#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:06 GMT TreeBASE (cc) 1994-2008 Study reference: Costea M., Garcia I., Docksteder K., & Stefanovic S. 2013. More problems despite bigger flowers: systematics of Cuscuta tinctoria clade (subgenus Grammica, Convolvulaceae) with description of six new species. Systematic Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13806] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=60; TAXLABELS Cuscuta_americana_698 Cuscuta_applanata_535 Cuscuta_aurea_1023 Cuscuta_aurea_506 Cuscuta_aurea_562 Cuscuta_aurea_799 Cuscuta_aurea_800 Cuscuta_cotijana_1140 Cuscuta_cotijana_1225 Cuscuta_floribunda_1009 Cuscuta_floribunda_1010 Cuscuta_floribunda_489 Cuscuta_haughtii_601 Cuscuta_insolita_802_802b Cuscuta_jalapensis_518 Cuscuta_jalapensis_606 Cuscuta_jalapensis_607 Cuscuta_jalapensis_617 Cuscuta_kellermania_1297 Cuscuta_kellermania_1298 Cuscuta_kellermania_852 Cuscuta_kellermania_absconsa_978_978b Cuscuta_kellermania_montana_1299 Cuscuta_kellermania_montana_581 Cuscuta_lindsayi_1302 Cuscuta_lindsayi_927 Cuscuta_mitriformis_556 Cuscuta_mitriformis_584 Cuscuta_mitriformis_815 Cuscuta_purpusii_1013 Cuscuta_purpusii_1025 Cuscuta_purpusii_898 Cuscuta_purpusii_928 Cuscuta_rugosiceps_517 Cuscuta_rugosiceps_745 Cuscuta_rugosiceps_915 Cuscuta_saurocalyx_1303 Cuscuta_saurocalyx_765 Cuscuta_tasmanica_680 Cuscuta_tasmanica_681 Cuscuta_tasmanica_682 Cuscuta_tinctoria_1226 Cuscuta_tinctoria_573 Cuscuta_tinctoria_574 Cuscuta_tinctoria_766 Cuscuta_tinctoria_798 Cuscuta_victoriana_678 Cuscuta_victoriana_683 Cuscuta_victoriana_684 Cuscuta_victoriana_685 Cuscuta_volcanica_1007 Cuscuta_volcanica_1044 Cuscuta_volcanica_1152 Cuscuta_volcanica_1153 Cuscuta_volcanica_1154 Cuscuta_volcanica_1208 Cuscuta_volcanica_560 Cuscuta_volcanica_595 Cuscuta_woodsonii_729 Cuscuta_woodsonii_916 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15748] TITLE 'Cuscuta tinctoria combined ITS and trnL-F'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1244; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Cuscuta_americana_698 ----------TTGTATTGAGCCTTGGTATGGAAACTTACTATGTGATCACTTTCAAACTCAGAGAAACCCTGGAATGAATACAATGGGCAATCCTGAGCCAAATCCTTATTT------ATAAATTT----------AGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCTATG-------CAAAA-AAAGAATCTGATAGATCTTT-TTACCACACCCCAAGCTGATTAGAGAATAAAGAGAGAGTCCATTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTGAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAGCCTAACAAA--------------------------------------------------------------------------------------------------------------------CAATTTATAATTAGA-----------------ATCTATAGTGGGAGA-----T-GGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCG---------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGACTCCTT--GTGGTAGAATGACTCGTTAACTTG-TACCAAAACAAGATTCTAGTGTTGGGGAGATC-TTTTGGATTTGGCCCTCACGAACAAAAACACCGGCGCAGCAGTGCCAAGGAATTTC-GT-AATGAGAATGCTAC-CTTGTGGAGCTCACCTTTACT-GCTTGTGAGGTTGGCGTCTTTTT---AATGGAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTTAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATTTATTAT-GTCTTCCCTTTCGTGTGTTTGAGTGGGAGTGGATCATGGCCTCCTGGGCCCGTCC--TTGGGCGCGGTTGGCAGAAAATATTGTCCCTGATGTTATTGATGTCTAGGCGTGCGGTGGATGTACCAAGTGTGCGT---AATGGCCGGCCTTGGTTGACCTCATTGTGGCGTTG---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAG--------------- Cuscuta_applanata_535 -----------TGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAATACAAAGGGCAATCCTGAGCCAAATCCTTCTT-------ATACTCTT----------ATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATG-------CAAAA-AGAGAGTCTGATAGATCTTT-TTACCAAA-------CTGATTCGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTGAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAACGCCTAAAAAA--------------------------------------------------------------------------------------------------------------------TAATTTAGAATTAAA----------ATAAAAAATATGCAATAGGAGA-----TGGGTCGGGATAGCTCAGTGGGTAAAGCAAAGGACTGA--------------------------------------GAAGGATCATTGTCGAAACCTT--GTGGCAGAATGACTTGTTAACTTG-TACCAATTCAAGATTCTAGTGTCGGGGCCATC-TTTCGGGTCTGGCCACGACGAACAAAAACACCGGCGCAGCAGCGCCAAGGAATTTC-GTAAATGAGAATGCTAC-CTCGCAGAGCTCATCTCCACT-GCTTGTGAGGTTGGCGTCTTTTT---TATAATAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAAACTTTGAACGCAAGTTGCGCCTTAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATAAT-GTCTTCCCTCCCGTGTTTTGGGTTGGGAGTGGATCGTGGCCTCCTGGGCCCATCC--TTGGGTGTGGTTGGCCGAAAATATTGTCCGTGATTTTGTTGATGTCTTGGCGTGCGGTGGATGTACAGAGTGTGCAT---AATGGCTTGCCCTGCTCGACTTCATTGTGGCGTTG---AGATCCTTTGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACTACCCGCT Cuscuta_aurea_1023 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------CCTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA----------TACAATA--------GAATTTATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTC----------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACTACCCGCT Cuscuta_aurea_506 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------CCTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA----------TACAATA--------GAATTTATAATTAGA-----------------ATCTGC----------------------------------------------------------------------------------------CGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCAAAGTCAGGCGAGAC-------- Cuscuta_aurea_562 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------CCTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA----------TACAATA--------GAATTTATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC-----CCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGA----------- Cuscuta_aurea_799 ------------GGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------CCTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA----------TACAATA--------GAATTTATAATTAGA-----------------ATCTGCCATAGGAAAGGAACTAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cuscuta_aurea_800 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------CCTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA----------TACAATA--------GAATTTATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTC----------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACG?AGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACTACCCGCT Cuscuta_cotijana_1140 --------------ATTGAGCCTTGTTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT---------TATAAAAGAAATAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAATCTGATAGATCTTT-TTACCGAA-------CTAATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAATTATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTCCCTTCAATA-------------------------GAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCA-------------------------------------------TGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGTGCCAAGGAATTTC-GT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTCGCTTGTGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGCTTGCTTGGGTGTCACGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCTTATTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGAATTT-TTGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGTGTTGGCTCTTCGATTGCGACCCCAAGTCAGGC------------- Cuscuta_cotijana_1225 -------------GATTGAGCCTTGTTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT---------TATAAAAGAAATAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAGTCTGATAGATCTTT-TTACCGAA-------CTAATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAATTATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTCCCTTCAATA-------------------------GAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCG---------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGTGCCAAGGAATTTC-GT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTCGCTTGTGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGCTTGCTTGGGTGTCACGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCTTATTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGAATTT-TTGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGTGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_floribunda_1009 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAAT----------------------------------------------------------------AATAGGAAAGGAAATAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC-----------------------------------TCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGCGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTG----------------------------- Cuscuta_floribunda_1010 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAAT----------------------------------------------------------------AATAGGAAAGGAAATAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC------CCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATATAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGAT?AAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGCGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAA-------------------- Cuscuta_floribunda_489 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAAT----------------------------------------------------------------AATAGGAAAGGAAATAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cuscuta_haughtii_601 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAGTACAAAGGGCAATCCTGAGCCAAATCCTTTTT-------ATAATTTTATAAAAAAAAATAAAAAA---AAGGA-----TAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATG-------CAAAATAAAGAATCTAATATATCTTTGTTACCAAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCGACATGTCCAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTAAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAGCCTAAAAAA-AAAA----------------------------------------------------------------------------------------------------------------------TAATTAGA-----------------ATCTACAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCAC----------------------GGAAGGATCATTGTCGAA-GCTC--ATGGCAGAATGAATTGTTAACATG-TACCCATGCAAGATTCAAGCGTCGGGACCGTC-TCTTCGATGTGGCCTTGACGAACCGAAACACTAGCGCAGCAGCGCCAAGGAATTTG-GT-AATGGGAATGCTAC-CTCGTAGAGCTGTCTTATACT-GCTTTTGAGGTTGGCATCTGTGT---AATAAAAATGACTCTTGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGTGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTCTGCTTGGGTGTCATGCAATAT-GTCTTCCCTCTCGTGTCTCGGAGTGGGATTAGATCATGGCCTCCCGGGCCCGTCC--TTGGGTGTGGTTGGCCGAAAGTGTTGTCCTTGATTTTGTTCACGTCTTGGCGTGTGGTGGATGTATCGAGTGTGCATGATAATGGCCTGCCTTGCTCGACTTCATTGTGGCCTTT--GAGATCCTATGAAGCTGTATCTGTTGGCTCCTTTACTGCGACCC----------------------- Cuscuta_insolita_802_802b -------------GATTGAGCCTTGGTATGGAGACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTAA-------------------------------------GGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA----CAACAAAA-AGGAAGTCTGATATATCTTT-TTACCGAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTACATGGTTC-AA--------CGTCTTTTTTTAACTTGCAATCCCCTT-TTGTT-GGTTTCATTTCCCTTCAATA-------------------------TAATTTATAATTATA-----------------ATCTGCAATAGCAAA-----TAGGTCGGGATAGCTCAGCCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCA-----CGTAGGTGAACCTGCGGAAGGATCATTGTCGTACCCTT--TTGGCAGAATGACTTGTTAACTTG-TACAAATACAAGATCCTAGTGTTGGGGCCATCTTTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTGTACTGGCGTGTGAGGTTGGCATCCTTT----TTAGAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGAACATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTCATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCTAGACTTGGTCGACTTCACTGTGGCATTT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACCACCCGC- Cuscuta_jalapensis_518 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAGTCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-------------------------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTC----------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--TCGGTAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-CT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTCGCTTGCGAGGTTGGCATCCTTTT---TTTAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTATTGACTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTCGATGATGTCCTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGACTTTCTCGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_jalapensis_606 