#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 07, 2021; 1:30 GMT TreeBASE (cc) 1994-2008 Study reference: Arora D., & Frank J.L. 2014. Clarifying the Butter Boletes: a new genus, Butyriboletus, is established to accommodate Boletus sect. Appendiculati, and seven new species are described. Mycologia, 106(3): 464-480. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13879] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=49; TAXLABELS Boletus_abieticola_Arora11087 Boletus_appendiculatus_AF456837 Boletus_auripes_Arora11224 Boletus_autumniregius_ARI063 Boletus_autumniregius_Arora11108 Boletus_autumniregius_JDS289 Boletus_autumniregius_JLF2271 Boletus_barrowsii_Arora12009 Boletus_bicolor_AY612800 Boletus_calopus_AF456833 Boletus_coniferarum_AF456827 Boletus_coniferarum_EF530923 Boletus_deliciosissimus_Arora11053 Boletus_deliciosissimus_Arora11058 Boletus_edulis_AF050643 Boletus_edulis_v_grandedulis_Arora12011a Boletus_fechtneri_AF456821 Boletus_frustosus_Arora11116 Boletus_fuscoroseus_MG383a Boletus_inedulis_JQ327013 Boletus_luridus_AF139686 Boletus_persolidus_Arora027 Boletus_persolidus_Arora11103 Boletus_persolidus_Arora11110 Boletus_pinophilus_AF462358 Boletus_primiregius_DBB00606 Boletus_primiregius_JLF1973 Boletus_primiregius_JLF2030 Boletus_querciregius_Arora11100 Boletus_radicans_AF336241 Boletus_regineus_JLF2273 Boletus_regius_MG407a Boletus_regius_MG408a Boletus_rexveris_EU232005 Boletus_roseopurpureus_JLF2565 Boletus_roseopurpureus_JLF2566 Boletus_roseopurpureus_JLF2567 Boletus_sanicibus_Arora99211 Boletus_satanas_AF336242 Boletus_smithii_JLF2240 Boletus_speciosus_v_brunneus_Arora11221 Boletus_subappendiculatus_AT2010197 Boletus_subvelutipes_AY612804 Boletus_variipes_EU232003 Boletus_yicibus_Arora9727 Boletus_zelleri_EU486447 Melanogaster_tuberiformis_AF167679 Paxillus_involutus_AF098385 Xerocomus_chrysenteron_AF050647 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=91; TAXLABELS Boletus_abieticola_Arora11086 Boletus_abieticola_Arora11087 Boletus_abieticola_Cooke38653 Boletus_abieticola_HDT44741 Boletus_abieticola_HDT46430 Boletus_abieticola_HDT52625 Boletus_abieticola_JLF2564 Boletus_abieticola_OSC67698 Boletus_amygdalinus_AY918960 Boletus_amygdalinus_DQ974705 Boletus_appendiculatus_HM347642 Boletus_appendiculatus_HQ882196 Boletus_appendiculatus_HQ882204 Boletus_appendiculatus_UDB000652 Boletus_auripes_Arora11224 Boletus_auripes_DW73672 Boletus_autumniregius_Arora11095 Boletus_autumniregius_Arora11096 Boletus_autumniregius_Arora11108 Boletus_autumniregius_Arora11112 Boletus_autumniregius_Arora11113 Boletus_autumniregius_HDT43782 Boletus_autumniregius_JDS289 Boletus_autumniregius_JLF2271 Boletus_autumniregius_JLF2275 Boletus_autumniregius_OSC66191 Boletus_barrowsii_Arora12009 Boletus_bicolor_GQ166889 Boletus_calopus_HM347645 Boletus_coniferarum_EF530923 Boletus_deliciosissimus_Arora11053 Boletus_deliciosissimus_Arora11054 Boletus_deliciosissimus_Arora11058 Boletus_deliciosissimus_Arora11076 Boletus_deliciosissimus_Arora11077 Boletus_deliciosissimus_Arora977 Boletus_deliciosissimus_GU233427 Boletus_deliciosissimus_OSC59355 Boletus_edulis_Arora11223 Boletus_edulis_HM579928 Boletus_fechtneri_AT2003097 Boletus_fechtneri_HM347652 Boletus_fuscoroseus_JN903697 Boletus_fuscoroseus_MG383a Boletus_fuscoroseus_SP613117 Boletus_fuscoroseus_UDB000649 Boletus_mirabilis_JLF2235 Boletus_persolidus_Arora11102 Boletus_persolidus_Arora11103 Boletus_persolidus_Arora11109 Boletus_persolidus_Arora11110 Boletus_persolidus_HDT10943 Boletus_persolidus_Halling15 Boletus_primiregius_AHS69419 Boletus_primiregius_Arora11081 Boletus_primiregius_Arora11084 Boletus_primiregius_Arora11085 Boletus_primiregius_HDT47714 Boletus_primiregius_JLF1973 Boletus_primiregius_JLF2029 Boletus_primiregius_JLF2030 Boletus_primiregius_JLF2097 Boletus_primiregius_JLF2139 Boletus_querciregius_01MWB052012 Boletus_querciregius_01MWB120512 Boletus_querciregius_Arora11098 Boletus_querciregius_Arora11099 Boletus_querciregius_Arora11100 Boletus_querciregius_Arora12012 Boletus_querciregius_EU018562_ecm Boletus_radicans_JQ685716 Boletus_regineus_JLF2273 Boletus_regius_HM347661 Boletus_regius_MG407a Boletus_regius_MG408a Boletus_regius_PN40600 'Boletus rex-veris JLF2012' Boletus_roseopurpureus_JLF2565 Boletus_roseopurpureus_JLF2566 Boletus_rubripes_JLF2078 Boletus_sanicibus_Arora99211 Boletus_smithii_JLF2240 Boletus_speciosus_HQ882205 Boletus_speciosus_v_brunneus_Arora11221 Boletus_speciosus_v_brunneus_DW75591 Boletus_subappendiculatus_AT2010197 Boletus_subappendiculatus_HM347653 Boletus_yicibus_Arora9727 Boletus_zelleri_DQ974704 Paxillus_involutus_JF899567 Xerocomus_chrysenteron_DQ822793 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M16339] TITLE Boletus_ITS_1J7c5; LINK TAXA = Taxa2; DIMENSIONS NCHAR=813; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Boletus_abieticola_Arora11086 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GATGTGA-TAA--------------TG-ATCGTCAT--GGCTGGGGAGC-A-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTT-GTGA-------GGCTGACGAA---CG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTC- Boletus_abieticola_Arora11087 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-GGGAGC-G-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---TG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_abieticola_Cooke38653 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCAAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GATGTGA-TAA--------------TG-ATCGTCGT--GGCTGGGGAGC-A-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTT-GTGA-------GGCTGACGAA---CG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_abieticola_HDT44741 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-GGGAGC-G-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTT-GTGA-------{AG}GCTGACCAA---CG-TTGAG-TGGACTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_abieticola_HDT46430 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCACA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCAG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-GGGAGC-G-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---TG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_abieticola_HDT52625 CTTCC-{GT}TTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCA?TGAATCATCGAATCTTTGA{AC}CGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GATGTGA-TAA--------------TG-ATCGTCGT--GGCTGGGGAGC-A-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTT-GTGA-------GGCTGACGAA---CG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_abieticola_JLF2564 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCT?G-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-ACT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGAC-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-GGGAGC-A-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_abieticola_OSC67698 CTTCC-TTTTCATTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------T-GGAT-GA--CGGTTGATAAT---ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAA--GGA{CT}-GGG-----CGA-GTC-TTTG-ATGTGCAACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-GGGAGC-G-T-CAGA---CATGCATGGAATCCGTCTGTGATGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CG-TTGAG-TGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_amygdalinus_AY918960 CTCCCCTCGTCGTCAACC----CATTCGC-CTTCTCTCTCACCC-CCTGTGCACCCG-TTGTAGGTCCTCGAAAAGAGGAT-CTATG--TTTT----TTCATATCACAC--CCATCGCATGTCTATAGAATGTA------ATGTATTGAGATCGTCGACCTGTCTCACAGGCCTGGCGGCT--CAATGAAATC-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAGTGCGATAAGTAATGTGACTGATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGGCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCAATCGAATTCTCAACCATG-T-CTTGATC--GATTGTCA---AGGTCCATGG----CTTGGAGTTTGGGGGTTTGCTGGCGG--CGA---CGC-GCT------------GTC-AGCTCTCCTGAAATGCATTAAGCGAA--GGGC-AAG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-C--TC-GACGTGAATAA--------------TGAATCGTCGT--GGGCTGGGAGCGGTTCCAAA---CATGCAC-GAAATG----------------------------------------------------------------------------------GGTCCCTGTGCC--------------------------------------------------------------------------------------------------- Boletus_amygdalinus_DQ974705 CTCCCCTCGTCGTCAACC----CATTCGC-CTTCTCTCTCACCC-CCTGTGCACCCG-TTGTAGGTCCTCGAAAAGAGGAT-CTATG--TTTT----TTCATATCACAC--CCATCGCATGTCTATAGAATGTA------ATGTATTGAGATCGTCGACCTGTCTCACAGGCCTGGCGGCT--CAATGAAATC-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTTGATC--GATTGTCA---AGGTCCATGG----CTTGGAGTTTGGGGGTTTGCTGGCGG--CGA---CGC-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCGAA--GGGC--AG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-C--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGCGGTT-CAGA---CATGCAC-GAATGGTCCT---GTGCTTCTAAT----------------------------------------------------CTTCCCTACCCTGGCCCTCG?GTCACGTC-GCTTTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CGTTGAAGCGTGCGTGGTCGCTGGCTGGCGTGTTTTCGAAACTTG Boletus_appendiculatus_HM347642 CTTCC-TTTTCGTCGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------CT--AT-GA--TGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGGA-CACAGGG--TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CCTACTA-----GGCTAGCCTCGGC-----------------------------------------------------------------------------------------TTGTCTCTATTCG Boletus_appendiculatus_HQ882196 CTTCC-TTTTCGTTGACC-----TTTCTC-ACATAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATGTTTTTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------CT--AT-GA--TGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCGTCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TC--TTTTT------AGGA-CACAG-G--TTTGGAGTT--GGGAGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CCTACTA-----GGCTAGCCTCGGC-----------------------------------------------------------------------------------------TTGTCTCTATTCG