#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:01 GMT TreeBASE (cc) 1994-2008 Study reference: Meshram V., Kapoor N., & Saxena S. 2012. Muscodor strobelli, new species from South India. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13782] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=24; TAXLABELS Muscodor_albus_AF324336 Muscodor_albus_AY527045 Muscodor_albus_AY527046 Muscodor_albus_AY527048 Muscodor_albus_AY927993 Muscodor_cinnanomi_GQ848369 Muscodor_crispans_EU195297 Muscodor_fengyangensis_HM034852 Muscodor_fengyangensis_HM034853 Muscodor_fengyangensis_HM034856 Muscodor_sp._6610CMSTITBRT 'Muscodor sp. A3-5 AY034665' 'Muscodor sp. AB-2011 JN426991' 'Muscodor sp. SR-2011 JF938595' 'Muscodor sp. WG-2009a FJ664551' Muscodor_vitigenus_AY100022 Muscodor_yucatanensis_FJ917287 Trichoderma_harzianum_AY605713 fungal_endophyte_EU686979 fungal_endophyte_EU687035 fungal_endophyte_sp._P1813B_EU977197 fungal_endophyte_sp._P912B_EU977236 fungal_sp._ARIZ_B342_FJ612989 'fungal sp. ZH S13-1-2 GQ220337' ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15765] TITLE 6610CMSTITBRT_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=632; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Muscodor_albus_AF324336 CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_albus_AY527045 CGGAGGCTACCCTATAGG------GGA-TACCACATACTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGTCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_albus_AY527046 CGGAGGCTACCCTATAAG------GGA-TACCACATACTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_albus_AY527048 CGGAGGCTACCCTATAGG------GGA-TACCACACACTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_albus_AY927993 CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_cinnanomi_GQ848369 CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCC------------------------------------------------------------------------------- Muscodor_crispans_EU195297 CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_fengyangensis_HM034852 AAGGCGCTACCCTGTAGTTACCCTGTAGTCCCAGGGAGCTGTCATCAGCTCTTTAGGGGAGCCCACA---GCCTGGCGACGTTTTCGTTACAGGGCTGTAGCT-CCGGACTGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAACTCTGAA---------------TCATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGGGCCTACGGCACAGCCT------GTAGC--CCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTATCTCTAAGC-GTAGT------AATTTCTTCT---------CGCTTCTGCAGTAGTG------CTGGCCCCC------------------------------------------------------------------------------- Muscodor_fengyangensis_HM034853 AAGGCGCTACCCTGTAGTTACCCTGTAGTCCCAGGGAGCTGTCATCAGCTCTTTAGGGGAGCCCACA---GCCTAGCGACGTTTTCGTTACAGGGCTGTAGCT-CCGGACTGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAACTCTGAA---------------TCATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGGGCCTACGGCACAGCCT------GTAGC--CCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTATCTCTAAGC-GTAGT------AATTTCTTCT---------CGCTTCTGCAGTAGTG------CTGGCCCCC------------------------------------------------------------------------------- Muscodor_fengyangensis_HM034856 AAGGCGCTACCCTGTAGTTACCCTGTAGTCCCAGGGAGCTGTCATCAGCTCTTTAGGGGAGCTCACA---GCCTAGCGATGTTTTCGTTACAGGGCTGTAGCT-CCGGACTGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTCTGAAACTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGGGCCTACGGCACAGCCT------GTAGC--CCTTTAAAGTG-ATTGGCGGAGTTAGT----TCTATCTCTAAGC-GTAGT------AATTTCTTCT---------CGCTTCTGCAGTAGTG------CTGGCCCCC------------------------------------------------------------------------------- Muscodor_sp._6610CMSTITBRT GGGAGGCTACCCCATAGG------GGA-TACCACATAGTGGTTACCCGGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATGGTCTACGGG----CAGCTCCCCGG?GGCCCTCCCCGCCGGC-GGCCAACT--AAACTC?