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACGTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAGTCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTTATTATT-GGTTTCATTTTCCTTCAATA-------------------------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTA---------------------------------------------------------------GTCGTAACCTT--TCGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGTGCCAAGGAATTTC-GT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTCGCTTGCGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCAAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTATTGAATTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTCGCTGATGTCTTGGCCTCCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGACTTTCTCGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCATGCGAGACCACCCGCT Cuscuta_jalapensis_607 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAATCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-------------------------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTA-------------------------------------------------------GGATCATTGTCGTAACCTT--TCGGTAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-CC-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTCGCTTGCGAGGTTGGCATCCTTTTT--TTTAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAAAACGTACCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTATTGACTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTCGATGATGTCTTGGCCTTTGGTGGATGTACCAAGTGTGCAT---AATGGCCAGACTTTCTCGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCATGCGAGACCACCCGCT Cuscuta_jalapensis_617 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAGTCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA----------TTCAATA--------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCAATTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--TCGGTAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-CT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACATGCTTGCGAGGTTGGCATCCTTTT---TTTAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cuscuta_kellermania_1297 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATAAAAAA-AGGAAATCTGATATATCGTT-TTACCAAAAAA----CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAAAGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-CGTTTTATTTTCCTTTAATT-----------TTAATATAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCA-TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTTT-AAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGTAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTGGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGCACCATTTGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_kellermania_1298 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCGTAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTTT-TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATTTGTGCAC---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_kellermania_852 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATAAAAAA-AGGAAATCTGATATATCGTT-TTACCAAAAAA----CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAAAAAACTCTCTGCTTGGTGCGCGGTTA-AAAAGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCC-------------------------------GGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTT{CT}-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTTT-AAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATTTGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGG-------------- Cuscuta_kellermania_absconsa_978_978b -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCT----------CT--------GGTGCGCGGTTA-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-CGTTTTATTTTCCTTCAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC------------------------------ATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTTT-AAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATTTGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGAC-------- Cuscuta_kellermania_montana_1299 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-AGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAGCCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTCATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cuscuta_kellermania_montana_581 -----------------------TGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-AGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAGCCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC------------------TGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCACAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTTT-AAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATACTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGCGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGG-------------- Cuscuta_lindsayi_1302 -----------------GAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAAACAATGGGCAATCCTGAGCCAAATCCCTTTT-------------------------ATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCA-----------------GAGAGTCTGATATATCTTT-TTACCAAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCGGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-CTACTCTCTGCTTGGTGCATGGTTCCAAATGGGGAACGTCTTTTTTTAACTTGTAATCCCCTT-TTATG-GGTTTCATTTCCCTTCAATA-------------------------TAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC--TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCGGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTT-GT-AATGAGAATGCTGCCCTCGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCACTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCCTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTACTGATGTCATGGCCTGCGGTGGATGTACCAAGTGTGCAC---GATGGCCAGACTTGCTCGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_lindsayi_927 --------------------CCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCCTTTT-------------------------ATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCGGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCTTAACAAA-CTACTCTCTGCTTGGTGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTGTAATCCCCTT-TTATG-GATTTCATTTCCCTTCAATA-------------------------TAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGG---------------------------------------------------GCGGAAGGATCATTGTCGTAACCTT--CTGGCGGAATGACTTGTTAACTTGGTACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-GT-AAAGAGAATGCTGCCCTCGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCACTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCCTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTACTGATGTCATGGCCTGCGGTGGATGTACCAAGTGTGCAT---GATGGCCAGACTTGCTCGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCA---------------- Cuscuta_mitriformis_556 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------CTTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------AAAAA-AGAAAGTCTGATATATATTT-TTACCGAA-------CTTATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTCCCTTCAATA-------------------------TAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCAA---------TGGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-AT-AATGAGAATGCCGC-CTCTCATAGCTCATTTGTACTCGCTTGTGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGCTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTATTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGACTTT-TTGACTTCATTGTGGCTTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACAC------ Cuscuta_mitriformis_584 -CGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------CTTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------AAAAA-AGAAAGTCTGATATATCTTT-TTACCGAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAACGAGGAACGT---------CCTTGCAATCCCCTT-TTATT-AGTTTCATTTCCCTTCAATA-------------------------TAATTTATAATTAGA-----------------ATC--------AAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTG----------CCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCACC-TTTTTTATTTGGCAACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTGTACTCGCTTGTGAGGTTGGCATCCTTTTTA-GAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGCTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGC{CT}TCCTGGGCCCATCCTATTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGACTTT-TTGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACAACCCGCT Cuscuta_mitriformis_815 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-AT-AATGAGAATGCCGC-CTCTCATAGCTCATTTGTACTCGCTTGTGAGGTTGGCATCCTTTT---TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGCTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTATTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAGACTTT-TTGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_purpusii_1013 -------------------------------------ACCAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------ATAAAAAAACTAAGGAGAGGAGAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCTGATATATCTTT-TTCCCAAA-------CTAATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-ATACTCTCTGCTTGGTGCGTGGTTC-AAATGGGAAACATCTTTTTTTAACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-----------------TAATT-TT-AATTTA---------------------------------------------TAGGTCGGGATAGCTCAGTTGGTAGAGCAGA--------------------------------------------GGAAGGATCATTGTCGTAACCTT--CTGGCTGAATGACTTGTTAACTTG-TAC-AATACAAGATTC-AGTGTTGGGGCCATC-TTTTCTATTTGGCCACAATGAACAAAAACACAGGCGCCGAAGCGCCAAGGAATTTT-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTCTAGTTGCTTGTGAGGTTGGCATCTTCTTT--TTAAAAA-TGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGGTTGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCTGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_purpusii_1025 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------ATAAAAAAACTAAGGAGAGGAGAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCTGATATATCTTT-TTCCCAAA-------CTAATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-ATACTCTCTGCTTGGTGCGTGGTTC-AAATGGGAAACATCTTTTTTTAACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-----------------TAATT-TT-AATTTA---------------------------------------------TAGGTCGGGATAGCTCAGTTGGTACAGCAGAGGACTGAA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cuscuta_purpusii_898 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------ATAAAAAAACTAAGGAGAGGAGAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCTGATATATCTTT-TTCCCAAA-------CTAATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-ATACTCTCTGCTTGGTGCGTGGTTC-AAATGGGAAACATCTTTTTTTAACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-----------------TAATT-TT-AATTTA---------------------------------------------TAGGTCGGGATAGCTCA?TTGGTAGAGCAGAGGACTGAAAAT-------------------------------GCGGAAGGATCATTGTCGTAACCTT--CTGGCTGAATGACTTGTTAACTTG-TAC-AATACAAGATTC-AGTGTTGGGGCCATC-TTTTCTATTTGGCCACAATGAACAAAAACACAGGCGCCGAAGCGCCAAGGAATTTT-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTCTAGTTGCTTGTGAGGTTGGCATCTTCTTT--TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGGTTGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCTGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGG-------------- Cuscuta_purpusii_928 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------ATAAAAAAACTAAGGAGAGGAGAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCTGATATATCTTT-TTCCCAAA-------CTAATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-ATACTCTCTGCTTGGTGCGTGGTTC-AAATGGGAAACATCTTTTTTTAACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA------------------------T-AATTTA---------------------------------------------TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTCGTG-------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCTGAATGACTTGTTAACTTG-TAC-AATACAAGATTC-AGTGTTGGGGCCATC-TTTTCTATTTGGCCACAATGAACAAAAACACAGGCGCCGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCATTTCTAGTTGCTTGTGAGGTTGGCATCTTCTTT--TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGGTTGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCTGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGGCCAGACTTGCTCGACTTCATTGTGGCGTGT--AAGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_rugosiceps_517 ----------------TGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAATCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-------------------------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTC------------------------------------TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--TCGGTAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-CT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTTGCTTGCGAGGTTGGCATCCTTTT---TTTAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTATTGACTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTCGATGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAAACTTTCTCGAATTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_rugosiceps_745 ----------------TGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAATCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-------------------------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTC------------------------------GAAGGATCATTGTCGTAACCTT--TCGGTAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-CT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTTGCTTGCGAGGTTGGCATCCTTTT---TTTAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTATTGACTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTCGATGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAAACTTTCTCGACTTCTTTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGAGCACCCGCT Cuscuta_rugosiceps_915 -----CTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ATTTTTTT----------ATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGAAAATCTCATAGATCTTT-TTACCGAA-------CTCATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAGGGCCTAACAAA-----------CTTGGTGCATGGTTC-AAATGAGGAACGT---------ACTTGCAATCCCCTT-TTATT-GGTTTCATTTTCCTTCAATA-------------------------TAATTTCTAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCT-------------------GGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--TCGGTAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACGACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-CT-AATGAGAATGCCGC-CTCGCATAGCTCATTTGTACTTGCTTGCGAGGTTGGCATCCTTTT---TTTAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTATTGACTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTCGATGATGTCTTGGCCTTCGGTGGATGTACCAAGTGTGCAT---AATGGCCAAAATTTCTCGACTTCATTGTGGCGTTT---AGATCCTATGAAGCTGACGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACCACCCGCT Cuscuta_saurocalyx_1303 --------------------CCTTGGTATGGAGACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTAA-------------------------------------GGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA----CAACAAAA-AGGAAGTCTGATATATCTTT-TTACCGAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTACATGGTTC-AA--------CGTCTTTTTTTAACTTGCAATCCCCTT-TTGTT-GGTTTCATTTCCCTTCAATA-------------------------TAATTTATAATTATA-----------------ATCTGCAATAGCAAA-----TAGGTCGGGATAGCTCAGCCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCA-TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTACCCTT--TTGGCAGAATGACTTGTTAACCTG-TACAAATACAAGATCCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGACTGCTGC-CTCGCATGGCTCATTTGTACTAGCTTGTGAGGTTGGCATCCTTT----TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGAACATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTCCGGTGGATGTACCAAGTGTGCAT---AATGGCTAGACTTGCTCGACTTCATTGTGGCATTT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGACCACCCGGT Cuscuta_saurocalyx_765 -------------GATTGAGCCTTGGTATGGAGACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTAA-------------------------------------GGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGAAGTCTGATATATCTTT-TTACCGAA-------CTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-----------CTTGGTGCATGGTTC-AA--------CGTCTTTTTTTAACTTGCAATCCCCTT-TTGTT-GGTTTCATTTCCCTTCAATA-------------------------TAATTTATAATTATA-----------------ATCTGCAATAGCAAA-----TAGGTCGGGATAGCTCAGCCGGTAGAGCAGAGGACTGAAAATC---------------TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTACCCTT--TTGGCAGAATGACTTGTTAACCTG-TACAAATACAAGATCCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAACGAACAAAAACACCGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATGGCTCATTTGTACTAGCTTGTGAGGTTGGCATCCTTT----TTAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGAACATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTCCGGTGGATGTACCAAGTGTGCAT---AATGGCTAGACTTGCTCGACTTCATTGTGGCATTT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTCGATTGCGACCCCAAGTCAGGCG------------ Cuscuta_tasmanica_680 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAAGGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTAATATTTTATAATTTTATAAAAAATTATAAAAAAACGAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA------TTGGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCTAAAGGCCTAACAAA-CTACTCTCTGCTTGATGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTACAATCCCCTT-TTAT-CGGTTTCATTTCCCTTCAATA-------------------------GACTTTATAATTAGA---------TAATTAGAATCTTTAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAA----------------------------------------------------TAACCTTCTCTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGAGTTGGGGCCATC-TCTTTAATTTGACCACAACGAACAAAAACAACGGCGCAGAAGCGCCAAGGAATTTT-GTAAATGAGAATGCTGC-CTCGCAGAGCTCATTTCTACGTGCTCGTGAGGTTGGCGTCATTTTAA-AAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCGTCTCTTGTGTTGGACTGGTAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTAGATTTCGTTGAAGTCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AGTGGCCAGACTCTCTCGACTTC--------------------------------------------------------------------------------- Cuscuta_tasmanica_681 -----CTTAATCGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAAGGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTAATATTTTATAATTTTATAAAAAATTATAA{AC}AAAACGAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA------TTGGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCTAAAGGCCTAACAAA-CTACTCTCTGCTTGATGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTACAATCCCCTT-TTAT-CGGTTTCATTTCCCTTCAATA-------------------------GACTTTATAATTAGA---------TAATTAGAATCTTTAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCA--------------------------------GTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTTCTCTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGAGTTGGGGCCATC-TCTTTAATTTGACCACAACGAACAAAAACAACGGCGCAGAAGCGCCAAGGAATTTT-GTAAATGAGAATGCTGC-CTCGCAGAGCTCATTTCTACGTGCTCGTGAGGTTGGCGTCATTTTAA-AAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCGTCTCTTGTGTTGGACTGGTAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTAGATTTCGTTGAA?TCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AGTGGCCAGACTCTCTCGACTTCACTGTGGCGTTTATTAGATCCTATGAAGCCGCCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACC------- Cuscuta_tasmanica_682 