Boletus_appendiculatus_HQ882204 CTTCC-TTTTCGTCGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------CT--AT-GA--TGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGGA-CACAGGG--TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CCTACTA-----GGCTAGCCTCGGC-----------------------------------------------------------------------------------------TTGTCTCTATTCG Boletus_appendiculatus_UDB000652 CTTCC-TTTTCGTCGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACTGTC-------------CT--AT-GA--TGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TC--TTTTTT-----AGGA-CACAGGG--TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CCTACTA-----GGCTAGCCTCGGC-----------------------------------------------------------------------------------------TTGTCTCTATTCG Boletus_auripes_Arora11224 TTCTTTCCTTTGTCGACC-----TTTCTC-TTTCTC---TCACA-CCTGTGCACCCA-TCGTAGGCCCTCG-AAAGAGGAT-CTATG---CTT----TTCTCATCACAT--CCATCGTATGTCCATAGAATGTA-TTAGTATGATCCGT-------------CGACCTCAGTCGGCGATCTACAAATAAATAA-ATGACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTCTCAACCATG-T-CTCGATC--GATGTCGAGCGAGG-GCATGG----CTTGGATATTTGGGGGTTGCTGGCAT--TGA---AAG-AA-------------GTC-AGCTCTCCTGAAATGCATG-AGCGAA--AAAG--GG--CAGCAAAGTCCTTCTGACATTGCATGGCC-T--TCCGACGTGA-TAAACCTATCATGGTCCTA-CTCGTCGT--GGCT-GGGAGT--GTCGGAG---ATTGCAA-GAAATGTCCATTTTTGCTTCCAATCTGAATC{AT}GAATCAGATATAAGTTGGAGGAGAGGGGAAGGGAAGGGGGGGACTCATGCTCACCCAAGCTCAGGCTGTGAGCAAGCTTAGCTAC--TA-GTTGGTC----AGAACTTAGGCCAGCGAA---CGCAGCTGTGTGTCTCCGTTGACCTTGATCCTTGAATCCAATCTG Boletus_auripes_DW73672 TTCTTTCCTTTGTCGACC-----TTTCTC-TTTCTC---TCACA-CCTGTGCACCCA-TCGTAGGCCCTCG-AAAGAGGAT-CTATG---CTT----TTCTCATCACAT--CCATCGTATGTCCATAGAATGTA-TTAGTATGATCCGT-------------CGACCTCAGTCGGCGATCTACAAATAAATAA-ATGACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTCTCAACCATG-T-CTCGATC--GATGTCGAGCGAGG-GCATGG----CTTGGATATTTGGGGGTTGCTGGCAT--TGA---AAG-AA-------------GTC-AGCTCTCCTGAAATGCATG-AGCGAA--AAAG--GG--CAGCAAAGTCCTTCTGACATTGCATGGCC-T--TCCGACGTGA-TAAACCTATCATGGTCCTA-CTCGTCGT--GGCT-GGGAGT--GTCGGAG---ATTGCAA-GAAATGTCCATTTTTGCTTCCAATCTGAATCTGAATCAGATATAAGTTGGAGGAGAGGGGAAGGGAAGGGGGGGACTCATGCTCACCCAAGCTCAGGCTGTGAGCAAGCTTAGCTAC--TA-GTTGGTC----AGAACTTAGGCCAGCGAA---CGCAGC--------------------------------------- Boletus_autumniregius_Arora11095 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTACAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-{AG}GCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--ATG-TTGAG-CAGGCTGAGC------TAGGCA-------------- Boletus_autumniregius_Arora11096 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTACAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAA{CT}------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--ATG-TTGAG-CAGGCTGAGC------TAGGCA-------------- Boletus_autumniregius_Arora11108 ---CC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAA{AG}AGGAT-CTATG---TTT----TTCACATCACAC{AC}-CTGTCGTATGTCTATA{AG}AATGTA-TTG--AAAACCGAC-------------CAGGA--GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCA{CG}CAACGGATCTCTGGGCTCTCGCATCGATGAA?AACGCACCGGATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--A--------------------------------------------- Boletus_autumniregius_Arora11112 --------TTTGTTGACC-----TTTCTC-ATATAC-AAGCACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTT------------------------------------------------------------------------------- Boletus_autumniregius_Arora11113 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--ATG-TTGAG-CAGGCTGAGC------TAGGCA-------------- Boletus_autumniregius_HDT43782 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC--CTA-----GGCTAGCCT---------------------------------------------------------------------------------------------------------- Boletus_autumniregius_JDS289 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTCC----A-G-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-{AG}GCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--ATG-TTGAG-CAGGCTGAGC------TAGGCATTTGTCTCTATTCG Boletus_autumniregius_JLF2271 -------------TGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-{AG}GCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--ATG-TTGAG-CAGGCTGAGC------TAGGCATTTGTCTCTATTCG Boletus_autumniregius_JLF2275 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC--CTA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGT{CT}-GTGA-------GGCTGACGGA--ATG-TTGA-GCAGGCTGA---------------------------- Boletus_autumniregius_OSC66191 CTTCC-TTTTTGTTGACC-----TTTCTC-ATATAC-AA-CACACCCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC---TTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ACGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTACTTTA-GTCAGTC-GTGA-------GGCTGACGGA--ATG-TTGAG-CAGGCTGAGC------TAGGCATTTGTCTCTATTCG Boletus_barrowsii_Arora12009 ----GGGTTTCCTCGGACTCCCCTTTCTA-GTTTTCCTTATTCA-CCCGTGCACCCT-TTGTAGGCCCTCG-AGAGAGGAT-CTACG---TTT----TCTGTAATCTACT-CTATTGCATGTCCAGAACGTACA------------------------------------------------------CAAACTTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTCGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TGGAATTCTCAACCGTG-T-CTCGATC-TGATCTC-----GAG-GCATGG----CTTGGACTT--GGGAGTTGCTGGCG----------GC-CTC------------GTC-AGCTCTCCTCAAACACATT-AGCGAC--GTTC--GT-----CAA-GCC---TG-ACGTGC-ACGGCCTTTGTCCGACGTGA-TAA--------------CG-ATCGTCGTGGGGCT--GGAGC--GT-AGGG---CGAGCGGTGAATC----------GCTTCCAATCC-----------------------------------------------TTAGACTTTTGGTCCTTCATCGGAACTTGAAAAGCCTTAGTTAC--TA-GTCGGTC-GTGA-------GGCCGACGAACG-GGCAGGGTCTAGGTTTGAAACTTTGGAGCAATTGTAACCCCCCTC Boletus_bicolor_GQ166889 CTACC-TTCTCGTCGACC------TTTTC-TCACAC---ACACA-CCTGTGCACCCA-TTGTAGGCCCTCG-AAAGAGGAT-CTATG--TTTT----TCCATATCACAC--CCATCGCATGTCTATAGAATGTA-TTG--AAAACGTCG---------ACCGACCTGACGGTCGGGGGGCGGTTTAAATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTCTCAACCATG-T-CTTGATT--TATTTC-----GAG-GCATGG----CTTGGAGTT-GGGGGTTTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA--GGGC--GG-----CAA-GTC-TTTG-ACATGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGT--GT-CACAGGACATGCAT-GAATCGTCC----GTGCTTCTAAT------------------------------------------------CCT---A-----------------------------CCTAGCCAC--GA-GTCGAGA------------GGCGGCTGGC------------------------------------TTGTGTTTTTGG Boletus_calopus_HM347645 CTTCC-TTGTCGTCGTCC-----TTTCTC-TCACACAACACACA-CCTGTGCACCTG-TTGTAGGTCCTCG-AAAGAGGAT-CTATG---TTT----TTCACATCACAC--CCATCGTATGTCTATAGAATGTA-ACC--AGAACGTCG-------ACCT--GT-T--CAGCAGGCCGGCGGTC--GATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTCGATC--TATTTC-----AAG-GCATG--GC-TTGGAGTTG--GGGGTTTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-GGGGC--AG-----CAA-GTC---TG-ACGTGC-CCGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC--GT-CTGGACTTGTGCAT-GAAACGTCC----CTGCTTCCAAT------------------------------------------------CCT---ACACCCTACCTAGCC---------------TTTGACTAC--CA-GTCGGTC-GTGA-------GGCCGGCGAA---CGTCAG--GTGTGCTGGGC------------TTGGGTCCATTTCG Boletus_coniferarum_EF530923 CTTCC-TTGTCGTCGACC-----TTTCTC-TCACACAACACACA-CCTGTGCACCTG-TTGTAGGTCCTCG-AAAGAGGAT-CTATG---TTT----TTCACATCACAC--CCATCGTATGTCTATAGAATGTA-ACC--AGAACGTCG-------ACCT--GT-T--CAGCAGGCCGGCGGTC--GATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTCGATC--GATTTC-----AAG-GCATG--GC-TTGGAGTTG--GGGGTTTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA--GGGC--GG-----CAA-GTC---TG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC--GT-CTGGACGTGTGCAT-GAAACGTCC----CTGCTTCCAAT------------------------------------------------CCTAC-ACACCCTACCTAGCC---------------TTTGACTAC--TA-GTCGGTC-GTGA-------GGCCGGCGAA---CGTCAG--GTGTGCTGGGC------------TTGGGTCCATTTCG Boletus_deliciosissimus_Arora11053 -------------------------TCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA--TTAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-G-TGGTC-GTGA-------GGCTGACGAA---CATTGAG-TTGGGCTGAGC------AAGGCTTTTGTCTCTATTCG Boletus_deliciosissimus_Arora11054 CTTCC-TTTTCGTCGACCCCC-TTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA--TTAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCAC-------------------------------------------------------------------------------------------- Boletus_deliciosissimus_Arora11058 CTTCC-TTTTCGTCGACCCCCTTTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA--TTAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CATTGAG-TTGGGCTGAGC------AAGGCTTTTGTCTCTATTCG Boletus_deliciosissimus_Arora11076 ----------------------TTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA--TTAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CATTGAG-TTGGGCTGAGC------AAGGCTTTTGTCTCTATTCG Boletus_deliciosissimus_Arora11077 CTTCC-TTTTCGTC{GT}ACCCCCTTTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA--TTAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CATTGAG-TTGGGCTGAGC------AAGGC--------------- Boletus_deliciosissimus_Arora977 CTTCC-TTTTCGTCGACCCCCTTTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA---TAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-GTGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CGTTGAG-TTGGGCTGAGC------AAGGCTTTTGTCTCTATTCG Boletus_deliciosissimus_GU233427 CTTCC-TTTTCGTCGACCCCCTTTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA--TTAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTCGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGATGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CGTTGAG-TTGGGCTGAGC------AAGGCTTTTGTCTCTATTCG