--------------------GTTTT-TATGGCATT?TGAA---------------TCATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCT?TTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAACGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTCC----T?AGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCTTAAAGTG-AT-GGCGGAGTTG-T----TCTCAC?TTAGGCCGGAGT------AAATC-ATCT---------?GCCTCTCTAATGGTT------CCGGCCCCC------------------------------------------------------------------------------- 'Muscodor sp. A3-5 AY034665' CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGATGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT-ACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- 'Muscodor sp. AB-2011 JN426991' CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- 'Muscodor sp. SR-2011 JF938595' CGGAGGCTACCCTGCGGG------AGAATACCACTTAGTGGTTACCCTGTAGTTTCAGGTAC------------------------------AT----CAGCTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TAACAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCTTGTTGC----TTAGCGTTGGGAGCCTACGGCACGGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AATTATATCT---------CGCTTCTGTAGTGGTC------CCGGCCCCT------------------------------------------------------------------------------- 'Muscodor sp. WG-2009a FJ664551' CGGAGGCTACCCTGCGGG------GGATTACCACCTAGTGGTTACCCTGCAGTCTCAGGTAC------------------------------AT----CTGTTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TCATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCATAGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AACTATATCT---------CGCTTCTGTAGTAGTT------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_vitigenus_AY100022 CGGAGGCTACCCTGCGGG------AGAATACCACTTAGTGGTTACCCTGTAGTTTCAGGTAC------------------------------AT----CAGCTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TAACAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCTTGTTGC----TTAGCGTTGGGAGCCTACGGCACGGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AATTATATCT---------CGCTTCTGTAGTGGTC------CCGGCCCCT------------------------------------------------------------------------------- Muscodor_yucatanensis_FJ917287 CGGAGGCTACCCTGCGGG------GGATTACCACCTAGTGGTTACCCTGCAGTCTCAGGTAC------------------------------AT----CTGTTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TCATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCATAGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AACTATATCT---------CGCTTCTGTAGTAGTT------CCGGCCCCT------------------------------------------------------------------------------- Trichoderma_harzianum_AY605713 --TTTACAACTCCCAAAC-----------CCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGAT----CTCTGCCCCGGGTGCGTCG--------CAGCC-CCGGACCAAGGCGCCCGCCGG{AG}{AG}GACCAACCTAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA{AG}AACGCAGCGAAATGCGATAAGTAATGTGAATTGCA{AG}AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATC---GGCCCTCCCTTAGCGGGTGGCCGTCTCCGAAATACAG{GT}GGCGGTCTCGCCGCAGCCTCTC-CTGCGCAGTAGTTTGC{AC}CACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACC{CT}CGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA{CT}A{AG}AAA{GT}{AT}CCAA{AC}CA fungal_endophyte_EU686979 CGGAGGCTACCCTGCGGG------AGAATACCACTTAGTGGTTACCCTGTAGTTTCAGGTAC------------------------------AT----CAGCTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TAACAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCTTGTTGC----TTAGCGTTGGGAGCCTACGGCACGGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AATTATATCT---------CGCTTCTGTAGTGGTC------CCGGCCCCT------------------------------------------------------------------------------- fungal_endophyte_EU687035 