#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 18:57 GMT TreeBASE (cc) 1994-2008 Study reference: Sulmann J.D., Drew B.T., Drummond C., Hayasaka E., & Sytsma K.J. 2013. Systematics, Biogeography, and Character Evolution of Sparganium (Typhaceae) – Diversification of a Widespread, Aquatic Lineage. American Journal of Botany, 100(10): 2023–2039. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13860] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=37; TAXLABELS Brocchinia_prismatica_1 Puya_ferruginea Puya_venusta Sparganium_americanum Sparganium_androcladum Sparganium_angustifolium Sparganium_angustifolium_1 Sparganium_angustifolium_2 Sparganium_angustifolium_3 Sparganium_angustifolium_X_S._emersum Sparganium_emersum Sparganium_emersum_2 Sparganium_emersum_3 Sparganium_emersum_4 Sparganium_erectum_subsp._microcarpum Sparganium_erectum_subsp._stoloniferum Sparganium_erectum_subsp._stoloniferum__var._macrocarpum Sparganium_eurycarpum Sparganium_eurycarpum_Engelm.var._greenei Sparganium_fallax_1 Sparganium_fallax_2 Sparganium_fluctuans Sparganium_glomeratum Sparganium_glomeratum_2 Sparganium_glomeratum_3 Sparganium_gramineum Sparganium_hyperboreum Sparganium_hyperboreum_2 Sparganium_japonicum Sparganium_japonicum_X_S._fallax Sparganium_natans Sparganium_subglobosum_1 Sparganium_subglobosum_2 Typha_angustifolia Typha_domingensis Typha_latifolia Typha_orientalis ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=28; TAXLABELS Brocchinia_prismatica Puya_ferruginea Puya_venusta Sparganium_americanum Sparganium_androcladum Sparganium_angustifolium Sparganium_angustifolium_2 Sparganium_angustifolium_3 Sparganium_emersum Sparganium_erectum_subsp._stoloniferum Sparganium_erectum_subsp._stoloniferum_var._macrocarpum Sparganium_eurycarpum Sparganium_eurycarpum_Engelm.var._greenei Sparganium_fallax_1 Sparganium_fallax_2 Sparganium_fluctuans Sparganium_glomeratum Sparganium_glomeratum_2 Sparganium_glomeratum_3 Sparganium_gramineum Sparganium_hyperboreum Sparganium_japonicum Sparganium_natans Sparganium_subglobosum_1 Typha_angustifolia Typha_domingensis Typha_latifolia Typha_orientalis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19767] TITLE 'Sparganium 37 taxa, 4-gene alignment'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3717; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=N GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Brocchinia_prismatica_1 AACCTGCTAAGTGGTAACTTTCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCTT--TATTTTGAGAAAACAGGGGT---ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTCGGTCAGCTGGAATCCCTCTATCGAAATTACAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTGACATATCAAACGATTAATCACGACACGAATCCATATCGTAT---------------AATATATTAATAATATTAA---------------------------------TGTTTATTATAACATTATGAATGATTATGAAATCATGAAATATGAAATGAAATTATGAAAAAATTCATAGTTATTGCGAATCCATTCCAATCG------AAC-AAAAATCGAATATTCAGTAATAAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTC----AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATCTTACTTCCTAA-CTA----TTTATCCTCTGATGTTTTTTCATCAATG-AAAAAATAAAATTCACTATCTTTCT--------CATTCATTCTACTCTTTCACAAAAGGATCC----GAACAGAAATCTTTGGATCTTATCCCATACAAATGAAGATATATA--------------GGTAAACAATCTCTATTATTAAAAAATTCACAATCCATATCATTATCCTTATATTTAATAGGTCCTATTTTT---TATTTTTTG-TTTTAGTCCCTTTAATTG-ACATAGATACAAGTACTCTAC--------------------TAGGATGATGCACAAAAAATGGTTGGGA---------------------------------AAAAAATT------------------CTGTAAATACTTTTGCTTGCTTTGTTTATACTC---TTTTTGTTTTGCGGGACGCCTGGAATTCATTACTTGTATTCCATTTT-AGTAATAAACAATAGGCATACAA-----ACAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAATGAAAGGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCTAATCTTCTATTCGACACAAGAAAAAGGG--------TGAAAATTCCTTTTTCTTGTGTCGTCTTGTATCAAAAT----AAT-AATCACT--TTTTTTCCTGTTCGTCAAAGATTACTATTCCTTTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGAAAA-AAAGGATTATATTATGGGGGAATAAATTATTGAGCAAATAGAATTTATTCACTTA-TT-CAATATTCTTCACTTATTCAATATAAGTTAAACTTCTAACTTAGAG----------------AAATTATTCAAACAAAA-----AA-GACT-------GTTCCGGTTGAAAGGTGGATTTTATTTTTACGAATATCCAAATCTTTATTTATTATATGATCAGAGTTTTTATTTTA----TTTTTAGAGTAGTTTTGATTAAGGTTCTATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTAGAAATCCATATAA---TA-------------------ATTATATA-----TTATT------------------GGATTATAGATAAAATCGATTGATTCGTTCTTTCTTCTTGCTTCCC----GTTAATATTTT--GG-GGGAGGGGCAGGAACTATGAATCCACCGCTAGATTCAATTGTTCACAAACATCATTAAGAAACAAAAGAATAGAGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Puya_ferruginea ------------------------------------------AATTAAAAATGGGCAA-TCCTGAGCCAAATCTT--TATTTTGGGAAAACAAGGGT---ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTCAGT-AGCTGGAATCCCTCTATCGAAATTCGAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTGACATATCAAACGATTAATCACGACACGAATCCATATCGTAT---------------AATATATTTATATTATTAA---------------------------------TG-----TATAACATTATGAATGATTATGAAATCATGAAATATGAAATGAAATTCGGAAAAAATTAAGAGTTATTGTGAATCCATTCCAATCC------AAC-AAAAATCGAATATTCAGTAATAAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAAATTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTC----AATACCGACAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCATTTTACTTCCTAA-CTA----TTTATCCTCTTTTGTTTTTTCATTGATG-AAAAAACAAAATTCACTATCTTTCT--------CATTCATTCTACTCTTTCACAAATGGATCC----GAACAGAAATCTTTGGATCTTATCCCATACAAATGAAGATATATA--------------GGTAAACAATCTCTATTATTAAATAATTCATAATCCATATCATTATCCTTATATTTACTAGGTCCAATTTTG---TATTTTTTG-TTTTAGTCCCTTTAATTG-ACATAGATACAAGTACTCTACTAGAGATACAAGTACTCTACTAGGATGATGCACAAAA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAT--------ATGCTTAAACTCAGCGGGTGGCCCCGCCTGACCTGGGGTCGCGGTCCGATCGCGC-------GGCCTGCCT----------ACTGCTAGGAGGCGCGCCGCTCGGGGTGGGGGTCCTCTTGGGCC-TCTCTCGCCGCTGGGGCCGGAGGCACGGCGCTCGGCTCGCTGGCG-------------CGTCCACCACTCGCCGTG-CCCGG-CCCGCGCGGGCGGCCCGCTCTTCGGCCCGCCGCG-CCGGAGGCGCGGGGGGCCAGTCTCCGCGTCCGCGGCACCCA-C-TCCGCCGTTCGGGCGGGCGGGGCGCGGAGCGTCGCGATGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCGGACGGCCTCGGGCGCAACTTGCGTTCAAAGACTAGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGAGTCGT-TAGGTG-TTACCTTTTACGGTCGGCCGCGGGGCG-GCCCGCCG---CGCTGGCGCGCGCGGCCGCCCCGCTTCCTTC-GTCA-GTGTTCCTTGGCGCGGCGCCGCGCCGGGGTTTTCGTCCGTCCTCCCCCGCCGCC--GA--GGCGACGG----GAGGGGGGAGGGGCG-------------GAAGG-AGGGGGGGCTCGCCCAACCCCAAGG-GTTGGTT---GGGT-CACGGGTG--CGCGGGT---------------------------------------------------------------------AGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAAGTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAGACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTTATTACAAAAATCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAAGGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAATGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGT Puya_venusta -------------------TCCAAATTCAGAGAAACCCTG-GAATTAAAAATGNNNNN-NCCTGAGCCAAATCTT--TATTTTGGGAAAACAAGGGT---ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTCAGT-AGCTGGAATCCCTCTATCGAAATTCGAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTGACATATCAAACGATTAATCACGACACGAATCCATATCGTAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTATAACATTATGAATGATTATGAAATCATGAAATATGAAATGAAATTCGGAAAAAATTAAGAGTTATTGTGAATCCATTCCAATCC------AAC-AAAAATCGAATATTCAGTAATAAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAAATTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTC----AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCACTTTACTTCCTAA-CTA----TTTATCCTCTTTTGTTTTTTCATTGATG-AAAAAACAAAATTCACTATCTTTCT--------CATTCATTCTACTCTTTCACAAATGGATCC----GAACAGAAATCTTTGGATCTTATCCCATACAAATGAAGATATATA--------------GGTAAACAATCTCTATTATTAAATAATTCACAATCCATATCATTATCCTTATATTTACTAGGTCAAATTTTG---TATTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAT--------ATGCTTAAACTCAGCGGGTGGCCCCGCCTGACCTGGGGTCGCGGTCCGATCGCGC-------GGCCTGCCT----------ACTGCTAGGAGGCGCGCCGCTCGGGGTGGGGGTCCTCTTGGGCC-TCTCTCGCCGCTGGGGCCGGAGGCACGGCGCTCGGCTCGCTGGCG-------------CGTCCACCACTCGCCGTG-CCCGG-CCCGCGCGGGCGGCCCGCTCTTCGGCCCGCCGCG-CCGGAGGCGCGGGGGGCCAGTCTCCGCGTCCGCGGCGCACG-C-TCCGCCGTTCGGGCGGGCGGGGCGCGGAGCGTCGCGATGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCGGACGGCCTCGGGCGCAACTTGCGTTCAAAGACTAGATGGTTCGCGGGATTCTGCAATN----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAAGTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAGACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTTATTACAAAAATCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAAGGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAATGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGT Sparganium_americanum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAT-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACCTATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCAATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGATAGGAAGGATTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATATAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGCATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCAGTCCGATGACAGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTGAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTTGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCGCCGCGCCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGA--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCACCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--GCACGCCC----GAGGGAGGAGGGACGTC-GAGGTGGGCCGACGAAACGGGCT-GC-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------ATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGATACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTTCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTATGATTTCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCATTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_androcladum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAT---ATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTTAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTTCTTTCTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATTTTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGG--TTTAGTGTCNATCGATACAAT-TCTGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATT------------------GGATTATCGAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-------------------------------------------------------TCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCAGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAGGGGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCAT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTCGGGGGTGGGCCGACGAAACGAGCTGGC-GCCCGCCCCGTCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-----------------------------------------------------------TTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCCCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTAACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATACTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATATTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACAAGAGTACCATGACAATTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCGTTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATATA--GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAGT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGATGC-------TGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCTGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGTGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-----------------------------------------------------------------------------------------------------------TTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGA{GT}{GT}CACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGACTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGGAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium_1 -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATA----GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATTATATTATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGATGCTAAGAAAT-CTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGAGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGCGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA---------------------------------------------GATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium_2 ----------------ACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCGTTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATA----GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAGT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGA---GAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCTGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGTGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGATTCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGGAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium_3 ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCGTTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATA----GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACA--------------TTTAGTGTCGATCGATACAGT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG------------T-CTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCTGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGTGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGATTCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGGAGGAAATGGTGAGGGCAGGAAAATGCACCCA---- Sparganium_angustifolium_X_S._emersum AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCANGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGAA----TTACTAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTGATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTC----------------------------------------------------------------------------------------------------------GAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCGCCTCGGTTTAAA----------------------------------GGGTCCGGA-GGGCCTTTACTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCA-----CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGCGCCC--GA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTTGCGCCGGGG--TTCGTCCGTGGTCTCC-GTCGAC--CC--CCGCGCCC----GAGGGGGGAGGGACGTC-GGAGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_emersum --CCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTTGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCATCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCACCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACAGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------------------------------------------AAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTTACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCTTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAACCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGGGTCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGTTCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_emersum_2 ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-T{AG}TGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTTGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTC----------------------------------------------GCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGC{AG}CGGAGGGCCATCATCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCACCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACAGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_emersum_3 ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACGTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTTGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-------------GCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCATCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCACCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACAGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_emersum_4 -----------TGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATC{AC}AAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGG{CT}CTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTTGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTT--------------------------------------------------------------------------------------------------------------GAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCATCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCACCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACAGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_erectum_subsp._microcarpum ------CTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCCTATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGA--------------------------------------------------------------------------------------CT---AT-TTTTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGAA----TTACTAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTGATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-----------------------------------------------------------------------------------------------------------------------------------------TATCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCA-----CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTC{GT}GCCGCGGGGGGCGCCC--GA------GGGC{AG}T-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGT{CT}GCGCCGGGG--TTCGTCCGTGGTCTCC-GTCGAC--CC--CCGCGCCC----GAGGGGGGAGGGACGTC-GGAGAGGGCCGACGAAACGAGCTG{AC}C-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-T----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_erectum_subsp._stoloniferum ---CTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCAATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTTTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCTGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGTAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCCTAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG----------------------------------------------------CGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCA-----CGCC-CCGCC{AT}AAG-GGGCGA--AGGGGGCGGAG{CT}GTCG-TTTG{CT}GTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGCGCCC--GA------GGGC{AG}T-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCTCC-GTCGAC--CC--CCGCGCCC----GAGGG{AG}GGAGGGAC{AG}TC-G{CG}AGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTAACGTAATCCAGGATAAGAAATTACCGGAAGATCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACAGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTCGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_erectum_subsp._stoloniferum__var._macrocarpum --------------------------------------------GTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGTAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCCTAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-------------------------------------------------------------------------CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCC-----CG-C-CCCCC{CG}AAG-GCCGGG--AGG{GT}-----A-CGTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------{CG}AGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACAACTTCTCCTTCCTCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTTGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_eurycarpum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTGGACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGA--------------------------------CAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTTTTTGTTTTGTGAGACGNCTAGAATTCATTACTTGTATCCTATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGTAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGTAGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCC-----CG-C-CCACCCAAG-GGATGG--AGGGGGCGGAGTGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGTGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCTCC-GTCGAC--CC--CCGCGCCC----GAGGGGGGAGGGACGTC-GGAGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCAGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA--------------------TCTTGGCTTACATTACCCCGCTACAGATATTCCTCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACAGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTCGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_eurycarpum_Engelm.var._greenei AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAAGGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATCACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTNNTTN-NCATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTTTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGTAGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCATCCGCC-----CG-C-CCGCCCAAG-GGACGG--AGGGGGCGGAGTGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGCCTCC-GTCGAC--CC--CCGCGCCC----GAGGGGGGAGGGACGTC-GGAGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATCAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAATACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTTGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTT------------------------------------------------------------------------------------------------------- Sparganium_fallax_1 ------------------------------AGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAATTATTATATTATTAATTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGA--------------------------------------------------------------GTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTCTTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAA------------------------------------------------------------------------------------------------------------GCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATTGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--A-GGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCACCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGCC-GGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGTCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------ATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGNNAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAANAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCG---------------------------------------------------------------------------------------------------------------TTCAGAGGCACAGATAATGGATATTGTTGCATGGNTACGAGAGTACCATGACGGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTT--------------------------------------- Sparganium_fallax_2 -----------TGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAATTATTATATTATTAATTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATCTTCGATTCAACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTAGTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTTTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTCTTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAA-----------------------------------------------------------------------------------------------GAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATTGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--A-GGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGCC-GGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGTCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_fluctuans AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATCTTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTACAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGGTTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTT-------GCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCAGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCATCCGC------CG-C-CCGCCCATG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGCCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGGGGGACGTC-GGGGTGGGCCGACGAAACGGGCTAGC-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA----------------------------------------------ATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTTCTACTGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATAGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_glomeratum AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATAAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-T{AG}TGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-AGGCC-TTCCTCG--AAGGGAGCCTAAGGCACGACATCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CA-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACAATCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-----------------------------------CCCCGCTACAGATATTCCGAAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGAAC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTATTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACGGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCGCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATG--------------------------------------------- Sparganium_glomeratum_2 ------CTAAGTGTTAACTTCCAAATTCAGAGAAACCCTGAGAATTAAAAACGGGCAAATCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTTTATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTAATAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGG-TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCACGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTGTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTT----------------------------------------------------------------------------------------GTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-AGGCC-TTCCTCG--AAGGGAGCCTAAGGCACGACATCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CA-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAACTCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATTCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGAAC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTATTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_glomeratum_3 -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTAATAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-----------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACAGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-AGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACATCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CA-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAACTCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGAAC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTATTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACGGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCGCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_gramineum ----TGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATCTTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTACAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGGTTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGCTTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTC--------------------------------------------------------TTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCAGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCATCCGC------CG-C-CCGCCCATG-GGGCGG--AGGGGGC{AG}GAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTAA-TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GCCGAC--CC--CCACGCCC----GAGGGAAGGGGGG{CT}GTC-{AG}GGGTGGGCCGACAAAACGGGCTAGC-GCCCGCCCCGCCAACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AGCAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_hyperboreum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGTGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATAAA---------------TTATATTATTAATATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAACCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCC-C--------------------TAGGATGATGCACAAGAAATGGTCGGGA------------------------TGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACTAAATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGCGTAATTTATTGAGCAAATAGCACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTTAAACAAAA-----AAAGACTTTTTTTTGTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTGATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTATTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-------------GCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTCAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGAGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAGG-GGGCCA--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AAGGG---GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTC-GGGGTGGGCCGACGAAACGGGCAGAT-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCGGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCATGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCGAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGTTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGATAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTACTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATGTCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGA----------------------- Sparganium_hyperboreum_2 ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGTGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATAAA---------------TTATATTATTAATATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAACCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATACATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCC-C--------------------TAGGATGATGCACAAGAAATGGTCGGGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACTAAATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGCGTAATTTATTGAGCAAATAGCACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTTTGTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTGATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTATTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTCAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAGG-GGGCCA--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTC-GGGGTGGG{CT}CGACGAAACGGGCAGAT-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCGGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGTTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGATAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_japonicum --CCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCTAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATATATAGGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGG--TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTAAACTTTGTTTATACTATATTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACA-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCACAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AACGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATT-------------GGATTATCTATAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-CTCCGCCCAAG-GGGCGG--AGGGGGCAGAGTGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGTGCCC--AA------GGGCAT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGAAGGAACGTC-GGGGAGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAACTCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCC{AG}AGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGACTATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACNGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCGCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_japonicum_X_S._fallax ----------------------------------------------------GGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCTAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACA-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCACAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AACGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATT-------------GGATTATCTATAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG---------------------------------------------------GCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCAT{CT}GTCCGCGTCCGC------CG-C-{CT}C{CG}{CG}CC{AC}A{AG}-GGG{CG}{CG}G--{AG}{AG}GGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGG{CT}GCCC--AA------GGGC{AG}T-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAG{AG}AGG{AG}ACG{CT}C-GGGG{AT}GGGCCGACGAAACGGGCTAGA-GCCCGCCCCG{CT}CGACATTCGTTCACGAGTTCAC{AG}GGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-T------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAANGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGACTATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACNGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCNCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_natans -------------------------TTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTAATATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAACCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTT---------------------------------------------------------------------------TTTAGTGTCGATCGATACAATCTATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACTAAATC------------CTGGTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAATACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CCTATTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTCAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCG---ATGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTC-GGGGTGGGCCGACGAAACGGGCAGAT-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCGGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------ATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAATGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCGAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGTTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGATAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTATAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGACGGCAGGAAAATGCACCCACGGT Sparganium_subglobosum_1 --------------------------------AAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACATACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATA------------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGG-TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTCTAACTTAGAC----------------AAATTATTCAAACAAAACAAAAAAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTTATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATTATCTAGAAAATTTGGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG------------TGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCACCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGAGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCATGCCC----GAGGGAGGAGGGACATC-GGGGTGGGCCGACGAAACGGGCTGGC-GCCCGCCGCGCCGACATTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_subglobosum_2 -----------------------------------CCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACATACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT----TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATA------------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-A--------------------------------------------------------------------TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTCTAACTTAGAC----------------AAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTTATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA-----------------CTATTATATT-----ATATTGGATTATCTAGAAAATTTGGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTT{GT}{CT}TTCGTAAGAGTGAATATATTATGT-GGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAG---CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCACCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGAGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCATGCCC----GAGGGAGGAGGGACATC-GGGGTGGGCCGACGAAACGGGCTGGC-GCCCGCCGCGCCGACATTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Typha_angustifolia ----TGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCGTATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGACCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTAGGAAATAATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT----TTTTTTAATCAATGGTTCAAACAAAATTCATTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATA------------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTTTATTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATGCATAAGAAATGGTCGGGATTTCGTGTCGATCGATACAAT-TATGTATGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTAAATCCTTTTGCTTACTTTGTTTATACTA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGTAAATAGAACTTCTTCACTTA-TTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAA-ACTTTTATT-GTTCTTGTTGAAGGGAGGATTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTATTT-TTATTTTTTTAGAGTAGTTTTGATTAAAGTTCCATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTATAAATCCATATAAATATAATATTATACATATAAA--TATAATATT-----ATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGTTTCCTAAGAGTGAATATATTATGT-GGGAAGGGCAGGGACTATGAATCAATCGATAGATTCAATTCTTCACAAACATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCCGATGGCCG-------CGCCGCGGT-----CCCGC----------GGCGCG-CGCCCGGTGT-GGGGTCCGGA-GGGCC-TTCCTCG--GAGGGGGTCGGAGGCACGACGTCCGGCTCGCG----CACGGT-AACGT-CGTCCACCACTCGCCGTGTCTCGGCCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGCCCGTGGGCACGGAGGGCCATCGTCCGCGTCCGCCGC---CGCC-CCGCCCGAGCGGGCGG--GGGGCGCGGAGCGTCG-TTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGGGAGAGCCGAGATATCCGTTGCCGAGAGTCATCT-GGTA-TTAAT---TTTGGTCGGCCGC-GGGGGCGCCCGGCA---CGCGGGCG--------CCCCGCGCTTCCGTCTCT-TTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGCCCCCC-GTCGTC--CCTTACCCGCCC--GAGAGGGGAGAGGGACGCCGGGGGAGGGCCGGCGGGACGGGCGGGT-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGC-GGTCGTCCTTGGTCAGGCATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA----------------------TCGGCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAATGATCTGTGATTGTTCTGCTCCACCAGTTAAGGTAATCCAGGATAGGAAATTAGCAGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AACAGCCGAAAGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCAGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTATATTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGTCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCGATCTGTGGCATGGCTGCAATTAAGATATC-------------------------------------------------------------------------------------------------------------------- Typha_domingensis -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGACCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAGTAGGAAATTATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT----TTTTTTAATCAATGGTTCAAACAAAATTCATTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTTTATTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATG------------------TTTCGTGTCGATCGATACAAT-TATGTATGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTAAATCCTTTTGCTTACTTTGTTTATACAA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGTAAATAGAACTTCTTCACTTA-TTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AA--ACTTTTATT-GTTCTTGTTGAAGGGAGGATTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTATTT--TTTTTTTTTAGAGTAGTTTTGATTAAAGTTCCATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTATAAATCCATATAAATATAA-----------------TATTATATT----------------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGTTTCCTAAGAGTGAATATATTATGT-GGGAAGGGCAGGGACTATGAATCAATCGATAGATTCAATTCTTCACAAACATCATTAAGAAACAAAAGAATAGAGTGGAT--------ATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCCGATGGCAG-------CGCCGCGGC-----------------------GCG-CGCTCGGTTT-GGGGTCCGGA-GGGCC-TTCCTCG--GAGGGGGTCGGAGGCACGACGTCCGGCTCGCG----CACAG------TACGTCCACCACTCGCCGTGTCTCGGCCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGTGCCCGTGGGCACGGAGGGCCATCGTCCGCGTCCGCCGC---CGCC-CCGCCCGAGCGGGCGG--GGGGCGCGGAGCGTCG-TTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGGGAGAGCCGAGATATCCGTTGCCGAGAGTCATCT-GGTA-TTAGT---TTTGGTCGGCCGCGGGGGGCG-----CA---CGCGGGCG--------CCCCACGCTTCCGTCTCT-TTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCATGCCCCCC-GTCGCCCTCCCTCCGCGCCC----GAGGGGAGAGGGACGCCGGGGGAGGGCCGACGGGACGGGCGGGT-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGC-GGTCGTCCTTGGTCAGGCATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------GGCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAGTGATCTGTGATTGTTCTGCTCCACCAGTTAAGGTAATCCAGGATAGGAAATTAGCGGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AACAGCCGAAAGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCAGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCTGCACTATATTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCGATCTGTGGCATGGCTGCAATTAAGATATCTTCAAAGGATTTT------------------------------------------------------------------------------------------------------- Typha_latifolia AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTCGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCGTATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGACCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTAGGAAATTATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT----TTTTTTAATCAATGGTTCAAACACAATTCATTATCTTTTT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTTT-TTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATGCATAAGAAATGGTCGGGATTTNGTGTCGATCGATACAAT-CCTTTAGGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTANNTCCTTTTGCTTACTTTGTTTATACTA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGTGAATAGAACTTCTTCACTTA-TTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAA-ACTTTTATT-GTTCTTGTTGAAGGGAGGATTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGCCG-------CGCCGCGGT-----CCCGC----------GGCGCG-CACACGGTCT-GGGGTCCGGA-GGGCC-TTCCTCG--GAGGGGGCCGGAGGCACGACGT{AC}CGGCTCGCG----CACAG------TACGTCCACCACTCGCCGTGTCTCGGCCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGCCCGTGGGCACGGAGGGCCATCGTCCGCGTCCGTCGC---CGCC-CCGCCCGAGCGGGCGG--GGGGCGCGGAGCGTCG-TTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGGGAGAGCCGAGATATCCGTTGCCGAGAGTCATCT-GGTA-TTAAT---TTTGGTCGGCCGCGGGGGGCGCCCGGCA---CGCGGGCG--------CCCCGCGCTTCCGTCTCT-TTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCTTGCCCCCC-GTCGCC--CCCTCCGCGCCCTG--GAGGGAAGAGGGACGCCGGGGGAGGGCCGACGGGACGGGCGGGT-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGC-GGTCGTCCTTGGTCAGGCATCGACAATGATCTTCCGCAGGTTTCACCTACGGAAACCTTGTTTACGACTTCTCCTTCCTCTA-------------------------GCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAATGATCTGTGATTGTTCTGCTCCACCAGTTAAGGTAATCCAGGATAGGAAATTAGCGGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AGCAGCCAAAGGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTATGTTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCAATCTGTGGCATGGCTGCAATTAAGATATCTTCGAAGGATTTTATCTTCTGGTTCC------------------------------------------------------------------------------------------ Typha_orientalis -----------------CTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCGTATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTAGGAAATTATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT----TTTTTTAATCAATGGTTCAAACAAAATTCATTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTT--TTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATGCATAAGAAATGGTCGGGATTTCGTGTCGATCGATACAAT-TATGTATGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTAAATCCTTTTGCTTACTTTGTTTATACTA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAATACAAAAGAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGTAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGAC----------------AAATTATTCAAACAAAA-----AAA-ACTTTTATT-GTTCTTGTTGAAGGGAGGGTTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTATTTATTTTTTTTTTAGAGTAGTTTTGATAAAAGTTCCATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTATAAATCCATATAAATATAATATTATACATATAAA--TATAATATT-----ATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGTTTCCTAAGAGTGAATATATTATGT-GTGAAGGGCAGGGACTATGAATCAATCGATAGATTCAATTCTTCACAAACATCATTAAGAAACAA{AT}{AT}GAATAGAGTG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGGCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAATGATCTGTGATTGTTCTGCTCCACCAGTCAAGGTAATCCAGGATAGGAAATTAGCGGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AGCAGCCAAAGGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTATGTTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCAATCTGTGGCATGGCTGCAATTAAGATATCTTCGAAGGAT---------------------------------------------------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M19766] TITLE 'Sparganium 28 taxa, 4-gene alignment'; LINK TAXA = Taxa2; DIMENSIONS NCHAR=3689; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .] Brocchinia_prismatica AACCTGCTAAGTGGTAACTTTCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCTT--TATTTTGAGAAAACAGGGGT---ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTCGGTCAGCTGGAATCCCTCTATCGAAATTACAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTGACATATCAAACGATTAATCACGACACGAATCCATATCGTAT---------------AATATATTAATAATATTAA---------------------------------TGTTTATTATAACATTATGAATGATTATGAAATCATGAAATATGAAATGAAATTATGAAAAAATTCATAGTTATTGCGAATCCATTCCAATCG------AAC-AAAAATCGAATATTCAGTAATAAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTC----AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATCTTACTTCCTAA-CTA----TTTATCCTCT----GATGTTTTTTCATCAATG-AAAAAATAAAATTCACTATCTTTCT--------CATTCATTCTACTCTTTCACAAAAGGATCC----GAACAGAAATCTTTGGATCTTATCCCATACAAATGAAGATATATA--------------GGTAAACAATCTCTATTATTAAAAAATTCACAATCCATATCATTATCCTTATATTTAATAGGTCCTATTTTT---TATTTTTTG-TTTTAGTCCCTTTAATTG-ACATAGATACAAGTACTCTAC--------------------TAGGATGATGCACAAAAAATGGTTGGGA---------------------------------AAAAAATT------------------CTGTAAATACTTTTGCTTGCTTTGTTTATACTC---TTTTTGTTTTGCGGGACGCCTGGAATTCATTACTTGTATTCCATTTT-AGTAATAAACAATAGGCATACAA-----ACAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAATGAAAGGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCTAATCTTCTATTCGACACAAGAAAAAGGG--------TGAAAATTCCTTTTTCTTGTGTCGTCTTGTATCAAAAT----AAT-AATCACT--TTTTTTCCTGTTCGTCAAAGATTACTATTCCTTTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGAAAA-AAAGGATTATATTATGGGGGAATAAATTATTGAGCAAATAGAATTTATTCACTTA-TT-CAATATTCTTCACTTATTCAATATAAGTTAAACTTCTAACTTAGAGAAATTATTCAAACAAAA-----AA-GACT-------GTTCCGGTTGAAAGGTGGATTTTATTTTTACGAATATCCAAATCTTTATTTATTATATGATCAGAGTTTTTATTTTA----TTTTTAGAGTAGTTTTGATTAAGGTTCTATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTAGAAATCCATATAA---TA------------------ATTATATATTATT------------------GGATTATAGATAAAATCGATTGATTCGTTCTTTCTTCTTGCTTCCC----GTTAATATTTT--GGGGGAGGGGCAGGAACTATGAATCCACCGCTAGATTCAATTGTTCACAAACATCATTAAGAAACAAAAGAATAGAGTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Puya_ferruginea ------------------------------------------AATTAAAAATGGGCAA-TCCTGAGCCAAATCTT--TATTTTGGGAAAACAAGGGT---ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTCAGT-AGCTGGAATCCCTCTATCGAAATTCGAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTGACATATCAAACGATTAATCACGACACGAATCCATATCGTAT---------------AATATATTTATATTATTAA---------------------------------TG-----TATAACATTATGAATGATTATGAAATCATGAAATATGAAATGAAATTCGGAAAAAATTAAGAGTTATTGTGAATCCATTCCAATCC------AAC-AAAAATCGAATATTCAGTAATAAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAAATTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTC----AATACCGACAAC?????????????????????????????????????????????????????????????????????????GCCCATTTTACTTCCTAA-CTA----TTTATCCTCTTTTG----TTTTTTCATTGATG-AAAAAACAAAATTCACTATCTTTCT--------CATTCATTCTACTCTTTCACAAATGGATCC----GAACAGAAATCTTTGGATCTTATCCCATACAAATGAAGATATATA--------------GGTAAACAATCTCTATTATTAAATAATTCATAATCCATATCATTATCCTTATATTTACTAGGTCCAATTTTG---TATTTTTTG-TTTTAGTCCCTTTAATTG-ACATAGATACAAGTACTCTACTAGAGATACAAGTACTCTACTAGGATGATGCACAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAT--ATGCTTAAACTCAGCGGGTGGCCCCGCCTGACCTGGGGTCGCGGTCCGATCGCGC----GGCCTGCCT----------ACTGCTAGGAGGCGCGCCGCTCGGGGTGGGGGTCCTCTTGGGCC-TCTCTCGCCGCTGGGGCCGGAGGCACGGCGCTCGGCTCGCTGGCG-------------CGTCCACCACTCGCCGTG-CCCGG-CCCGCGCGGGCGGCCCGCTCTTCGGCCCGCCGCG-CCGGAGGCGCGGGGGGCCAGTCTCCGCGTCCGCGGCACCCA-C-TCCGCCGTTCGGGCGGGCGGGGCGCGGAGCGTCGCGATGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCGGACGGCCTCGGGCGCAACTTGCGTTCAAAGACTAGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGAGTCGT-TAGGTG-TTACCTTTTACGGTCGGCCGCGGGGCG-GCCCGCCG---CGCTGGCGCGCGCGGCCGCCCCGCTTCCTTC-GTCA-GTGTTCCTTGGCGCGGCGCCGCGCCGGGGTTTTCGTCCGTCCTCCCCCGCCGCC--GA--GGCGACGG----GAGGGGGGAGGGGCG-------------GAAGG-AGGGGGGGCTCGCCCAACCCCAAGG-GTTGGTT---GGGT-CACGGGTG--CGCGGGT---------------------------------------------------------------------AGATCGGATCTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGCGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCCTGTCGGGCTCGACGTTAAGAGCTCCTCACGGTTGCCACGCTCAGTATATGGTTAATATGGGCTCTATTGCCTCCCTTGTCATGTCCGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACGAGCCCAAGGTTTGTCCCTTTTCCACTCAGATATGCTTGTGAGTTCCTGTTGCAAGTGTTCAGCATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAGACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTATTGGTATTTTCACTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTTATTACAAAAATCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGGTCTACCGGGTTGAGCACCGACAGCTTGGCAGAAGCCGGTTATCCCGGCGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCTGCAATTAAGATTACTTCAAAGGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAATGGGGTGGAGCTAAAAATGAGCCGGCTGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGT Puya_venusta -------------------TCCAAATTCAGAGAAACCCTG-GAATTAAAAATG?????-?CCTGAGCCAAATCTT--TATTTTGGGAAAACAAGGGT---ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTCAGT-AGCTGGAATCCCTCTATCGAAATTCGAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTGACATATCAAACGATTAATCACGACACGAATCCATATCGTAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTATAACATTATGAATGATTATGAAATCATGAAATATGAAATGAAATTCGGAAAAAATTAAGAGTTATTGTGAATCCATTCCAATCC------AAC-AAAAATCGAATATTCAGTAATAAAATCATTCATTCCAGAGTTTGATAGATCTTTTGAAAAATTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTC----AATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTATAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCACTTTACTTCCTAA-CTA----TTTATCCTCTTTTG----TTTTTTCATTGATG-AAAAAACAAAATTCACTATCTTTCT--------CATTCATTCTACTCTTTCACAAATGGATCC----GAACAGAAATCTTTGGATCTTATCCCATACAAATGAAGATATATA--------------GGTAAACAATCTCTATTATTAAATAATTCACAATCCATATCATTATCCTTATATTTACTAGGTCAAATTTTG---TATTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAT--ATGCTTAAACTCAGCGGGTGGCCCCGCCTGACCTGGGGTCGCGGTCCGATCGCGC----GGCCTGCCT----------ACTGCTAGGAGGCGCGCCGCTCGGGGTGGGGGTCCTCTTGGGCC-TCTCTCGCCGCTGGGGCCGGAGGCACGGCGCTCGGCTCGCTGGCG-------------CGTCCACCACTCGCCGTG-CCCGG-CCCGCGCGGGCGGCCCGCTCTTCGGCCCGCCGCG-CCGGAGGCGCGGGGGGCCAGTCTCCGCGTCCGCGGCGCACG-C-TCCGCCGTTCGGGCGGGCGGGGCGCGGAGCGTCGCGATGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCGGACGGCCTCGGGCGCAACTTGCGTTCAAAGACTAGATGGTTCGCGGGATTCTGCAAT?----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATCGGATTTGGAGCCTTATCTCGGCTTGCACTATCCTGCTACTGATATCCCGCAAGCTTCGAGGTTTCTTTTTATGAAGAACAAAGTGAGGATGATTTGTGATTGCACTGCTCCGCCGGTCAAGGTAATACAGGATAAGAGACTAGCTGAGCCGCTGATCTTGTCGGGCTCGACGTTAAGAGCTCCTCACGGCTGCCACGCTCAGTATATGGCTAATATGGGCTCTATTGCCTCCCTTGTCATGTCTGTTACCATTAACGAGGATGAGGAAGAAACCGGCAGTGACCAACAACAGCACATGGGGAGGAAGCTTTGGGGTTTGGTGGTTTGCCATCATACAAGCCCAAGGTTTGTCCCTTTTCCGCTCAGATATGCTTGTGAGTTCCTGTTGCAAGTGTTCAGTATTCAGCTGAACAAAGAGGTAGAGTTAGAGGCTCAAGCAAAGGAGAAGCATATCCTCCAGACCCAGACCCTTCTTTGTGATATGCTTCTGCGAGATGCTCCTGTTGGTATTTTCGCTCAGTCGCCTAATGTTATGGATCTTGTTAAGTGCCACGGTGCGGCACTTTATTACAAAAATCAATTTTGGCTTCTTGGAACTACACCTTCTGAGTCGCAGATAAAGGATATTGTGGCGTGGCTTTTAGAGTATCATGATGGCTCTACAGGGTTGAGCACCGACAGCTTGGCAGAAGCTGGTTATCCCGGTGCTTCTGCTTTGGGAGACGCAGTCTGTGGCATGGCCGCAATTAAGATTACTTCAAAGGATTTTATGTTTTGGTTCCGATCCCACACTGCAAAGGAGATTAAATGGGGTGGAGCTAAAAATGAACCGGCCGATAGGGATGATGAGGGACGGAAAATGCATCCGCGGT