Boletus_deliciosissimus_OSC59355 CTTCC-TTTTCGTCGACCCCCTTTCTCAC-ACACAA-CA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGA--TGGTCAATAATA---TAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACCCCATG-TC--TTTTTT-----AG-AGCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCC------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGACGGGG-----CAA-GTC-TTTG-ACGTGC-ATGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-AGGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCTCGGC--TTGGTCACTTTTAACTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA---CATTGAG-TTGGGCTGAGC------AAGGCTTTTGTCTCTATTCG Boletus_edulis_Arora11223 CTTTCTCTTTCGTGGAACCTCCCCTTTCT-AGTTTCCTTATCCA-CCTGTGCACCCT-TTGTAGGCCCTCG-AAAGAGGAT-CTACG---TTTTCTCTATATACGCTTTTTGCTA{CT}GCATGTCCAGAATGTATA------------------------------------------------------CAAAC-TTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-TCCTTGAAT-------------TAG-GCATGG----CTTGGACTT--GGGGGTTGCTGGCAC--------ACG-T-T------------GTC-AGCTCTCCTGAAATGCATT-AGCGAT--GTTC--AG-----CAA-GCC---TGAACGTGC-ACGGCCTT--TTCGACGTGA-TAA--------------CG-ATCGTCGT-GGGCT--GGAGC--GT-AGGG---TGAGCAGTGAATC----------GCTTCTAATCTATACCTCAGTTACTAGTCGGTCGTGAGACTGA---------------CGAACGCGCGAGG------CTTGATCTTGGACAGCCTTAGTTAC--TA-GTCGGTC-GTGA-------GGCCGATGAACG-CGCAGGGTTAGGACCATTGAAC----------------------- Boletus_edulis_HM579928 CTTTCTCTTTCGTGGAACCTCCCCTTTCT-AGTTTCCTTATCCA-CCTGTGCACCCT-TTGTAGGCCCTCG-AAAGAGGAT-CTACG---TTTTCTCTATATACGCTTTTTGCTACGCATGTCCAGAATGTATA------------------------------------------------------CAAAC-TTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTTGAAT-------------TAG-GCATGG----CTTGGACTT--GGG?GTTGCTGGCAC--------ACG-T-T------------GTCAAGCTCTCCTGAAATGCATT-AGCGAT--GTTC--AG-----CAA-GCC---TGAACGTGC-ACGGCCTT--TTCGACGTGA-TAA--------------CG-ATCGTCGT-GGGCT--GGAGC--GT-AGGG---TGAGCAGTGAATC----------GCTTCTAATCTATACCTCAGTTACTAGTCGGTCGTGAGACTGA---------------CGAACGCGCGAGG------CTTGATCTTGGACAGCCTTAGTTAC--TA-GTCGGTC-GTGA-------GGCCGACGAACG-CGCAGGGTTAGGACCATTTGAA----------------------- Boletus_fechtneri_AT2003097 CTTTC-TTTTCGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACAACCATCGTATGTCTATAGAATGTA-TTG--ATTG------------------------------AATCAATAAT---ATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAGACCCCATG-TC-TTTTTAT-----AGG-GCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAG-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA-AGGAC-GAG-----CAA-GTC-TTTG-ACGTGCAACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGTGGGT-TAGA---CATGCAT-GAATTCGTCTATGTTGCTTCCAAT------------------------------------------------CC---TA-----GGCTAGCCTCTGC--TTGGTCAC-TTTAGCTAC--TA-GTCTGTC-GTGA-------GACAGATGAAA--CGTTTGA-GTGCACTGAGC------TAGGCTTTTGTCTTTGTTCG Boletus_fechtneri_HM347652 CTTTC-TTTTCGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTTCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACAACCATCGTATGTCTATAGAATGTA-TTG--ATTG------------------------------AATCAATAAC---ATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAGACCCCATG-TC-TTTTTAT-----AGG-GCATG-AGC-TTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAG-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA-AGGAC-GAG-----CAA-GTC-TTTG-ACGTGCAACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGTGGGT-TAGA---CATGCAT-GAATTCGTCTATGTCGCTTCCAAT------------------------------------------------CC---TA-----GGCTAGCCTCTGC--TTGGTCAC-TTTAGCTAC--TA-GTCTGTC-GTGA-------GACAGATGAAA--CGTTTGA-GTGCACTGAGC------TAGGCTTTTGTCTTTGTTCG Boletus_fuscoroseus_JN903697 CTTCC-TTGTCGTTAACC-----TTTCTC-ACACAC-AAACACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG-TTTTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGGACAGTCGGATAATGTTATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TCTTTTTTTC-----AAG-GCATG-AGC--TTGGAGTT--GGGGGCTGCTGGCAG--TGA---GAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA-GGAACGGGG-----CAA-GTCTTTTG-ACGTGC-ACGGCC-T--TC-GATGTGA-TAA--------------TG-ATCATCGT--GGCT--GGAGC-GTT-TGGA---CATGCAT-GAATCCGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TG-----GGCTAGCCTTGGCTTTTGGTCAC--TTAGCTAC--TA-GTTGGTC-ATGA-------GGCTGACGAA---CATT-GA-GTGGGCTGTGA----GCTAGGC-TGTGTCTCTATTCG Boletus_fuscoroseus_MG383a --------------------------------------AACACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG-TTTTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGGAC{AG}GTCGGATAATGTTATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TCTTTTTTTC-----AAG-GCATG-AGC--TTGGAATT--GGGGGCTGCTGGC{AC}A--{GT}GA---AAA-ACC------------GTT-GGCTTTCCTGAAAAGCCAT-TAGCAA-AGGACGGGG-----CCA-ATTCTTTG-ACGTGC-CC{CG}GCC-T--T{CT}-GATGTGA-TAA--------------TG-ATCGTCGG--GGGT--GGAAG-CTT-TGGA---CATGCAT-GAATCCGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TG-----GGCTAGCCTTGGCTTTTGGTCAC--TTAGCTAC--TA-GTTGGTC-ATGA-------GGCTGACGAA---CATT-GA-GTGGGCTGTGA----GCTAGGC-TGTGTCTCTATTCG Boletus_fuscoroseus_SP613117 -------------------------TCTC-ACACAC-AAACACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG-TTTTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGGACAGTCGGATAATGTTATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TCTTTTTTTC-----AAG-GCATG-AGC--TTGGAGTT--GGGGGCTGCTGGCAG--TGA---GAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA-GGAACGGGG-----CAA-GTCTTTTG-ACGTGC-ACGGCC-T--TC-GATGTGA-TAA--------------TG-ATCATCGT--GGCT--GGAGC-GTT-TGGA---CATGCAT-GAATCCGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TG-----GGCTAGCCTTGGCTTTTGGTCAC--TTAGCTAC--TA-GTTGGTC-ATGA-------GGCTGACGAA---CATTGGA-GTGGACTGTGA----GCTAGGC-TGTGTCTCTATTCG Boletus_fuscoroseus_UDB000649 CTTCC-TTGTCGTTAACC-----TTTCTC-ACACAC-AAACACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG-TTTTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------CGGGATGGGACAGTCGGATAATGTTATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAA-CCCATG-TCTTTTTTTC-----AAG-GCATG-AGC--TTGGAGTT--GGGGGCTGCTGGCAG--TGA---GAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA-GGAACGGGG-----CAA-GTCTTTTG-ACGTGC-ACGGCC-T--TC-GATGTGA-TAA--------------TG-ATCATCGT--GGCT--GGAGC-GTT-TGGA---CATGCAT-GAATCCGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TG-----GGCTAGCCTTGGCTTTTGGTCAC--TTAGCTAC--TA-GTTGGTC-ATGA-------GGCTGACGAA---CATT-GA-GTGGACTGTGA----G-TAGGC-TGTGTA-------- Boletus_mirabilis_JLF2235 CTTTGCCTTTCGTCGACC-----TTTCTC-ATA----ATACACA-CCTGTGCACCCATTTGTAGGTCTTCG-AAAGGGGATGCTACG---TTT----TTCACATCACAT--CTATCGTATGTCTACAGAATGTTATCA--AAGACTGTTGACCAGGCTTTGCCCTGGTTGGCTTGTCGATAAATA--AAATAA-AATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTCCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTTGATT--GATTTC-----AAGCGCATG--GC-TTGGATCTT--GGGGGTTGCTGGTGG--CCAATCACA-GCC------------ATC-AGCTCTCCTGAAATGCATT-AGCAAT--GGGT--TG-----TCTGGTCTATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGCGTTT-TTAAGACCATGCAT-GAATAGCCT----AAGCTTCTAAT---------------------------------------------------AATGATAAAGATAAGATTTGGA--TCCGTTAGCTTTAGTTAC--TA-GTCAGCC-GTGA-------GGCTGGCGAA---CACAGAGCAAAGATTT----------------------------- Boletus_persolidus_Arora11102 CTTCC-TTTTCATTGACC-----TTTCTC-ATACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCA-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TCG--AAGACCGTC-------------TC--AT-GA--CGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CTCATG-TC--TTTTT------AGG-CCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACAAA---C{AG}GTTGAG-CTAGCTGAGC------TAGGC-TTGGTCTCTATTCG Boletus_persolidus_Arora11103 ----------------------------------------CACA-CCTGTGCACCTG-TTGTAGGTCCTCA-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TCG--AAGACCGTC-------------TC--AT-GA--CGGTCGATAATT--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CTCATG-TC--TTTTT------AGG-CCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACAAA---CGGTTGAG-CTAGCTGAGC------TAGGC-TTGGTCTCTATTCG Boletus_persolidus_Arora11109 CTTCC-TTTTCATTGACC-----TTTCTC-ATACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCATATGTCTATAGAATGTA-TCA--AAGACCGTC-------------TC--AT-GA--CGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CTCATG-TC--TTTTT------AGG-CCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATT-GTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACAAA---CGGTTGAG-CTAGCTGAGC------TAGGC-TTTGTCTCTCTATT Boletus_persolidus_Arora11110 CTTCC-TTTTCATTGACC-----TTTCTC-ATACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCA-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TCG--AAGACCGTC-------------TC--AT-GA--CGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CTCATG-TC--TTTTT------AGG-CCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACAAA---CGGTTGA-------------------------------------- Boletus_persolidus_HDT10943 CTTCC-TTTTCATTGACC-----TTTCTC-ATACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCA-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TCG--AAGACCGTC-------------TC--AT-GA--CGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CTCATG-TC--TTTTT------AGG-CCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACAAA---CGGTTGAG-CTAGCTGAGC------TAGGC-TTGGTCTCTATTCG Boletus_persolidus_Halling15 CTTCC-TTTTCATTGACC-----TTTCTC-ATACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCA-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TCG--AAGACCGTC-------------TC--AT-GA--CGGTCGATA-----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CTCATG-TC--TTTTT------AGG-CCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGTATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TAGGTTGGTC-GTGA-------GGCTGACAAA---CGGTTGAG-CTAGCTGAGC------TAGGC-TTGGTCTCTATTCG Boletus_primiregius_AHS69419 