CCTGG---CCGTGAACCA-CAAGAAGT-GGAACCCGTAACGACGTCTGCAG-GTTTTGCA-AGGTCGTACCATGACCCCAGGTCAGG-AAAATAAAATATAAAAAAAAA-CGGGTTGTGACCGTGTCGGCATGTGAGTGGTGATTGTTGTGTGT-GCTATGTCAGGCCCCCCGCTTT-TTGCGGCCGACTGATGAGCCCCACAA--GT-TTTTCGTGCCTACGTGTTGG----AAGAC-GCT-----AGG--TTCTCAGGTTGCCATCGTAGAAAACGGACCC-GGTCTGGAA-TA----GTGCTCGGTGATG-TTGTTTGTACCG-C-CCCTCCTC--TTG--TCCAAGTGCTTGGGGGGTACAGAGTTGGACG------CT---TCGG-TATTTTGATTGCTCTGTTACCTTGCCTATCATTTTTGTCG----TTGATTGCTCCAATAGTTTTGCGGGTGTTGTCCATGTTAAGGAATCTTTG---G--AAGCGT-TTCGTTTGT--GCTTTCAAATTTTTTGC--CTGGTTTT-----TCCAGCACC-ATCTAAGAA-AAGG-CCTGCACGAGGCGTTGCGCGGC--------------AGGAACGCTAG-ACGTCGTT-GTGCAGGTGCCTGAGAAGACGTGCTACCTGGTTGATCCTGCCAGTAGT?-ATAAAAAAAAAAATAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TCTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTAAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAAAAAAAT-CCTTTTCCTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATAGA-CTCCTCAA------CTTTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCGAGTAGAAA-ATTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTTT----------------------------------AAGATCAAATTAAATAGGTTTTAGGTTT-------TGTTTAC------------------T-AAATATTATT------CTAT-ATTT--------TATTAAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTTCTT-TAATTTAGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAATGTTTAC---------------------------------------TAAAGTATAACTATAT--------TGGATTCTAGAATCTACATCTAGACGATTCA-AATAAAAAATTAAAAAAAA Allium_sharsmithiae TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGCGAGATCGAGAACGTG--TCGCTTT-G-CCCGTC-----GAGAAG-----------------------------TTGCTTTCTGGACGGGCGCCCTT--TG---CCGCCTCCGGC-TCGCT-----TTCGTTCGAGGCGAG-AAGGAGGGCGAGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGGCGCGTCCTC--CTAC---TGGTGTCATAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TTCCAAGCATGC--ACTGTCGTGCGGG-TTTCGGTGCGTCCTGATGCGGATACTGACCCTCCGTGCTCTTTCGTGCGCGGTGGGTTCAAGTGATTGGCGGCGATG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---TCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAAAAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------GTTGCCTT{CG}GTGGAAAACGGACCG-GGTTTGGAA-TACG--AAGTTCGATGGTG-TTGTTTGTACCG-C-C{CG}TT{CG}GTC--TTA--CCCAGGTGTTTGGGCGGTACGTAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTCCGTCGTGTTGCCAATCATTTTTATCG----TCGGGTACTCCGATAGTTTTACGGGTGTGGTGCATGGTGAGAGCACTGGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GCCTAGAA--AAGG-CCTGCACGGTTCGTGGAGCGTC--------TTAAGGACGGATGCGAG-A?????????????????????????????????????????????????????????-AAAAAAATAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTT---TTTTTTTT--A----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATT{CT}TTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATTTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-TAAAAAAAAA-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-------???????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????? Allium_shevockii ????????????????-???????GGATCATTGTCGAGT-CCCTCTTTACGAGACTGAGAACGTG--TAGCTTT-A-CCCGTC---------------------------------------------GCAGAGACGGATGCCCTT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-TCCCGGCGCGGTTCGCGCCAAGG-ACGGTTTTTTGTT-GGAGCGCGTCGCCTTCTTTTT--GTTAGGCGGCGCGTCCTC--CTAC---TAGCATCAA{AC}ATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TGCCCGGCTTAA--ACGCCC------------GGTGCCTCTTGATGTGGATATTGACCCTCCGCGCTCTTTTACGCGCGGTGGGTTTAAGTGATTGGCGGCGTTG--GGTTTC-CACGCGGCGGAATGGTGGA-T--AGATTATACGCTTTAAGCCTTCAGCTGTGCAC-GTGA-CTCCCTAG---CCGTGACTTA-CGAGAAGT-GAAACCCAGAACGATGTTTGCGC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAATAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCCCCCCGCTTTGTTGCGGCCGACTGACGAGTACCACGT--CT-TTTTCGCGCCTACGCGTCGG----ATTTC-GCT-----AGG--TTTC-GTGTTGCCTTCGTGAGAAACGGACCC-GGTTCGGAA-TGTA--ACGTTCGATGATG-TTGTTCGTACCG-C-CCCTCCTC--TTAACTCCGAGAGTTTGGGGGGTACAGTGTCGGAAG------CC---TTGG-TATTTTGATCGCTCCGTTGTGTTGCCAATCATTTTTATCG----TTGGGCGCTCCGATAGTTTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---GG-AAGCCT-TCCCTTTGT--GA-CTTTAATTCGTGGC--TTGGTTTT-----GCCAGCACC-AT{AC}TGAA---AAGG-CCTGCACGGTTCGTGGCGCATC--------TTTAGGACGGATGCGGT-ACGTCGTT-GTGTAGGTGCCTGAGAGGACGTGCTACCTGGTG????????????????-AAAAAAAAAATAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGTTTCAAGTCCCTCTATCCCCA??????????????????????????????????TACTATATTCTCC-TC--CCTCTTTTTTTCGTAA{CG}TGGTT---------CAAAGAAAATTCAAT{AC}TCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATATCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGTAGAGGCTTGAAAATCC????????????????????????????????????????????????????????????????????-???????????????????????-AAAAAAAAAA-------?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-------???????????????????????????????????????????????????????????????????????????????????????????????????????????????