#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 16:46 GMT TreeBASE (cc) 1994-2008 Study reference: Rahman M.Z., Uematsu S., Coffey M.D., Uzuhashi S., Suga H., & Koji K. 2014. Re-evaluation of Japanese Phytophthora isolates based on molecular phylogenetic analyses. Mycoscience, 55(4): 314-327. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13726] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=116; TAXLABELS Halophytophthora_vesicula Phytophthora_alni Phytophthora_arecae Phytophthora_asparagi Phytophthora_bisheria Phytophthora_boehmeriae Phytophthora_botryosa Phytophthora_brassicae Phytophthora_cactorum Phytophthora_cactorum_MAFF235099 Phytophthora_cactorum_NBRC32194 Phytophthora_cajani Phytophthora_cambivora Phytophthora_capsici Phytophthora_captiosa Phytophthora_chrysanthemi Phytophthora_cinnamomi Phytophthora_cinnamomi_var_parvispora Phytophthora_citricola Phytophthora_citricola_CH97TUL2 Phytophthora_citrophthora Phytophthora_clandestina Phytophthora_colocasiae Phytophthora_cryptogea Phytophthora_cuyabensis Phytophthora_drechsleri Phytophthora_drechsleri_CH96HE1 Phytophthora_drechsleri_CH96HE2 Phytophthora_erythroseptica Phytophthora_europaea Phytophthora_fallax Phytophthora_foliorum Phytophthora_fragariae Phytophthora_glovera Phytophthora_gonapodyides Phytophthora_gregata Phytophthora_hedraiandra Phytophthora_heveae Phytophthora_hibernalis Phytophthora_humicola Phytophthora_idaei Phytophthora_ilicis Phytophthora_infestans Phytophthora_inflata Phytophthora_insolita Phytophthora_inundata Phytophthora_ipomoeae Phytophthora_iranica Phytophthora_katsurae Phytophthora_kernoviae Phytophthora_macrochlamydospora Phytophthora_meadii Phytophthora_medicaginis Phytophthora_megakarya Phytophthora_megasperma Phytophthora_megasperma_CH00MKR1 Phytophthora_megasperma_CH00MKR2 Phytophthora_megasperma_CH02PHR1 Phytophthora_megasperma_CH04PHR11 Phytophthora_megasperma_CH04PHR12 Phytophthora_megasperma_CH94PHR1 Phytophthora_megasperma_CH95PHG7 Phytophthora_megasperma_CH95PHG8 Phytophthora_megasperma_CH95PHR10 Phytophthora_megasperma_CH95PHR16 Phytophthora_megasperma_CH95PHR17 Phytophthora_megasperma_CH97PHR1 Phytophthora_megasperma_GF433 Phytophthora_megasperma_GF543 Phytophthora_megasperma_GF649 Phytophthora_megasperma_MAFF237500 Phytophthora_megasperma_NBRC31624 Phytophthora_megasperma_NBRC32176 Phytophthora_megasperma_P_A Phytophthora_megasperma_P_B Phytophthora_megasperma_Pm_1 Phytophthora_melonis Phytophthora_mexicana Phytophthora_mirabilis Phytophthora_multivesiculata Phytophthora_nemorosa Phytophthora_nicotianae Phytophthora_niederhauserii Phytophthora_palmivora Phytophthora_phaseoli Phytophthora_pini Phytophthora_pistaciae Phytophthora_polonica Phytophthora_porri Phytophthora_primulae Phytophthora_pseudosyringae Phytophthora_pseudotsugae Phytophthora_quercina Phytophthora_quininea Phytophthora_ramorum Phytophthora_richardiae Phytophthora_rubi Phytophthora_sansomeana Phytophthora_sinensis Phytophthora_siskiyouensis Phytophthora_sojae Phytophthora_sojae_NBRC31016 Phytophthora_species_APC001 Phytophthora_species_GF468 Phytophthora_species_GF534 Phytophthora_species_MAFF235784 Phytophthora_species_MAFF235786 Phytophthora_species_MAFF235788 Phytophthora_species_MAFF235794 Phytophthora_species_MAFF238158 Phytophthora_species_MAFF239556 Phytophthora_species_Toku_1 Phytophthora_species_kelmania Phytophthora_syringae Phytophthora_tentaculata Phytophthora_vignae ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15456] TITLE Japanese_Phytophthora_AICc4; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1994; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Halophytophthora_vesicula TAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCACGTTGTGCGCGGCGAATTGTAGTCTATAGATGCGTGATCAGCGCGGGCGCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTTGTACCTGAGTGTTTTGCGCGTACGGTCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCATGTGCGAGTGCGTGCGTTTCGGCTTTGTGGCAGTGGTTTTTGTCTGCGCGTTGCTGTTTGTGCGTGTGGTTGCGCGTGCCCTGTGCTGTGGTGGGACGTCAAGGTGAGTTCGAATGCTGCGGGAAATGGCCGTCGGGGAGGTAGGTCTTAAGCTTGCTTTTGGCTATTATATCTCGGCGGTTGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGCGCGTGCGTGTCTCTGTGCTTGCGTTGTGCGGATAGCTTGCTATGCGCGTGGCGTTGCGTGCGGATGGATATGCGCTGCTGCTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGGGCTCGTCGCGATGGTTGTAGGCGTTGCCTGGCGCGTGTTTTGAACCAGACTGAGATACTGTGGGGACGAAAGTCTCTGCTTTGACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGGACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGTCTGTATCAGTGTCCGTAAAGCACTGTTGCCTCTCTTCCTTCCGTGTAGTCGGTGGCGGGGACGGCAGACGTGAAGCGTCTTGCCAGTTTTCGGCAAGTCCTTTGAAAACTGTGTTCTCTCTGTTTGGAAACTGAATGGCGTTGTGGTGCGTGCGTGGCGGCCTGCTGGCGAGTGTTCGCGAGGGCGTGGAGAGGTTGATTCGCGGTATGTTAGGTTTCGGCCGGACAGGCTTATCGGGGGCGTTCTCTGTTCTTGCGGATCGTTGGCGGCGTGTGGTTGTGGCTTTGGCGTTTGAATTAGTGTGCGGAGCTGCGTTGTGCGGTCGAAGGGTGAGTGATTTGGGAATGTGCTTGCGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCATTTGCTGGTATGGTTGGTACAACTTTATCTGTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTAATTGTAACTGCACATGCTTTTGTTATGGTATTCTTTTTAGTAATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCATCAGCTCTTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCTTTATCTAGTGTACAAGCTCACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCGCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCATTAACTATGCTTTTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCAGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_alni TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCACCCAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCCAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGAGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGGACTTGGCCTTTGAACGTGTTCGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTCCGCAAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGGGATCCTGTACTATATCAA Phytophthora_arecae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCTCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTTTTTTAAACCAAACTGATATACTGTAGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCCAAAAGTGCGTGTGATTGTGGAGGCTGCTTGGTAGCCAGTCGGCGACTTTGTGCTGTGGCATGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTAAATATTTCTTCAGCTGTGGTGTATGATTGGTGAACCGTAGCTATGGACTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATC-ATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAA Phytophthora_asparagi TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGTCGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGTCCGAGCTAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCCTGCTTTCGGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCAAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGAATGTTTTTCCTGCTGTGGCGTACGACTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAACTTGCTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACTTTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAACGTTGTTGTTACTGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGAGCCCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCGGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCAGTATTAATTACTGCTTTTCTTTTATTATTAACCTTACCCGTATTAGCTGGTGCAATTACTATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGGGGAGATCCAGTATTATATCAA Phytophthora_bisheria TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTCCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCCGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGGTGTGAGTGTTTGCCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGGGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGATGTCCATCGCAAACGTTTGGGGTCTGAGCAAGTAGCTTTTTTAAACAATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGAGCGTGTGGTTGTGGAGGCTGCCCGGTGGCCAGTCGGCGACTTTGTGCTGCGGTGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTTTTCCCTGCTGTGGCGGATGACTGGTGAACCGTAGCTATGAGCTTGGCTTTTGAACATACTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGCGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTGATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCAGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_boehmeriae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACCTGAGTGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGCGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTTGCAGTGGCTTTTGGCTGCGCGGTGCGTGCTGTGCGTGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGGGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGAACTCTCTGTGTGCGCGCTGTGCGGATAGCTTGCTATGTGTGCGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGACGACCATCACGAGTATTTGGGGTCTGAGTTGCGAGTCTTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCGTGTAGTCGGTGGAGGGAATGCCAGACGTGAAGTGTCTTGCGCGCTTCGGGCGAGTCCTTTGAATACTGTTCTCTCTTTGCTCGAAAAGTGAGTGATGTTGTGGAGGCTGCCATACGGCATGTCGGCGACTTCGTGCTGAGGCGGAGAGGGGTCGATTCGCGGTAGTGTTGGTTTCGGCCGAACACGCTTATTGGGTTCTTTCCAGGCTTTGGCGTGCGGTCGGTGTACCGTAGCTGTGGTCTTGGCCTTTGAACGTTTTGGCGAAGTAGAGTGGTTCGGACGATGGACGAAATTTTTGGGAATGTGCCCTTGTAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATTGTTGGTACAACATTCTCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATAATGGTATTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCATCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCAGGTACCGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATATCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_botryosa TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTTCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGTGTCGATCCTTTTGGGAATGTGTCTTTGTAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCGATTACTATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_brassicae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCATGCAAGTTTTGTATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCCTGAGTGGCTTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGTGTGTGCTGTGGCAGTGGCTTTAAGCTGCGCGGTGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCAGCGCGACCTTCTGGGCTTGGGGCTAGTAGCTATTTTAAACCTTACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCCTGCTTCATGCGAGTCCTTTTAAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGTGTGGAGAAGTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTAGATGTTTTTCTTACTGCGGCGGATGGCTGGTGAACCGTAGCTGTGAGCTTGGCTTTTGAACATATTTGCGAAGTAGAGTGATCCGGCCGAGGGTCGATCCATTTGGGAATGTGCCCTGCTAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCCCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGGGCACCTGATATGGCATTTCCGCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTGGCAATCTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCCCCGGGTTTAAGTTTCCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACGGCTTTCCTTTTATTATTAACTTTACCTGTTTTTGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACGTCTTTTTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_cactorum TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGCCTGAGCTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCTATGTAGCAAGTTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAGGCTTATTGGATGTTTTTTCTGCTGTGGCGGATGGCCGGTGAACCATAGCTCAGTGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGGGGTGATCCAGTATTATATCAA Phytophthora_cactorum_MAFF235099 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGCCTGAGCTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCTATGTAGCAAGTTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTTTTTCTGTTGTGGCGGATGGCCGGTGAACCATAGCTCAGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCGAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCCGTATTATATCAA Phytophthora_cactorum_NBRC32194 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGCCTGAGCTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCTATGTAGCAAGTTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTTTTTCTGTTGTGGCGGATGGCCGGTGAACCATAGCTCAGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCGAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCCGTATTATATCAA Phytophthora_cajani TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCAATTGTTTGGGAACTAGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGTTGTGAACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACGGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_cambivora TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCCAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGGACTTGGCCTTTGAACGTGTTCGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTGCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGAGATCCTGTACTATATCAA Phytophthora_capsici TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGC{CT}TTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTACCCATCGCGAATGTTTGGGGTCCGGGCGAGTAGCTGTTTTAAACCATTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGAATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGTTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_captiosa TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCTCTCGGGGTAAGTTCCTTGGAAGAGGATAGCATGGAGGGTGAAACTCCCGTTCATACCTGAGTGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTTCCAGTGTCTATAATCCGTGGCATATTCCATTGCCGAGTGTGTGCGTGTGTGGGTTTCGGCAGCGGCTTTGGGCTGCGCTGCCTGTGCTGTGCGTGTGCTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTGTGCCGCGGGAAATATCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGCCTCTCTGTGTGCGCGCCGTGCGAATAGCTTGCTATGCGTGTGGTGTTGTGTGTGGATTGAGGCGTGCTGTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGACGACCATCACGAAACATCGAGGTCGGAGCCAGTAGTCTTTGTAAACCATACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTATATCAAACTTGCCTTCCTTCCTTCCGTGTAGTCGGTGGAGGGAACGTCAGATGTGAAGTGTCTTGCTCGCTTCTGGCGAGTCCTTTTAATACTGTTCTCTCTTTGCTCGAAAAGTGGGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTCGTGCTGAGACG-GGGGGAGTTGATTCGCGGTATGGTTGGCTTCGGCTGAACTCGCTTATTGGGCTTCTTTCATGTCTTGGCGTGCGATTGGTGTACCGTAGCTGTGGTCTTGGCTTTTGAACCTGTGTGCGAAGTAGAGTGGTTCGGACGAGGGACGAGACTTTTGGGAATGTGCCTTTGGAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATCGTTGGTACAACATTTTCACTTTTAATTAGGATGGAATTAGCACAACCAGGTAACCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCCTTAATAGGTGGATTCGGTAATTGGTTTGTACCTTTAATGATTGGAGCTCCAGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCGCCCTCATTATTATTATTAGTTTCATCTGCTTTAGTTGAATCAGGTGCTGGTACCGGTTGGACAGTATATCCACCTTTATCGAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTCTATTTGTATGGTCTGTATTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_chrysanthemi TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATGGAGGCGTGGTCAGCGCGGGCGCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGCCGCTTGCGCGTACGACCCGTGTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGTCGAGTGTGTGCGTGTGCGTGCGTTCGCAGTGGCTTTTGGCTGCGCGGCGCGTGTGCTGTGTGTGCTTGGTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCTCTGTGTGCCCGGTGTGCGGATAGCTTGCTATGCGTGTGCTGTCGTGCGCGGATGGGGGCGTGCTGTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGGCGCTCATCACGAGGCTCTGGAGTCTGGGGTAGTAGTTTTTGTAAACCATTTCTGAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCGTGTAGTCGGTGGCGGGAACGCCAGACGTGAAGTGTCTTGCCGTCTCCCGGCGAGTCCTTTGAATACTGTTCTCTCTTTGCTGGAAAAGTGCGGGTGGTTGTGGAGGCTGCCGTGTGGCAAGTCGGCGACTTCGTGCTGAGGCGGGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTCGCTTATTGGCTGTTTCTGCTGTTTCGGCGGGCGTTTGGTGAACCGTAGTCATGTGCTTGGCTTTTGAACGTGTTCGCGAAGTATGGTGGTTCGGCCGAAGGACGACCTATTTGGGACTGTGCCTTTGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGCGCTTTTTCAGGTATTGTGGGTACAACTTTTTCACTTTTAATTAGAATGGAACTTGCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCCTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTCTTGTTGAATCTGGTGCTGGTACTGGTTGGACGGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCCCTATTTGTTTGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCCTTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_cinnamomi TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGGTGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCTAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGGTGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGTGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTCCACAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATAGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAAATCTTAATGGGAAATCATCAATTATATAATGTAATTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAGTCTGGTGCAGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTTCAAGCACACTCTGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCCGGTTTAAGTTTTCATAGATTACCATTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGGGGTGATCCAGTATTATATCAA Phytophthora_cinnamomi_var_parvispora TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGGTGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCTAGTAGCTATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGGCGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGTGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGAACTTGGCGTTTGAACGTGTTGGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATCTGTCTTCACAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCATTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCAATCGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGCGTTCAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCCATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_citricola TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTGCAAGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_citricola_CH97TUL2 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGCGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAAC-TGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGCTCGAGCTAGTAGCAATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGCTTTCGGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGGTGGCTTGTCGGCGACTTTGTGCTGTGACGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACACGCTTATTGGGTGCTTTTCCTGTCATGGCGTGCGACTGGTGAACCGTAGTCATGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGTGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATTTGTCTTTGCAAATCATAAAAGTATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGTATGGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCACCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCCGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTAGCAAGTGCACAAGCACACTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCAGTGTTAGCAGGTGCTATTACAATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGAGATCCAGTATTATATCAA Phytophthora_citrophthora TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTG{CT}GAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTTCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGTGTCGATCCTTTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTAATTGTTACTGCTCATGCTTTCATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACCGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATATCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTGTTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_clandestina TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGAGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTATCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTAGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCAACGCGAAAGTTTAGGGTCCGGGCTAGTAGCTATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATATGAAGTGTCTTGCTTGTTTCCTGCGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGAGGCTGTTACGTGGCCAATTGGCGACTTTGTGCTGTGGCGTGGAAGAATTGATTCGCGGTATGATTAGCTTCGGCTGAACAGGCTTATTGGGTGTTTATCCTGCTG{CT}GGCGGATGGCTGGTGAACCATAGCTCGGGACTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAGGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGGACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAATAATATAAGCTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCGGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_colocasiae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCC{AG}AGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTTCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGTGTCGATCCTTTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCTCACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTCTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_cryptogea TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGTGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCATTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCTGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_cuyabensis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATGGAGGCGTGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGCCGCTTGCGCGTACGACCCGTGTTCTTCGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGTCGAGTGTGTGCGTGCGTGTGTGTTCGCAGCGGCTTTTGGCTGCGCGGCGCGTGTGCTGTGTGTGCTTGGAGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGTCTCTCTGTGTGCCCGGTGTGCGGATAGCTTGCTATGCGTGTGTCGTCGTGCGCGGATGGGGGCGTGCTGTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGCCGCTTATCACGAGGCTCTGGAGTCGAGGGTAGTAGATTTTGTAAACCTTTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCGTGTAGTCGGTGGCGGGAATGCCAGACGTGAAGTGTCTTGCCTGGTGTCTGCGAGTCCTTTGAATACTGTTCTCTCTTTGCTGGAAAAGTGCGTGTGGTTGTGGAGGCTGCCGTATGGCCAGTCGGCGACTTCGTGCTGAGGCGTGGAGAGGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTCGCTTATGGGCTGCTTGTGCTGCTTTGGCGGTCGGTTGGTGAACCGTAGTCATGGTCTTGGCTTTTGAACCTGTTCGCGAAGTATGGTGGCCAAGACGAAGGACGACCTATTTGGGACTGTGTCTTTGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCTGGAATTGTGGGTACAACTTTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCCTTTATCATGGTATTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATAGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTCTTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_drechsleri TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTGCCCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGTCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGCTGTGTGTGGATTGATGCGCGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCCTGGGGCCTGGGTTAGTAGCTTTTTTAAACCATACTGAAAAACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTTAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTTCTGCTGCGGCGGATGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTATTTGCGAAGTAGGGTGTCTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCGGGTGCCGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_drechsleri_CH96HE1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_drechsleri_CH96HE2 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_erythroseptica TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGTGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTATTTTTAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCTGTATTAGCCGGAGCAATTACCATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_europaea TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGTTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCCAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGAACGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTCGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTGTTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACGGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACAATGTTATTGACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGGGGAGGAGATCCTGTACTATATCAA