Sparganium_americanum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAT-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACCTATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCAATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGATAGGAAGGATTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATATAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGCATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCAGTCCGATGACAGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTGAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTTGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCGCCGCGCCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGA--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCACCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--GCACGCCC----GAGGGAGGAGGGACGTC-GAGGTGGGCCGACGAAACGGGCT-GC-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------ATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGATACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTTCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTATGATTTCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCATTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_androcladum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAT---ATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTTAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTTCTTTCTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATTTTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGG--TTTAGTGTC?ATCGATACAAT-TCTGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATT------------------GGATTATCGAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-------------------------------------------------TCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCAGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAGGGGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCAT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTCGGGGGTGGGCCGACGAAACGAGCTGGC-GCCCGCCCCGTCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-----------------------------------------------------------TTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCCCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTAACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATACTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATATTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACAAGAGTACCATGACAATTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCGTTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATATA--GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAGT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGATGC-TGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCTGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGTGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-----------------------------------------------------------------------------------------------------------TTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGA{GT}{GT}CACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGACTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGGAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium_2 ----------------ACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCGTTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATA----GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAGT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGA---GAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCTGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGTGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGATTCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGGAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_angustifolium_3 ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTAGATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCGTTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATA----GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACA--------------TTTAGTGTCGATCGATACAGT-TATGTTCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGCTTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTCTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGATT-------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG------T-CTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCTGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGAGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGACGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGGGGAGGGACGTC-GGGGTGGGCCGACGAAACGAGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAAACAGTTTTGGCTTCTAGGGATAACACCTTCAGATTCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGGAGGAAATGGTGAGGGCAGGAAAATGCACCCA---- Sparganium_emersum --CCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTTGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCATCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCACCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACAGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------------------------------------------AAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTTACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCTTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAACCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGGGTCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGTTCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_erectum_subsp._stoloniferum ---CTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCAATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTTTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCTGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGTAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCCTAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATT-----------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG----------------------------------------------CGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCA-----CGCC-CCGCC{AT}AAG-GGGCGA--AGGGGGCGGAG{CT}GTCG-TTTG{CT}GTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGCGCCC--GA------GGGC{AG}T-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCTCC-GTCGAC--CC--CCGCGCCC----GAGGG{AG}GGAGGGAC{AG}TC-G{CG}AGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTAACGTAATCCAGGATAAGAAATTACCGGAAGATCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACAGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTCGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_erectum_subsp._stoloniferum_var._macrocarpum --------------------------------------------GTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGTAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCCTAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATT-----------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG----------------------------------------------------------------CGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCC-----CG-C-CCCCC{CG}AAG-GCCGGG--AGG{GT}-----A-CGTCG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------{CG}AGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACAACTTCTCCTTCCTCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTTGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_eurycarpum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTGGACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGA--------------------------------CAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTTTTTGTTTTGTGAGACG?CTAGAATTCATTACTTGTATCCTATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGTAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATT-----------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGTAGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGCC-----CG-C-CCACCCAAG-GGATGG--AGGGGGCGGAGTGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGTGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCTCC-GTCGAC--CC--CCGCGCCC----GAGGGGGGAGGGACGTC-GGAGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCAGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA--------------------TCTTGGCTTACATTACCCCGCTACAGATATTCCTCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACAGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTCGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_eurycarpum_Engelm.var._greenei AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAAGTAAAAAGGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGGAATCCCTCTATCGAAATCACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCTTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTT??TT?-?CATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTTTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATAAATACT-AATCACATTTTTTTTCCTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCA--------ATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATTAGAACTTTTATTTATTGATTTTTTAGAGTAGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATT-----------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTAGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTACTCG--AAGGTAGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCATCCGCC-----CG-C-CCGCCCAAG-GGACGG--AGGGGGCGGAGTGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TTTGGTCGGCCGCGGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGCCTCC-GTCGAC--CC--CCGCGCCC----GAGGGGGGAGGGACGTC-GGAGAGGGCCGACGAAACGAGCTGAC-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATCAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTCCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCCCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGTTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAATACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTAACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTTGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTT------------------------------------------------------------------------------------------------------- Sparganium_fallax_1 ------------------------------AGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAATTATTATATTATTAATTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGA--------------------------------------------------------------GTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTCTTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAA-----------------------------------------------------------------------------------------------------GCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATTGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--A-GGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCACCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGCC-GGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGTCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------ATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTG??AATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAA?AGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCG---------------------------------------------------------------------------------------------------------------TTCAGAGGCACAGATAATGGATATTGTTGCATGG?TACGAGAGTACCATGACGGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTT--------------------------------------- Sparganium_fallax_2 -----------TGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAATTATTATATTATTAATTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATCTTCGATTCAACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTAGTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTTTTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTCTTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAA----------------------------------------------------------------------------------------------GAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATTGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--A-GGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGCC-GGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGTCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_fluctuans AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATCTTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTACAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGGTTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTT-------GCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAGCGCCTCGGTTAAAA----------------------------------GGGTCCAGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCATCCGC------CG-C-CCGCCCATG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGCCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGGGGGACGTC-GGGGTGGGCCGACGAAACGGGCTAGC-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA----------------------------------------------ATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATATGAGCCCAAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTTCTACTGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATAGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCACGGT Sparganium_glomeratum AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATAAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATAATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-T{AG}TGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-AGGCC-TTCCTCG--AAGGGAGCCTAAGGCACGACATCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CA-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACAATCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-----------------------------------CCCCGCTACAGATATTCCGAAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGAAC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTATTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACGGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCGCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATG--------------------------------------------- Sparganium_glomeratum_2 ------CTAAGTGTTAACTTCCAAATTCAGAGAAACCCTGAGAATTAAAAACGGGCAAATCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTTTATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTAATAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGG-TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCACGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTGTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTT----------------------------------------------------------------------------------GTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-AGGCC-TTCCTCG--AAGGGAGCCTAAGGCACGACATCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CA-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAACTCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATTCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGAAC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTATTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Sparganium_glomeratum_3 -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTAATAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTAGCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATA------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GGG--------TAAAAAATCC-TTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGAT--------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACCATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-----ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACAGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-AGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACATCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CAGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CA-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAAGAGGGACGTC-AGGGTGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACAGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAACTCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGAAC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTATTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACGGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCGCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_gramineum ----TGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATCTTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTACAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGGATTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGGTTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGCTTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTC--------------------------------------------------TTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGACAAGCGCCTCGGTTAAAA----------------------------------GGGTCCAGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCATCCGC------CG-C-CCGCCCATG-GGGCGG--AGGGGGC{AG}GAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTAA-TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GCCGAC--CC--CCACGCCC----GAGGGAAGGGGGG{CT}GTC-{AG}GGGTGGGCCGACAAAACGGGCTAGC-GCCCGCCCCGCCAACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAAATCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AGCAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGACAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_hyperboreum ----------GTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGTGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATAAA---------------TTATATTATTAATATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAACCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCC-C--------------------TAGGATGATGCACAAGAAATGGTCGGGA------------------------TGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACTAAATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGCGTAATTTATTGAGCAAATAGCACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTTAAACAAAA-----AAAGACTTTTTTTTGTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTGATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATT-----------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTATTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG-------GCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTCAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGAGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAGG-GGGCCA--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AAGGG---GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTC-GGGGTGGGCCGACGAAACGGGCAGAT-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCGGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCATGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCGAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGTTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGATAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTACTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATGTCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGA----------------------- Sparganium_japonicum --CCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCTAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATATATATATATATAGGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGG--TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTAAACTTTGTTTATACTATATTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACA-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCACAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AACGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGATT-------------GGATTATCTATAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCATGCTTCAGCCCACCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-CTCCGCCCAAG-GGGCGG--AGGGGGCAGAGTGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTTGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGTGCCC--AA------GGGCAT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGAAGGAACGTC-GGGGAGGGCCGACGAAACGGGCTAGA-GCCCGCCCCGCCGACATTCGTTCACGAGTTCACGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTAAACTCAGATTTGGAGCCTTATCTTGGCTTACATTACCCCGCTACAGATATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAACGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCC{AG}AGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGACTATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGAC?GTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCGCTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTACAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGAGGGCAGGAAAATGCACCCAAGGT Sparganium_natans -------------------------TTCAGAGAAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCGGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTAATATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAACCTTTGGATTTGATCCCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTT---------------------------------------------------------------------------TTTAGTGTCGATCGATACAATCTATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTTGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACTAAATC------------CTGGTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAATACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTGATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA---------------CCTATTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAT--ATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTCAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCGCCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGGGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCG---ATGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCACGCCC----GAGGGAGGAGGGACGTC-GGGGTGGGCCGACGAAACGGGCAGAT-GCCCGCCCCGCCGACGTTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCGGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------------------------------ATTCCGCAAGCTTCAAGATTTCTTTTCTTGAAGAATAAAGTGAGAATGATATGTGATTGTTCTGCTCCACCAGTTAATGTAATCCAGGATAAGAAATTACCGGAAGCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAATACATGTCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATTACCATAAACGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCGAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTTTGGTTTCTAGGGATAACACCTTCAGAGGCACAGATAATGGATATTGTTGCATGGCTACGAGAGTACCATGATAGTTCTACGGGATTGAGTACTGACAGTTTGACAGAAGCAGGTTTTCCAGGTGCTGCTGCACTAGGAGATGCAGTTTGTGGCATGGCTGCAATTAAGATATCTATAAAGGATTTTATCTTCTGGTTCCGATCCCACACAGCAAAGGAGATCAAGTGGGGTGGAGCTAAACATGAGCCTTCTGAAGGAAATGGTGACGGCAGGAAAATGCACCCACGGT Sparganium_subglobosum_1 --------------------------------AAACCCTG-GAATTAAAAACGGGCAA-TCCTGAGCCAAATCCTGATATTTTGATAAAACAAGGGTTT-ATAAAACTAGAATCAAAAAGGAAGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AGCTGTAATCCCTCTATCGAAATTACGGAAAGGATGGACGGATATACCTAATACATACGTATACATACTTACATATCAAACGATTAATCATGATCCGAATCCATATCATATAAATCCATATCATATAATATATTTATATTATTAA---------------TTATATTATTATTATTAATGTTTAT---------------------------------TAGGAAA-----TTCTGAATAATTGCAGA---------AATGCATTCCAATGGAAGGTGAACGAAGAATCGAATATTAAGTAATCAAACCATTCATTCCAAAGTTTGATAGATCTTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACGTGTCAGTCAATACCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATGCCCATTTTACTTACTAAGCTAAGTCTTTATCCTCT--------TTTTGTCAGCAATGGTTCAAACAAAATTAACTATCTTTCTTT----CTCATTCATTTTACTCTTTCACAAATGAATCCAACCAAACAGAAATCTTTGGATTTGATCCCATACAAATGAACATATATATA------------GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATATCATTATCCTTACATTTACTAAGTAATATTTTTGACTATTTTTTGATTTTACTTACTTTAATTG-ACATAAGTACAAGTACTCCAC--------------------TAGGATGATGCACAAGAAATGGTCGGG-TTTAGTGTCGATCGATACAAT-TATGTCCGATCAAAAAATT------------------CGGTAAATCCTTTTGTTTACTTTGTTTATACTAT-TTCTTTGTTTTGTGAGACGTCTAGAATTCATTACTAGTATCCCATATTGGGTAATAGACAATAGGCATATAA-----ATAAATACAAAA-------GAAGAGACTACAAGGCAAGGATGGGAAAAA-----AGAACAAATACTTTTAGGA-AGGA----TTACAAGTCTTCCGAATCTTCGATTCGACACAAGAAAA-GG-ATTTTTTA--------CCCTTTTCTTGTGTCGTCTTGTATCAAAATCAATACT-AATC------------CTGTTCCTCAAAGATTACTA-----TTCCTTCTTTTACGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAACAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGCAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTCTAACTTAGACAAATTATTCAAACAAAACAAAAAAAGACTTTTTTT-GTTCGGGTTGAAGGGAGGATTTTATTTTTACGACGATCCTAATCT------ATTATCTGATCAGAACTTTTATTTATTTATTTTTTAGAGTCGTTTTTATTAAAGTTCGATTAGTTTAGTCCATAAATTCGTTTATAGTCTAGAAATGATTTGCAAGATGTCTCATCCGTATAAATCCATATAAATATA----------------CTATTATATTATATTGGATTATCTAGAAAATTTGGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGCTTCGTAAGAGTGAATATATTATGTGGGAAGGGCAGGAACTATGAATCAATCGATCGATTCAATTCTTCACAACCATCATTAAGAAACAAAAGAATAGAGTG------TGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCCGATGACGGCAAGCGCCTCGGTTAAAA----------------------------------GGGTCCGGA-GGGCC-TTCCTCG--AAGGGCACCTAAGGCACGACGTCCGGCTCGCG---------TGAAGATACGTCCACCACTCGCCGTGTCTCGGTCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGTCCGTGGGCGCGGAGAGCCATCGTCCGCGTCCGC------CG-C-CCGCCCAAG-GGGCGG--AGGGGGCGGAGCGTCG-TTTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTCACACCAGGTATCGCACTTCGCTGCGTTCTTCATCGATGGGAGAGCCTAGATATCCGTTGCCGAGAGTCATCTAAGTA--TAAG---TATGGTCGGCCGCAGGGGGCGCCC--AA------GGGCGT-------CCCCACGCTTCCGTCTCTCTTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGGTCCCC-GTCGAC--CC--CCATGCCC----GAGGGAGGAGGGACATC-GGGGTGGGCCGACGAAACGGGCTGGC-GCCCGCCGCGCCGACATTCGTTCACGAGTTCGCGGGTCGT-CTTGGTCAGGTATCGATAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTATTACCATAAATGAGGATGATGATGAGACAGGCAGTGACC---AACAGCAGAAGGGCAGGAAACTTTGGGGATTAGTGGTCTGCCATCATACGAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTACGCCTGTGAATTTTTGTTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAGTTAGCTGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAGACTCTACTTTGTGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCTAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTCTGCTACCGGAATCAGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Typha_angustifolia ----TGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCGTATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGACCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTAGGAAATAATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT--------TTTTTTAATCAATGGTTCAAACAAAATTCATTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATA------------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTTTATTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATGCATAAGAAATGGTCGGGATTTCGTGTCGATCGATACAAT-TATGTATGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTAAATCCTTTTGCTTACTTTGTTTATACTA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGTAAATAGAACTTCTTCACTTA-TTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAA-ACTTTTATT-GTTCTTGTTGAAGGGAGGATTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTATTT-TTATTTTTTTAGAGTAGTTTTGATTAAAGTTCCATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTATAAATCCATATAAATATAATATTATACATATAA-ATATAATATTATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGTTTCCTAAGAGTGAATATATTATGTGGGAAGGGCAGGGACTATGAATCAATCGATAGATTCAATTCTTCACAAACATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCCGATGGCCG----CGCCGCGGT-----CCCGC----------GGCGCG-CGCCCGGTGT-GGGGTCCGGA-GGGCC-TTCCTCG--GAGGGGGTCGGAGGCACGACGTCCGGCTCGCG----CACGGT-AACGT-CGTCCACCACTCGCCGTGTCTCGGCCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGCCCGTGGGCACGGAGGGCCATCGTCCGCGTCCGCCGC---CGCC-CCGCCCGAGCGGGCGG--GGGGCGCGGAGCGTCG-TTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGGGAGAGCCGAGATATCCGTTGCCGAGAGTCATCT-GGTA-TTAAT---TTTGGTCGGCCGC-GGGGGCGCCCGGCA---CGCGGGCG--------CCCCGCGCTTCCGTCTCT-TTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCGTGCCCCCC-GTCGTC--CCTTACCCGCCC--GAGAGGGGAGAGGGACGCCGGGGGAGGGCCGGCGGGACGGGCGGGT-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGC-GGTCGTCCTTGGTCAGGCATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA----------------------TCGGCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAATGATCTGTGATTGTTCTGCTCCACCAGTTAAGGTAATCCAGGATAGGAAATTAGCAGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AACAGCCGAAAGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCAGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTATATTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGTCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCGATCTGTGGCATGGCTGCAATTAAGATATC-------------------------------------------------------------------------------------------------------------------- Typha_domingensis -----GCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCATATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGACCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTAGTAGGAAATTATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT--------TTTTTTAATCAATGGTTCAAACAAAATTCATTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTTTATTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATG------------------TTTCGTGTCGATCGATACAAT-TATGTATGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTAAATCCTTTTGCTTACTTTGTTTATACAA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGTAAATAGAACTTCTTCACTTA-TTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AA--ACTTTTATT-GTTCTTGTTGAAGGGAGGATTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTATTT--TTTTTTTTTAGAGTAGTTTTGATTAAAGTTCCATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTATAAATCCATATAAATATA----------------ATATTATATT-----------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGTTTCCTAAGAGTGAATATATTATGTGGGAAGGGCAGGGACTATGAATCAATCGATAGATTCAATTCTTCACAAACATCATTAAGAAACAAAAGAATAGAGTGGAT--ATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCCGATGGCAG----CGCCGCGGC-----------------------GCG-CGCTCGGTTT-GGGGTCCGGA-GGGCC-TTCCTCG--GAGGGGGTCGGAGGCACGACGTCCGGCTCGCG----CACAG------TACGTCCACCACTCGCCGTGTCTCGGCCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGTGCCCGTGGGCACGGAGGGCCATCGTCCGCGTCCGCCGC---CGCC-CCGCCCGAGCGGGCGG--GGGGCGCGGAGCGTCG-TTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGGGAGAGCCGAGATATCCGTTGCCGAGAGTCATCT-GGTA-TTAGT---TTTGGTCGGCCGCGGGGGGCG-----CA---CGCGGGCG--------CCCCACGCTTCCGTCTCT-TTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCATGCCCCCC-GTCGCCCTCCCTCCGCGCCC----GAGGGGAGAGGGACGCCGGGGGAGGGCCGACGGGACGGGCGGGT-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGC-GGTCGTCCTTGGTCAGGCATCGACAATGATCTTCCGCAGG-TTCACCTACGGAAACCTTG-TTACGACTTCTCCTTCCTCTA------------------------GGCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAGTGATCTGTGATTGTTCTGCTCCACCAGTTAAGGTAATCCAGGATAGGAAATTAGCGGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AACAGCCGAAAGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCAGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCTGCACTATATTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCGATCTGTGGCATGGCTGCAATTAAGATATCTTCAAAGGATTTT------------------------------------------------------------------------------------------------------- Typha_latifolia AACCTGCTAAGTGTTAACTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTCGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCGTATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGACCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTAGGAAATTATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT--------TTTTTTAATCAATGGTTCAAACACAATTCATTATCTTTTT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTTT-TTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATGCATAAGAAATGGTCGGGATTT?GTGTCGATCGATACAAT-CCTTTAGGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTA??TCCTTTTGCTTACTTTGTTTATACTA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAA-------GAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTTTTGAGTGAATAGAACTTCTTCACTTA-TTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAA-ACTTTTATT-GTTCTTGTTGAAGGGAGGATTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGCCG----CGCCGCGGT-----CCCGC----------GGCGCG-CACACGGTCT-GGGGTCCGGA-GGGCC-TTCCTCG--GAGGGGGCCGGAGGCACGACGT{AC}CGGCTCGCG----CACAG------TACGTCCACCACTCGCCGTGTCTCGGCCCCTGCCGA-CGGCCCGTGCTTCAGCCCGCCGCGCCCGTGGGCACGGAGGGCCATCGTCCGCGTCCGTCGC---CGCC-CCGCCCGAGCGGGCGG--GGGGCGCGGAGCGTCG-TTGGCGTGACGCCCAGGCAGGCGTGCCCTCGACCAGAAGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGGGAGAGCCGAGATATCCGTTGCCGAGAGTCATCT-GGTA-TTAAT---TTTGGTCGGCCGCGGGGGGCGCCCGGCA---CGCGGGCG--------CCCCGCGCTTCCGTCTCT-TTGTGTTCCTTGGCGCCATGTCGCGCCGGGG--TTCGTCCTTGCCCCCC-GTCGCC--CCCTCCGCGCCCTG--GAGGGAAGAGGGACGCCGGGGGAGGGCCGACGGGACGGGCGGGT-GCCCGCCCCGCCGGCGTTCGTTCACGAGTTCGC-GGTCGTCCTTGGTCAGGCATCGACAATGATCTTCCGCAGGTTTCACCTACGGAAACCTTGTTTACGACTTCTCCTTCCTCTA-------------------------GCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAATGATCTGTGATTGTTCTGCTCCACCAGTTAAGGTAATCCAGGATAGGAAATTAGCGGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AGCAGCCAAAGGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTATGTTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCAATCTGTGGCATGGCTGCAATTAAGATATCTTCGAAGGATTTTATCTTCTGGTTCC------------------------------------------------------------------------------------------ Typha_orientalis -----------------CTTCCAAATTCAGAGAAACCCTG-GAATTAAAAATGGGCAA-TCCTGAGCCAAATCCTTATATTTTGAGAAAACAAGGGTTT-ATAAAACTAGAATAAAAA----AGGATAGGTGCAGAGACTCGATGGAAGCTGTTCTAACGAATAGAGTTGACTACGTTGCGTTGGT-AACTGGAATCCCTTTATCGAAATTACAGAAAGGATGGCCGTATATACCTAATACGTACGTATACATACTTACATATCAAACGATTAATCACGATCCGAATCCATATCATAT---------------AATATATTTATATTATTAA---------------------------------TGTTTATTAGGAAATTATGAATGATTATGAAA--------TAGGAAA-----TTCTGAAAAATTGCAGA---------AATGCATTCCAATGGAAGTTGAAGGAAGAATCGAATATTAAGTAATCAAATCATTCATTCCAAAGTTAGGTAGATCGTTTGAAAAACTGATTAATCGGACGAGAATAAAGAGAGAGTCCCATTCTACATGTCAGTCAATACCGGCAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCC---GCCCATTTTACTTACTAAGCTAAGTCTTTATCCTAT--------TTTTTTAATCAATGGTTCAAACAAAATTCATTATCTTTCT--------CATTCATTTTACTCTTTCACAAATGAATCTAACCAAACATAAATCTTTGGATTTTATACCATACAAATGAACATATATATATA----------GGCAAGGAATCTCTATTATTAAATCATTCATAATTCATATCATTATCCTTACATTTACTAAGTCATATTTTATACTATTTTTT--TTTTAGTTACTTTAATTG-ACATAAGTACAAGTACTCTAC--------------------TAGTATGATGCATAAGAAATGGTCGGGATTTCGTGTCGATCGATACAAT-TATGTATGATCAAAAAATTCTGTAAATCCTCAAAATTCTGTAAATCCTTTTGCTTACTTTGTTTATACTA---TTTTTGTTTTGTGGGACGTCTGGAATTCAGTACTTGTATCCCATTTTGGGTAAAAGACAATAGGCATATAATATAAATAAATACAAAATACAAAAGAAGAGAATACAAGGCAAGGATGGGAAAAA-----GGAACAAATACTTTTAGGA-AGGA----TTACTAGTCTTCCGAATCTTCTATTCGACACAAGAAAA-GGG--------TGAAAAATCC-TTTTCTTGTGTCGTCTTGTATCGAAAT----ACT-AATCACA--TTTTTTCCTATTCTTCAAAGATTACTA-----TTCCTTCTTTTCCGGGTCTATCGGAACTCCTTTGTTTAGATTCATAAGAAGTAGTGGACAAACAAAGGGAAAGAAAGGATTAT-----GGGGGAGTAATTTATTGAGTAAATAGAACTTCTTCACTTAATTTCA--TTTCTTCATTTATTCAATT-AAGTTAAACTTATAACTTAGACAAATTATTCAAACAAAA-----AAA-ACTTTTATT-GTTCTTGTTGAAGGGAGGGTTTT-TTTTTACGAAGATCCTAATCT------ATTATCTGATCAGAGTTTTTATTTATTTTTTTTTTAGAGTAGTTTTGATAAAAGTTCCATTAGTTTAGT-------------------CTAGAAATGATTTGCAGGATGTCTCATCCGTATAAATCCATATAAATATAATATTATACATATAA-ATATAATATTATATT------------------GGATTATCTAGAAAATCGATTGATTCCTTCTTTCTTCTTGTTTCCTAAGAGTGAATATATTATGTGTGAAGGGCAGGGACTATGAATCAATCGATAGATTCAATTCTTCACAAACATCATTAAGAAACAA{AT}{AT}GAATAGAGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGGCTTGCATTACCCTGCTACTGATATTCCGCAGGCTTCAAGATTTCTTTTCATGAAGAATAAAGTGAGAATGATCTGTGATTGTTCTGCTCCACCAGTCAAGGTAATCCAGGATAGGAAATTAGCGGAGCCTCTGACCCTGTGTGGATCTACCTTGAGGGCTCCCCATGGCTGCCATGCTCAGTACATGGCTAATATGGGCTCCATCGCCTCCCTTGTAATGTCTATCACGATAAATGAGGATGATGATGATACAGGTGATGACC---AGCAGCCAAAGGGCAGGAAGCTCTGGGGATTGGTGGTCTGCCATCACACAAGCCCGAGGTTTGTCCCTTTTCCACTCAGGTATGCCTGTGAATTTTTATTGCAAGTTTTTGGTATACAGTTGAATAAAGAGGTAGAATTAGCAGCTCAAGCAAAGGAGAAGAATATACTTCGGACACAAACTCTACTTTGCGATATGCTCCTCCGAGATGCTCCTATTGGTATTTTTACCCAGTCGCCCAATGTTATGGACCTTGTTAATTGTGATGGTGCAGCACTATGTTACCGGAATCAATTTTGGCTTCTAGGGATAACACCTTCAGAGGCACAGATAAAGGATATTGCTGCATGGCTACAAGAGTACCATGACGGATCTACTGGATTGAGTACTGACAGCTTGATAGAAGCAGGTTATCCAGGAGCTGTTGCACTAGGAGATGCAATCTGTGGCATGGCTGCAATTAAGATATCTTCGAAGGAT---------------------------------------------------------------------------------------------------------- ; END; BEGIN SETS; CHARSET trnL_F (CHARACTERS = 'Sparganium 28 taxa, 4-gene alignment') = 1-1022; CHARSET nDNA (CHARACTERS = 'Sparganium 28 taxa, 4-gene alignment') = 2012-3689; CHARSET psbA_petJ (CHARACTERS = 'Sparganium 28 taxa, 4-gene alignment') = 1023-2011; END; BEGIN TREES; TITLE 4_genes_37_taxa_bestML; LINK TAXA = Taxa1; TRANSLATE 1 Brocchinia_prismatica_1, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_1, 8 Sparganium_angustifolium_2, 9 Sparganium_angustifolium_3, 10 Sparganium_angustifolium_X_S._emersum, 11 Sparganium_emersum, 12 Sparganium_emersum_2, 13 Sparganium_emersum_3, 14 Sparganium_emersum_4, 15 Sparganium_erectum_subsp._microcarpum, 16 Sparganium_erectum_subsp._stoloniferum, 17 Sparganium_erectum_subsp._stoloniferum__var._macrocarpum, 18 Sparganium_eurycarpum, 19 Sparganium_eurycarpum_Engelm.var._greenei, 20 Sparganium_fallax_1, 21 Sparganium_fallax_2, 22 Sparganium_fluctuans, 23 Sparganium_glomeratum, 24 Sparganium_glomeratum_2, 25 Sparganium_glomeratum_3, 26 Sparganium_gramineum, 27 Sparganium_hyperboreum, 28 Sparganium_hyperboreum_2, 29 Sparganium_japonicum, 30 Sparganium_japonicum_X_S._fallax, 31 Sparganium_natans, 32 Sparganium_subglobosum_1, 33 Sparganium_subglobosum_2, 34 Typha_angustifolia, 35 Typha_domingensis, 36 Typha_latifolia, 37 Typha_orientalis; TREE bestREP1 = [&R] ((1:0.023960769999999992,(2:0.006460560000000004,3:0.004794949999999992):0.04439797000000001):0.11241586,(((34:0.0037313800000000064,35:0.004016080000000033):0.0016141999999999823,(36:0.005155010000000015,37:0.002012029999999998):0.001666570000000006):0.022573979999999993,(((18:0.002409330000000015,19:0.0022689899999999985):0.0020064099999999863,((10:1.0000000022492017E-8,15:0.0017761300000000146):0.0030971599999999877,(16:0.0019900999999999947,17:0.0031306200000000006):0.0010934300000000063):4.152799999999901E-4):0.004427310000000018,((31:0.001402010000000009,(27:8.811999999999987E-4,28:4.292800000000041E-4):0.003537309999999988):0.0037604900000000052,((4:0.005951100000000015,5:0.004898760000000002):2.81989999999982E-4,((32:9.999999994736442E-9,33:9.999999994736442E-9):0.0034780799999999945,((22:0.0021885799999999955,26:0.002166460000000009):0.0027810400000000124,((20:4.3086999999999986E-4,21:9.999999994736442E-9):0.003246180000000015,(7:6.12980000000013E-4,(6:3.1754000000000504E-4,9:9.999999994736442E-9,8:9.999999994736442E-9):0.001835360000000008):0.0036734800000000067,((29:0.0012147599999999814,30:9.999999994736442E-9):0.004303420000000002,((23:0.0013752599999999893,(24:0.0011511800000000016,25:4.625000000000046E-4):3.0594000000000454E-4):0.0029042099999999904,(11:9.999999994736442E-9,12:9.999999994736442E-9,13:4.617899999999897E-4,14:9.999999994736442E-9):0.0028407599999999977):0.0012294700000000103):3.025000000000111E-4):6.075700000000017E-4):0.001245329999999989):3.0364999999998865E-4):5.794300000000197E-4):0.0047226300000000054):0.037093970000000004):0.05620793); END; BEGIN TREES; TITLE 36_taxa_2_genes_nDNA_best; LINK TAXA = Taxa1; TRANSLATE 1 Brocchinia_prismatica_1, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_1, 8 Sparganium_angustifolium_2, 9 Sparganium_angustifolium_3, 10 Sparganium_angustifolium_X_S._emersum, 11 Sparganium_emersum, 12 Sparganium_emersum_2, 13 Sparganium_emersum_3, 14 Sparganium_emersum_4, 15 Sparganium_erectum_subsp._microcarpum, 16 Sparganium_erectum_subsp._stoloniferum, 17 Sparganium_erectum_subsp._stoloniferum__var._macrocarpum, 18 Sparganium_eurycarpum, 19 Sparganium_eurycarpum_Engelm.var._greenei, 20 Sparganium_fallax_1, 21 Sparganium_fallax_2, 22 Sparganium_fluctuans, 23 Sparganium_glomeratum, 24 Sparganium_glomeratum_2, 25 Sparganium_glomeratum_3, 26 Sparganium_gramineum, 27 Sparganium_hyperboreum, 28 Sparganium_hyperboreum_2, 29 Sparganium_japonicum, 30 Sparganium_japonicum_X_S._fallax, 31 Sparganium_natans, 32 Sparganium_subglobosum_1, 33 Sparganium_subglobosum_2, 34 Typha_angustifolia, 35 Typha_domingensis, 36 Typha_latifolia, 37 Typha_orientalis; TREE bestREP1 = [&R] ((2:0.01071528,3:0.00788746):0.13557014,(((36:1.0E-8,37:0.00137925):0.00565239,(34:0.0071093,(1:2.7E-5,35:0.00305546):0.00304345):0.00422413):0.02137018,(((16:0.00238099,(10:1.0E-8,15:0.00332814):0.00421021):0.00217478,(17:0.00535347,(18:0.00378684,19:0.00360464):0.00297076):0.00135054):0.00658067,((31:0.00158629,(27:0.00142346,28:1.0E-8):0.00333267):0.00681165,((4:0.00999406,5:0.007009):6.1152E-4,((32:1.0E-8,33:1.0E-8):0.00590421,((22:0.0046783,26:0.00454923):0.00389835,((20:8.626E-4,21:1.0E-8):0.00316265,(7:0.00131605,(6:6.8241E-4,9:1.0E-8,8:1.0E-8):0.00323079):0.00387015,((29:0.00424397,30:1.0E-8):0.00212056,((25:6.2548E-4,(23:0.00134783,24:7.6624E-4):6.7081E-4):0.00576506,(11:1.0E-8,12:1.0E-8,13:1.0E-8,14:1.0E-8):0.00618497):0.00122891):0.00136651):0.00128152):0.00263439):6.4108E-4):1.0385E-4):0.00698415):0.04789688):0.13557014); END; BEGIN TREES; TITLE 4_genes_37_taxa_strictconsensus_of_312_MPTs; LINK TAXA = Taxa1; TRANSLATE 1 Brocchinia_prismatica_1, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_1, 8 Sparganium_angustifolium_2, 9 Sparganium_angustifolium_3, 10 Sparganium_angustifolium_X_S._emersum, 11 Sparganium_emersum, 12 Sparganium_emersum_2, 13 Sparganium_emersum_3, 14 Sparganium_emersum_4, 15 Sparganium_erectum_subsp._microcarpum, 16 