CTTCC-{GT}TTTTGTTGACC-----TTTCTC-ACACAC-AA-TACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_primiregius_Arora11081 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-TACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G------------------------------------------- Boletus_primiregius_Arora11084 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-TACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCC Boletus_primiregius_Arora11085 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-TACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTT------------ Boletus_primiregius_HDT47714 -------------TGACC-----TTTCTC-ACACAC-AA-TACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCATCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_primiregius_JLF1973 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-{CT}ACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_primiregius_JLF2029 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-{CT}ACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_primiregius_JLF2030 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_primiregius_JLF2097 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTTGGTC-GTGA-------GGCTGACGAA--A-G-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_primiregius_JLF2139 CTTCCTTTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACCGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AAG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATTTATT-AGCAAA-AGGAT-GGG-----CAA-GTC-ATTG-ATGTGC-ACGGCC-T--TT-GACGTGA-TAA--------------TG-ATCGTCAT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTA--------------------------------------------------------------------------------------- Boletus_querciregius_01MWB052012 CTTTC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GTC-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCCATCTGTGCTGCTTCTAAT------------------------------------------------CC--CTA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTCGGTC-ATGA-------GGCTGATGAA---CG-TTGA-GCAGGCTGAGC------TAGGCTTTTGTCTCTATTCG Boletus_querciregius_01MWB120512 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GTC-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCCATCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----AGCTA-------------------------------------------------------------------------------------------------------------- Boletus_querciregius_Arora11098 CTTCC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTTG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GTC-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT-GGGAGC-G-T-CGGA---CATGCAT-GAATCCATCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTCAGTC-ATGA-------GACTGATGA------------------------------------------------- Boletus_querciregius_Arora11099 CTTTC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GTC-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCCATCTGTGCTGCTTCTAAT------------------------------------------------CC--CTA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTCGGTC-ATGA-------GGCTGATGAA---CG-TTGA-GCAGGCTGAGC------TAGGC--------------- Boletus_querciregius_Arora11100 CTT{CT}C-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GTC-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAAC-G-T-CCGA---CCTGCCT-GAATCCCTCTGGGCTGCTTCTAAT------------------------------------------------CC--CTA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTCGGTC-ATGA-------GGCTGATGAA---CG-TTGA-GCAGGCTGAGC------TATGCTTTTGTCTCTATTCG Boletus_querciregius_Arora12012 CTT{CT}C-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCAT-GAGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GT{CT}-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Boletus_querciregius_EU018562_ecm CTTTC-TTTTTGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAAACTGTC-------------CAGG-T-GA--CGGTTGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTA---TCAAA-TCCATG-TC--TTTTT------AAG-GCATGAGGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA-AGGAT-GGG-----CGA-GTC-ATTG-ACGTGC-ACGGCCTT--TT-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CCGA---CATGCAT-GAATCCATCTGTGCTGCTTCTAAT------------------------------------------------CC---TA-----GGCTAGCCTTGGC--TTGGTCAC--TTAGCTAC--TA------------------------------------------------------------------------------ Boletus_radicans_JQ685716 CTCGC-TCGTC-TCGACC-----TTTCTC-TCATAC-ACCCACA-CCTGTGCACCCT-TTGTAGGCCCTCG-AAAGAGGAT-CTATG---TTT----TTCACATCACAC--CCGTCGTATGTCTATAGAATGTA-TTC--AGAACGTCG-------ACCT--GTTT--CGGCAGGCCGGCGGTC--GATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAAAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAAATTTTCA?TGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC?GAGGAGCATGCCTGTTTGAGTGTCA-TCGAACCATCAACCATG-C-CTTGATC--GATTTC-----AAG-GCATG--GC-TTGGAGTTG--GGGGTTTGCTGGCGG--CAA---AAC-?CC------------ATC-AGCTCTCCTGAAATGCATT-AGCAAA--GGGC--GG-----CAA-GTC---TG-ACGTGC-ACGGCC-T--TC?GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC--GT-TGGA---CGTGCAT-GAATCGACC----TTGCTTC?GAA------------------------------------------------CCT-TTACCCCGCTCTACCCTTC?GAGTTG------CTCAGCTAC--TA-GCTGGTC-GTGA-------GGCTGGCGAA---CGTCGG--GCAGCTTGGAG----GGGGGACTTTTGGGCTATTTCG Boletus_regineus_JLF2273 --------TTCATGGACCCCCCCCTTTCT-AGTTTCCTTATCCA-CCTGTGCACCCT-TTGTAGGCCCTCG-AAAGAGGTT-CTATG---TTTT---TATCTATCTACTACCACATGTATGTCCAGAATGTATA------------------------------------------------------CAAAT-TTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTTGAAT-------------GAG-GCATGG----CTTGGACTT--GGGGGTTGCTGGCAC--------ATG-TCT------------GTC-AGCTCTCCTGAAATGCATT-AGCGAT--GGTC--AG-----CAA-GCC---TG-ACGTGC-ACGGCCTT--TTCGACGTGA-TAA--------------CG-ATCGTCGT-GGGCT--GGAGC-GGT-AGGG---TGAGCGGTGAATC----------GCTTCTAATCTAA------------AGTCGGTCGTGAGACTGA---------------C--------------------------TGAGGGCCTTTAGTTAC--TA-GTCAGTC-GTGA-------GGCTGACGAACG-CGCAGGGTCT----------------------------------- Boletus_regius_HM347661 CTCCC-TTTTCGTTGACC-----CTTCTC-ATACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC---------GCGGTGCG-T-GA--CGGTCGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCATTTGAATTTC---TCAAACT-CATG-TC--TTTTTT-----AGG-GCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAATAGGAC-GGG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT-----------------------------------------------CCCCCCTA-----GGCTAGCCTTGGC--TTGGTCAC-TTTAGCTAC--TA-GTCCGGCAATCA-------GGCTGAAGAA---CG-TTGG-GCGGGCTGAGC------TTGGG-CTTGTCTCTTTTCC Boletus_regius_MG407a CTCCC-TTTTCGTTGACC-----CTTCTC-ATACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC---------GCAGTGCG-T-GA--CGGTCGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAACT-CATG-TC--TTTTTT-----AGG-GCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAATAGGAC-GGG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT-----------------------------------------------CCCCCCTA-----GGCTAGCCTTGGC--TTGGTCAC-TTTAGCTAC--TA-GTCGGTCAATCA-------GGCTGATGAA---CG-TTGG-GCGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_regius_MG408a CTCCC-TTTTCGTTGACC-----CTTCTC-ATACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC---------GCAGTGCG-T-GA--CGGTCGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAACT-CATG-TC--TTTTTT-----AGG-GCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAATAGGAC-GGG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT-----------------------------------------------CCCCCCTA-----GGCTAGCCTTGGC--TTGGTCAC-TTTAGCTAC--TA-GTCGGTCAATCA-------GGCTGATGAA---CG-TTGG-GCGGGCTGAGC------TAGGC-TTTGTCTCTATTCG Boletus_regius_PN40600 CTCCC-TTTTCGTTGACC-----CTTCTC-ATACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CTGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC---------GCAGTGCG-T-GA--CGGTCGATAATA--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAACT-CATG-TC--TTTTTT-----AGG-GCAT-GAGCTTTTGGAGTT--GGGGGCTGCTGGCGG--TGA---AAA-GCT------------GTC-GGCTCTCCTGAAATACATT-AGCAAATAGGAC-GGG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATCTGTCTGTGCTGCTTCTAAT-----------------------------------------------CCCCCCTA-----GGCTAGCCTTGGC--TTGGTCAC-TTTAGCTAC--TA-GTCGGTCAATCA-------G--------------------------------------------------------- 'Boletus rex-veris JLF2012' ------------TGGACC--CCCCTTTCT-AGTTTCCTTATCCA-CCTGTGCACCCT-TTGTAGGCCCTCG-AAAGAGGTT-CTATG---TT-----TATCTATCTACTACCCCATGTATGTCCAGAATGTATA------------------------------------------------------CAAAC-TTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCGTG-T-CTTGAAT-------------TAG-GCATGG----CTTGGACTT--GGGGGTTGCTGGCGC--------ACG--TT------------GTC-AGCTCTCCTGAAATGCATT-AGCGAC--GGTC--AG-----CAA-GCC---TG-ACGTGC-ACGGCCTT--TTCGACGTGA-TAA--------------TG-ATCGTCAT-GGGCT--GGAGC--GT-AGGG---CGAGTGGTGAATC----------GCTTCTAATCTAAACCTCAGTTACTAGTCGGTCGTGAGACTGA---------------CGAACGCGCGAGGCTTGATCTTGATCTTGGACAGCCTTAGTTAC--TA-GTCGGTC-GTGA-------GGCTGACGAA---CGCAGGGCCCC---------------------------------- Boletus_roseopurpureus_JLF2565 CTTTC-TTTTCGCCGACC-----TTTCTC-TTACTC---TCACA-CCTGTGCACCTA-TTGTAGATCCTCG-AAAGAGGAT-CTATG--TTTT----TTCA{CT}ATCACAC--CTGTCGCATGTCTATAGAATGTA-TGG--TCAA-CG--------------------------------AT--T--TATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTTC---TCAA--TCCATGATC---TTGACT----TGG-TCTTGGA---TTTGGTCTT--GGGAGCTGCTGGCGG--CAA---AAA-GCT------------GTT-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CGG-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-GTT-AGGA---CATGCATTGAATC-GTCTGTGTTGCTTCTAAT------------------------------------------------CCT-CTA-----GGCTAGCCTCAAG--TCGGTCA-GCTCAGCTAC--TA-GTCGGCC-ATGT-------GGCCAACGAA---CGTCGAGCATGGGCTGAGC---TTTTGGGCTTGTCTTC------- Boletus_roseopurpureus_JLF2566 