-???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????? Allium_simillimum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTCATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGCTAGGGTTGCGAA----C--GCGCTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCTT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TGCCTGGCTTGA--ACTGTCACGCGGG-TTTTGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATATGCGCGGTGGGTTTAAGTGATTGTCGGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGAGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TT---TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTTCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACGTGG---GG-AAGCCT-TCCCTCTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATCCGTGGCGCATC--------CTTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATAAAAAAAA-G-AAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATAGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAG???-???????????????????????-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATAATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------TGTTTTAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_speculae TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGACTGAGAACGTG--TAGCATT-A-GCCATC-----GAGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGCTGTCTTT-TTA---CCGCCTTTGGC-TTGCT-----TC-ATTCGAGGCAAC-GATGAGATCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGTGCGGTGTGTTCTC--CTGC---TAGTGTGAGAATACGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGATCACC-TGCCTAGCTTGA--AACGTCATGACGG-TTTCGGTGCATCTTGATGTGGATATTGACTCTTCGCGCAC-TTCACGCGCGGTGGGTCTAAGTGATTGGTGTTGCTT--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTGTACGCGTCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGAGAAGT-GGAACCTGAAACGATGCTTGCAC-CTTTTGTA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCAC-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATATCT-CTTTCATTCCTATGTGCTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCTTCGTGGAAATTGGACCC-GGTTCGGAA-TACA--ATGATGGATGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTTTGAGGGGTACCAAGCTGGATA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCCAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTATTTATAGC--TCGGTTTT-----GCCACCACCTGTCTTAATA-AACG-CCTGCACGTGTCATGGAGTGTC--------ATGAGGAGGAATACAAA-ATGTTACT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TA------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTTACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATATAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTTTG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTTT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATTAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_stellatum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGGAAACATGTGTAGCTTT-ACCCCATCGAGAAGAGAAGAGGC-TAGTTTTGCAAG---T--GCACTTCTACTTTCTAGATGGACGCCCCT--TG---CCGCCTCTGGC-TTGCT-----TC-ATTCGAGGCAAG-AAAGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACAT-TTTTTGTT-GGAGTGCATCGCCTTCGATTT--GTTGCGCGGTGCATCTTC--TTAC---TAGTGCGAGATTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCAAAGCACC-TACCTAGCTTAA--ACAATCATGCGGG-TTTCGGTGTGCCTTGATGTGGATATTGACCCTCCACGCTCTTTTACGCGCGGTGGGTTTAAGTGATCGGCGGTGTTG--GGTTTC-CACGCGGCGAAATGGTGGA-T--AGATTATACGCTTCAAG---CCAGTTGTGCAC-GTGAACTCCCTAG---CCATGACTTA-CAAGAAGT-GGAACCTAGAACGACGTTTGCAC-CTTTTGCA-AGTTCGGACCATGACCCCAGGTCAGG-TTAAAAAAAAAAAAAAAATTA-TGGGCTGTGACCGTGACGGCATATGAGTGGTTATTTATGTGCGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTAGCATAA--CT-CTTTTATACCTATGTGTTGA----ATTTC-ACT-----AGG--TTTC-ATGTTGCCATCATGGAAAACGGACCC-GGTTTGAAA-TATA--ATGTTCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTT--CCCAAGTGTTTGGGGGGTACAAAGTTGGAAA------CC---TTGGTTATTTTGATCGCTTCGTTGTGTTGCCTATCATTTTTATCG----TTGACTGCTCCAATAGTTTTACGGGTGTTGTGCATGTTAAAGATTCTTGG---G--AAGCCA-TCCCTTTGT--GC-TTTTAATTTATAGT--TTGGTTTT-----GCCAACACC-ATCTAAAAA-AAGG-CCTACATGATTCGTGGCGCGTC--------TTTAGGACGATTGCAAA-ACGTCATT-GTGTAGGTGCC-AAGAGGACGTGTTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAATAAAAAAAAAA-??????TTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTC-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTAAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAAT{AC}TGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAATAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTAAGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAGATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCTTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATAT-------AAAACTATTTTGTTTTATTATTTAT----------TAT-ATGTCT-----------------------------ATTTAAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTAATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAAAATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCCACATCTAGACGATTCA-AAAAAAAATAAAAAAAAAA