Sparganium_erectum_subsp._stoloniferum, 17 Sparganium_erectum_subsp._stoloniferum__var._macrocarpum, 18 Sparganium_eurycarpum, 19 Sparganium_eurycarpum_Engelm.var._greenei, 20 Sparganium_fallax_1, 21 Sparganium_fallax_2, 22 Sparganium_fluctuans, 23 Sparganium_glomeratum, 24 Sparganium_glomeratum_2, 25 Sparganium_glomeratum_3, 26 Sparganium_gramineum, 27 Sparganium_hyperboreum, 28 Sparganium_hyperboreum_2, 29 Sparganium_japonicum, 30 Sparganium_japonicum_X_S._fallax, 31 Sparganium_natans, 32 Sparganium_subglobosum_1, 33 Sparganium_subglobosum_2, 34 Typha_angustifolia, 35 Typha_domingensis, 36 Typha_latifolia, 37 Typha_orientalis; TREE Consensus_of_312_trees = [&R] ((1,(2,3)),(((34,35),(36,37)),((16,17,(10,15),(18,19)),((31,(27,28)),((4,5),((32,33),((22,26),((20,21),(7,(6,9,8)),((29,30),((23,24,25),(11,12,13,14))))))))))); END; BEGIN TREES; TITLE 4_genes_37_taxa_bayes_majorityrule_consensus; LINK TAXA = Taxa1; TRANSLATE 1 Brocchinia_prismatica_1, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_1, 8 Sparganium_angustifolium_2, 9 Sparganium_angustifolium_3, 10 Sparganium_angustifolium_X_S._emersum, 11 Sparganium_emersum, 12 Sparganium_emersum_2, 13 Sparganium_emersum_3, 14 Sparganium_emersum_4, 15 Sparganium_erectum_subsp._microcarpum, 16 Sparganium_erectum_subsp._stoloniferum, 17 Sparganium_erectum_subsp._stoloniferum__var._macrocarpum, 18 Sparganium_eurycarpum, 19 Sparganium_eurycarpum_Engelm.var._greenei, 20 Sparganium_fallax_1, 21 Sparganium_fallax_2, 22 Sparganium_fluctuans, 23 Sparganium_glomeratum, 24 Sparganium_glomeratum_2, 25 Sparganium_glomeratum_3, 26 Sparganium_gramineum, 27 Sparganium_hyperboreum, 28 Sparganium_hyperboreum_2, 29 Sparganium_japonicum, 30 Sparganium_japonicum_X_S._fallax, 31 Sparganium_natans, 32 Sparganium_subglobosum_1, 33 Sparganium_subglobosum_2, 34 Typha_angustifolia, 35 Typha_domingensis, 36 Typha_latifolia, 37 Typha_orientalis; TREE tree_1 = [&R] ((1:0.013986551111111106,(2:0.006884844000000001,3:0.006430547111111129):0.04252349999999999):0.10497572888888898,(((34:0.0039592346666666445,35:0.004635053777777787):0.0019555178253119476,(36:0.005686890222222213,37:0.0022644537777777862):0.0021795525606468913):0.022173117333333298,((16:0.002403527999999988,17:0.003491597777777772,(10:6.484342222222161E-4,15:0.0021378004444444487):0.002967095555555549,(18:0.0025046533333333287,19:0.002866991555555559):0.0020723808888888917):0.00469551066666668,((31:0.001900651555555577,(27:0.0012727911111111156,28:8.0823599999999E-4):0.0037717946666666613):0.004355968444444441,((4:0.006555999111111127,5:0.0052814862222222425):6.58607624633406E-4,((32:4.125955555555616E-4,33:4.199506666666686E-4):0.0037681377777777636,((22:0.0024813293333333375,26:0.0028152248888888842):0.003072186666666671,((20:9.08945777777781E-4,21:5.122053333333487E-4):0.0035568439999999757,(7:9.327528888888881E-4,(6:6.135675555555553E-4,9:2.992293333333451E-4,8:3.0271555555555496E-4):0.0024458946666666426):0.004000911999999995,((29:0.0016392826666666582,30:4.1980222222220975E-4):0.004418647111111118,((23:0.0018081288888888714,(24:0.0015182537777777838,25:6.9690622222221E-4):6.320880640465765E-4):0.003136819555555559,(11:5.691977777777801E-4,12:4.39365777777756E-4,13:8.708635555555455E-4,14:4.977457777777528E-4):0.0029213439999999924):0.0015198564444444673):9.46022716946826E-4):9.329162583519013E-4):0.0015794839999999921):6.136132623426882E-4):8.691943282194414E-4):0.005077902666666662):0.037788498222222244):0.05248786444444449); END; BEGIN TREES; TITLE Sparg_4_genes_28_taxa_time_BEAST; LINK TAXA = Taxa2; TRANSLATE 1 Brocchinia_prismatica, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_2, 8 Sparganium_angustifolium_3, 9 Sparganium_emersum, 10 Sparganium_erectum_subsp._stoloniferum, 11 Sparganium_erectum_subsp._stoloniferum_var._macrocarpum, 12 Sparganium_eurycarpum, 13 Sparganium_eurycarpum_Engelm.var._greenei, 14 Sparganium_fallax_1, 15 Sparganium_fallax_2, 16 Sparganium_fluctuans, 17 Sparganium_glomeratum, 18 Sparganium_glomeratum_2, 19 Sparganium_glomeratum_3, 20 Sparganium_gramineum, 21 Sparganium_hyperboreum, 22 Sparganium_japonicum, 23 Sparganium_natans, 24 Sparganium_subglobosum_1, 25 Typha_angustifolia, 26 Typha_domingensis, 27 Typha_latifolia, 28 Typha_orientalis; TREE TREE1 = [&R] ((1:31.59583318475727,(2:5.745628195842197,3:5.745628195842197):25.850204988915102):68.22257601416624,(((25:4.452024287216509,26:4.45202428721651):2.525897161404938,(27:4.934207111073432,28:4.934207111073435):2.0437143375480122):65.36940060493885,(((10:2.4963804742785975,11:2.496380474278598):1.8322734215246408,(12:2.683747261215359,13:2.683747261215359):1.6449066345878767):8.149085393692621,((21:3.519114406779877,23:3.519114406779877):4.737738979766177,((4:6.3689588011103275,5:6.36895880111033):0.9790220314930833,(24:6.802665541184139,((16:2.4010088040374926,20:2.4010088040374926):3.4792761230869997,((6:0.37473733349305616,(8:0.13630854177863608,7:0.13630854177863608):0.23842879171442002):4.971596070517946,((14:0.4986290371795814,15:0.4986290371795814):4.496971508555809,(22:4.4574847203735875,(9:3.231846397699445,(17:1.3826661152196817,(18:0.8353856483507149,19:0.8353856483507146):0.5472804668689681):1.8491802824797596):1.225638322674142):0.5381158253618032):0.3507328582756113):0.5339515231134904):0.9223806140596489):0.545315291419274):0.908872553942639):4.220885902949799):59.86958276406446):27.47108714536317); END; BEGIN TREES; TITLE Strict_consensus_of_24_MPTs_28_taxa; LINK TAXA = Taxa2; TRANSLATE 1 Brocchinia_prismatica, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_2, 8 Sparganium_angustifolium_3, 9 Sparganium_emersum, 10 Sparganium_erectum_subsp._stoloniferum, 11 Sparganium_erectum_subsp._stoloniferum_var._macrocarpum, 12 Sparganium_eurycarpum, 13 Sparganium_eurycarpum_Engelm.var._greenei, 14 Sparganium_fallax_1, 15 Sparganium_fallax_2, 16 Sparganium_fluctuans, 17 Sparganium_glomeratum, 18 Sparganium_glomeratum_2, 19 Sparganium_glomeratum_3, 20 Sparganium_gramineum, 21 Sparganium_hyperboreum, 22 Sparganium_japonicum, 23 Sparganium_natans, 24 Sparganium_subglobosum_1, 25 Typha_angustifolia, 26 Typha_domingensis, 27 Typha_latifolia, 28 Typha_orientalis; TREE Consensus_tree_of_24_trees_from_Sample_Trees = [&R] ((1,(2,3)),(((25,26),(27,28)),((10,11,(12,13)),((21,23),((4,5),(24,((16,20),((14,15),(6,8,7),(22,(9,(17,18,19))))))))))); END; BEGIN TREES; TITLE Sparg_4_genes_28_taxa_MLboot; LINK TAXA = Taxa2; TRANSLATE 1 Brocchinia_prismatica, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_2, 8 Sparganium_angustifolium_3, 9 Sparganium_emersum, 10 Sparganium_erectum_subsp._stoloniferum, 11 Sparganium_erectum_subsp._stoloniferum_var._macrocarpum, 12 Sparganium_eurycarpum, 13 Sparganium_eurycarpum_Engelm.var._greenei, 14 Sparganium_fallax_1, 15 Sparganium_fallax_2, 16 Sparganium_fluctuans, 17 Sparganium_glomeratum, 18 Sparganium_glomeratum_2, 19 Sparganium_glomeratum_3, 20 Sparganium_gramineum, 21 Sparganium_hyperboreum, 22 Sparganium_japonicum, 23 Sparganium_natans, 24 Sparganium_subglobosum_1, 25 Typha_angustifolia, 26 Typha_domingensis, 27 Typha_latifolia, 28 Typha_orientalis; TREE tree_1 = [&R] ((1:0.02233464099999999,(2:0.004943531500000015,3:0.005721644500000012):0.04111841319999998):0.1137740257,(((25:0.0038150220000000012,26:0.003869978600000018):0.001877583199999977,(27:0.0052015802,28:0.001945854899999988):0.0019948298958333277):0.02239635109999999,((10:0.0027060060999999913,11:0.0024366537999999938,(12:0.0020345284999999935,13:0.0025213067000000033):0.0018012432394366173):0.004543373900000008,((21:0.0043277194999999935,23:0.0014814160999999937):0.0037618600999999863,((4:0.005968022200000006,5:0.0046151048000000194):4.7759124999999236E-4,(24:0.0032536277000000113,((16:0.0022269779999999906,20:0.002367845499999993):0.002525895500000014,(22:0.00538571630000001,(14:4.3405039999999673E-4,15:9.999999994736442E-9):0.0031706776000000048,(6:3.7005860000000057E-4,8:1.0000000022492017E-8,7:1.0000000022492017E-8):0.005675156099999995,(9:0.0032564967,(17:0.0013835822000000109,(18:0.0010428544999999956,19:3.438208999999859E-4):4.5526152542374465E-4):0.0027594879999999766):0.0012280952702702908):6.864659420289798E-4):0.0014446516091954076):4.880905999999907E-4):7.665954166666822E-4):0.0046018656565656735):0.03703426210000002):0.056887012850000016); END; BEGIN TREES; TITLE 4_genes_37_taxa_MLbootstrap; LINK TAXA = Taxa1; TRANSLATE 1 Brocchinia_prismatica_1, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_1, 8 Sparganium_angustifolium_2, 9 Sparganium_angustifolium_3, 10 Sparganium_angustifolium_X_S._emersum, 11 Sparganium_emersum, 12 Sparganium_emersum_2, 13 Sparganium_emersum_3, 14 Sparganium_emersum_4, 15 Sparganium_erectum_subsp._microcarpum, 16 Sparganium_erectum_subsp._stoloniferum, 17 Sparganium_erectum_subsp._stoloniferum__var._macrocarpum, 18 Sparganium_eurycarpum, 19 Sparganium_eurycarpum_Engelm.var._greenei, 20 Sparganium_fallax_1, 21 Sparganium_fallax_2, 22 Sparganium_fluctuans, 23 Sparganium_glomeratum, 24 Sparganium_glomeratum_2, 25 Sparganium_glomeratum_3, 26 Sparganium_gramineum, 27 Sparganium_hyperboreum, 28 Sparganium_hyperboreum_2, 29 Sparganium_japonicum, 30 Sparganium_japonicum_X_S._fallax, 31 Sparganium_natans, 32 Sparganium_subglobosum_1, 33 Sparganium_subglobosum_2, 34 Typha_angustifolia, 35 Typha_domingensis, 36 Typha_latifolia, 37 Typha_orientalis; TREE tree_1 = [&R] ((1:0.023368934000000008,(2:0.006588434000000004,3:0.004692109100000008):0.041931318199999984):0.11597884960000004,(((34:0.0036698381999999974,35:0.0034938511000000005):0.0017983098571428546,(36:0.004788010900000028,37:0.0020060756999999985):0.0021493386956521476):0.022529137500000018,((16:0.0019188434000000087,17:0.002832284399999996,(10:5.051699999980563E-6,15:0.0017844566999999922):0.002747260306122462,(18:0.0020245510000000133,19:0.0022744192000000163):0.0019087966666666567):0.004333264444444457,((31:0.0013820754000000157,(27:9.354564000000065E-4,28:4.7558750000001315E-4):0.0034735055000000015):0.0037667969999999884,(4:0.005808284400000002,5:0.0050304025999999835,((32:9.999999994736442E-9,33:9.999999994736442E-9):0.0031413846999999995,((22:0.0022033842999999997,26:0.0021997871999999974):0.0027319043000000043,((20:4.4998509999999436E-4,21:9.999999994736442E-9):0.0028185938999999993,(29:0.0013065264000000076,30:9.999999994736442E-9):0.004146499393939379,(7:6.206855000000233E-4,(6:3.104530999999966E-4,8:9.999999994736442E-9,9:9.999999994736442E-9):0.0019693950505050573):0.003647622199999978,((23:0.0013045679000000254,24:9.510220000000236E-4,25:3.3994010000001906E-4):0.002600675899999988,(11:9.999999994736442E-9,12:9.999999994736442E-9,13:4.5306230000000114E-4,14:9.999999994736442E-9):0.003066465800000001):0.001283803975903608):8.192287878787952E-4):0.0013482143478260877):5.868884313725564E-4):6.808685937499948E-4):0.0045215935999999846):0.036718695999999995):0.057989424800000015); END; BEGIN TREES; TITLE Sparg_4_genes_28_taxa_bestML; LINK TAXA = Taxa2; TRANSLATE 1 Brocchinia_prismatica, 2 Puya_ferruginea, 3 Puya_venusta, 4 Sparganium_americanum, 5 Sparganium_androcladum, 6 Sparganium_angustifolium, 7 Sparganium_angustifolium_2, 8 Sparganium_angustifolium_3, 9 Sparganium_emersum, 10 Sparganium_erectum_subsp._stoloniferum, 11 Sparganium_erectum_subsp._stoloniferum_var._macrocarpum, 12 Sparganium_eurycarpum, 13 Sparganium_eurycarpum_Engelm.var._greenei, 14 Sparganium_fallax_1, 15 Sparganium_fallax_2, 16 Sparganium_fluctuans, 17 Sparganium_glomeratum, 18 Sparganium_glomeratum_2, 19 Sparganium_glomeratum_3, 20 Sparganium_gramineum, 21 Sparganium_hyperboreum, 22 Sparganium_japonicum, 23 Sparganium_natans, 24 Sparganium_subglobosum_1, 25 Typha_angustifolia, 26 Typha_domingensis, 27 Typha_latifolia, 28 Typha_orientalis; TREE bestREP1 = [&R] ((1:0.022707829999999984,(2:0.00586006,3:0.005711660000000007):0.04088259999999999):0.11404955,(((25:0.0037502500000000105,26:0.004085880000000014):0.0016440799999999922,(27:0.0052011800000000274,28:0.0020268900000000034):0.0016810099999999828):0.022764740000000006,(((10:0.002770469999999997,11:0.0024369699999999828):7.518700000000156E-4,(12:0.002115089999999986,13:0.002544829999999998):0.0015983400000000036):0.004855100000000001,((21:0.0043578100000000175,23:0.001444479999999998):0.003850429999999988,((4:0.006071909999999986,5:0.0047395699999999985):2.7272000000000407E-4,(24:0.003520430000000019,((16:0.00212341000000002,20:0.0024003900000000022):0.0026950799999999886,((14:4.254999999999953E-4,15:9.999999994736442E-9):0.0032129399999999975,(6:3.0779000000000223E-4,8:9.999999994736442E-9,7:9.999999994736442E-9):0.005662159999999999,(22:0.005349839999999995,(9:0.003073179999999981,(17:0.0013824199999999953,(18:0.001182820000000001,19:4.350300000000029E-4):2.9621999999998594E-4):0.0027811600000000047):0.0011869899999999989):6.091900000000094E-4):5.918000000000034E-4):0.0012099499999999874):2.9510000000002035E-4):5.489999999999939E-4):0.004525749999999995):0.037395209999999984):0.057024775); END;