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAAGGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTAATATTTTATAATTTTATAAAAAATTATAAAAAAACGAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA------TTGGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCTAAAGGCCTAACAAA-CTACTCTCTGCTTGATGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTACAATCCCCTT-TTATTCGGTTTCATTTCCCTTCAATA-------------------------GACTTTATAATTAGA---------TAATTAGAATCTTTAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAAT--------------------------------------GATCATTGTCGTAACCTTCTCTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGAGTTGGGGCCATC-TCTTTAATTTGACCACAACGAACAAAAACAACGGCGCAGAAGCGCCAAGGAATTTT-GTAAATGAGAATGCTGC-CTCGCAGAGCTCATTTCTACGTGCTCGTGAGGTTGGCGTCATTTAAAAAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCGTCTCTTGTGTTGGACTGGTAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTAGATTTCGTTGAAGTCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AGTGGCCAGACTCTCTCGACTTCACTGTGGCGTTTATTAGATCCTATGAAGCCGCCGGCGTTGGCTCTTTGATTGCGACCCCAAGTC----------------- Cuscuta_tinctoria_1226 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGGAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA---TTCAATATAAAATA--------GAATTGATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAAGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCTGTTCACCAATTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATA{CT}AAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGG-------------- Cuscuta_tinctoria_573 -CGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGGAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA---TTCAATATAAAATA--------GAATTGATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAAGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTG-----------------------TGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATATAAGATTCTAGTGTTGGGGCCATC-CTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTT-AAAAGATAGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGTGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGACTACCCGCT Cuscuta_tinctoria_574 -CGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGGAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA---TTCAATATAAAATA--------GAATTGATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAAGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAA-----------------TTTCCGTAGGTGAAC?TGCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATA{CT}AAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACG?AGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGA----------- Cuscuta_tinctoria_766 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGGAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA---TTCAATATAAAATA--------GAATTGATAATTAGA-----------------ATCTGCAATAGGAAAGGAAATAAGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCA------------------GCGGAAGGATCATTGTCGTAACCTT--CTGGCCGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCTGAAGCGCCAAGGAATTTTTGG-AATGAGAATGCTGC-CTTGCATAGCTCATTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATTGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTTGATTGGGAAGAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGTCTGCGGTGGATGTACCATGTGTGCAT---AATGTCCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGTGTTGGCTCTTTGATTGCGACCC----------------------- Cuscuta_tinctoria_798 ACGGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------------------------CGAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAGA-AGGGAGTCT-----------------------------TATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGGAATGAAATTTTCAGTAAGAAGAAAATCCGTCGATTTTAAAAATCATGAGGGTTCAAGTCCCTCTATCCCCAAAGAATT---------ACTCTCTGCTTGG----------------GGGAACAGCTTTTTTTAACTTGCAATCCCCTT----------TTCTTGTTCCTTCAATA---TTCAATATAAAATA--------GAATTGATAATTAGA-----------------ATCTGCAATACGAAAGGAAATAAGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cuscuta_victoriana_678 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ACAATTTT---------TATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATAT----------AAA------TCTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-CTACTCTCTGCTTGGTGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTT-TTATT-GATTTCATTTCCCTTCAATA-------------------------TAATTTATAATTATA-----------------ATCTGTAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCT----------------------GAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGTCATC-TTCTTTATTTGACCACAACGAACAAAAA-ACCGGCGCAGAAGCGCCAAGGAATTTT-GT-AATTAGAATGCTGC-CTCGCGTAGCTCGTTTCTACTTGCTTGTGAGGTTGGCGCCTTTTTC--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGACAGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATGTTGTCCTTGATTTTGTTGATGTCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AACGGCCAGACTTGCTCGACTTCACTGTGGCGTTT---GGATCCTACGAAGCCGTCGGCGTCGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGAACA------ Cuscuta_victoriana_683 ---------ATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ACAATTTT---------TATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATAT----------AAA------TCTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-CTACTCTCTGCTTGGTGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTT-TTATT-GATTTCATTTCCCTTCAATA-------------------------TAATTTATAATTAGA-----------------ATCTGTAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCC-------------------------ACCTGCGGAAGGATCATTGTCGTAACCTT--CTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGTCATC-TTCTTTATTTGACCACAACGAACAAAAA-ACCGGCGCAGAAGCGCCAAGGAATTTT-GT-AATTAGAATGCTGC-CTCGCGTAGCTCGTTTCTACTTGCTTGTGAGGTTGGCGCCTTTTTC--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGACAGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATGTTGTCCTTGATTTTGTTGATGTCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AACGGCCAGACTTGCTCGACTTCACTGTGGCGTTT---GGATCCTACGAAGCCGTCGGCGTCGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGA--------- Cuscuta_victoriana_684 