Allium_textile TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTACGAGATTGAGAACGCG--TAGCATT-A-CCCATC-----AAGAACAAGC-TAGTTTTGCAAT---T--GCACTTCTGCTTTCTAGATGGTTATCCCT-TTA---CCGCCTTTGGC-TTGCT-----TT-ACTCGAGGCAAC-AACGAGAGCGGGAACAAGA-TCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCATCGCCTTCTTCTT--GTTGCGCGGTGTGTTCTC--CTAC---TAGTGTGA-AATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGGCCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGATCACC-TTCCTAGCTAAA--A--------ACGG-TTTTGGTGCATCTTGATGTGGATATTGACCCCTCGCGCAC-TTCACGCGCGGTGGGTCTAAGTGATTGGTGTTGCTT--GGTTTC-CACGCGACGGAATGGTGGA-T--AGATTGTACGCATCGAGCCTCCAGTTATGCAC-GTGA-CT-CCAAG---CCATGGCTTA-CGAGAAGT-GAAACCTATAACGATGCTTGCAC-CTTTTGTA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAATAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGCGC-ACTACGTCAGGCTCCCTGCTTTGTTGCAGCCAACTGACGAGTACCACATACCT-CTTTCATTCCTATGTGTTGA----ATTCC-ACT-----AGG--TTTG-ATGTTGCCTTCGTTGAAATTGGACCG-GGTTCGGAA-TATA--ATGATGGATGATGCTTATTTGTACTG-C-CCCTCGTC--TTA--TCCAAGCGTTTGAGGGCTACCAAGCTGGACA------CT---TTGG-TATTTTGATTGCTTCGTTGTGTTGCCTATCATTATTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCCAAAGAGTCTTGG---G--AAGCCT-TTCCTTCGT--GC-TTATTATTTGTATCTCTCGGTTTT-----GCCACCATCTGTCTTAATA-AACC-CCTGCACGTGTCGTGGCGTGCC--------TTGAGGAGGATTACAAA-ACGTTATT-GTGTAGGTGTTTAAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAATAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATGCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCCTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTGGAATATGAA----AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCAAATACTAACTTA-TCTGTCTATTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCTCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATAAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATCTAA-----ATATTTAAATTATGTACATAACAAACAACAAAGAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATTAAATTTAAA----------------ATGTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTATA------TTTATTTGAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAATGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTACACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATT??-AAAAAAAAAAAAAATAAAA Allium_tolmiei TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTATGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCGAA---C--GCGCTTCTGCTTTCTAGACGGATGCCCTT-TTG---CCGCCTCCGTC-TTGCT-----TCTATCCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGTGCCGCCTTCTTCTT--GTCGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAACATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTGGCTTGA--ACTGTCACGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTTAAGTGATTGGCTGTGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-A--AGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTATGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCATAA--CT-TTTTCTCACCTATGCGGCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AACGTTTAATGATG-TCGTTTGTACCG-C-CCCTCCTC--TTA--TCCAAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTCGTGTTGCCAATCATTTTTATCG----TTGGGTGCTCCAATAGTTGCACGGGTGTTGTGCATGCTAAAGACACTTGG---GGAAAGCCT-TCCCTTTGT--GC-TTCTAATCCATGGC--TCGGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCATGATTCGTGGCGCATC--------CTTAAGTCGAATGCGAA-ACGTCATT-GTGCAGGTGCCTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAATTTAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTTAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC-TTTTTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTTCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAAAGCAAAGGACTGAAAATCC-AATAAAATAA-CCTTTTCTTTAGCAAAATCAGTTTCCACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGGCCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATAATAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTTAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_tribracteatum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGTGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAGA---T--GCACTTTTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGTGCTCTTATACGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-TAAAGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAGC--CCACGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAATAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGATGTGTGT-GCTACGTCAGGCTCCCCGCTCTGTTGCGGCCAACTGACGAGCACCATTA--CT--TTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGATCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--CTA--TCCGAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCA----TTGGGTGCTCCAATAGTTGTACGGGTGTCGTGCATGCTGAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCATC--------TCTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCTTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAATAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGGTTTAAGTTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAA-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAGAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AATAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCTAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCTAAT--------------------GGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAATATAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AAAAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAATAAAAAAAAAAAA Allium_tricoccum TTCTGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTTTTTGAAAGATTGAGAAGTTA--TAGCCAT-G-CCCATC-----TAGAACAAGG-CGGTTGTGCTGT----GTACACTTTGACCTTTCGGATGGGTTCCCTC--TA---CTGCATTCGCC-CTGC------TTTCTTTGAAGAAAG-AAGGAGAGGGGAAATAACA-GAACGGCACGATTTGTGCCAAGG-ACGG-CTGCTGCT-GGAGTGCATCGCCTTATTTTG--GTTGTACAGTGTGCTACT--CTAC---AAGCGTGAGCGTATGAATGACTCTCGGCAATGGATATCTTGGCTCTCGTGTCGATGAAGAACGTAGCGAAATGCGACACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCTCGAAACCTTTAGGTCGAGAGCACGTCTGCTTGGGCGTCATGCTTTGCGTCATTCTAAACATC-AACCTACCTTAA--ATAAAAGTGTGGG-TAACGGTG------GATGTGGAGATTGGCCTTCCGTGCTC-TTGATGTGCGGTTGGTTTAAGAGACCGTCGTCGTTA--GGATTG-CACGCGGCG-AATGTTG-A-T--CGAGTTCATGCACGAAGTCTCCAACTGCGTAC-ATGA-GT-CCTAA---CCATGATGTA-TAATAATT-GAAACCATTATCGATGTTTGCAC-TATTCGCA-AGCACGAACCATGACCTCAGATCATG-AAAAAAAAAAAAAATAAAAAA-??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-??????????????????A-??????????????????????????????????AAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAAAAACAAACAAGGG------TTTCAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTCAAATTTTTCTAT-----------------CAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTTATAAATGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGAATTATTCACAGCCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAAGCTT-AAAATCCTTGTGTCACCGGTTC----------------AAATATGGCTCCTGAATTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAAATAAAAA-????????????CAAAGTCAATTTCTACAGGAAATTCAAAAAGTTTTTTTGTGCAGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTTCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTCGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTGCTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTGTTTTGT-------TTTAT----------TAT-ATGTAT-----------------------------ATCTCAAGATCAAATTAAA-------TTGGTTT-------TGTTTTC------------------T-AAATATTATC------CTAT-ATTTAA-------------ATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTATTT-AAATTTCTAATTTA--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATCC------------------TA--TTTATTTAATTTATA------TTTATTTTTGAAAAAAAAATATCG-----TTCTAAG--------TTTTCTAAGTGTTATT------AAAAATTCAAAGAATACTTT--------AGTTT-----AAACAAACGAGTTTA-AAAG-----AACCTTTA--------TTCATAC----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAAAAAAA Allium_tuberosum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGATG--CCCGAGAGGAAGAATGCGAACTTG--TGATCGC-G-CCCTTC-----GGGAGCGGAGGCGGCGGCGGCCGCGTCGCACGCCCTCGCTCCCC---TGGGCCCCCCT---G---CTGCCCCCGCC-CCGGT-----TTCTGCCGGGACGGG------CGGTGGGAACACGA-CCCCGGCGCGGTTTGCGCCAAGGAACAG-TTTTTGAC-GGAGAGCTCCGCGTGCCTCGC--GGCGCGCGGTGCGATC----CCGC---TAGCGTGAGAACCTGCATGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGGACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCTCGCGTCACTTCGTGCACCCTGCCTGCCCCGC-TCCTGGCGGGCGG--CCTCCGTGCAG--GGACGTGGAGATTGGCCCCTCGTGTCCTCTGCGGCGCGACGGGTTGAAGTG-CTGGCTCTGCCGCCGGTTCTGGACGCGGCG-AGTGGTGGA-C--GGAGTTCACGCACTGCGCCTTTTGCCGCGGACCGTAG-TG-GCCGG---CCTTCGCGGAGCGGTGGAA-GGAACCCAAGCCGATG---GCGCGCGATCGCG-GCCTCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAAAAAA-TTGGTTGCGGCCGTGTCGGCATGTGAGTGGTTATGGATGCGTGT-TCTCCGGCGGGCTCCCTGCTTTTGTGCAGCCAACCGCATGGTTTGCCAT--CC-CTTTCATTCCTCTACGCTTATGGCTTTGC-GCTCATCGGTGTTGTTCCTTGTTGCCTGTGTTGAAAACCATTAT-TTTATGGAA-----------CCAATTTTT-TTATGCGTGCCGATGTCGTCCTC--TTG--CCC-----TTGGGGCGGGGTGACATTGAAAGGCGGCCCTTCATCGGTCGTGGTCGATGGCCTTTTAGGCTGTTAGGC-----TATCGGTACTCGAGGGTCGCTTAGGTCTTACGGATGCGGTGTA--CTGATGGTATCGGGGCGTGTAGCCCTGTCCCAACGTCGGT---------TGTTGC--TCGGTTTTCTATGGCCCGCTCTCATGTGAAT--GATG--CTACGTGTGCGCCGTTCCTTC--------TTTGGGGGGAAGAGAGCTTCGGCGTC-GCGCTGGTATCGTTGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA---------------GGTAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----GTTTTTGAA----AAACAAGGG-----TTTTAAAAACTAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGGAATCCTTCTATGACCTTTTTTTTTCAAAAAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCGTTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTAAC------TATTTATCCTTATCC-TC------TTTTTTTCATAAGCGGTT---------CAAAGAAAATTCAATATCTTTCTCATGCATTCT-------------ACTCTTTCACAAATAGATCCGAACAGAAATCTTTTGATCTTATACCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCT-AAAAAATTCGGGGACGAGGTCAAAATTTTGAATACTTTTTTTT--------GAGTGTATTTAATTTACATAGATACAAGTACTCTACGAGGATGATGCGC-GGGAAA----TGGTCG-GGATAGCTT-AAAAAAAAAA-?????????????????????????????GGAAATTCAAAAAGTTTTTTTGTGCGACAAACAAGTAAGAAAATTTTGGAATAATTTGAATTCCGTGGTTCAAAGAATTT---------CCAATTTTAGAATATGAAAAAGAATTTCTATT------AACTAATG-------TATTGAACTCCTCAA------GATTAG------TTAGAACTCGCTG-----CTAT-GTTATGTAGAATACTCGCTTA-TTTGTCTGCTG-------------GTTTGGTTCTAAGTATCATTTTATTTCTTTTCC--------------------ATTGGGAAAAGAAATAAAATGAAATTCTAATGGATATT------AAAACTCTTTTGT-------TTTAT----------TAT-ACGCCT-----------------------------AACTCAAGATCAAATTAAA-------TTATT---------GGTTTGA------------------T-AAATACTATC------ATAT-ACAT-------ATATTGAAATTATGTACATAACAAACAACAAGGAGTAT-GTAT--------CGAAATCGTTCGAAAA------ATTCCTT-TA----------------------------------------------------ATTTAGTAATTAA------------ATTGTGATACATATCAAATCC------------------TA--TCTTGAAAATTT-TA------TTAACTGAA--AAAAGAAATATCT-----TTGATAATTT-----TTTTATTTATCTGATTTCGCAGAAAAAAAAAAAGAAT-----------------------AAAGAAAAAAATAGAAAAGGGGGACAATTCTTATCTTAGTTTCTATCTCGGCGGAAACCAAAACTTTCAAGTTCCAATTGTTCCGAGGGAACTTAGTATATAGTTCGTATATGGGATAGTACATAAAAATTGATTTTAT-------TGTGAAATTTGAACCTACGATAATACTAACTA-AAAAAAAAAAAAAAAAAAA Allium_tuolumnense TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTCGCGAGATCGAGAACGTG--TCGCTTT-G-CCCGTC-----GAGAAG-----------------------------TTGCTTTCTGGACGGGCGCCCTT--TG---CCGCCTCCGGC-TCGCT-----TTCGTTCGAGGCGAG-AAGGAGGGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGCGCGTCGCCTTCTTCTT--GTTGTGCGGCGCGTCCTC--CTAC---TGGTGTCACAGTATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCGTCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCGCTCGGAGCACC-TTCCAAGCATGC--ACTGTCGTGCGGG-TTTCGGTGCGTCCTGATGCGGATACTGACCCTCCGTGCTCTTTCGTGCGCGGTGGGTTCAAGTGATTGGCGGCGATG--GGTTTC-CACGCGGCGGAATGGTGGA-C--AGGTTATACGCTTTAAGCCTTCGGTTGTGCAC-GTGA-CTCCCTAG---TCGTGACTTA-CAAGAAGT-GGAACCCGTAACGATGTTTGCGC-CTTTCGCA-AGATCGGACCATGACCCCAGGTCAGG-AAATAAAAAAAAAAAAAAAAA-TGGGTTGTGACCGTGACGGCATG{GT}GAGTGGTTGTTGATGTGTGC-GCTACTTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGCGCCACGT--CT-TTTTAACGCCTACGCGTTGA----ATTTC-GCT-----AGG--TTTTCATGTTGCCTTCGTGGAAAACGGACCG-GGTTTGGAA-TACG--AAGTTCGATGGTG-TTGTTTGTACCG-C-CCTTCGTC--TTA--CCCAGGTGTTTGGGCGGTACGTAGTTGGAAG------CCTCGTCGG-TATTTTGATCGCTCCGTCGTGTTGCCAATCATTTTTATCG----TCGGGTGCTCCGATAGTTTTACGGGTGTGGTGCATGGTGAGAGCACTGGG---G--AAGCCT-TCCCTTTGT--GC-TTTCGATTCGTAGC--TCGGTTTT-----TCCAGCACC-GTCTAGAA--AAGG-CCTGCACGGTTCGTGGAGCGTC--------TTAAGGACGGA{CT}GCGAG-ACGTCGTC-GTGCGGGAGCCTGAGA{AG}GACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAATAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATTTTTT----TTTTTTT--A----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATTTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-TAAAAAAAAA-??TTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAACTG-----CTAT-TTTATGTCGAATACTAATTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTTTAATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTTGAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAAAAAAAATATCT-----TTCTACGTTT-----TTTTATAAGTGTTATT------AACACTTAAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACAATTCA-AAAAAAAAAAAAAAAAAAA Allium_unifolium TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAAT-CCCCCTTTTAAAAACTGAGAACGTG--TAGCTTC-A-ACCATC-----GAGAACATGC-CAGGCTTGCAGC---C--GCAATTCTGCTGTCTGGATGGATCTCTTT--TT---CCGCC-CCGGC-TTGCC-----TT-ATTCAAGACAAC-TGGTGGAGCGGGAAGAAGA-CCCCGGCGTGGTTCACGCCAAGG-ACGG-TTTTTGTT-GGGGCGCATCGCCTTCTTCTT--GTTGTGCGGTGCGTTCTC--CCAC---TAGTGTATAAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCAAGGGCACGTCTGCCTGGGCGTCACGCCTCGCGTCACTCGGAGCACA-GACCTGGCTCAA--------ACCTGGG-TTTTGGTGCGTCTTGACGTGGACATTGACCCTCCGTGATCTTTTACGCACGGTGGGTCTAAGCGGTCGGCGTTGCTG--GGTTTC-CACGCGACGAAGTGGTGGA-T--AGATTGTACGCATGAAGCCCCCAGTCGTGCGC-GTGA-CT-CCTGA---CCGTGACCTG-AAAGAAGT-GGAACCCGTAACGACGTCTGCAG-CATTTGCA-TGGTCGTACCATGACCCCAGGTCAGG-AAAAAAAAAAATAAAAAAAAA-CGGGTTGTGACCGTGACGGCATGTGAGTGGTTATTGATGTGTGT-GCTATGTCAGGCCCCCCGCTTTTTTGCGGCCGACTGATGAGTACCACAA--CC-GTTTTATACCTACGCATTGG----ATTTT-GCT-----AGG--TTTG-GTGTTGCCGTCG{CT}AGAAAACAGACCC-TGTTTGGAA-AATG--GTGTCCAACGATG-TCATTTGTACCG-C-CCCTCCTC--TTG--TCCAAGTGTTTGGGGCGTACAAAGTCGGATA------CT---TCGG-TATTTTGATTGCTCTATTATGTTGACTTTCATTTTTACCG----TTGATTGCTCCAACCGTTTTACGGGTGTTGTCCATGCTAAAGATTCTTTG---G--AAGCAT-TCCATTTGT--GC-TTTCAATTTATTGT--TTGGTTTC-----GCCAGCACC-ATATGAAA--AAGG-CCTACACGAGTCGTCGTGCAGT------------ATAGGAACGTAAG-ACTTCATT-GTGTAGGTGCCTAAGAAGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTTCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAATAAAAAAGAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTTATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAACGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTT-AAAATCCTTGTGTCGCTGGTTC----------------AAATCTGGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-AAATAAAAAT-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCGAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGCGATTTAAAGAACTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------CACTTATG-------TATTGACCTCCTCAA------CATTAGTTAGAATTAGAACTAGCTG-----CTAT-TTTATGTTGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAA-TATTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTAT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTTAAGATCAAATTAAATAGGTTTTAGGTTT-------CGTTTAC------------------T-AAATATTATT------CTAT-ATTTAA-----ATATTAAAATTATGTACATAACAAACAACAAAGAAAAA-ATAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTATAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATATTTA--TTTATTTTAAT-AAAAAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAG{AC}GTTGA-AAGG-----GACCCTTA--------TTCATCT----------------------ATTCTAA{CT}GTTTCC---------------------------------------TAAAGTATAACTATAT--------TAGATTCTAGAATCTACATCTAGACGATTCA-AAATAAAAAATAAAAAAAA Allium_validum TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGTGT-CCCTCTTTATGAGATTGAGAACGTG--TAGCATT-A-CCCATC-----GGGAACAAGC-TAGTTTTGCAAG---TGCGCACTTCTGCTCTCTAGATGGATGTCCTT-TTG---CCGCCTTTGGCTTTGCT-----TT-ATTCGAGGCAAC-GAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTTGCGCCAAGG-ACGG-TTGTTGTT-GGAGTGCTCCGCCTTCTTTTT--GTTGCGCGGTGCGTTCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTCGCGTCACTCGGAGCACC-TACCTAGCTTGA--ACCCTCATGCGGG-TTTCGGTGCGTCTCGATGTGGATATTGACCCTTCGCGCTC-TTCACGTGCGGTGGGTTTAAGTGATCGGTGTTGCTG--GGTTTC-CACGCGGCGGAATGGTGGATT--AGATTATACGCATCAAGCCTCCAGTTGTGCAC-GTGA-CT-CCTAG---CCATGACTTA-CAAGAAGT-GGAACCCAGAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAATAAAA-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTATTGATGTGTGT-ACTACGTCAGGCTCCCCGCTTTGTTGCGGCCAACTGACGAGTACCACATACCT-TTTTCATACCTATGTGTTGA----ATTTC-ACT-----AGG--TTTG-ATGTTGCCATCATGGAAATTGGACCG-GGATCGGAA-TAGA--ATGTTCAATGACGCTTATTTGTACCG-C-CCCTCCTC--TTA--TCCAAGCGTTTAGGGGGTACAAAGTTGGAAA------CC---TTGG-TATTTTGATTGCTTCATACTGTTGCCTATCATTTTTATCG----TTGAGTGCTCCAAAAATTTTACGGGTGTTGTGCATGCTAAAGATTCTTGG---G--AAGCCT-TCCCTTTAT--GC-TTATAATTGATAGC--TCGGTTTT-----GCCAGCACC-ATCTGAAAG-AAGG-CCTACACGAGTCGTGGCGCATC--------TCGAGGAGGAATGCAAA-ACGTTATT-GTGTAGGTGCCTGAAAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AATAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGA-----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTTACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATA-----TTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAAAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAAGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGAAAATCCTTGTGTCACCGGTTC----------------AAATCTAGCTCCTGAACTGTTGGGATAGCT-CAGTTG-GTAGAGCAGAGGACTGAAAATCC-ATAATAAAAA-CCTTTTCTTTAGCGAAATCAGTTTATACGGGAAATTCAAAAAGTTTTTTTGTGCGGCAAACAAACAAGAAAATCTCGGAATAATTTGAATTCCGTTATTTAAAGAATTTT-------TCTATATTTAGAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCCAGTAGAAATTTTTTTTTCCATTAGGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------CGTTTAC------------------T-AAATATTATC------CTAT-ATTTAA-----ATATTTAAATTATGTACATAACAAACAACAAAAAATAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-AAATTTCTAATTTC--------ATTTATGAAATTTAAA----------------ATTTAGTAATTAC------------ATTTCGATATGTATAAAATCC------------------TA--TTTATTGAATTTAGA------TTTTTTTTAATAAAAAAAATCTCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AACAATTTAAAGAATACTTT--------AGTTTAAATTAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAAAAAAAAAATAAAA Allium_yosemitense TTCCGTAGGTGAACCT-GCGG-AAGGATCATTGTCGAGT-CCCTCTTTGTGAGATTGAGAACATG--TAGCTTT-A-CCCGTC-----GAGAAGAGGC-TAGGGTTGCAGA-----TGCACTTTTGCTTTCTAGACGGATGCCCCT--TG---CCGCCTCCGGC-TTGCT-----TTTATTCGAGGCGAG-AAGGAGAGCGGGAATAAGA-CCCCGGCGCGGTTCGCGCCAAGG-ACGG-TTTTTGTT-GGAGTGCGCCGCCTTCTTCGT--GTTGTGCGGTGCATCCTC--CTAC---TAGTGTGAGAATATGCATGACTCTTGGCAACGGATATCTAGGCTCTCGCGTCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAGACCATCAGGTCGAGGGCACGTCTGCTTGGGCGTCACGCCTTGCGTCACTCGGAGCACC-TACCTAGCTTGG--ATTGTCATGCGGG-TTTCGGTGCGTCTTGATGTGGATACTGACCCTCCGCGCTCTTATACGCGCGGTGGGTTCAAGTGATTGGCGGCGCTG--GGTTTC-CACGCGGCGGAATGGTGGA-TAAAGATTATACGCTTAAAGCCTTCAGTTGCGCAC-GTGA-CTACCTAGC--CCACGACTTA-CAAGAAGT-GGAACCCATAACGATGTTTGCAC-CTTTTGCA-AGATCGGACCATGACCCCAGGTCAGG-AAAAAAAAAAAAAAAAATAAT-TGGGTTGTGACCGTGACGGCATGTGAGTGGTTGTTGTTGTGTGT-GCTACGTCAGGCTCCCCGCTCTGTTGCGGCCAACTGACGAGCACCATTA--CT--TTTCTCGCCTATGCGTCGA----ATTTC-GCT-----AGG--TTTC-ATGTTGCCTTCGTGGAAAACGGACCC-GGTTTGGAA-TAAG-AATGATCAATGATG-TTGTTTGTACCG-C-CCCTCCTC--TTA--TCCGAGTGTTTGGGGGGTACAATGTTGGAAA------CC---TTGG-TATTTTGATCGCTACGTTGTGTTGCCAATCATTTTTATCA----TTGGGTGCTCCAATAGTTGTACGGGTGTTGTGCATGCTAAAGATACTTGG---G--AAGCCT-TCCCTTTGT--GC-TTTTAATCCATGGC--TTAGTTTT-----GCCAGCACC-ATCTAAAAA-AAGG-CCTGCACGATTCGTGGCGCATC--------TCTAAGTCGAATGCGAA-ACGTCATT-GTGTAGGTGCTTAAGAGGACGTGCTACCTGGTTGATCCTGCCAGTAGTC-AAAAAAAAAAAAAAAAAAA-GAAAACTTCCAAATTCAGAGAAACCCTGGAACTAAAAATGGGCAATCCTGAGCCAAATCTTTA-----TTTTTTGAA----AAACAAAGG------TTTAAAAAAGAGAAT----AAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGAGTTGACTACGTTGCGTTGGTAACTGAAATTCTTCTAT-----------------AAAAAAATGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGTTTCAAGTCCCTCTATCCCCAGTAAAAAGCCCATTTTACTTCTTTAC------TATACTATATTCTCC-TC------TTTTTTTCATAAGTGGTT---------CAAAGAGAATTCAATATCTTTCTTATTCATTTT-------------ACTCTTTCACAAATGGACCCGAAGTGGATTATTCACAGTCCATCTCATTTTCCTTGCATTCACAAGGAAAGTC--TTCTTTTTGAAAATCG-AAAAAATTAGGGAATAGCTCAGTTGTGTAGAGCAGAGGCTTGCAAATCCTCG?????????????????????????????????????????????????????????????????-???????????????????????-AAAAAAAAAA-CCTTTTCTTTAGCAAAATCAGTTTCTACGGGAAATTCTAAAAGTTTTTTTGTGCGGCAAACAAATAAGAAAATCTTGGAATAATTTGAATTCCGTGATTTAAAGAACTTT-------TCTATATTTAAAATATGAAA---AATTTGCATT------AACTTATG-------TATTGACCTCCTCAA------GATTAG------TTAGAACTAGCTG-----CTAT-TTTATGTCGAATACTAACTTA-TCTGTCTACTA-------------GTTTGGTTCTAAGTATTATTTTATTTCTTTTCCTAAT--------------------GGAAAAGAAATAAAATGCAATTATGATGAATATT------AAAACTATTTTGT-------TTTAT----------TAT-ATGTCT-----------------------------ATTTGAAGATCAAATTAAA-------TAGGTTT-------TGTTTAC------------------T-AAATATTATC------CTAT-ATTTCA-----ATATTAAAATTATGTACATAACAAACAACAAAGAGTAT-GTAGACTAAAAACAAGATTTTTAGAAAAAG----AGTCCTT-TAATTTCTAATTTC--------ATTTATTAA-----------------------ATTTAGTAATTAC------------ATTTTGATATGTATAAAATAC------------------TA--TTTATTGAATTTATA------TTTATTTTAATAATATAAATATCT-----TTCTAAGTTT-----TTTTATAAGTGTTATT------AAAAATTTAAAGAATACTTT--------AGTTTAAATCAAACAAAAGAGTTGA-AAGG-----AACCCTTA--------TTCATCT----------------------ATTCTAATGTTTCC---------------------------------------TAAAGTATAACTATAT--------CGGATTCTAGAATCTACATCTAGACGATTCA-AAAAAATAAAAAAAAAAAA ; END; BEGIN TREES; TITLE Allium_subgenus_Amerallium_MB; LINK TAXA = Taxa1; TRANSLATE 1 Allium_aaseae, 2 Allium_abramsii, 3 Allium_acuminatum, 4 Allium_amplectens, 5 Allium_anceps_, 6 Allium_atrorubens, 7 Allium_bigelovii, 8 Allium_bisceptrum, 9 Allium_bolanderi, 10 Allium_brandegeei, 11 Allium_brevistylum, 12 Allium_burlewii, 13 Allium_campanulatum, 14 Allium_canadense, 15 Allium_cernuum, 16 Allium_columbianum, 17 Allium_coryi, 18 Allium_cratericola, 19 Allium_crenulatum, 20 Allium_crispum, 21 Allium_cuthbertii, 22 Allium_diabolense, 23 Allium_dichlamydeum, 24 Allium_dictuon, 25 Allium_douglasii, 26 Allium_drummondii, 27 Allium_elmendorfii, 28 Allium_eurotophilum, 29 Allium_falcifolium, 30 Allium_fibrillum, 31 Allium_fimbriatum, 32 Allium_geyeri, 33 Allium_glandulosum, 34 Allium_haematochiton, 35 Allium_hickmanii, 36 Allium_hoffmanii, 37 Allium_howellii, 38 Allium_hyalinum, 39 Allium_jepsonii, 40 Allium_kunthii, 41 Allium_lacunosum, 42 Allium_lemmonii, 43 Allium_macropetalum, 44 Allium_macrum, 45 Allium_madidum, 46 Allium_membranaceum, 47 Allium_monticola, 48 Allium_munzii, 49 Allium_nevadense, 50 Allium_nevii, 51 Allium_obtusum, 52 Allium_parishii, 53 Allium_parryi, 54 Allium_parvum, 55 Allium_passeyi, 56 Allium_peninsulare, 57 Allium_perdulce, 58 Allium_platycaule, 59 Allium_plummerae, 60 Allium_praecox, 61 Allium_robinsonii, 62 Allium_runyonii, 63 Allium_scilloides, 64 Allium_serra, 65 Allium_sharsmithiae, 66 Allium_shevockii, 67 Allium_simillimum, 68 Allium_speculae, 69 Allium_stellatum, 70 Allium_textile, 71 Allium_tolmiei, 72 Allium_tribracteatum, 73 Allium_tuolumnense, 74 Allium_unifolium, 75 Allium_validum, 76 Allium_yosemitense, 77 Allium_roseum, 78 Allium_flavum, 79 Allium_cepa, 80 Allium_tricoccum, 81 Allium_tuberosum; TREE con_50_majrule = [&R] (((((((((((((((((30:0.003195000000000059,45:0.0042839999999999545):0.0020769999999998845,71:0.003570999999999991):0.004481000000000179,((1:0.002007000000000092,67:0.006493000000000082):0.0024370000000000225,10:0.005225000000000035):0.0019339999999998803):0.001819000000000015,(44:0.0037720000000001086,50:0.002199000000000062):0.005479000000000012):0.0011440000000000339,(16:0.009634999999999838,25:0.006842000000000015):0.004058000000000117):0.0021740000000001203,61:0.007611999999999952):0.0013639999999999208,42:0.010426999999999964):0.0032840000000000646,63:0.015460999999999947):0.0023239999999999927,((((((51:4.3600000000010297E-4,72:3.830000000000222E-4):0.0019609999999998795,18:0.0019780000000000353,76:0.002866000000000035):0.005800999999999945,36:0.0032639999999999336):0.002674000000000065,58:0.007630