CTTTC-TTTTCGCCGACC-----TTTCTC-TTACTC---TCACA-CCTGTGCACCTA-TTGTAGATCCTCG-AAAGAGGAT-CTATG--TTTT----TTCACATCACAC--CTGTCGCATGTCTATAGAATGTA-TGG--TCAA-CG--------------------------------AT--T--TATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTTC---TCAA--TCCATGATC---TTGACT----TGG-TCTTGGA---TTTGGTCTT--GGGAGCTGCTGGCGG--CAA---AAA-GCT------------GTT-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CGG-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-GTT-AGGA---CATGCATTGAATC-GTCTGTGTTGCTTCTAAT------------------------------------------------CCT-CTA-----GGCTAGCCTCAAG--TCGGTCA-GCTCA--------------------------------------------------------------------------------------- Boletus_rubripes_JLF2078 CTCGC-TCACCGTCGACC-----CTTCTC-TCATAC---ACACA-CCTGTGCACCTT-TTGTAGGCCCTCG-AAAGAGGAT-CTATG---TTT----TTCACATCACAC--CCATCGTATGTCTATAGAATGTA-TTC--AGAACGTCG-------ACCT--GTCT--CGGCAGGCCGGTGGTC--AATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATCATCAACCATG-T-CTTGATT--GATTTC-----AAG-GCATG--GC-TTGGAGTTG--GGGGTTTGCTGGCAG--CGA---AAT-GCT------------ATC-AGCTCTCCTGAAATGCATT-AGCAAA--GGGC--GG-----CAA-GTC---TG-TCGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC--TT-CGGA---CATGCAT-GAATCGACC----TTGCTTACGAA----------------------------------------------------C-AATTTACCCTAGCCTTCGAGCTG-------CTCAGCTAC--TA-GCTGGTC-GTGA-------GGCCGGCGAA---TGTCGG--GCGGCTTGGGG---------ACTTTTGGGCTATTTCG Boletus_sanicibus_Arora99211 CTTTC-TTTTCGTTGACC-----TTACTC-ACACAC-AA-CACA-CCTGTGCACCTA-TTGTAGGTCCTCG-AAAGAGGGT-CTATG---TTT----TTCACATCACACATTCATCGTATGTCTATAGAATGTA-TCG--AA----------------------------------TCGATGATATTATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC--TTTTTC-----AGG-GCAT-GAGC--TTGGAGTT--GGGGGCTGCTGGCAG--CGA---AAAGGCT------------GTC-GGCTCTCCTGAAATGTATT-AGCAAA-AGGAC-AAG-----CGG-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CAGA---CATGCAT-GAATTCGTCTGTGCTGCTTCCAAT------------------------------------------------CCCCCTAA----GGCTAGCCTCTGC--TTGGTCAC-TTTAGCTAC--TA-GTCTGTC-GTGA-------GACGGATGAAACCCA-TTGAGTTGAACTGAGC------TAGGC-TTTGTCTCCATTCG Boletus_smithii_JLF2240 CTTCGCTTTCCGTCGACC-----TTTCTCAACACAC---ACACA-CCTGTGCACCTA-TTGTAGGTCCTCG-AAAGAGGAT-CTATG--TTTT----TTCACATCACAC--CTATCGTATGTCTATAGAATGTA-TTG--AAAACCTGTCGGACCAGGCT--TGGCCCTGGTTTGGCAGGTCGATAAATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTCCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTCTCAACCATG-T-CTTGATC--GTTTTC-----GAGCGCATGG----CTTGGAGTT--GGGGGTTGCTGGCGG--CGA---AAA-CTTGACTTTTGGCCGGTC-GGCTCTCCTTAAATACATT-AGCAAA--GGGT--GG-----CTA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGCGACT-TGGACG-CATGCAT-GAATCGCCC----GTGCTTCTAAT---------------------------------------------------TCAGATAGATTCTGAGCCTTGGGGCTGAGC-TTTTTAGCTAC--TA-GTCGGTC-GTAACTTTTACGGCTGGCGAA---CGCAGC--AAGCAACGTTTCTGGGCTTGTCTTCTTTCTTTCTTCG Boletus_speciosus_HQ882205 CTTTC-TTTTCGCCGACC-----TTTCTC-TTACTC---TCACA-CCTGTGCACCTA-TTGTAGATCCTCG-AAAGAGGAT-CTATG--TTTT----TTCACATCACAC--CTGTCGCATGTCTATAGAATGTA-TGG--TCAA-CG--------------------------------AT--T--TATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TCGAATTTC---TCAA--TCCATGATC---TTGACT----TGG-TCTTGGA---TTTGGTCTT--GGGAGCTGCTGGCGG--CAA---AAA-GCT------------GTT-GGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CGG-GTC-TTTG-ACGTGC-ACGGCT-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-GTT-AGGA---CATGCATTGAATC-GTCTGTGTTGCTTCTAAT------------------------------------------------CCT-CTA-----GGCTAGCCTCAAG--TCGGTCA-GCTCAGCTAC--TA-GTCGGCC-ATGT-------GGCCAACGAA---CGTCGAGCATGGGCTGAGC---TTTTGGGCTTGTCTTCTATTTCG Boletus_speciosus_v_brunneus_Arora11221 CTTTC-TTTTCGTTGACC-----TTTCTC-TCACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG--TTTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------TG--AT-GA--CGGTCGATAAAT--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCTATG-T---TTCTTT-----AGGA-CAT-GGGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGAT--GG-----CAA-GTCTTTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTTGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-ATCTGTGCTGCTTCTAAT------------------------------------------------CC---TACTTAGGGCTACCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTCGGTT-GTGA-------GGCTGA---------------------------------------------------- Boletus_speciosus_v_brunneus_DW75591 -----------GTTGACC-----TTTCTC-TCACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG--TTTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTA-TTG--AAGACCGTC-------------TG--AT-GA--CGGTCGATAAAT--ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCTATG-T---TTCTTT-----AGGA-CAT-GGGC-TTTGGAGTT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAA--GGAT--GG-----CAA-GTCTTTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTTGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-ATCTGTGCTGCTTCTAAT------------------------------------------------CC---TACTTAGGGCTACCCTTGGC--TTGGTCAC--TTAGCTAC--TA-GTCGGTT-GTGA-------GGCTGACGAA---CG-TTGAG-CGCGCTGAG--------------------------- Boletus_subappendiculatus_AT2010197 ----------------------------------------------------------------------G-GAAGAGGAT-CTATG--TTTT----TTTACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCATC-------------CA--ATGGA--TGGTCAATAA----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC-TTTTTTT-----AGGA-CAT-GGGC-TTTGGAGTT--GGGGGCTGCTGGTGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTT-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC--TTAA----GGCTAGCCTTGGC--TTGGTCGC-TTTAGCTAC--TA-GTTGGTC-GTGA-------GGCTAATGAA---CGTTTGAG-CGGGCTGAGCTTTTTTTAGGC-TTTGTCTCTATTCG Boletus_subappendiculatus_HM347653 CTCCC-TTTTTGTCAACC----TTTTCTC-ACACAT-AA-CACA-CCTGTGCACCTG-TTGTAGGTCTTCG-GAAGAGGAT-CTATG--TTTT----TTTACATCACACA-CCATCGTATGTCTATAGAATGTA-TTG--AAGACCATC-------------CA--ATGGA--TGGTCAATAA----ATAAAT-CATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAA-CCCATG-TC-TTTTTTT-----AGGA-CAT-GGGC-TTTGGAGTT--GGGGGCTGCTGGTGG--TGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTT-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC--TTAA----GGCTAGCCTTGGC--TTGGTCGC-TTTAGCTAC--TA-GTTGGTC-GTGA-------GGCTAATGAA---CGTTTGAG-CGGGCTGAGCTTTTTTTAGGC-TTTGTCTCTATTCG Boletus_yicibus_Arora9727 CTTCC-TTTTCGTTGACC-----TTTCTC-ACACAC-AA-CACA-CCTGTGCACCTG-TTGTAGGTCCTCG-GAAGAGGAT-CTATG---TTT----TTCACATCACACA-CCGTCGTATGTCTATAGAATGTATTTG--AAGACCGTC-------------TC--AT-CA--CGGTCGATAA----ATAAAT-TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTTC---TCAAT-CCCATG-TC--TTTTT------AGCA-CAT-GGGC-TTTGGAATT--GGGGGCTGCTGGTGG--CGA---AAA-GCT------------GTC-AGCTCTCCTGAAATGCATT-AGCAAA--GGAC--GG-----CAA-GTC-TTTG-ACGTGC-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGC-G-T-CGGA---CATGCAT-GAATC-GTCTGTGCTGCTTCTAAT------------------------------------------------CC-CCTA-----GGCTAGCCCTGGC--TTGGTCAC-TTTAGCTAC--TA-GTCGGTC-GTGA-------GGCTGACGAA---C-GTTGAG-TGGGCTGAGC--CCTTTAGGC-TTTGTCTCTATTCG Boletus_zelleri_DQ974704 CTTCC-TTTTCGTCGACC-----TTTCTC-TTACTC---TCACA-CCTGTGCACACA-TTGTAGGTCCTCG-AAAGAGGAT-CTATG---TTT----TCATCATCACACA--CACTGTATGTCTAGAATGTATT-ACG--ATCGTCGAC---------CG--GCCTTGCGGTCGGGTGGCGGTCAAATAAATA-AATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TGTAATTCTCAACCATG-T-CTTGATT--GATTTC-----GAG-GCATGG----CTTGGACTT--GGGGGCTGCTGGCGG--CGA---AA--GCT------------GT?-GGCTCTCCTGAAAT?CATT-AGCA?C--GGAC--AG-----CGATGTC---TG-ACGTGC-ACGGCC-T--T--GACGTGA-TAA--------------TG-ATCGTCGT--CGCT--GGAGC--GT-CGGA---CGCGCAC---ACAAGTCCTC-TTGCTTCGAATCC-----------------------------------------------TTTTGACTTGAGACTTGG?CTTTC--GAGCGAAGCGTCAGCTAC--TA-GTCGGTC-GTGA-------G?CCGGCGAA---CGCAGGC-TTGCTCGGAGG---TCGGAGTCCCTCGTCTTCCTTGA Paxillus_involutus_JF899567 CCTTTCCTTCGGACGACC-----TTTCTT-----------CACA-CCCGTGCACCCA-TTGTAGGTCTCCG-CGAGGGGAT-CTATG---TCT----TC---ATAAAAC--TCTACGTATGTCTA-GGAATGTA-TCT--AAAGCGTCGACCGGCTTGGCTCGATGCCTGGTCGG--CGACGGTAAAGAACGA-AATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTTAATTCTCAACCATC-C-CTCGATT--CGTTTC-----GAG-GTTTGGC---TTGGATTTT--GGGGGCTGCCGGGCGACCCT---ACG-GTC------------TTC-GGCTCTCCTTAAAAGCATT-AGCGAT--GGTG--GAACGACCTA-ACT-CCAT-GCATGA-ACGGCC-T--TC-GACGTGA-TAA--------------TG-ATCGTCGT--GGCT--GGAGTGCTAGCGGGCGTCGTGAAG-----------CCGGCGCTTCTAAA-----------------------------------------------------------------------------------------------TC-TCTCGTC------------GAAAGACGAA-------------------------------------------ACTCG Xerocomus_chrysenteron_DQ822793 CTTCC-TTTTCGTCGACC-----TTTCTC-TTACTC---TCACA-CCTGTGCACACA-TTGTAGGTCCTCG-AAAGAGGAT-CTATG---TCT----TTATCATCACACA--CATCGTATGTCTAGAATGTATC-ACG--ATCGTCGAC---------CG--ACTTTGCGGTCGGGCGGCGGTCAAATAAATA-AATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGA---ATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGC-GCTCCTTGGTATTCC-GAGGAGCATGCCTGTTTGAGTGTCA-TTGAATTCTCAACCATG-T-CTTGATT--GATTTC-----GAG-GCATGG----CTTGGACTT--TGGGGTTGCTGGCGG--CGA---AA--GCT------------GTC-GGCTCTCCTGAAATGCATT-AGCAAT--GGAC--AG-----CAA-GTC---TG-ATGTGC-ACGGCC-T--T--GACGTGA-TAA--------------TG-ATCGTCGT--CGCT--GGAGC--AT-TGGA---CGAGCAT-GAATGAGTCTGT-TTGCTTCCAATCC-------------------------------------------------TTGACTTGGGACTT------------GCGAAGCTTTAGCTAC--TA-GTTGGTC-GTGA-------GGCCGACGAA---CGCAAGG-CT-------GG---CTCCGGTCCCTCGTCTTCCTTGA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M16340] TITLE Boletus_LSU_MAF_9Mb3; LINK TAXA = Taxa1; DIMENSIONS NCHAR=713; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Boletus_abieticola_Arora11087 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTATTTCCCGGTT-GACGGGTCAGCATCAGTTTCAGTCACCGTACAAGGGCAAGG-GGAACGTGGCACTTCTT--GGAGTGTGTTATAGCCTTTT-GTTGTATGCGGT-GGTCGGGACTGAGGA--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_appendiculatus_AF456837 