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ACAATTTT---------TATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA------TCTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-CTACTCTCTGCTTGGTGCATGGTTC-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTT-TTATT-GGTTTCATTTCCCTTCAATC-------------------------TCATTTATAATTAGA-----------------ATCTGTAATAGGAAA-----TAGGTCGGGATAGCTCAGT-------------------------------------------------AACCTGCGGAAGGATCATTGTCGTAACCTT--CTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGTCATC-TCCTTTATTTGACCACGACGAACAAAAA-ACCGGCGCAGAAGCGCCAAGGAATTTT-GT-AATTAGAATGCTGC-CTCGCGTAGCTCGTTTCTACTTGCTTGTGAGGTTGGCGCCTTCTTC--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGACAGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATGTTGTCCTCGATTTTGTTGATGTCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AACGGCCAGACTTGCTCGACTTCACTGTGGCGTTT---GGATCCTATGAAGCCGTCGGCGTCGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGAACACCCGCT Cuscuta_victoriana_685 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGCAATCCTGAGCCAAATCCTTTTT-------ACAATTTT---------TATAAAAAAACTAAGGA-----AAGGTGCAGAGACTCAACGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA------TCTGATTAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAGAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTAACAAA-CTACTCTCTGCTTGGTGCATGGTTC-AAATGGGGAACGTCTTTTATTAACTTGCAATCCCCTT-TTATT-GGTTTCATTTCCCTTCAATC-------------------------TAATTTATAATTAGA-----------------ATCTGTAATAGGAAA-----TAGGTCG-------------------------------------------------------------AACCTGCGGAAGGATCATTGTCGTAACCTT--CTGCCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGTCATC-TTCTTTATTTGACCACGACGAACAAAAA-ACCGGCGCAGAAGCGCCAAGGAATTTT-GT-AATTAGAATGCTGC-CTCGCGTAGCTCGTTTCTACTTGCTTGTGAGGTTGGCGCCTTCTTC--TAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGACAGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATGTTGTCCTCGATTTTGTTGATGTCTTGGCCTACGGTGGATGTACCAAGTGTGCAT---AACGGCCAGACTTGCTCGACTTCACTGTGGCGTTT---GGATCCTATGAAGCCGTCGGCGTCGGCTCTTCGATTGCGACCCCAAGTCAGGCGAGAACACCCGCT Cuscuta_volcanica_1007 ------------------------------------TACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGG------------------------------------------------------GAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTTTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCACTTCTACTTGCTTGTGAGGTTGGCATCTTTTT-AAAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATT-GGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGACCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTC----------------- Cuscuta_volcanica_1044 -------TAATTGGATTGAGCCTTGGTATGGAAACGTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTGTTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cuscuta_volcanica_1152 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTA-------------------------------------------------------------TTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTTTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCACTTCTACTTGCTTGTGAGGTTGGCATCTTTTTTAAAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATT-GGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGACCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCA--------------------- Cuscuta_volcanica_1153 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTA----------------------------------------------------------T-ATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTTTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCACTTCTACTTGCTTGTGAGGTTGGCATCTTTTT--AAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATT-GGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGACCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACC------------------------ Cuscuta_volcanica_1154 ----------------TGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTACTTTAATA-----------------TAATTATTAAATTTATAATTAGATTAAATTTATAATTAGAATCTGCAATAGGAAA-----TAGGTCGGG-----------------------------------------------------------------CGGAAGGAT-ATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTTTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCACTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT-AAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATT-GGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGACCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAGTC------------------ Cuscuta_volcanica_1208 ACGGACTTAATTAGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTACTTTAATA-----------------TAATTATTAA--------------------------------------------------------------------------------------------------------------------------TGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTTTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCACTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT-AAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATT-GGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGACCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGCGAGAACACCCGCC Cuscuta_volcanica_560 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTACAGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cuscuta_volcanica_595 -------------GATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATAACCAATACAAAA-CGGGAATCTGATATATCGTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGTCTCAAAAA-AAACTCTCTGCTTGGTGCGCGGTTA-AAATAGGGAACGTCTTTTTTTAACTTGCAATTCCTTTATTATT-CGTTTTATTTTCCTTTAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCACC----------------------GAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTTTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCACTTCTACTTGCTTGTGAGGTTGGCATCTTTTT--AAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATT-GGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTTGTGTGTTGGATTGGGAGTAGATCATGGCCTCCCGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGACCAGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCC---------------------- Cuscuta_woodsonii_729 ----ACTTAATTGGATTGAGCCTTGGTATGGAAACGTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-CAACT--------GGTGTGCGGTTA-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-TGTTTTATTTTCCTTCAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCC----------------------TGAACCTGCGGAAGGATCATTGTCGTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCAAC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCTTTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT-AAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTAGATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGCCTTGGCCTGCGGTGGATGTACCATGTGTGCAT---AATGGCCGGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTGATTGCGACCCCAAGTCAGGC------------- Cuscuta_woodsonii_916 --GGACTTAATTGGATTGAGCCTTGGTATGGAAACTTACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATGAAGACAATGGGTAATCCTGAGCCAAATCCTTTAT------------------------TATAAAAAAACTAAGGA-----GAGGTGCAGAGACTCAATGGAAGCTTTTCTAACCAATA-------CAAAA-AGGGAGTCTGATATATCTTT-TTACCAAA-------CTGATCAGAGAATAAAGAGAGAGTCCTTTTCTACATGTCAAT-ATGGACAGTAATGAAATTTTCAGTAAAAAGAAAATCCGTTGATTTTAAAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAGGCCTCAAAAA-CAACT--------GGTGCGCGGTTA-AAATGGGGAACGTCTTTTTTTAACTTGCAATCCCCTTATTATT-TGTTTTATTTTCCTTCAATA-----------------TAATTATTAAATTTATAATTAGA-----------------ATCTGCAATAGGAAA-----TAGGTCGGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAAATCCTC--------------------------------------------GTAACCTT--CTGGCAGAATGACTTGTTAACTTG-TACCAATACAAGATTCTAGTGTTGGGGCCATC-TTTTTTATTTGGCCACAATGAACAAAAACACAGGCGCAGAAGCGCCAAGGAATTTC-GT-AATGAGAATGCTGC-CTCGCATAGCTCTTTTCTACTTGCTTGTGAGGTTGGCATCTTTTTT-AAAAAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTAGGTTGAGGGCACGTTTGCTTGGGTGTCATGCATTAT-GTCTTCCCTCTCGTGTGTTGGATTGGGAGTATATCATGGCCTCCTGGGCCCATCCTCTTGGGTGTGGTTGGCCGAAAATATTGTCCTTGATTTTGTTGATGTCTCGGCCTGCGGTGGATGTACCGTGTGTGCAT---AATGGCCGGACTTGCTCGACTTCATTGTGGCGTGT---AGATCCTATGAAGCTGTCGGCGTTGGCTCTTTG--------------------------------- ; END; BEGIN SETS; CHARSET excluded (CHARACTERS = 'Cuscuta tinctoria combined ITS and trnL-F') = 472-488 512-528 825-834; END; BEGIN TREES; TITLE Cuscuta_tinctoria_result; LINK TAXA = Taxa1; TRANSLATE 1 Cuscuta_haughtii_601, 2 Cuscuta_americana_698, 3 Cuscuta_applanata_535, 4 Cuscuta_rugosiceps_517, 5 Cuscuta_rugosiceps_745, 6 Cuscuta_rugosiceps_915, 7 Cuscuta_jalapensis_607, 8 Cuscuta_jalapensis_606, 9 Cuscuta_jalapensis_617, 10 Cuscuta_jalapensis_518, 11 Cuscuta_cotijana_1140, 12 Cuscuta_cotijana_1225, 13 Cuscuta_mitriformis_556, 14 Cuscuta_mitriformis_584, 15 Cuscuta_mitriformis_815, 16 Cuscuta_saurocalyx_765, 17 Cuscuta_saurocalyx_1303, 18 Cuscuta_insolita_802_802b, 19 Cuscuta_victoriana_678, 20 Cuscuta_victoriana_683, 21 Cuscuta_victoriana_684, 22 Cuscuta_victoriana_685, 23 Cuscuta_tasmanica_680, 24 Cuscuta_tasmanica_681, 25 Cuscuta_tasmanica_682, 26 Cuscuta_lindsayi_927, 27 Cuscuta_lindsayi_1302, 28 Cuscuta_tinctoria_573, 29 Cuscuta_tinctoria_574, 30 Cuscuta_tinctoria_766, 31 Cuscuta_tinctoria_798, 32 Cuscuta_tinctoria_1226, 33 Cuscuta_aurea_506, 34 Cuscuta_aurea_562, 35 Cuscuta_aurea_799, 36 Cuscuta_aurea_800, 37 Cuscuta_aurea_1023, 38 Cuscuta_floribunda_489, 39 Cuscuta_floribunda_1009, 40 Cuscuta_floribunda_1010, 41 Cuscuta_purpusii_898, 42 Cuscuta_purpusii_928, 43 Cuscuta_purpusii_1013, 44 Cuscuta_purpusii_1025, 45 Cuscuta_volcanica_560, 46 Cuscuta_volcanica_595, 47 Cuscuta_volcanica_1007, 48 Cuscuta_volcanica_1044, 49 Cuscuta_volcanica_1152, 50 Cuscuta_volcanica_1153, 51 Cuscuta_volcanica_1154, 52 Cuscuta_volcanica_1208, 53 Cuscuta_kellermania_montana_581, 54 Cuscuta_kellermania_montana_1299, 55 Cuscuta_kellermania_852, 56 Cuscuta_kellermania_1297, 57 Cuscuta_kellermania_1298, 58 Cuscuta_kellermania_absconsa_978_978b, 59 Cuscuta_woodsonii_729, 60 Cuscuta_woodsonii_916; TREE Bayesian = [&R] ((1:0.092823,(2:0.070976,3:0.043247):0.00761):0.013428,((((23:0.0,24:0.0,25:9.2E-4):0.034267,((19:9.44E-4,20:0.0):0.001847,(21:0.001889,22:9.56E-4):0.004825):0.013409):0.009773,((26:0.003046,27:0.003723):0.010822,((18:0.006969,(16:0.001678,17:0.001551):0.003836):0.017584,(((11:9.88E-4,12:0.0):0.011537,(14:0.009767,(13:0.005269,15:0.0):0.003432):0.00289):0.002868,(8:0.006375,(7:0.005831,10:0.001879,(9:0.001398,(4:0.00193,5:0.001931,6:9.46E-4):0.001417):0.001376):0.003523):0.011927):0.005279):0.007856):0.003023):0.001964,((58:9.76E-4,(59:0.004833,60:0.002948):0.0044,((53:0.0,54:0.002218):0.003765,(57:0.004698,(55:0.0,56:0.003749):0.0):0.004836,(45:0.002289,46:0.0,47:0.0,48:0.004656,49:0.0,50:0.0,(51:0.002937,52:0.0):0.002166):0.012686):0.004353):0.011248,((41:0.0,42:9.6E-4,43:0.001,44:0.002529):0.00898,((38:0.0,(39:0.0,40:0.001042):3.37E-4):7.03E-4,(29:0.0,30:0.0,32:0.002997,(28:0.008993,31:0.002515):0.0):0.003901,(33:0.001061,34:0.0,35:0.005405,36:0.0,37:9.82E-4):9.9E-4):0.021418):0.009919):0.009335):0.013428); TREE MPStrict = [&R] ((3:0.046795,(1:0.090493,2:0.07157):0.005956):0.0151385,(((26:0.003066,27:0.003745):0.011938,((23:0.0,24:0.0,25:9.24E-4):0.034613,((19:9.5E-4,20:0.0):0.001871,(21:0.001898,22:9.61E-4):0.00485):0.013797):0.011232,((18:0.00703,(16:0.00169,17:0.001561):0.003849):0.017749,(((11:9.94E-4,12:0.0):0.011616,(14:0.009842,(13:0.005312,15:0.0):0.003459):0.002905):0.003028,(8:0.006507,(4:0.001967,5:0.00197,6:9.78E-4,7:0.00683,9:0.002803,10:0.004716):0.006318):0.012031):0.005257):0.009161):0.003626,((55:0.003973,56:0.00775,57:0.004894,58:0.003982,(53:0.0,54:0.002238):0.004677,(59:0.004891,60:0.002939):0.009683,(45:0.002308,46:0.0,47:0.0,48:0.004696,49:0.0,50:0.0,(51:0.002951,52:0.0):0.00216):0.013702):0.015747,((41:0.0,42:9.66E-4,43:0.001005,44:0.00256):0.009856,(38:0.0,39:9.16E-4,40:0.001948,(28:0.009072,29:0.0,30:0.0,31:0.002555,32:0.003023):0.004082,(33:0.001069,34:0.0,35:0.005493,36:0.0,37:9.9E-4):0.001149):0.020862):0.009531):0.008988):0.0151385); END;