000000000026):0.0023729999999999585,5:0.003601999999999883):0.003586000000000089,(12:0.008106999999999864,54:0.006205000000000016):0.0012840000000000629,(19:0.0026490000000001235,29:0.005451000000000095):0.00939599999999996):0.0011639999999999429):0.01323199999999991,(((((((((22:0.0025679999999999037,37:0.0031249999999998224):0.0018090000000001716,48:0.0036490000000000133):0.0015279999999999738,(65:0.003342999999999874,73:0.0014639999999999098):0.0026440000000000907):0.00433299999999992,31:0.008291999999999966):0.008272999999999975,(52:0.005371999999999932,53:0.00876599999999983):0.012207999999999997):0.015044999999999975,(2:0.020040999999999976,39:0.021663999999999906):0.011412999999999895):0.014373000000000191,((8:0.002143000000000006,46:0.003383000000000136):0.0069509999999999295,13:0.004197000000000006):0.02672500000000011):0.00479099999999999,(7:0.015441000000000038,49:0.011469000000000174):0.009141999999999983):0.007428999999999908,((6:0.010917000000000066,47:0.011746999999999952):0.007954000000000017,66:0.034348000000000045):0.007527999999999979):0.008318000000000048):0.006153000000000075,34:0.02262799999999987):0.005606,(15:0.00548700000000002,69:0.006472000000000033):0.02260899999999988):0.0065629999999998745,((((((4:0.0021180000000000643,35:0.003306999999999949):0.02132199999999984,38:0.026756000000000002):0.005422000000000038,74:0.021021999999999874):0.010733000000000104,60:0.04212900000000008):0.015490000000000004,((((23:0.006753000000000009,64:0.009538999999999964):0.00726899999999997,56:0.01077399999999984):0.00317400000000001,20:0.020344999999999835):0.031632000000000104,41:0.038578):0.00994000000000006):0.015554999999999986,((3:0.005096999999999907,24:0.0063629999999998965):0.010175000000000045,9:0.01483599999999985):0.0311840000000001):0.02457700000000007):0.007189000000000112,(((((((((43:0.0068509999999999405,57:0.005017999999999967):0.008426000000000045,(55:0.0018979999999999553,70:0.0024530000000000385):0.010386000000000006):0.003255000000000008,(14:0.009265999999999996,21:0.009894999999999987):0.005542000000000158):0.0025439999999998797,((27:0.00498299999999996,62:0.0024690000000000545):0.02097099999999985,68:0.009400999999999993):0.003182000000000018):0.006960000000000077,(17:0.003815000000000124,26:0.0038130000000000663):0.033922999999999925):0.0072870000000000434,32:0.0074230000000001795):0.012815999999999939,((28:0.003011000000000097,59:0.0061590000000000256):0.0012879999999999558,11:0.003905999999999965):0.004615000000000036):0.007609999999999895,(33:0.040947999999999984,40:0.01200100000000015):0.009556999999999816):0.003159000000000134,75:0.012607999999999953):0.01392799999999994):0.02297400000000005,77:0.13336199999999998):0.016336999999999824,((78:0.09563999999999995,79:0.048734000000000055):0.08151599999999992,80:0.060740999999999934):0.08242800000000017):0.702084,81:0.9616680000000001); TREE con_50_majrule = [&R] (((((((((((((((((30:0.003195,45:0.004284):0.002077,71:0.003571):0.004481,((1:0.002007,67:0.006493):0.002437,10:0.005225):0.001934):0.001819,(44:0.003772,50:0.002199):0.005479):0.001144,(16:0.009635,25:0.006842):0.004058):0.002174,61:0.007612):0.001364,42:0.010427):0.003284,63:0.015461):0.002324,((((((51:4.36E-4,72:3.83E-4):0.001961,18:0.001978,76:0.002866):0.005801,36:0.003264):0.002674,58:0.00763):0.002373,5:0.003602):0.003586,(12:0.008107,54:0.006205):0.001284,(19:0.002649,29:0.005451):0.009396):0.001164):0.013232,(((((((((22:0.002568,37:0.003125):0.001809,48:0.003649):0.001528,(65:0.003343,73:0.001464):0.002644):0.004333,31:0.008292):0.008273,(52:0.005372,53:0.008766):0.012208):0.015045,(2:0.020041,39:0.021664):0.011413):0.014373,((8:0.002143,46:0.003383):0.006951,13:0.004197):0.026725):0.004791,(7:0.015441,49:0.011469):0.009142):0.007429,((6:0.010917,47:0.011747):0.007954,66:0.034348):0.007528):0.008318):0.006153,34:0.022628):0.005606,(15:0.005487,69:0.006472):0.022609):0.006563,((((((4:0.002118,35:0.003307):0.021322,38:0.026756):0.005422,74:0.021022):0.010733,60:0.042129):0.01549,((((23:0.006753,64:0.009539):0.007269,56:0.010774):0.003174,20:0.020345):0.031632,41:0.038578):0.00994):0.015555,((3:0.005097,24:0.006363):0.010175,9:0.014836):0.031184):0.024577):0.007189,(((((((((43:0.006851,57:0.005018):0.008426,(55:0.001898,70:0.002453):0.010386):0.003255,(14:0.009266,21:0.009895):0.005542):0.002544,((27:0.004983,62:0.002469):0.020971,68:0.009401):0.003182):0.00696,(17:0.003815,26:0.003813):0.033923):0.007287,32:0.007423):0.012816,((28:0.003011,59:0.006159):0.001288,11:0.003906):0.004615):0.00761,(33:0.040948,40:0.012001):0.009557):0.003159,75:0.012608):0.013928):0.022974,77:0.133362):0.016337,((78:0.09564,79:0.048734):0.081516,80:0.060741):0.082428):0.7020839999999999,81:0.961668); END;