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTC-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGAC-TAGGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCTGGTC-GACGGGTCAGCATCAGTTTCAGTCACCGTACAAGGGTGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGT-GGTTGGGACTGAGGA--GCTCAGCACGGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_auripes_Arora11224 --------------------------------------------CAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-AAGCTCAAATTTT-AAATCTGGCGGTC-TCATT-GGCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCTGG-CCCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTCGC-C-AGGGATCAACCCCGCT-TCAT--CGCTGGGCGTATTTCCTGGTCGGACGGGTCAGCATCAGTTTCGATCGGCATAGAAGGGCGAAG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGTGCC-GGTGGGGACTGAGGA--ACTCGGCACCCTGTTCCAGGT-----------------------GTTGCTTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCT- Boletus_autumniregius_ARI063 -------------------------------------------------------------------------------------------TGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CG--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTCGGGACTGAGGT--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_autumniregius_Arora11108 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CG--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTCGGGACTGAGGT--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_autumniregius_JDS289 --------------------------------------------------------------------------------------------------------------A-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CG--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGC{CT}GTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTCGGGACTGAGGT--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTC-- Boletus_autumniregius_JLF2271 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CG--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTCGGGACTGAGGT--GCTCA------------------------------------------------------------------------------------ Boletus_barrowsii_Arora12009 ----------ATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-AAGCTCAAATTTT-GAATCTGGCGGTC-TTTGCAGACCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCCGG-CCCGTGTACAAGTCTCCTGGAAGGGAGCGTCTTAGAGGGTGAGAATCCCGTCTCTGACACGGACCACCGGGGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAAAGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTCCAGTCGCGTCGTC-C-GGGGGTCAACCTTGCT-TCAC--TGCTCGGTGTATTTCCTGGTT-GACGGGTCAGCATCAGTTTCGGTCGTCCTACAAGGGCCGAGAGGAAAGTGGCACCCTTCCGAGGGTGTGTTATAGCCTTTCGGTCGTATGCGGC-GACCGGGACTGAGGAG-ACTCGGCACGCCTCGCG---------------------------GTGTGCTAG-AGATGCTGGCATAATGGCATTGAGCGACCCGTCTG Boletus_bicolor_AY612800 ---------------------------------------------------CGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAT-GAGCTCAAATTTC-GAATCTGGCGGTC-TT----G-CCGTCCGAGTTGTAATCTAGAGAAG-CGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGTGTCGGC-C-GGGGATCAACCTTGCT-TGTT--TGCTGGGTGTACTTCTCGGTC-GACAGGTCAGCATCAGTTTCGGTCGCCGTACAAGGG{CT}GAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTTTC-GTCGTATGCGGCGGGTCGGGACTGAGGA--ACTCAGCACGGCCTCCGGGTT-----------------------CTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_calopus_AF456833 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTCG--G-CCGTCCGAGTTGTAATCTAGAGAAG-TGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCCTCGC-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGTGAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTCTC-GTCGTATGCGGC-GCTCGGGACTGAGGA--ACTCAGCACGGATTT-GGT-------------------------TTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_coniferarum_AF456827 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTCG--GCCCGTCCGAGTTGTAATCTAGAGAAG-TGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCCGC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTCTC-GTCGTATGCGGC-GCTCGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------TTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_coniferarum_EF530923 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTCG--G-CCGTCCGAGTTGTAATCTAGAGAAG-TGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCCGC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTCTC-GTCGTATGCGGC-GCTCGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------TTGTGCTTA-GGATG------------------------------ Boletus_deliciosissimus_Arora11053 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTCTCTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTTTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCT- Boletus_deliciosissimus_Arora11058 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTCTCTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTTTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCT- Boletus_edulis_AF050643 -------------------------------------------------------------------TAACAAGGATT--CCCCTATTAACTGCGAGTTGAAGCG--GGAA-GAGCTCAAATTTC-GAATCTGGCAGTC-TTTGCAG-CCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCCGG-CCTGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACCACCGGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAAAGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTCGAGTCGCGTCTGG-C-TGGGGTCAACCTTGCG-GTTT--CGCTGGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGTCGTACAAGGGCCAAG-GGAAAGTGGCACCCTTCCGGGGGTGTGTTATAGCCTTTCGGTCGTATGCGCG-GCTCGGGACTGAGGAG-ACTCGGTGTGGGCTTCGGC-------------------------TTACACTAG-AGATGCTGGCATAATGGCCTTGAGCGACCCGTCTT Boletus_edulis_v_grandedulis_Arora12011a ---------------------------------------CATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-AAGCTCAAATTTT-GAATCTGGCGGTC-TTTGCAGGCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCCGG-CCTGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTCTGACACGGACCACCGGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAAAGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTC-AGTCGCGTCGGC-T-GGGGGTCAACCTTGCG-GTTT--CGCTGGGTGTATTTCCTGGTT-GACGGGTCAGCATCAGTTTCGGTCGTCGTACAAGGGCCAAG-GGAAAGTGGCACCCTTCCGGGGGTGTGTTATAGCCTTTCGGTCGTATGTGGCGGCTCGGGACTGAGGAG-ACTCGGTGTGGGCTTCGGC-------------------------TTACACTA?-AGATGCTGGCATAATGGCCTTGAGCGACCCGTCTG Boletus_fechtneri_AF456821 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CT----GGCTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTCCTCGC-TGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTTGGTCGCCGTACAAGGGCGAGA-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCAGT-GGTCAGGACTGAGGAGTGCTCAGCACGGCTTCTTCG-------------------------TTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_frustosus_Arora11116 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTCG--G-CCGTCCGAGTTGTAATCTAGAGAAG-TGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCCGC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTCTC-GTCGTATGCGGC-GCTCGGGACTGAGGA--ACTCAGCATGGCTTC-GGT-------------------------TTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_fuscoroseus_MG383a TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACCGCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGATTGCTGTACAAGGATGAGG-GGAACGTGGCACTCCCC--GGAGTGTGTTATAGCCTTTC-ATCGTATGCAGC-GGTTGGGACTGAGGA--GCTCAGCACGGCTTCTCGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_inedulis_JQ327013 -----------------------------------------------------------------------------------CTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGG{CG}GGCG-TTTC--G-TCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACATGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAATGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTGGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------TTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_luridus_AF139686 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTC-GAATCTGGCGGTC-TTTG--G-CCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTCCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGGC-C-GGGGATCAACCTTGCT-T-CT-CCGCTGGGTGTACTTCCTGGTC-GACGGGTCAGCATCAGTTTCCGTCCCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGCATGCGGG-GGTCGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------CTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_persolidus_Arora027 ----------------------------------------------------------------------CAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCTGTACAAGGGTGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-ATCGTATGCAGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTCTTGC-------------------------TTGC----------------------------------------- Boletus_persolidus_Arora11103 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTTGGAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCTGTACAAGGGTGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-ATCGTATGCAGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTC-- Boletus_persolidus_Arora11110 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCTGTACAAGGGTGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-ATCGTATGCAGT-GGTCGGGACTGAGGA--GCTCAGC---------------------------------------------------------------------------------- Boletus_pinophilus_AF462358 --------------------------------------------------------------------AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-AAGCTCAAATTTT-GAATCTGGCGGTC-TTCACAGGCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCCGG-CCCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTCTGACACGGACCACCGGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAAAGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTC-AGTCGCGTCGGC-T-GGGGGTCAACCCTGCG-GTTTACTGCTGGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGTCGTACAAGGGCCAAG-GGAACGTGGCACCCTTCCGGGGGTGTGTTATAGCCTTTCGGTCGTATGCGGCGGCTCGGGACTGAGGAA-ACTCGGT----------GC-------------------------TTGCGCCAG-AGATGCTGGCATAATGGCCTTGAGCGACCCGTCTT