Phytophthora_fallax TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCTCTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATACCTGAGTGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAATAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGGATCGTTTCCAGTGTCTATAATCCGTGGCATATTCCATTGCCGAGTGTGTGCGTGTGTGGGTTTCGGCAGCGGCTTTGGGCTGCGCTGCCTGTGCTGTGCGTGTGCTTGGTGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTGTGCCGCGGGAAATATCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTAGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGTGCTTCTCTGTGTGCGCGCCGTGCGAATAGCTTGCTATGCGTGTGGTGTTGTGTGTGGATTGAGGCGTGCTGTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGATGACCATCACGAAACATCGGGGTCGGAGCCAGTAGTCTTTGTAAACCATACTGAAAAACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGAAGTATGCCTGTATCAGTGTCCGTATATCAAACTTGCCTTCCTTCCTTCCGTGTAGTCGGTGGAGGGAACGTCAGATGTGAAGTGTCTTGCGTCCTTCTGGCGAGTCCTTTTAATACTGTTCTCTCTTTGCTCGAAAAGTGGGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTCGTGCTGAGACGGTGGGGAGTTGATTCGCGGTATGGTTGGCTTCGGCTGAACTCGCTTATTGGGCTTCTTTCATGTCTTGGCGTGCGATCGGTGTACCGTAGCTGTGGTCTTGGCTTTTGAACCTGTGTGCGAAGTAGAGTGGTTCGGACGAGGGACGAGACTTTTGGGAATGTGCCTTTGGGAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCCTTTTCTGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAACTTGCACAACCGGGTAATCAAATTTTAATGGGGAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCCTTAATAGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCCTTAGTTGAATCAGGTGCTGGTACAGGTTGGACAGTATATCCACCATTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGGATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTATGGTCTGTATTAATTACCGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCGGGTGCAATTACAATGTTATTAACTGATAGAAATTTTAATACATCTTTTTATGACCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_foliorum TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGGTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATGGATGCGTGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGCCTGGGGTCTGAGCTAGTAGCACTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTACGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAATATGTGTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATTTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCCTTTCCACGAATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCGGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATATTAATTACAGCCTTTCTTTTATTATTAACATTACCCGTTTTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCATCTGGGGGGGGTGATCCAGTATTATATCAA Phytophthora_fragariae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCCAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGGACTTGGCCTTTGAACGTGTTCGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCGGGTAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTATTTGGTCTGTATTAATTACAGCATTTCTTTTATTACTAACTTTACCGGTATTAGCTGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGGGGAGATCCAGTACTATATCAA Phytophthora_glovera TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGCGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCCCCCAAATTCCACGTGACCGTGGGTACCCATCGCGAATGTTTGGGGTCCGGGCGAGTAGCTGTTTTAAACCATTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCAAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGAGGAGGAGCCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGAATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGTTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGAACTTTATATATAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATCTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGAGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACGGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGGCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_gonapodyides TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGCGCGTGCGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGCTCGAGCTAGTAGCAATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGCTTTCGGTGAGTCCTTTGAGAACTGTACTCTCTTTGCGCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGTGACGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACACGCTTATTGGGTGCTTTTCCTGTCATGGCGTACGACTGGTGAACCGTAGCTGTGGGCTTGGCTTTTGAACTTGCTTGCGAAGTAGTGTGATTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATGGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGAAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTGTCATCAGCTATTGTCGAATCTGGTGCTGGGACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCATCATTATTGGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCACAGATTACCCCTATTTGTTTGGTCTGTGTTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACTATGTTATTAACTGATAGAAATTTAAATACTTCGTTTTACGATCCATCTGGAGGAGGTGATCCGGTATTATATCAA Phytophthora_gregata TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGCTCGAGCTAGTAGCAATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGCTTTCGGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGGTGGCTTGTCGGCGACTTTGTGCTGTGACGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACACGCTTATTGGGTGCTTTTCCTGTCATGGCGTGCGACTGGTGAACCGTAGTCATGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGTGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGAACTTTATATATAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGGGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTAGCAAGTGCACAAGCACACTCAGGACCTTCCGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTGTTAGCAGGTGCTATTACAATGTTATTAACCGATAGAAATTTAAATACTTCTTTTTATGACCCATCCGGTGGGGGAGATCCCGTATTATATCAA Phytophthora_hedraiandra TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGCCTGAGCTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCTATGTAGCAAGTTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTTTTTCTGCTGTGGCGGATGGCCGGTGAACCATAGCTCAGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTATTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTACAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_heveae TAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTTCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAAGAGATGCCAGATGTGAAGTGTCTTGCCTGTCTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAATGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTCTGTGCTGCAGCGTGGAGGCGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGTGTTTCCTGTTGTGGCGTAATGCTGGTGTACCGTAGCTATGGGCTTGGCTTTTGAATTTGCTTGTGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATTTGTTTATGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTACGATCCTTCTGGTGGAGGAGATCCAGTATTATATCAA Phytophthora_hibernalis TAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCACACAAGTTTTGTGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTTTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGTCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGATGCGGTGGGACGTCAAGGTCAATTCGTATGCCGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGATTGAGGTGCCTACAACGTGCTTTTGAGTGAGTCCGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTACTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGCCTGGGGTCTGAGCTAGTAGTTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGTCAGACGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAGAACGGTACTCTCTTTGCTCGAAAAATATGAATGGTTGTGGAAGCTTCCCGGTGGCAAGTCGGCGACTTTGTGCTACGGCGTGGAGGAATCGATTCGCGGTATGGTTAGCTTCGGCTGAACAGGCTTATTGGATGTTTTTCCTGCTGTGGTGTAATGCTGGTGAACCGTAGCTATGAGATTGGCCTTTGAACATGTTTGTGAAGTAGAGTGGTTTGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGTAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCCCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTCGTTCCTTTAATGATAGGGGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCCGCTTTATTATTATTAGTATCATCAGCTATTGTGGAATCTGGAGCAGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCGGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCTGTTTTAGCAGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCCTCTGGAGGTGGTGATCCCGTATTATATCAA Phytophthora_humicola TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCCGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGTGTGCGTGCGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGTTGTGCTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGCGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGAGCGCTCATCGCGAGCGTTTGGGGCTCGAGCTAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGCTTTCGGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGATGGCCAGTCGGCGACTTTGTGCTGTAGTATGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACACGCTTATTGGGTACTTTTCCTGCTATGGCGTACGACTGGTGAACCGTAGCTGTGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATATGTCTTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTCGAATGGAATTAGCACAACCGGGTAATCAAATTTTTATGGGGAATCATCAATTATATAATGTTATTGTTACAGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_idaei TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGCCTGAGCTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCTATGTAGCAAGTTGGTGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTTTTTCTGCTGTGGCGGATGGCCGGTGAACCATAGCTCAGGGCTTGGCTTTTGAATTTGCTTGCGGAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTGATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATCACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGTGATCCAGTATTATATCAA Phytophthora_ilicis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGTTTTAGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTTTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCCGATTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGGTGGCCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAGGCTTATTGGATGTTCTTCTTGCTGTGGCGGATGGCTGGTGAACCGTAGCTATGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGTAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTGGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCGCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTTGGTAATTGGTTTGTTCCATTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCCGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACAATGTTGTTAACCGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_infestans TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTATTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCTTGTTTCCTGCGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGACGCTGCTATGTAGCGAGTTGGCGACTTTGTGCTGCGGCGTGGAGAAATCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGGTGATTTTCCTGCTGTGGCGGATGGCTGGTGAACCATGGCTCTTAGCTTGGCATTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_inflata TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTG{CT}GAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTTCACGTGACCGTGGTCGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGATTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCCTTATCTAGTGTGCAAGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTCCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_insolita TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCGAGTTTCGCGTGGCGAATTGTAGTCTATAGATGCGTGGTCAGCGTTGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATC{CT}CTGAGTGGCTGGCGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGGCGAGTGTGTGCGTGCGTG{CT}GCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGCTGTGCGTGTGCTTGGTGGTGCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGCGAGTGTGTGTCTCTGGATGCGTGCTGTGCGGATAGCTTGCTATGCGTGTGGCGTTGTGTTTGGATTGGCGTGCGCTTTTGCTTGTTGCCGTTCCCACAAAGTCCACGTGACTGTGGGCGCTCATCACGAGGAGGCGGGGCCTGCGTTCTTTGTTGTTTTAAACCTCACTGATGTACTGTGGGGACGAAAGTCTCTGCTTTGACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATGAAACTTGGCTTCCTTCCTTCCGTGTAGTCGGTGGCGGGAACGCCAGACGTGAAGTGTCTTGCTTGATTTTGGCGAGTCCTTTGAGACGTGTGTTCTCTTTGCTGGAAAAGTGGGCGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTCGTGCTGATGCGTGGGAGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGATTTCGCTTATTGGTTGCGTTTGCTGCGTCGGCGTGCGGTCGGTGAACCGTAGCTGCGTGCTTGGCTTCTGAACCTGTGTGCGAAGTATGGTGGTGTGGTCGAGAGACTGTCCATTTGGGAATTTGTCCTGGTAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACACGCTTTTATTATGGTATTCTTTTTAGTTATGCCTGCATTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCTGGTATTTCTTCTTTATTAGGTGCTATCAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTCCATAGATTACCATTATTTGTTTGGTCTGTTTTAATTACAGCTTTTTTATTATTATTAACTTTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTCTATGATCCTTCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_inundata TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCCGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGTGTGCGTGCGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGTTGTGCTTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGCGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGTCTTAACTTGTCGCCGTTCACCCAAATTTCACGTGACCGTGAGCGCTCATCGCGAGCGTTTGGGGCTCGAGCTAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGCTTTCGGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGATGGCCAGTCGGCGACTTTGTGCTGTAGTATGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACACGCTTATTGGGTGCTTTTCCTGCTATGGCGTACAACTGGTGAACCGTAGCTGTGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACAGCACACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTATCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCAAGTGTACAGGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGGGGTGATCCTGTATTATATCAA Phytophthora_ipomoeae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAG{CT}TGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTATTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCTTGTTTCCTGCGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGACGCTGCTATGTAGCGAGTTGGCGACTTTGTGCTGCGGCGTGGAGAAATCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGGTGATTTTCCTGCTGTGGCGGATGGCTGGTGAACCATGGCTCTTAGCTTGGCATTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAGTTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACGGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTATGATCCATCAGGTGGAGGTGATCCCGTATTATATCAA Phytophthora_iranica TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGTGGGCACTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTATCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCAACGCGAAAGTTTAGGGTCTGGGCTAGTAGCTATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATATGAAGTGTCTTGCTTGTTTCCTGCGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGAGGCTGTTACGTGGCCAATTGGCGACTTTGTGCTGCGGCGTGGAAGAATTGATTCGCGGTATGATTGGCTTCGGCTGAACAGGCTTATTGGGTGTTTATCCTGCTGCGGCGGATGGCTGGTGAACCATAGCTCGGGACTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAAAGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGGACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCAGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_katsurae TAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTCGCTCATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTCTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCAAAAAATGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTCTGTGCTGCGGCGTGGAGGCGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTGTTTCCTGCTGTGGCGTAATGCTGGTGTACCGTAGCTATGGGCTTGGCTTTTGAATTTGCTTGTGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCATCATTATTAGGTGCTATTAACTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_kernoviae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCAAGTTTTGCGTGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGCGAGCGCTTGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATACCTGAGTGGCTTGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTATGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGTGCGTGTTGTGCGTGTGTTTGCTGGTGCCCTGTGCTATGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCTGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTCTGTGGAACTCTCTGTGTGCGTGCTGTGTGGATAGCTTGCTATGTGCGTGGTGCTGTGCGTGGATTGAGGTCTGCTGTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGCGTTCATCACGATCATTTGGAGTCGGAATTGAGAGTTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGCTTCCTTCCTTCCGTGTAGTCGGTGGAGGGAATGCCAGACGTGAAGTGTCTTGCGCGTTTCCGGCGAGTCCTTTGAATACTGTTCTCTCTTTGCTCGAAAAGTGAGTGTAGTTGTGGAGGCTGCCATACGGCATGTCGGCGACTTCGTGCTGAGGCGGAGAGGGGTCGATTCGCGGTAGTGTTGGTTTCGGCCGAACACGCTTATTGTGTCTTTTCCTTGCTTTGGCGTGCGATTGGTGTACCGTAGTAGTGGTCTTGGCTTTTGAACTTGTGTGCGAAGTAGAGTGGTTCGGACGAGGGACGAAACTTTTGGGAATGTGTCTTTGTAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTTCTGGTATTGTTGGTACAACATTTTCACTTTTAATTCGTATGGAATTATCACAACCAGGTAATCAAATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTCTTAGTTATGCCTGCTTTAATTGGTGGCTTTGGTAATTGGTTTATTCCTTTAATGATAGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCATCAGCTTTAGTTGAATCAGGTGCGGGTACAGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCTATTTTTAGTTTACATTTATCCGGAATGTCTTCACTGTTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTATTTTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCATTTTATGATCCTTCAGGCGGAGGTGATCCGGTATTATATCAA Phytophthora_macrochlamydospora TAGTAACGGCGAGTGAAGCGGGAGGAGCTCAAGCTTAAAATCTCCGCGCCAGTTTGGCGTGGCGAATTGTAGTCTATGGACGCATGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTGATTCCCTGGGTTGCTTGTGCGTACGACCCGTGGTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCTGCATATTTCATTGGCGGGCGTGTGCGTGTGTGGGCTTTGGCAGTGGCTTTTGGCTGCGCGGTCTGTGCTGTGCGTGTGTCTGGCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGGAATCTCTGTGTGCGCGGTGTGCGGATAGCTTGCTATGCGTGTGCTGTTGTGCGTGGATTGAGGCCTGCTGTAGCTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGACGACCATCGCGACCGCTCGGAGTCGGGGCCAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATGAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAAGTGTCTTGCGCGTTCGCTGCGAGTCCTTTGAGACCTGTTCTCTCTTTGGCCGAAAAGTTCGAGTGGTTGTGGAGGCTGCCTTGCGGCATGTCGGCGACTTCGTGCTGAGGCGTGGGGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTCGCTTATTGGCTTTTTTCGCGGCTTTGGCGTGCGGTCGGTGTACCGTAGCTGCGGTCTTGGCCTTTGAACGTGCGAGCGAAGTAAGGTGGTGTAGTCGAGGGACGCAACATTTGGGAATTTTCCTTGGCGAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTAATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTTCAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCAATTAATTTCATATCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAA Phytophthora_meadii TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTTGTTTTAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTTCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGTGTCGATCCTTTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTATTGTTACTGCTCACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGGGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATATCATCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_medicaginis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCTTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTTTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCTTGGGCTAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGTGGACGGCTGGTGAACCGTAGCTGTATACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCCGGTATTGTAGGTACAACATTATCCCTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATCATGGTTTTCTTCTTAGTTATGCCCGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCGGCATTATTATTATTAGTTTCTTCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCACAGATTACCCTTATTCGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACCTTACCGGTATTAGCTGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCGTTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megakarya TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGTAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTACTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGACTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTTTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACCTCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGATGTGAGGTGTCTTGCCTGCTTCCTGTGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTAAGTGTTGTTGTGGAGGCTGCTTGGTAACCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGATTGGCTTCGGCTGAACAAGCTTATTGGGCGTTTTTCCTGCTATGGCGTATGAGTAGTGAACCGTAGTTATGGGCTTGGCTTTTGAATGTGCTTGCGAAGTAGAGTGGTTTGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTAGGTACAACTTTATCTCTATTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCTCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAGGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCTTCAGGTGGTGGAGATCCTGTATTATATCAA Phytophthora_megasperma TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGCGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGCGCGTGCGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGTTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTACCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGTTTGGGGCTCGAGCTAGTAGCAATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAACCTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGAGGATATGCCAGACGTGAAGTGTCTTGCGCGCTTTCGGTGAGTCCTTTTAGAACTGTACTCTCTTTGCGCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGGTGGCCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACACGCTTATTGGGTGCTTTTCCTGTCATGGCGTATGACTGGTGAACCGTAGCTGTAGGCTTGGCTTTTGAACTTGCTTGCGAAGTAGTGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTGTTGGTACAACCTTATCACTTTTAATCCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCACCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGAGCACCTGATATGGCTTTCCCACGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCGTTATTATTATTAGTTTCATCAGCTATTGTTGAATCCGGTGCGGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGAGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCCGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACTGCCTTTCTTTTATTATTAACATTACCCGTATTAGCTGGTGCCATTACCATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCTTCTGGGGGGGGGGATCCAGTATTATATCAA Phytophthora_megasperma_CH00MKR1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH00MKR2 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTGACGTGAGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAAAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH02PHR1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH04PHR11 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH04PHR12 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH94PHR1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH95PHG7 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTCTTTTAAACCAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCGGACGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma_CH95PHG8 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTCTTTTAAACCAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCGGACGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACTGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma_CH95PHR10 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH95PHR16 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH95PHR17 