CGGAGGCTACCCTGCGGG------GGATTACCACCTAGTGGTTACCCTGCAGTCTCAGGTAC------------------------------AT----CTGTTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TCATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCATAGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AACTATATCT---------CGCTTCTGTAGTAGTT------CCGGCCCCT------------------------------------------------------------------------------- fungal_endophyte_sp._P1813B_EU977197 CGGAGGCTACCCTGCGGG------AGAATACCACTTAGTGGTTACCCTGTAGTTTCAGGTAC------------------------------AT----CAGCTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TAACAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCTTGTTGC----TTAGCGTTGGGAGCCTACGGCACGGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AATTATATCT---------CGCTTCTGTAGTGGTC------CCGGCCCCT------------------------------------------------------------------------------- fungal_endophyte_sp._P912B_EU977236 CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- fungal_sp._ARIZ_B342_FJ612989 CGGAGGCTACCCTGCGGG------AGAATACCACTTAGTGGTTACCCTGTAGTTTCAGGTAC------------------------------AT----CAGCTACCCGGTAGTCATCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTTCTTTGGAATTCTGAA---------------TAACAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCTTGTTGC----TTAGCGTTGGGAGCCTACGGCACGGCCC------GTAGC--TCCTTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAAGC-GTAGT------AATTATATCT---------CGCTTCTGTAGTGGTC------CCGGCCCCT------------------------------------------------------------------------------- 'fungal sp. ZH S13-1-2 GQ220337' CGGAGGCTACCCTATAGG------GGA-TACCACATAGTGGTTACCCTGTAGTCCCAGGTGCTAGATCGTGCTCAACGTCTTATCGTCTACGAC----TAGCTACCCGGTGGCCCTCCCCGCCGGC-GGCCAACT--AAACTCT--------------------GTTTT-TATGGCATTCTGAA---------------TTATAAACTT------AATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGCATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCACCACTTAAGCCCTGTTGC----TTAGCGTTGGGAGCCTACGGCACTGCCC------GTAGC--TCCCTAAAGTG-ATTGGCGGAGTTGGT----TCTCACTCTAGGC-GTAGT------AAATCTATCT---------CGCCTCTGTAGTGGTT------CCGGCCCCT------------------------------------------------------------------------------- ; END; BEGIN TREES; TITLE 6610cmstitbrt_its; LINK TAXA = Taxa1; TRANSLATE 1 Muscodor_sp._6610CMSTITBRT, 2 Muscodor_albus_AF324336, 3 'Muscodor sp. A3-5 AY034665', 4 Muscodor_vitigenus_AY100022, 5 Muscodor_albus_AY527045, 6 Muscodor_albus_AY527046, 7 Muscodor_albus_AY527048, 8 Trichoderma_harzianum_AY605713, 9 Muscodor_albus_AY927993, 10 Muscodor_crispans_EU195297, 11 fungal_endophyte_EU686979, 12 fungal_endophyte_EU687035, 13 fungal_endophyte_sp._P1813B_EU977197, 14 fungal_endophyte_sp._P912B_EU977236, 15 fungal_sp._ARIZ_B342_FJ612989, 16 'Muscodor sp. WG-2009a FJ664551', 17 Muscodor_yucatanensis_FJ917287, 18 'fungal sp. ZH S13-1-2 GQ220337', 19 Muscodor_cinnanomi_GQ848369, 20 Muscodor_fengyangensis_HM034852, 21 Muscodor_fengyangensis_HM034853, 22 Muscodor_fengyangensis_HM034856, 23 'Muscodor sp. SR-2011 JF938595', 24 'Muscodor sp. AB-2011 JN426991'; TREE tree1 = [&R] (8:0.163978155,((22:0.01244509,(20:0.00195103,21:2.0044E-4):0.00289345):0.07908742,(((12:0.0,(16:0.0,17:0.0):0.0):0.01799495,(4:0.0,(11:0.0,(13:0.0,(15:0.0,23:0.0):0.0):0.0):0.0):0.01815843):0.00286431,(1:0.02836626,(19:9.3828E-4,((6:0.00213726,(5:0.00221396,7:0.00217588):5.766E-5):0.00214396,(2:-1.72E-6,(9:-1.72E-6,(10:-2.29E-6,(14:-3.44E-6,(18:-5.5E-6,(3:0.00220312,24:-9.17E-6):5.5E-6):3.44E-6):2.29E-6):1.72E-6):1.72E-6):3.36E-5):0.0012189):0.00950961):0.03132331):0.04586876):0.163978155); END;