Boletus_primiregius_DBB00606 ----------------------------------------------------CGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGTGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTCGGGACTGAGGT--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_primiregius_JLF1973 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGG{AG}TGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCATATGCGGC-GGTCGGGACTGAGGT--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_primiregius_JLF2030 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGATGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCATATGCGGC-GGTCGGGACTGAGGT--GCTCAGCACAGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCT- Boletus_querciregius_Arora11100 TTGACCTCAGATCAGGTAGGACTACCCGCTGAACTTA{AG}GCATATCAATA{AG}GCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCCGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CG--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GGTCGGGACTGAGG-------------------------------------------------------------------------------------------- Boletus_radicans_AF336241 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTTG--G-CCGTCCGAGTTGTAATCTAGAGAAG-TGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCCGC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGACGAGG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTCTC-GTCGCATGCGGC-GCTCGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_regineus_JLF2273 -------------------------GCTGAACCTTAAAGCACCTCAATAAGCGGAGGAAACGAAACTAACCAACGATT--CCCCTAGCAACTGCGAG-TGAAGC{CG}--GGAA-AAGCTCAAATTTT-GAATCTGGCGGTC-TTCATAGGCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCCGG-CCCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTCTGACACGGACCACCGGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAAAGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTC-AGTCGCGTCGGC-T-GGGGGTCAACCCTGTG-GTTTACTGCTGGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGTCGTACAAGGGCCAAG-GGAACGTGGCACCCTTCCGGGGGTGTGTTATAGCCTTTCGGTCGTATGCGGCGGCTCGGGACTGA?GAT-ACTCGGT----------GC-------------------------TTGCGCCAG-AGATGCTGGCATAATGGCCTTGAGCGACCCGTCTT Boletus_regius_MG407a TTGACCTCAAATCAGGTAGGACCACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCACCGTACAAGGGTGAGA-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGT-GGTCGGGACTGAGGT--GCTCAGCACGGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGAC------- Boletus_regius_MG408a ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCCGCGCTGGCCCCGTGTATAAGTCTCCTGGAAGG{CG}AGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCACCGTACAAGGGTGAGA-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-CTCGTATGCGGT-GGTCGGGACTGAGGT--GCTCAGCACGGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTG Boletus_rexveris_EU232005 -----------------------------------------------------------------------------------------------------------------------AATTTT-GAATCTGGTGGTC-TTTGCAGGCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCCGG-CCCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTCTGACACGGACCACCGGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAAAGGGTGGTAAACTCCATCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTC-AGTCGCGTCGGC-T-GGGGGTCAACCTTGCG-GTTT--CGCTGGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGTCGTACAAGGGCCGAG-GGAAAGTGGCACCCTTTCGGGGGTGTGTTATAGCCTTTCGGTCGTATGCGGCGGCTCGGGACTGAGGAG-ACTCGGTGTGGGCTTCGGC-------------------------TTGCACTAG-AGATGCTGGCATAATGGCCTTGAGCGACCCGTCTT Boletus_roseopurpureus_JLF2565 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGGC-C-GGGGATCAACCTTGCT-T-CT--CGCTCGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGCATGCGGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTC-CGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTC-- Boletus_roseopurpureus_JLF2566 --------------------ACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGGC-C-GGGGATCAACCTTGCT-T-CT--CGCTCGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGCATGCGGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTC-CGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGT--- Boletus_roseopurpureus_JLF2567 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGGC-C-GGGGATCAACCTTGCT-T-CT--CGCTCGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGCATGCGGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTC-CGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_sanicibus_Arora99211 ----------------------------------TTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATTCCCCCCTAGTAACTGCGAG-TG{AC}CGCGGTGCAA-GAGCTCAAATTTT-GAATCTGGCAGTC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTCGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCTGGTC-GACGGGTCAGCATCAGTTTTGGTCGCTGTACAAGGGCAAGA-GGAACGTGGCACTCCTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCAGT-GGTCAGGACTGAGGA--GCTCAGCACGGCTTCTTGCT------------------------TTGTGCTTAGGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_satanas_AF336242 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTC-GAATCTGGCGGTC-TTCG--GCCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGC-TCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGTC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTCTGACGGGTCAGCATCAGTTTCGGTCGTCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGC-GCTCGGGACTGAGGA--ACTCAGCACGACCTTCGGT-------------------------TTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_smithii_JLF2240 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGAG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTCG--G-CCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCTGG-TCCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGTC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGCATTTCCTGGTC-GACGGGTCAGCATCAGTTTCCGTCGCCGTACAATGGCAAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTCGC-GTCGTATGCGGT-GGTAGGGACTGAGGA--ACTCGGCACGACTTCCG------------------------------------------------------------------------ Boletus_speciosus_v_brunneus_Arora11221 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-TTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-TG--TGCTGGGTGTACTTCCTGGTC-GACGGGTCAGCATCAGTTTCAGTCGCTGTACAAGGGCGAGA-GGAACGTGGCACTTCTT--GGAGTGTGTTATAGCCTTTC-GTCATATGCAGT-GGTCGGGACTGAGGA--GCTCAGCACGGCTTCTTGC-------------------------TTGTGATCA-GGATGCTGGCATA---------------------- Boletus_subappendiculatus_AT2010197 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGAG--GGAA-GAGCTCAAATTTT-AAATCTGGCAGCC-CTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACATGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTT-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGTGAAG-GGAACGTGGCACTCT------------------------------------------------------------------------------------------------------------------------------------------------ Boletus_subvelutipes_AY612804 ----------------------------------------ATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTC-GAATCTGGCGGTC-TTTC--GGTCGTCCGAGTTGTAATCTAGAGAAG-CGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGCAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCACGTCGGC-A-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCTGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGGGTGTGTTATAGCCTTTC-GTCGCATGCGGT-GGTCGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------CTGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Boletus_variipes_EU232003 -----------------------------------------------------------------------------------------------------------------------AATTTT-GAATCTGGCAGTC-TTTGCAGGCCGTCCGAGTTGTAATCTAGAGAAG-CGTCTTCCGCGCTGG-CCCGTGTACAAGTCTCCTGGAAGGGAGCGTCATGGAGGGTGAGAATCCCGTCTCTGACACGGATCACCGGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATAGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGGACTCTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTCGATGTC-AGTCGCGTCGGC-T-GGGGGTCAACCTTGCGAGTTT--TGCTGGGTGTATTTCCTAGTC-GACGGGTCAGCATCAGTTTCGGTCGTCCTACAAGGACTGAGGGGAACGTAGCACCCTTCCGGGGGTGTGTTATAGCCTTTCGGTCGTATG?GGC-GACCGGGACTGAGGAA-ACTCGGCGC-----------------------------------TC?CGCCAG-AGATGCTGGCATAATGGCCTTGAGCGACCCGTCTT Boletus_yicibus_Arora9727 ----------------------------------------------------GGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGAG--GGAA-GAGCTCAAATTTT-GAATCTGGCAGTC-TTTG--G-CTGTCCGAGTTGTAATCTAGAGAAG-TGTTTTCCGCGCTGG-ACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTTGGC-T-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTACTTCCCGGTC-GACGGGTCAGCATCAGTTTCAGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCCTTC-GTCGTATGCAGT-GGTTGGGACTGAGGA--TCTCAGCACGGCTTCTTGC-------------------------TTGTGCTCA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTC-- Boletus_zelleri_EU486447 TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACT-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTTG--G-CCGTCCGAGTTGTAATCTAGAGAAG-CGTTTTCCGCGTTGG-CCCGTGTACAAGTCTCCTGGAAAGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACCGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCTGC-C-GGGGATCAACCTTGCT-T-CT--CGCTGGGTGTATTTCCTGGTC-GACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGG-GGAACGTGGCACTCTCC--GGAGTGTGTTATAGCCTTTC-GTCGTATGCGGT-GGTCGGGACTGAGGA--ACTCAGCACGGCTTC-GGT-------------------------CTGTGCT-A-GGATG------------------------------ Melanogaster_tuberiformis_AF167679 --------------------------------------------------------------------AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAA-GAGCTCAAATTTT-GAATCTGGCGGTC-TTTC--GGCCGTCCGAGTTGTAATCTAGAGAAG-CGTTTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACCGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCCGC-C-GGGGATCAACCTAGCT-TAAT--CGCTCGGTGTACTTTCTGGTG-GACGGGTCAGCATCAGTTTCGATCGCCGTACAAGGGCGAAG-GGAATGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGCATGCGGT-GACTGGGACTGAGGA--ACTCAGCACGGCCCCTCGAGGGTTCGAGGCTTCGGCCTACG-TATCGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Paxillus_involutus_AF098385 --------------------------------------------------------------------AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAT-GAGCTCAAATTTT-GAATCTGGCGGTC-TTCA--GGCCGTCCGAGTTGTAATCTAGAGAAGCCGTCTTCCGCGCTGG-ACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGCAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATCGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAGGTC-AGTCGCGTCGGA-C-GGGGATCAACCTTGCT-T-CT--CGCTCGGTGTACTTCCTGCTC-GACGGGTCAGCATCAGTTTCGATCGCCGTACAAGGGTCGAG-GGAATGTGGCACTCCTC--GGAGTGTGTTATAGTCCTCG-GTCGCATGCGGT-GGTCGGGACTGAGGA--ACTCAGCACGACCCCTCGAGGGTTCGGGGCCACGGCCTACGTTAACGTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT Xerocomus_chrysenteron_AF050647 ------------------------------------------------------------------T-AACAAGGATT--CCCCTAGTAACTGCGAG-TGAAGCG--GGAAGGAGCTCAAATTTT-GAATCTGGCGGTC-TTTG--GCCCGTCCGAGTTGTAATCTAGAGAAG-CGTTTTCCGCGCTGG-CCCGTGTACAAGTCTCCTGGAAAGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAAT-CACGTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACCGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTC-AGTCGCGTCGGC-C-AGGGATCAACCTTGCT-T-CT--CGCTGGGTGTATTTCCTGGTC-GACGGGTCAGCATCGGTTTCGGTCGCCGTACAAGGGCGA-G-GGAACGTGGCACTCTTC--GGAGTGTGTTATAGCCTTTC-GTCGCATGCGGT-GGTCGGGACTGAGGA--ACTCAG-ACGGCTTCAGG--------------------------TCTTGCTTA-GGATGCTGGCATAATGGCCTTAAGCGACCCGTCTT ; END; BEGIN TREES; TITLE Boletus_LSU_MAF; LINK TAXA = Taxa1; TRANSLATE 1 Boletus_appendiculatus_AF456837, 2 Boletus_persolidus_Arora027, 3 Boletus_regius_MG407a, 4 Boletus_autumniregius_JDS289, 5 Boletus_autumniregius_ARI063, 6 Boletus_autumniregius_Arora11108, 7 Boletus_primiregius_DBB00606, 8 Boletus_primiregius_JLF2030, 9 Boletus_primiregius_JLF1973, 10 Boletus_persolidus_Arora11103, 11 Boletus_yicibus_Arora9727, 12 Boletus_fuscoroseus_MG383a, 13 Boletus_deliciosissimus_Arora11053, 14 Boletus_deliciosissimus_Arora11058, 15 Boletus_querciregius_Arora11100, 16 Boletus_autumniregius_JLF2271, 17 Boletus_persolidus_Arora11110, 18 Boletus_abieticola_Arora11087, 19 Boletus_regius_MG408a, 20 Boletus_speciosus_v_brunneus_Arora11221, 21 Boletus_coniferarum_EF530923, 22 Boletus_frustosus_Arora11116, 23 Boletus_radicans_AF336241, 24 Boletus_coniferarum_AF456827, 25 Boletus_calopus_AF456833, 26 Boletus_roseopurpureus_JLF2566, 27 Boletus_roseopurpureus_JLF2565, 28 Boletus_roseopurpureus_JLF2567, 29 Boletus_subvelutipes_AY612804, 30 Boletus_inedulis_JQ327013, 31 Boletus_luridus_AF139686, 32 Boletus_zelleri_EU486447, 33 Boletus_satanas_AF336242, 34 Boletus_subappendiculatus_AT2010197, 35 Boletus_sanicibus_Arora99211, 36 Boletus_fechtneri_AF456821, 37 Boletus_smithii_JLF2240, 38 Boletus_bicolor_AY612800, 39 Xerocomus_chrysenteron_AF050647, 40 Paxillus_involutus_AF098385, 41 Melanogaster_tuberiformis_AF167679, 42 Boletus_auripes_Arora11224, 43 Boletus_rexveris_EU232005, 44 Boletus_edulis_v_grandedulis_Arora12011a, 45 Boletus_pinophilus_AF462358, 46 Boletus_regineus_JLF2273, 47 Boletus_edulis_AF050643, 48 Boletus_variipes_EU232003, 49 Boletus_barrowsii_Arora12009; TREE PAUP_1 = [&R] (40:0.02590454,(41:0.03540496,(29:0.03448418,30:0.02993222,31:0.01978526,33:0.02053834,37:0.04493995,38:0.03546073,(32:0.00804719,39:0.01760516):0.01962182,(23:0.00639119,(21:1.0E-8,22:0.00385844,24:1.0E-8,25:0.01069329):0.00394823):0.00890569,(42:0.11803672,(49:0.04913473,(48:0.04624682,(45:1.0E-8,46:0.02243596):0.01802225,(43:0.00587922,(44:0.00602536,47:0.02281509):0.00880981):0.01173442):0.03787943):0.06592617):0.01108594,(1:0.01792805,2:0.01533808,11:0.01707575,12:0.03130207,18:0.03650398,20:0.02533195,34:0.02768791,(3:1.0E-8,19:0.00526678):0.01123192,(10:1.0E-8,17:1.0E-8):0.01468606,(13:1.0E-8,14:1.0E-8):0.00797613,(35:0.01207986,36:0.01991799):0.02020425,(26:1.0E-8,27:1.0E-8,28:1.0E-8):0.02259343,((7:0.00208269,(8:1.0E-8,9:1.0E-8):0.00380618):0.00360681,(4:1.0E-8,5:1.0E-8,6:1.0E-8,15:0.00230371,16:1.0E-8):0.00210672):0.00983101):0.03720967):0.04768286):0.02590454); END; BEGIN TREES; TITLE Boletus_ITS_NJ_result; LINK TAXA = Taxa2; TRANSLATE 1 Boletus_sanicibus_Arora99211, 2 Boletus_yicibus_Arora9727, 3 Boletus_persolidus_Halling15, 4 Boletus_persolidus_HDT10943, 5 Boletus_persolidus_Arora11102, 6 Boletus_persolidus_Arora11110, 7 Boletus_persolidus_Arora11109, 8 Boletus_persolidus_Arora11103, 9 Boletus_speciosus_v_brunneus_Arora11221, 10 Boletus_speciosus_v_brunneus_DW75591, 11 Boletus_subappendiculatus_HM347653, 12 Boletus_subappendiculatus_AT2010197, 13 Boletus_abieticola_HDT52625, 14 Boletus_abieticola_Cooke38653, 15 Boletus_abieticola_Arora11086, 16 Boletus_abieticola_HDT46430, 17 Boletus_abieticola_Arora11087, 18 Boletus_abieticola_JLF2564, 19 Boletus_abieticola_HDT44741, 20 Boletus_abieticola_OSC67698, 21 Boletus_autumniregius_JDS289, 22 Boletus_autumniregius_OSC66191, 23 Boletus_autumniregius_JLF2271, 24 Boletus_autumniregius_Arora11095, 25 Boletus_autumniregius_Arora11096, 26 Boletus_autumniregius_Arora11113, 27 Boletus_autumniregius_Arora11112, 28 Boletus_autumniregius_Arora11108, 29 Boletus_autumniregius_JLF2275, 30 Boletus_autumniregius_HDT43782, 31 Boletus_primiregius_HDT47714, 32 Boletus_primiregius_Arora11084, 33 Boletus_primiregius_Arora11085, 34 Boletus_primiregius_Arora11081, 35 Boletus_primiregius_JLF2029, 36 Boletus_primiregius_JLF1973, 37 Boletus_primiregius_AHS69419, 38 Boletus_primiregius_JLF2030, 39 Boletus_primiregius_JLF2097, 40 Boletus_primiregius_JLF2139, 41 Boletus_querciregius_Arora11100, 42 Boletus_querciregius_Arora11099, 43 Boletus_querciregius_01MWB052012, 44 Boletus_querciregius_Arora12012, 45 Boletus_querciregius_01MWB120512, 46 Boletus_querciregius_Arora11098, 47 Boletus_querciregius_EU018562_ecm, 48 Boletus_regius_MG407a, 49 Boletus_regius_PN40600, 50 Boletus_regius_MG408a, 51 Boletus_regius_HM347661, 52 Boletus_appendiculatus_HM347642, 53 Boletus_appendiculatus_HQ882204, 54 Boletus_appendiculatus_UDB000652, 55 Boletus_appendiculatus_HQ882196, 56 Boletus_deliciosissimus_Arora977, 57 Boletus_deliciosissimus_OSC59355, 58 Boletus_deliciosissimus_Arora11058, 59 Boletus_deliciosissimus_Arora11076, 60 Boletus_deliciosissimus_GU233427, 61 Boletus_deliciosissimus_Arora11077, 62 Boletus_deliciosissimus_Arora11054, 63 Boletus_deliciosissimus_Arora11053, 64 Boletus_fechtneri_AT2003097, 65 Boletus_fechtneri_HM347652, 66 Boletus_fuscoroseus_MG383a, 67 Boletus_fuscoroseus_UDB000649, 68 Boletus_fuscoroseus_JN903697, 69 Boletus_fuscoroseus_SP613117, 70 Boletus_roseopurpureus_JLF2565, 71 Boletus_roseopurpureus_JLF2566, 72 Boletus_speciosus_HQ882205, 73 Boletus_rubripes_JLF2078, 74 Boletus_calopus_HM347645, 75 Boletus_coniferarum_EF530923, 76 Boletus_radicans_JQ685716, 77 Boletus_bicolor_GQ166889, 78 Xerocomus_chrysenteron_DQ822793, 79 Boletus_zelleri_DQ974704, 80 Boletus_smithii_JLF2240, 81 Boletus_mirabilis_JLF2235, 82 Boletus_amygdalinus_DQ974705, 83 Boletus_amygdalinus_AY918960, 84 Boletus_edulis_Arora11223, 85 Boletus_edulis_HM579928, 86 'Boletus rex-veris JLF2012', 87 Boletus_regineus_JLF2273, 88 Boletus_barrowsii_Arora12009, 89 Paxillus_involutus_JF899567, 90 Boletus_auripes_DW73672, 91 Boletus_auripes_Arora11224; TREE PAUP_1 = [&R] (89:0.35499949,((88:0.27220287,(87:0.04328789,(86:0.02450054,(84:0.00616543,85:0.00346035):0.07112778):0.00612286):0.11458547):0.21875727,((90:1.0E-8,91:1.0E-8):0.4457574,((78:0.01869864,79:0.07581673):0.18773641,((82:1.0E-7,83:0.02804559):0.24673291,((77:0.12631841,((73:0.0438726,76:0.04748972):0.06751868,(74:0.01301585,75:1.0E-7):0.06567957):0.07323901):0.03024009,(81:0.32418438,(80:0.16894826,((71:1.0E-8,(70:1.0E-8,72:0.00227676):0.0):0.13829128,((1:0.03806247,(64:1.0E-8,65:0.0066291):0.04340783):0.04277325,(((55:0.01355242,(54:1.0E-8,(52:1.0E-8,53:1.0E-8):1.0E-8):0.0):0.02025603,((11:1.0E-8,12:1.0E-8):0.04379187,(62:1.0E-8,((56:0.00199825,60:0.00399733):1.0E-8,(63:1.0E-8,(57:1.0E-8,(59:1.0E-8,(58:1.0E-8,61:1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.00199299):0.0):0.03321521):0.00288852):2.1539E-4,(((2:0.01871013,(9:1.0E-8,10:1.0E-8):0.03306412):0.00450874,((6:1.0E-8,7:0.01826558):0.0,(8:1.0E-8,(5:1.0E-8,(3:1.0E-8,4:1.0E-8):1.0E-8):1.0E-8):0.00194414):0.02856168):0.00793408,((66:0.0556878,(68:1.0E-8,(67:0.0020779,69:1.0E-8):0.00203958):0.00765982):0.0598191,(((16:0.00428815,17:0.00213213):0.0021342,(20:1.0E-8,(19:0.00642036,(18:0.00213485,(13:0.0042527,(14:0.00211882,15:0.00212769):1.0E-8):0.00430163):0.00213081):0.0):6.0E-8):0.0258471,(((48:1.0E-8,50:1.0E-8):0.0,(49:1.0E-8,51:0.02086312):0.0):0.02901156,(((44:1.0E-8,(45:0.00299548,46:0.01025939):0.0):0.0,(47:0.00821425,(41:0.01521748,(42:1.0E-8,43:1.0E-8):1.0E-8):1.0E-8):0.00215206):0.01908317,((27:1.0E-8,(30:1.0E-8,(28:0.01301071,(22:0.00210341,(21:1.0E-8,(23:1.0E-8,(29:1.0E-8,(26:1.0E-8,(24:1.0E-8,25:1.0E-8):0.00223942):1.0E-8):1.0E-8):1.0E-8):1.8E-7):0.0):3.4E-7):0.0):0.01322887,(40:1.0E-8,((38:1.0E-8,39:1.0E-8):1.0E-8,(36:1.0E-8,(35:1.0E-8,((31:0.0021805,37:1.0E-8):1.0E-8,(34:1.0E-8,(32:1.0E-8,33:1.0E-8):5.09E-6):0.00210654):0.0):0.00130674):8.0091E-4):0.0):0.00724333):0.01551701):0.02488099):0.00529187):0.0):1.4E-7):0.01190459):1.0658E-4):0.04422714):0.12371721):0.01917168):0.02924068):0.02612662):0.0318492):0.03521539):0.0256475):0.35499949); END;