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_CH97PHR1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTGACGTGAGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACAAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_GF433 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGATTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCCTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCAGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma_GF543 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGATCGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma_GF649 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGAC{AGT}AAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGATCGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCTTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma_MAFF237500 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGCATTTGGCTGCGCGGCGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTTCACGTGACCGTGGACGACCATCGCGATCGCTCGGGGTCTGGGCTAGTAGCTTTTTTAAACCAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAAATGCCAGACGTGAAGTGTCTTGCCTGCTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCATGTGGTTGTGGAGGCTGCCTGGTGGCCTGTCGGCGACTTTGTGCTGCGGCGAGGAGGCGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTGTTTTCTGCTGTGGCGTATGGCCGGTGAACCGTAGCTGTGGGCTTGGCGTTTGAACTTGCGCGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATAGTAGGTACTACTTTATCTCTTTTAATTAGAATTGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCACACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTCTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCTTTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATAAATTTTATATCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCGTCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_NBRC31624 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTCTTTTAAACCAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCGGACGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTCTTGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_megasperma_NBRC32176 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGCATTTGGCTGCGCGGCGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTATTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTTCACGTGACCGTGGACGACCATCGCGATCGCTCGGGGTCTGGGCTAGTAGCTTTTTTAAACCAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAAATGCCAGACGTGAAGTGTCTTGCCTGCTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCATGTGGTTGTGGAGGCTGCCTGGTGGCCTGTCGGCGACTTTGTGCTGCGGCGAGGAGGCGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTGTTTTCTGCTGTGGCGTATGGCCGGTGAACCGTAGCTGTGGGCTTGGCGTTTGAACTTGCGCGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATAGTAGGTACTACTTTATCTCTTTTAATTAGAATTGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAACCATCAATTATATAATGTTGTAGTTACTGCACACGCTTTTATAATGGTTTTCTTTTTAGTTATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTCTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCAATTGTTGAATCAGGTGCTGGTACTGGTTGGACAGTATATCCACCTTTATCTAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATAAATTTTATATCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCGTCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_P_A TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_P_B TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGCGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAAGTCCACGTGACCGTGGGCGCCCATCGCGAAGTGTTGTACGTGATGTCGGCTGCTGTTTTAAACCAAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTACGTGCTTTGTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGCGCGTATGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTCTGTGCTGTGGCAAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTAAACAAGCTTATTGGATGCTTTTTCTGCTATGGCGTACGGCTGGTGAACCGTAGCTATTTACTTGGCGTTTGAACTTGTTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTTGTAGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGATTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATCAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCAGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGGGGAGGTGATCCGGTATTATATCAA Phytophthora_megasperma_Pm_1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_melonis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGTGTATGGCTGGTGAACCGTAGTTGTGGACTTGGCTTTTGAACGTGTTAGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_mexicana TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCGGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTACCCATCGCGAATGTTTGGGGTCTGGGCGAGTAGCTGTTTTAAACCATTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGAATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGTTCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_mirabilis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTA{AG}CTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTATTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCTTGTTTCCTGCGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGACGCTGCTATGTAGCGAGTTGGCGACTTTGTGCTGCGGCGTGGAGAAATCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGGTGATTTTCCTGCTGTGGCGGATGGCTGGTGAACCATGGCTCTTAGCTTGGCATTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTGGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAACACTTCATTTTACGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_multivesiculata TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGCGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGCGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAATGTTTGCGTGCGTGTGCTATGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGCGGATTGATGCAGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGATCGTTTGGGGTCTGAGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGTCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTATGTGGTTGTGGAGACTGCCTGGTGGCCAGTCGGCGACTTTGTGCTACGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGTTCTTGGTCTTTGAATTTGCTTGCGAAGTAGAGCGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATAGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTATCTCAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTTTTTCTAGTTATGCCTGCTTTAATTGGCGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTCCCTCGTATGAATAATATCAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACCTTACCTGTATTAGCTGGTGCAATTACTATGCTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCTGGGGGAGGAGATCCTGTATTATATCAA Phytophthora_nemorosa TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGTTTTAGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTTTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCCGATTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGGTGGCCAGTCGGCGACTTTGTGCTGTAGCGTGGAGGAGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAGGCTTATTGGATGTTCTTCTTGCTGTGGCGGATGGCTGGTGAACCGTAGCTATGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGTAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCACTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATTATGGTTTTTTTTT?AGTTATGCCCGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCCTTAATGATTGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGAACAGGTTGGACAGTTTATCCACCTTTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTGGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCAGGTTTAAGTTTTCATAGATTACCCTTATTTGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGAGATCCTGTATTATATCAA Phytophthora_nicotianae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTACGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAACGTTTGGGGCCTGATTTAGTAGTTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGAAGGCTGCTATGTGGCAAATTGGCGACTTTGTGCTGCGGCATGGAAGAGTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGACTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCATAGCTCGGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_niederhauserii TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATAGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAGATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCTCCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACCTCTTTCTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_palmivora TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCTCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTTTTTTAAACCAAACTGATATACTGTAGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCCAAAAGTGCGTGTGATTGTGGAGGCTGCTTGGTAGCCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGAATATTTCTTCAGCTGTGGTGTATGATTGGTGAACCGTAGCTATGGACTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAA Phytophthora_phaseoli TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTATTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCTTGTTTCCTGCGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGACGCTGCTATGTAGCGAGTTGGCGACTTTGTGCTGCGGCGTGGAGAAATCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGGTGATTTTCCTGCTGTGGCGGATGGCTGGTGAACCATGGCTCTTAGCTTGGCATTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTTTCTCTTTTAATTAGAATAGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCGGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTGCCTCCTTCTTTATTATTATTAGTTTCTTCAGCTATCGTTGAATCTGGGGCTGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTTCAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTACTAGCTGGGGCAATTACTATGTTACTAACTGATAGAAATTTAAATACTTCATTTTATGATCCATCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_pini TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTTCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTATGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGATTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAGTTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATAATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCCTTATCTAGTGTGCAAGCACACTCTGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTCCACAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_pistaciae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGCCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGGGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGAGTCGATCCATTTGGGAATCTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATAATGGTTTTTTTTTTAGTTATGCCTGCTTTAATAGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_polonica TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCTGCGCGAGTTTCGTGCGGCGAATTGTAGTCTATAGATGCGTGGTCAGCGTTGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCTCTGAGTGGCTGGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATCGGCGAGTGTGTGCGTGCGCGTGCTTTGGCAGTGGCTTTGGGCTGCGCGGCGTGTGCTGTGCGTGTGTTTGCTGGTGCCCTGTGTTGCGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGCGTCTCTGTGCGCTTGCTGTGCGGATAGCTTGCTATGCGTGTGGCGTAGTGTTTGGATGGATGTGCGCTTTTGCTTGTTGCCGTTCACACAAAGTCCACGTGACTGTGGGCGCCCATCACGAGGAGGCGGGGCCTGCTTTAGTAGTTATTTTAAACCTAACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAAGCCTGGGAGTATGCCTGTATCAGTGTCCGTACAACAACCTTGGCTTCCTTCCTTCCGTGTAGTCGGTGGCGGGAACGCCAGACGTGAAGTGTCTTGCTCAATTTTAGCGAGTCCTTTGAGACGTGTTCTCTCTTTGCTGGAAAAGTTCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTCGTGCTGATGCGTGGGGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGATTTCGCTTATTGGTCGTTTCTGCTGCGTTGGCGTGCGGTCGGTGAACCGTAGCTGCGTGCTTGGCTTTTGAACCTGTGTGCGAAGTATGGTGGTTCGGGCGAGAGACGGTCCATTTGAGAATTTGTCCTTTTAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATAGTAGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCGCAACCAGGTAATCAGATTTTAATGGGTAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGGGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCTGCTCTTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTTCAAGCACACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTATCAGGTATTTCATCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTTTATTATTATTAACATTACCTGTTTTAGCTGGTGCTATTACAATGTTATTAACCGATAGAAATTTAAATACATCTTTTTATGATCCATCTGGAGGAGGTGATCCCGTATTATATCAA Phytophthora_porri TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCCCGTGACCGTGGGCGCTCAGCGCGACCTTCTGGGCCTGGGGCTAGTAGCCTTTTTAAACCTTACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCCTGCTTTATGCGAGTCCTTTTAAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGTGTGGAGAAGTTAATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTAAATGTTTTTCTTACTGCGGCGGATAGCTGGTGAACCGTAGCTGTGAGCTTGGCCTTTGAATATATTTGCGAAGTAGAGTGATCCGGCCGAGGGTCGATCCATTTGGGAATGTGCCCTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAACTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCTATTGTTGAATCGGGTGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCGGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCGATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATTTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_primulae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCATGCAAGTTTTGTATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTTAGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCCTGAGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGTGTGTGCTGTGGCAGTGGCTTTAAGCTGCGCGGTGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTTGTCGCCGTTCACACAAATCCCCCGTGACCGTGGGCGCTCAGCGCGACCTTCTGGGGCTTGGGCTAGTAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCCTGCTTTATGCGAGTCCTTTTAAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGTGTGGAGAAGTTAATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTAAATGTTTTTCTTACTGTGGCGGATAGCTGGTGAACCGTAGCTGTGAGCTTGGCCTTTGAACATATTTGCGAAGTAGAGTGATCCGGCCGAGGGTCGATCCATTTGGGAATGTGCCCTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTATTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAGATTTTTATGGGAAATCATCAATTATATAATGTTGTAGTTACAGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCCGCTTTAATTGGTGGATTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTACTGTTAGTTTCTTCAGCAATTGTTGAATCCGGCGCAGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGGATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTTTACCTTTATTTGTATGGTCGATCTTAATTACGGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCTATTACGATGCTATTAACAGATAGAAATTTAAATACTTCTTTTTATGACCCATCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_pseudosyringae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGTTTTAGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCACACAAATTCCACGTGACTGTGGGTGCCCATCGCGAGCGTTTGGGGTCTGAGCTAGTAGCTTTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCCGATTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCCGGTGGCCTGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAGGCTTATTGGATGTTCTTCTTGCTGTGGCGGATGGCTGGTGAACCGTAGCTATGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGTACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACTGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACCATTTATAATATGCGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTACGACCCTTCTGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_pseudotsugae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTAATCCCTGAGTTGCTCGTGCGTACGGCCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTACTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAGCGTTTGGGGCCTGAGCTAGTAGCTCTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCCTGTTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCTATGTAGCAAGTTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGATTTTTCTGCTGTGGCGGATGGCCGGTGAACCATAGCTCAGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTCATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCTTTAATTGGGGGTTTTGGTAACTGGTTTGTTCCTTTAATGATTGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCGCACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATATACAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCTATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGAGGAGGTGATCCAGTATTATATCAA Phytophthora_quercina TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCT{CT}GTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGACATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCTTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAACGTTTGGGGTCTGAACAAGTAGCTTTTTTAAACTATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCCTGTTTCATGTGAGTCCTTTGATTACTGTACTCTCTTTGCTCGAAAAGTGCGTGTAATTGTGGAGGCTGCCAGGTGGCCAGTCGGCGACTTTGTGCTGTAGCGTGGAGGAGTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGATCTTGGCCTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGACCTTTATATTTAATTTTTAGTGCTTTTGCTGGTGGTGTTGGTACAACATTATCTCTTTTAATTAGAATAGAATTAGCACAACCCGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCACGCTTTTATTATGGTTTTTTTTTTAGTTATGCCAGCATTAATTGGCGGTTTCGGTAACTGGTTCGTTCCTTTAATGATTGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCCGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCGGGGGGAGGAGATCCTGTATTATATCAA Phytophthora_quininea TAGTAACGGCGAGTGAAGCGGGAGGAGCTCAAGCTTAAAATCTCCGCGCCAGTTTGGCGTGGCGAATTGTAGTCTATGGACGCGTGGTCAGCGCGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTGATTCCCTGGGTTGCTTGTGCGTACGACCCGTGGTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGCGGCATATTTCATTGCCGGGCGTGTGCGTGTGTGGGCTTTGGCAGTGGCTTTTGGCTGCGCGGTCTGTGCTGTGCGTGTGTCTGGCGGTGCCCTGTGCTGTGGTGGGACGTCAAGGTCAGTTCGTGTGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTGGGAATCTCTGCGTGCGCGGTGTGCGGATAGCTTGCTATGCGTGTGCTGTTGTGCGTGGATTGAGGCCTGCTGTAGCTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGACGACCATCGCGACCGCTCGGAGTCGGGGCCAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTATGCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAAGTGTCTTGCGCGCTTCCTGCGAGTCCTTTGAGACCTGTTCTCTCTTTGCCCGAAAAGTTCGAGTGGTTGTGGAGGCTGCCTTGCGGCATGTCGGCGACTTCGTGCTGAGGCGTGGGGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACTCGCTTATTGGGCTTTTTTCCTGGCTTGGCGTGCGGTCGGTGTACCGTAGCTGCGGTCTTGGCCTTTGAACGTGCGAGCGAAGTAAGGTGGTGTAGTCGAGGGACGCAACATTTGGGAATTTTCCTTGGCGAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTTCAGGTATTGTTGGTACAACATTTTCACTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTTACTGCACATGCTTTTATTATGGTATTTTTTTTAGTAATGCCAGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCTTCATTATTATTATTAGTTTCATCAGCTCTTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTATATCCACCTTTATCAAGTGTTCAAGCACACTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCAATTAATTTCATATCAACAATTTATAATATGAGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCATTTTTATTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCATTTTATGATCCTTCAGGTGGGGGGGATCCAGTATTATATCAA Phytophthora_ramorum TAGTAACGGCGAGTGAAGCGGGATGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTTTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGT{AG}TGCTTGTTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTACTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGAGCGCTTGAGGTCTGAGCTAGTAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGTCAGACGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAATGCGTGTGGTTGTGGAGGCTGCCCGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAGGCTTATTGGATGCTTTTTCTGCTGTGGCGTAATGCTGGTGAACCGTAGCTGTGAGCTTGGCTTTTGAATGTGTTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACCTTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACTGCACATGCTTTTATCATGGTTTTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCAGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCGGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGAGCTGGTACTGGTTGGACAGTTTATCCACCTTTATCAAGTGTACAAGCACATTCAGGACCTTCTGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGCGAGCTCCTGGTTTAAGTTTCCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCAGGCGGAGGTGATCCTGTGTTATATCAA Phytophthora_richardiae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGTGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGCGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCATTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAGCCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACCGCCCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCGTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATCGTTGAATCAGGAGCAGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCTGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACGTTACCCGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGTGGTGATCCTGTATTATATCAA Phytophthora_rubi TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGTGCGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAGCGTTTGGGAACTGAGCCAGTAGCTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGACGTTCTTCCTGCTGTGGCGTACGGTCGGTGAACCGTAGCTGTGGACTTGGCCTTTGAACGTGTTCGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATCGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAATTGTAACTGCACATGCCTTTATAATGGTTTTCTTTTTAGTTATGCCTGCCTTAATTGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATCGTTGAATCTGGTGCGGGTACAGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTGGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCTATAAATTTTATTTCAACTATTTATAATATGAGAGCTCCCGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCCGTATTGGCAGGAGCAATTACAATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCCGGGGGGGGGGATCCTGTACTATATCAA Phytophthora_sansomeana TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGCGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGTGCTTTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTCTTTTAAACCAGACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAAAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCGGACGGCTGGTGAACCGTAGCTGTGTACTTGGCGTTTGAACGTGTGTGCGAAGTAGGGTGTCTTGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACATTATCTCTTTTAATAAGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCAGCATTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACGGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCACCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCCGTATTAGCTGGGGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGACCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_sinensis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGTGTATGGCTGGTGAACCGTAGTTGTGGACTTGGCTTTTGAACGTGTTAGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATCTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA Phytophthora_siskiyouensis TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCCTTTGGCTGCGCGGTGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTACGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTACCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTACGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGATTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCCGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTGGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATAGGGGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACCGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCGCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCGTTCCTTTTATTATTAACTTTACCTGTATTAGCAGGTGCAATTACTATGTTATTAACCGATAGAAATTTAAATACTTCATTTTATGATCCTTCTGGTGGAGGTGACCCTGTATTATATCAA Phytophthora_sojae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCAGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCGCATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTCTATGATCCATCTGGTGGGGGTGATCCAGTATTATATCAA Phytophthora_sojae_NBRC31016 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACCATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCGTGCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCCTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTTGGTACAACATTATCTTTATTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTAACTGCACATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACATTCTGGACCATCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCTACTATTTATAATATGCGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCGGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACATCTTTTTATGATCCTTCAGGAGGAGGTGATCCTGTATTATATCAA Phytophthora_species_APC001 TAGT-ACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGCGTTTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGTGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTACCCATCGCGAATGTTTGGGGTCCGGGCGAGTAGCTGTTTTAAACCATTCTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTCGCTTGCTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGAGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGAATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGTTCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCTTTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTGTTGTTGGTACAACATTATCTCTTTTAATTAGAATGGAATTAGCACAACCAGGTAATCAAATCTTTATGGGAAATCATCAATTATATAACGTTATTGTTACTGCTCACGCTTTTATTATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAACTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCAGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATCTCTTCATTATTAGGTGCAATTAATTTTATTTCAACCATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_species_GF468 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAACGTTTGGGGCCTGATTTAGTAGTTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGAAGGCTGCTATGTGGCAAATTGGCGACTTTGTGCTGCGGCATGGAAGAGTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGACTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCATAGCTCGGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_species_GF534 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCTCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTTTTTTAAACCAAACTGATATACTGTAGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCCAAAAGTGCGTGTGATTGTGGAGGCTGCTTGGTAGCCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGAATATTTCTTCAGCTGTGGTGTATGATTGGTGAACCGTAGCTATGGACTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAA Phytophthora_species_MAFF235784 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAACGTTTGGGGCCTGATTTAGTAGTTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTATATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAAAACTGAACTCTCTTTGCTCGAAAAGGGCGTGTGGTTGTGAAGGCTGCTATGTGGCAAATTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGACTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCATAGCTCGGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_species_MAFF235786 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATC-------------------AAAAAAAATTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGAAGGCTGCTATGTGGCAAATTGGCGACTTTGTGCTGCGGCGTGGAAGAGTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGACTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCATAGCTCGGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_species_MAFF235788 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGAGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGTGTCTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGTGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCTCATCGCGAGCGTTTGGGGTCTGAACTAGTAGCTTTTTTAAACCAAACTGATATACTGTAGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGTTTTCTTCCTTCCGTGTAGTCGGTGGTGGATGTGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGTGAGTCCTTTGAGAACTGTACTCTCTTTGCTCCAAAAGTGCGTGTGATTGTGGAGGCTGCTTGGTAGCCAGTCGGCGACTTTGTGCTGTGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCTTATTGAATATTTCTTCAGCTGTGGTGTATGATTGGTGAACCGTAGCTATGGACTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTAGTTGGTACAACTTTATCTCTTTTAATTAGAATGGAATTATCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTGACTGCTCATGCTTTTATTATGGTTTTTTTTTTAGTTATGCCTGCTCTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCTGCTATTGTTGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCAGGACCTTCTGTTGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGATTAAGTTTTCATAGATTACCTTTATTTGTGTGGTCTATTTTAATTACTGCTTTTCTTTTATTATTAACATTACCAGTATTAGCAGGTGCGATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGGGGAGGAGATCCAGTATTATACCAA Phytophthora_species_MAFF235794 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCATGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATTTCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCTCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTACGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGAGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAACGTTTGGGGCCTGATTTAGTAGTTCTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATTAAACTTGACTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATGTGAAGTGTCTTGCTTGCTTCCTGCGAGTCCTTTTAAAACTGAACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGAAGGCTGCTATGTGGCAAATTGGCGACTTTGTGCTGCGGCATGGAAGAGTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAGACTTATTGGACGTTTTTCCTGCTGTGGCGGATGGCTGGTGAACCATAGCTCGGGGCTTGGCTTTTGAATTTGCTTGCGAAGTAGGGTGGTTCGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTGTTGTAGGTACAACACTATCTCTTTTAATTAGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGTAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTATTTTTTTTAGTTATGCCTGCTTTAATTGGTGGGTTTGGTAACTGGTTTGTACCTTTAATGATAGGTGCTCCTGATATGGCATTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTAGAATCTGGTGCTGGTACTGGTTGGACTGTTTATCCCCCATTATCTAGTGTACAAGCACATTCAGGTCCTTCTGTAGATTTAGCGATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTCGTATGGTCTATATTAATTACCGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGAGCAATTACTATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_species_MAFF238158 TAGT-ACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGGCGAGCGTTTGCGTGCATGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGGTGTGAGTGTTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATGGATGCGGGCCTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAATGTTTGGGGTCTGGGCTAGTAGCTGTTTTAAACAATACTGATATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGATGTGCCAGATGTGAAGTGTCTTGCTTTCTTCCTGCGAGTCCTTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGTGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGTATGCTTTTCCTGCTGTGGCGGATGGCTGGTGAACCGTAGCTGTGGTCTTGGCTTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGCCGAGTGTCGATCCTTTTGAGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTTGGTACAACATTATCTCTTTTAATTCGTATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTATTGTTACTGCTCATGCTTTTATTATGGTTTTCTTTTTAGTTATGCCAGCTTTAATTGGAGGTTTCGGTAATTGGTTTGTTCCTTTAATGATCGGTGCACCTGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCCCCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACAGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCTTCAGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_species_MAFF239556 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCATGGCGAATTGTAGTCTATAGAAGCGTGGTCAGTGAGGGTACTCGGGGTAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGAAACTCCCGTTCATCCCTGAGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGTGTGTGCTGTGGCAGTGGCTTTAAGCTGCGCGGTGTGCGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGTGGTGGGACGTCAATGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTATAACGTGCTTTTGAGTGTGTGTGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGCGCTGTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCAGCGCGAGCTTCTGGGCTTGGGGCTAGTAGCTCTTTTAAACCTTACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTCGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAATAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGATGCCAGATGTGAAGTGTCTTGCCTGCTTCATGCGAGTCCTTTTAAAACTGTATTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCCAGTCGGCGACTTTGTGCTGCGGTGTGGAGAAGTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGTTTTTCTTACTGCGGCGGATGGCTGGTGAACCGTAGCTGTGGACTTGGCGTTTGAACATATTTGCGAAGTAGAGTGATCCGGCCGAGGGTCGATCCATTTGGGAATGTGCCCTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCGGGTATTATAGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCTGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACTGCACATGCATTTATTATGGTTTTTTTTTTAGTAATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCACCTGATATGGCATTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCGGGTGCGGGTACTGGTTGGACTGTTTATCCACCATTATCAAGTGTACAGGCACATTCAGGACCTTCTGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGAGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCTGGTTTAAGTTTTCATCGTCTACCTTTATTTGTATGGTCTATATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTTTTAGCTGGAGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCTGTATTATATCAA Phytophthora_species_Toku_1 TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGATTGTTTGGGAACTGGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGTGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGCTGTGGACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTGCGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACGTTATCACTTCTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCTTTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCACCAGCTTTATTATTATTAGTTTCATCAGCTATTGTTGAATCTGGTGCTGGTACGGGTTGGACTGTTTATCCACCATTATCAAGTGTACAAGCACATTCGGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTCTACGATCCATCAGGTGGGGGTGATCCAGTATTATACCAA Phytophthora_species_kelmania TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGGGTGGCTCTTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTTTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTATGGGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGTGCTGTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCGCTTGGGGCCTGGGCTAGTAGCTTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACACTAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGACGCCAGATGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTGAACACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGGTGGCATGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGATCGGCTTCGGCTGAACAAGCTTATTGGGTGCTTTTCCTGCTGTGGCTGATGGCTGGTGAACCGTAGCTGTGTACTTGGCTTTTGAACGTGTGTGCGAAGTAGGGTGTTCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTCGCAAATCATAAAGATATTGGCACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATCCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTGGTGACCGCCCACGCTTTTATCATGGTTTTCTTTTTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATAGGTGCTCCTGATATGGCATTTCCACGTATGAATAATATAAGTTTTTGGTTATTACCACCAGCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCTGGTGCTGGTACAGGTTGGACCGTTTATCCACCATTATCTAGTGTACAAGCACACTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTAACAGGTATTTCTTCGTTATTAGGTGCAATTAACTTTATTTCAACTATTTATAACATGAGAGCTCCAGGTTTAAGTTTTCATCGATTACCTTTATTTGTTTGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTATTAGCCGGAGCAATTACTATGTTGTTAACTGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGAGGTGATCCAGTATTATATCAA Phytophthora_syringae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGTGAGGGCGCTCGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCTTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCTGTGGCATATTTCATTGACGAGTGTGTGTGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGCGTGTGCTTGTTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGAGTGTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGCGTGGATTGATGCGTGCTTTAGCTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCGACCCTCTGAGGCCTGGGCTAGTAGCCTTTTTAAACCATACTGAAAAACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCCCTTCCTTCCGTGTAGTCGGTGGAGGGGATGCCAGACGTGAAGTGTCTTGCCTGCTTCCTGCGAGTCCTTTTAGAACTGTACTCTCTTTGCTCGAAAAGTTTATATGGTTGTGGAGGCTGCCTGGCGGCAAGTCGGCGACTTTGTACTGCGGCGTGGAGGAGTCGATTCGCGGTATGGATGGCTTCGGCTGAACTAGCTTATTGAGTACTTTTCCTGCTGTGGTGTACGACTGGTGAACCGTAGCTGTGTTCTTGGCTTTTGAACATGTGTGCGAAGTAGAGTGATCCGGCCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGGACTTTATATTTAATTTTTAGTGCTTTTGCAGGTATTGTTGGTACAACATTATCTCTTTTAATTCGAATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACGGCACACGCATTTATAATGGTTTTCTTCTTAGTTATGCCTGCTTTAATCGGTGGTTTTGGTAATTGGTTCGTTCCTTTAATGATTGGTGCTCCAGATATGGCCTTCCCACGTATGAATAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCTGCAATTGTAGAATCTGGTGCAGGTACTGGTTGGACAGTTTATCCACCATTATCAAGTGTACAAGCCCACTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCTTCATTATTAGGTGCAATTAATTTTATTTCAACTATATATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTGTATTAATTACAGCTTTTCTTTTATTATTAACATTACCTGTTTTAGCTGGTGCAATTACAATGTTATTAACAGATAGAAATTTAAATACTTCTTTTTATGATCCATCTGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_tentaculata TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGTGCGGCGAATTGTAGTCTATAGAAGCGTGGTCAGCGTGGGCACTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTTATGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTATGGCAGTGGCTTTTGGCTGCGCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCATGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTTGCCGTTCACACAAATTCCACGTGACCGTGGGTGCCCATCGCGAAAGTTTGGGGTCTGAGCTAGTAGTTATTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGACTTTCTTTCTTCCGTGTAGTCGGTGGAGGAGATGTCAGATATGAAGTGTCTTGCTTGTTTCCTGTGAGTCCTTTTAAAACTGTACTCTCTTTGCTCCAAAAGTGCATGTGGTTGTGGAGGCTGTTACGTGGCCAATTGGCGACTTTGTGCTGCGGCGTGGAAGAGTTGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGGTGTTTATCCTGCTGTGGCGGATGGCTGGTGAACCATAGCTCGGGACTTGGCCTTTGAATTTGCTTGCGAAGTAGAGTGGTTCGGTCGAGGGTCGATCCATTTGGGAATGTGTCTTTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCAGGTGTTGTGGGAACAACATTATCTCTTTTAATTAGGATGGAATTAGCACAACCAGGTAATCAAATTTTTATGGGAAATCATCAATTATATAATGTTGTTGTTACAGCACATGCTTTTATTATGGTGTTTTTTTTAGTTATGCCTGCGTTAATTGGTGGTTTCGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCTCGTATGAACAATATAAGTTTTTGGTTATTACCTCCAGCATTATTATTATTAGTTTCATCAGCTATTGTTGAATCAGGTGCTGGTACTGGTTGGACTGTTTATCCACCTTTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCCCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTATGGTCTATTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCTGGCGCAATTACTATGTTATTAACTGATAGAAACTTAAATACTTCTTTCTATGATCCATCAGGTGGGGGTGATCCTGTATTATATCAA Phytophthora_vignae TAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTGGCTCGTGCGTACGACCCGTGTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGTGGCTTTTGGCTGCGCGGTGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCTTTAACTTGTCGCCGTTCACACAAATTCCACGTGACCGTGGGCGCTCATCGCAATTGTTTGGGAACTAGATCATGAGCCTTTTTAAACCATACTGAAATACTGTGGGGACGAAAGTCTCTGCTTTTACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTCTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAGGTGTCTTGCGCGCTTCCTGCGAGTCCCTTGAGAACTGTACTCTCTTTGCTCGAAAAGTGCGTGTGGTTGTGGAGGCTGCCTGATGGCCAGTCGGCGACTTTGTGCTGCGGCGTGGAGGAGTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAGGCTTATTGGATGCTTTTCCTGCTGTGGCGTATGGCTGGTGAACCGTAGTTGTGAACTTGGCTTTTGAACGTGTTTGCGAAGTAGGGTGGTTCGGCCGAGGGTCGATCCATTTGGGAATTTGTCTGTGCAAATCATAAAGATATTGGAACTTTATATTTAATTTTTAGTGCTTTTGCTGGTATTGTTGGTACAACTTTATCACTTTTAATTAGAATGGAATTAGCACAACCTGGAAATCAAATTTTAATGGGAAATCATCAATTATATAATGTAGTTGTAACTGCACATGCTTTTATCATGGTTTTCTTTCTAGTTATGCCTGCATTAATTGGTGGTTTTGGTAATTGGTTTGTTCCTTTAATGATTGGTGCCCCTGATATGGCTTTTCCACGTATGAATAATATTAGTTTTTGGTTATTACCTCCAGCTTTATTATTATTAGTTTCATCAGCTATTATTGAATCTGGTGCTGGTACAGGTTGGACTGTTTATCCACCATTATCTAGTGTACAAGCACATTCAGGACCTTCAGTAGATTTAGCAATTTTTAGTTTACATTTAACAGGTATTTCATCATTATTAGGTGCTATTAATTTTATTTCAACTATTTATAATATGAGAGCTCCTGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGTCTGTTTTAATTACTGCATTTCTTTTATTATTAACTTTACCTGTATTAGCCGGTGCAATTACTATGTTATTAACTGATAGAAATTTAAACACCTCTTTTTATGATCCATCAGGTGGGGGAGATCCTGTATTATATCAA ; END; BEGIN SETS; CHARSET ITS (CHARACTERS = Japanese_Phytophthora_AICc4) = 707-1322; CHARSET LSU (CHARACTERS = Japanese_Phytophthora_AICc4) = 1-706; CHARSET COX1 (CHARACTERS = Japanese_Phytophthora_AICc4) = 1323-1994; END; BEGIN CODONS; CODONPOSSET * UNTITLED (CHARACTERS = Japanese_Phytophthora_AICc4) = N: 1-1322, 1: 1323-1992\3, 2: 1324-1993\3, 3: 1325-1994\3; END; BEGIN TREES; TITLE Japanese_Phytophthora_MP_Result; LINK TAXA = Taxa1; TRANSLATE 1 Phytophthora_drechsleri_CH96HE1, 2 Phytophthora_drechsleri_CH96HE2, 3 Phytophthora_citricola_CH97TUL2, 4 Phytophthora_megasperma_CH95PHG7, 5 Phytophthora_megasperma_CH04PHR12, 6 Phytophthora_megasperma_NBRC32176, 7 Phytophthora_megasperma_GF543, 8 Phytophthora_megasperma_Pm_1, 9 Phytophthora_megasperma_CH00MKR1, 10 Phytophthora_megasperma_CH00MKR2, 11 Phytophthora_megasperma_CH94PHR1, 12 Phytophthora_megasperma_CH95PHG8, 13 Phytophthora_megasperma_CH95PHR16, 14 Phytophthora_megasperma_CH95PHR17, 15 Phytophthora_megasperma_CH97PHR1, 16 Phytophthora_megasperma_NBRC31624, 17 Phytophthora_megasperma_P_B, 18 Phytophthora_megasperma_GF649, 19 Phytophthora_megasperma_CH02PHR1, 20 Phytophthora_megasperma_CH04PHR11, 21 Phytophthora_megasperma_CH95PHR10, 22 Phytophthora_megasperma_P_A, 23 Phytophthora_megasperma_GF433, 24 Phytophthora_species_APC001, 25 Phytophthora_species_GF468, 26 Phytophthora_species_GF534, 27 Phytophthora_species_MAFF235784, 28 Phytophthora_species_MAFF235786, 29 Phytophthora_species_MAFF235794, 30 Phytophthora_species_MAFF238158, 31 Phytophthora_species_MAFF235788, 32 Phytophthora_species_MAFF239556, 33 Phytophthora_species_Toku_1, 34 Phytophthora_megasperma_MAFF237500, 35 Phytophthora_sojae_NBRC31016, 36 Phytophthora_cactorum_NBRC32194, 37 Phytophthora_cactorum_MAFF235099, 38 Phytophthora_alni, 39 Phytophthora_arecae, 40 Phytophthora_asparagi, 41 Phytophthora_bisheria, 42 Phytophthora_boehmeriae, 43 Phytophthora_botryosa, 44 Phytophthora_brassicae, 45 Phytophthora_cactorum, 46 Phytophthora_cajani, 47 Phytophthora_cambivora, 48 Phytophthora_captiosa, 49 Phytophthora_capsici, 50 Phytophthora_chrysanthemi, 51 Phytophthora_cinnamomi, 52 Phytophthora_cinnamomi_var_parvispora, 53 Phytophthora_citrophthora, 54 Phytophthora_citricola, 55 Phytophthora_clandestina, 56 Phytophthora_colocasiae, 57 Phytophthora_cryptogea, 58 Phytophthora_cuyabensis, 59 Phytophthora_drechsleri, 60 Phytophthora_erythroseptica, 61 Phytophthora_europaea, 62 Phytophthora_fragariae, 63 Phytophthora_fallax, 64 Phytophthora_foliorum, 65 Phytophthora_glovera, 66 Phytophthora_gregata, 67 Phytophthora_gonapodyides, 68 Phytophthora_heveae, 69 Phytophthora_hedraiandra, 70 Phytophthora_humicola, 71 Phytophthora_hibernalis, 72 Phytophthora_idaei, 73 Phytophthora_ilicis, 74 Phytophthora_infestans, 75 Phytophthora_inflata, 76 Phytophthora_insolita, 77 Phytophthora_ipomoeae, 78 Phytophthora_inundata, 79 Phytophthora_iranica, 80 Phytophthora_katsurae, 81 Phytophthora_kernoviae, 82 Phytophthora_macrochlamydospora, 83 Phytophthora_meadii, 84 Phytophthora_medicaginis, 85 Phytophthora_megakarya, 86 Phytophthora_megasperma, 87 Phytophthora_melonis, 88 Phytophthora_mexicana, 89 Phytophthora_mirabilis, 90 Phytophthora_multivesiculata, 91 Phytophthora_nemorosa, 92 Phytophthora_nicotianae, 93 Phytophthora_niederhauserii, 94 Phytophthora_palmivora, 95 Phytophthora_phaseoli, 96 Phytophthora_pini, 97 Phytophthora_pistaciae, 98 Phytophthora_polonica, 99 Phytophthora_porri, 100 Phytophthora_primulae, 101 Phytophthora_pseudosyringae, 102 Phytophthora_pseudotsugae, 103 Phytophthora_quercina, 104 Phytophthora_quininea, 105 Phytophthora_ramorum, 106 Phytophthora_richardiae, 107 Phytophthora_rubi, 108 Phytophthora_sansomeana, 109 Phytophthora_sinensis, 110 Phytophthora_siskiyouensis, 111 Phytophthora_syringae, 112 Phytophthora_sojae, 113 Phytophthora_tentaculata, 114 Phytophthora_vignae, 115 Phytophthora_species_kelmania, 116 Halophytophthora_vesicula; TREE MajRule = [&R] (116:0.209063545,(((50:0.03096514,58:0.03567497):0.05645382,((76:0.03958739,98:0.04346211):0.06303526,((48:0.01308543,63:0.02169182):0.07990469,((42:0.03105776,81:0.04753836):0.05182838,(82:0.01046882,104:0.00299402):0.08858305):0.01102742):0.02232774):0.0100988):0.03478715,(((71:0.0550462,105:0.01739997):0.02465161,(64:0.02403318,(111:0.04971624,((32:0.00645638,(44:0.01711505,(99:0.03206778,100:0.01002877):0.02489259):0.00805915):0.06501703,(59:0.02093952,((84:0.02123686,((4:1.0E-8,12:1.0E-8):2.5897E-4,(16:1.0E-8,108:1.0E-8):0.00284029):0.00872157):0.00639458,((60:0.00154538,(57:7.6581E-4,106:0.00696192):7.4891E-4):0.01005561,(23:0.00223098,(7:1.0E-8,(18:1.0E-8,115:0.00152184):7.5839E-4):0.00237309):0.00256489):0.00932554):0.00471763):0.02030649):0.01039316):0.00897855):0.00227109):0.01173713,((((10:7.6988E-4,15:7.6988E-4):0.0,(5:1.0E-8,9:1.0E-8,11:1.0E-8,13:1.0E-8,14:1.0E-8,17:1.0E-8,19:1.0E-8,20:1.0E-8,21:1.0E-8,22:1.0E-8):0.00550345):0.05162903,(((51:0.02038244,52:0.01631436):0.01115239,(61:0.00710827,(62:0.00584854,(107:0.00682674,(38:0.0045901,47:0.00158595):9.3812E-4):0.00134729):0.00640647):0.01205609):0.00708293,((8:1.0E-8,112:1.0E-8):0.00494611,(33:0.00867034,97:0.01019292,((1:1.0E-8,2:1.0E-8,93:7.7075E-4):0.00659466,((46:8.6315E-4,114:0.00224802):0.0054113,(87:1.0E-8,109:1.0E-8):0.00602082):0.00865322):0.00293985):0.00269349):0.01574122):0.00628448):0.00891447,(((6:1.0E-8,34:1.0E-8):0.04947679,(40:0.02751231,((70:0.00856798,78:0.00660515):0.02061763,((3:0.00814964,66:0.01892279):0.01991372,(67:0.01900432,86:0.01889499):0.00624192):0.00692095):0.01820598):0.01567746):0.00670963,(((95:0.00247562,(77:0.00559967,(74:7.8223E-4,89:0.00156876):1.0E-8):6.7502E-4):0.04168544,((72:0.00978776,((45:0.00359918,102:0.00447226):0.00222273,(69:1.0E-8,(36:1.0E-8,37:1.0E-8):0.00236498):0.00239429):0.00245933):0.01397386,((113:0.01745528,(55:0.01076115,79:0.00577547):0.00843341):0.01900657,(27:0.00193491,(28:0.00497908,(25:1.0E-8,(29:1.0E-8,92:7.8433E-4):7.8254E-4):7.9337E-4):4.1817E-4):0.03206505):0.00875713):0.00573263):0.02054478,(((68:0.01208738,80:0.00779439):0.02059938,((103:0.03520711,(101:0.00753595,(73:0.00849287,91:0.0070695):0.00789197):0.02281056):0.00271014,(85:0.03853952,(26:1.0E-8,31:7.8959E-4,39:0.00158331,94:1.0E-8):0.0410118):0.01102228):0.00323883):0.00217512,(41:0.04034314,(90:0.03102093,((110:0.01529466,(65:0.00875866,(49:1.0E-8,(24:0.00155664,88:0.00157306):0.00274459):0.00289789):0.0113969):0.00273819,((35:0.01326076,(54:0.00284451,(75:0.00260108,96:0.00132097):0.0037326):0.00471501):0.0045603,((56:0.00455519,83:0.00929709):0.00492052,(30:0.00512718,(43:0.00532885,53:0.00773054):6.6835E-4):0.0):0.01328698):0.00288347):0.01072145):0.00495909):0.01217509):0.00411314):0.010949):0.00569618):0.00615386):0.02942565):0.209063545); END;