#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on May 11, 2021; 23:11 GMT TreeBASE (cc) 1994-2008 Study reference: Chaverri P., & Samuels G.J. 2013. Evolution of host affiliation and substrate preference in a cosmopolitan fungal genus with evidence of interkingdom host jumps and major shifts in ecology. Evolution, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13888] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=144; TAXLABELS Hypocrea_aeruginea Hypocrea_alcalifuscescens Hypocrea_alni Hypocrea_alutacea Hypocrea_americana Hypocrea_andinensis Hypocrea_avellanea Hypocrea_chionea Hypocrea_crystalligena Hypocrea_dacrymycella Hypocrea_danica Hypocrea_decipiens Hypocrea_delicatula Hypocrea_epimyces Hypocrea_eucorticioides Hypocrea_flaviconidia Hypocrea_fomiticola Hypocrea_leucopus Hypocrea_lutea Hypocrea_megalocitrina Hypocrea_microcitrina Hypocrea_moravica Hypocrea_neorufa Hypocrea_nigrovirens Hypocrea_nybergiana Hypocrea_parepimyces Hypocrea_parmastoi Hypocrea_patella Hypocrea_phyllostachydis Hypocrea_pillulifera Hypocrea_placentula Hypocrea_protopulvinata Hypocrea_pseudostraminea Hypocrea_psychrophila Hypocrea_pulvinata Hypocrea_rodmanii Hypocrea_semiorbis Hypocrea_seppoi Hypocrea_spinulosa Hypocrea_straminella Hypocrea_subalpina Hypocrea_sulawesensis Hypocrea_sulfurea Hypocrea_tawa Hypocrea_voglmayrii Hypomyces Sphaerostilbella Trichoderma_aggressivum Trichoderma_amazonicum Trichoderma_arundinaceum Trichoderma_asperelloides Trichoderma_asperellum Trichoderma_atrogelatinosum Trichoderma_atroviride Trichoderma_aureoviride Trichoderma_austrokoningii Trichoderma_brevicompactum Trichoderma_brunneoviride Trichoderma_candidum Trichoderma_caribbaeum Trichoderma_catoptron Trichoderma_ceraceum Trichoderma_ceramicum Trichoderma_cerinum Trichoderma_chlorosporum Trichoderma_chromospermum Trichoderma_cinereoflava Trichoderma_cinnamomeum Trichoderma_citrinoviride Trichoderma_costaricensis Trichoderma_crassum Trichoderma_cremeum Trichoderma_cuneisporum Trichoderma_dingleyae Trichoderma_dorotheae Trichoderma_erinaceus Trichoderma_estonicum Trichoderma_evansii Trichoderma_fertile Trichoderma_gamsii Trichoderma_gelatinosum Trichoderma_ghanense Trichoderma_hamatum01 Trichoderma_hamatum02 Trichoderma_hamatum03 Trichoderma_harzianum01 Trichoderma_harzianum02 Trichoderma_harzianum03 Trichoderma_harzianum04 Trichoderma_harzianum05 Trichoderma_harzianum06 Trichoderma_harzianum07 Trichoderma_harzianum08 Trichoderma_harzianum09 Trichoderma_harzianum10 Trichoderma_helicum Trichoderma_intricatum Trichoderma_koningii Trichoderma_koningiopsis Trichoderma_lieckfeldtiae Trichoderma_longibrachiatum Trichoderma_longipile Trichoderma_martiale Trichoderma_melanomagnum Trichoderma_minutisporum Trichoderma_novaezelandiae Trichoderma_oblongisporum Trichoderma_ovalisporum01 Trichoderma_ovalisporum02 Trichoderma_pachybasioides Trichoderma_parapiluliferum Trichoderma_parareseei Trichoderma_parestonicum Trichoderma_paucisporum Trichoderma_petersenii Trichoderma_pleuroticola Trichoderma_pleurotum Trichoderma_protrudens Trichoderma_pseudokoningii Trichoderma_pubescens Trichoderma_reesei Trichoderma_rogersonii Trichoderma_rossicum Trichoderma_saturnisporum Trichoderma_sinuosum Trichoderma_spirale01 Trichoderma_spirale02 Trichoderma_spirale03 Trichoderma_stilbohypoxyli Trichoderma_strictipile Trichoderma_strigosum Trichoderma_stromaticum Trichoderma_surrotundum Trichoderma_thailandicum Trichoderma_thelephoricola Trichoderma_theobromicola Trichoderma_tomentosum Trichoderma_turrialbense Trichoderma_velutinum Trichoderma_victoriensis Trichoderma_virens Trichoderma_virescentiflava Trichoderma_viride Trichoderma_viridescens ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15964] TITLE ACT; LINK TAXA = Taxa1; DIMENSIONS NCHAR=754; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_aeruginea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_alcalifuscescens ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_alni ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_alutacea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_americana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_andinensis CTACAATGAGCTGCGTGTCGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACATTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTCGGTCTCGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTCTCTTTGCCCCCGATGCCGT---TT--------CTGTTTCG-AAT--CGTGATGCTAA-T--TGCATTCTCCCAT-CCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Hypocrea_avellanea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_chionea CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCTCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGCCGTGATCTTACCGACTATCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTTTACGGCAACATTGTCATGGTAAG------TGACTTTT----TGCT-GAATACAAATC-----------GGTTG-AAT--AGCAGCGCTAA-TCATGCATTTCTCAAT-TCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Hypocrea_crystalligena ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_dacrymycella ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_danica ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_decipiens ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_delicatula ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_epimyces ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_eucorticioides ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_flaviconidia -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCTCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGACGGTGTTACCCACGTTGTACCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTTGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGAATTTT----GGCA-TTTGGCAACTG-----------GGTCT-TAT--AGCGGCGCTAA-TCATGTAATTCTCAAT-CCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Hypocrea_fomiticola ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_leucopus ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_lutea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_megalocitrina ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_microcitrina ---CAATGAGCTGCGTGTTGCTCCCGAGGAGCATCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCTATCTACGAGGGTTTCGCCCTTCCTCACGCCATTGCTCGTGTTGATATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCTTGGCTGAGCGAGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTTATCACTATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTGGGTCTTGAGAGCGGCGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGTGATGTCGACGTTCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG-------TTGTAAT----CGGGTATGAATATTAG---------GCTTTTG-GGT--AGTAGCGCTAA-C--CGCAATCTT-TCT-CTAGTCTGGTGGTACTACCATGTACCCCGGTCTC-- Hypocrea_moravica ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_neorufa CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTTACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGACGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCTATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTTGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCATGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTATGGCAACATTGTCATGGTAAG------TAATTTT-----CACA-TCCAGCAACTC-----------ATTTA-TAC--GGCAGCGCTAA-TTATGCATTTCTCAAT-CCAGTCTGGTGG------------------------ Hypocrea_nigrovirens -TACAATGAGCTGCGTGTGGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTTCCCATCTACGAGGGTTTCGCTCTTCCCCACGCCATTGCTCGTGTGGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCCGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCTGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG---TTTTTTTTCTG----TTCATTTAAGCAGCAGCGAGTCTTTGTGTGTG-TGC--AGTGGCGCTAA-TG-AACATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCGGTC----- Hypocrea_nybergiana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_parepimyces ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_parmastoi ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_patella ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_phyllostachydis TTACAATGAGCTGCGTGTTGCCCCCGAAGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATTCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCTGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGATGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCCGAGGCTCTATTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATTATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCAG----TCCGCTCACACAGCAG------CAGGCTTTTG-TAT--GGTGGTGCTAA-T--TGTATTCTCTAC--CTAGTCTGGTGGTACCACCATGTACCC-GGTCTT-- Hypocrea_pillulifera ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_placentula ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_protopulvinata ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_pseudostraminea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_psychrophila TTACAATGAGCTGCGTGTTGCTCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAAAAGATGACCCAGATTGTCTTCGAGACTTTCAACGCTCCCGCTTTCTATGTCTCCATCCAGGCCGTTTTGTCTCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGATTCCGGTGATGGTGTTACCCACGTTGTTCCCATCTACGAGGGTTTCGCTCTTCCTCACGCTATCGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTTGAGCAGGAGATCCAGACTGCTGCTCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTACG------T---TTC--ATCCATTTTCCCATTCAGT----ATCAAATCTTTG-TAT--AGCAGCGCTAA----TGCA-TCTTCAAT-CTAGTCTGGTGGTACTACTATGTACCCTGGTCTT-- Hypocrea_pulvinata ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_rodmanii ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_semiorbis -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTCCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACTGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTATGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCCCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG--------TTTCAG----CCCATTCAAATAGCAT------CGAATTTTTGTTAT--GATGACGCTAATT--TGCATTCCCCAAT-CTAGTCTGGTGGTACTACCATGTACCCCGGTCTC-- Hypocrea_seppoi ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_spinulosa ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_straminella TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCTGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTTTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCTTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTTACCACCTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCAA----TTGA--------------------------------------------------------------------------------------------------- Hypocrea_subalpina ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_sulawesensis ----------GTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCCCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCATGTGCGAGCGTGGCTACACCTTTTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGGTTCCGTGCTCCCGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTCGAGAGCGGCGGCATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATCGTCATGGTATGT------TTC-AGT----CCACTCACGGCGTGCG------CGGAATTTTG-AAC--GGTGGCACTAA-CTGCATTCTTTACCCA-TTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Hypocrea_sulfurea TTACAATGAGCTGCGTGTTGCTCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAAACCTTCAACGCTCCCGCTTTCTATGTTTCTATTCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCTTGGCTGAGCGTGGTTACACTTTCTCCACTACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTTGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCCTCTGTCCTGGGTCTTGAGAGCGGCGGTATCCATGTCACCACCTTCAACTCCATCATGAAGTGCGATGTCGACGTTCGAAAGGACCTCTACGGCAACATTGTCATGGTACG-------TTAGAAT----CGGGTATGAATATTAG---------GCTTTTG-GGT--AGTAGCGCTAA-C--CGCATTCTC-AAT-CTAGTCTGGTGGTACTACCATGTACCCCGGTCTC-- Hypocrea_tawa TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA-----TGATTCGCGCAGCTT-----------------CAA------------------------------------------------------------------- Hypocrea_voglmayrii ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypomyces CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGATTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGCGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG------T---TTT--CTCTTTGTTCACGCAGCAG------CG-AGTTTTG-TAC--GGTAGCGCTAA-C--CGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Sphaerostilbella CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTTCTGTCTCTGTACGCCTCCGGTCGTACCACTGGTATCGTTCTCGACTCTGGTGATGGTGTCACTCACGTTGTCCCCATCTACGAGGGTTTCGCTCTCCCCCACGCCATTGCCCGTGTCGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGCGGTTACACCTTCTCCACCACTGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTTGCCCTCGACTTTGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCACCCTGGAGAAGTCCTATGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTCTTCCAGCCTTCCGTCCTCGGTCTTGAGAGCGGTGGCATCCACGTCACGACTTTTAACTCCATCATGAAGTGTGATGTCGACGTTCGAAAGGACCTGTACGGCAACATCGTCATGGTATG------T---ACA--ACCCAGCTCTGCGGATGAT-----------GATAT-TAC--GGTGTTTTTGG-TTGCTGACGCTTTCC--ACAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_aggressivum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_amazonicum -------------------------------------GTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCCCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGTT-----TTTCTAA----TTGACTCGCACAGCAT------CA-GTTTGTG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTG------------------------- Trichoderma_arundinaceum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_asperelloides -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTTGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGAATTG-----AGCA-TTCAACAAACA----------GGCTCT-AAT--AGCAGTGCTAA-TGATGTATTTCCCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_asperellum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTTGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCTGAGCGAGAAATCGTTCGTGATATTAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTTGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGAATTG-----AGCA-TTCAACAAATA----------GGCTCT-AAT--AGCAGTGCTAA-TGATGCATTTACCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_atrogelatinosum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_atroviride ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_aureoviride ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_austrokoningii CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCTTGGCCGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGTGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTTGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCCGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGATTTT-----CTCGCTTCGAGCAGAG-------ATAGTTTTG-AGC--AGCAACGCTAA-TGATGCACTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_brevicompactum -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTATGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTATGGCAACATTGTCATGGTATG------TTGTGAAT---TTTTTTTTGAACGTGAC-----CTTTTTTGTTG-TGC--AGTGACGCTAA-T--CGCATTCTC-GCT-ACAGTCTGGTGGTACCACCATGTACCCCGGTCTCTC Trichoderma_brunneoviride ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_candidum ------------------------CGAAGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCTCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTTATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTTACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----CTTTTCTCCCCTTTACGCAGCAAGAGGTTTTG-CAT--GGTGGCGCTAA-C--TGCATTCTCTACCAATAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_caribbaeum --------------------------------------------TCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCTATCCAAGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATTTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACTGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTTACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGACGTT-----TGCA---AGACAAATT-----------GGCTG-AAT--AACAGCGCTAA-TTATGCTTTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_catoptron --ACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATTCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCAC----TCGATTCACACAGCAT------CA-GGTTATG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCC-GGTCTT-- Trichoderma_ceraceum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_ceramicum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCTCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATTTACGAGGGTTTCGCCCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCTACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCTTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTATG-------TTTTCAG----TCCATTTACACAGCAG------CA-GGGTTTG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCC-G------- Trichoderma_cerinum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_chlorosporum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGCATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TTCGTTCACGCAGCAG------CA-AGTTTTG-TAT--GGTAGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCC-GGTCTT-- Trichoderma_chromospermum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCGGCCTTCTATGTCTCCATCCAGGCTGTTCTGTCCCTGTACGCTTCCGGTCGTACCACTGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTGCCCATCTACGAAGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCGGAGCGTGGCTACACCTTTTCCACCACCGCCGAACGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAAGTCATCACCATCGGCAACGAGCGATTCCGTGCGCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCTATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTATACGGCAACATTGTCATGGTATG-------CTTTCCG----TCAATTCAC---------------------------------------------------------------------------------------------- Trichoderma_cinereoflava ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_cinnamomeum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCTCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGCCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCCCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCAA----TCGATTCACACATCAT------CA-GTTTATG-TAC--GACAGCGCTAA-T--TGCATTCTCTCCT-CCAGTCTGGTGGTACCACTATGTACCC-GGTCTC-- Trichoderma_citrinoviride CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACATTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTTTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTCCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTTGACTTTGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTGGGTCTTGAGAGCGGTGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTCTTTGT---CCCAGTGCGACGAGTT-------------CTG-AAT--AGTGGCGCTAA-T--TGC--TTTCTCAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_costaricensis TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTCCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGATTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGATATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCTACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTCGGTCTCGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGAATG-------TTTTCTG---TTTCATTCACGCGGCAG------CA-AGTTTTG-TAC--GGTAGCGCTAA-T--TGCATTCTCTACT-TTAGTCTGGGGGTACCACCATGTACCCCGG------ Trichoderma_crassum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_cremeum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGATTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGCGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TTTGTTCACGCAGCAG------CG-AGTTTTG-TAC--GGTAGCGCTAA-C--CGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_cuneisporum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_dingleyae -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----TGCA---AGACAAACT-----------GGCTG-AAT--AACAGCGCTAA-TTATGCATTTCGCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_dorotheae -----------------------------AGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTTACCACTTTCAACTCCATCATGAAATGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGACTTT-----TGCA---AGACAAATT-----------GGCTG-AAT--AACAGCGCTAA-TTATGCTTTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_erinaceus -----ATGAGCTGCGTGTTGCTCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCCGTTTTGTCTCTCTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGTGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CGCT-CAAGATAAATC-----------AGCTG-AAT--AGCAGCGCTAA-TTATGCCTTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_estonicum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCTCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCTTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTATG-------TTTCCAG----TCCATTTACACAGCAG------CA-GGGTTTG-TAT--CGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_evansii CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCTTTCTACGTCTCTATCCAGGCTGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGTGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGAAACATTGTCATGGTAAG------TGAATTTT----CGCA-TTCAGCAACTG-----------GATCC-CAT--AGCGGTGCTAA-TCATGTATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_fertile ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_gamsii CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACTGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCTCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTTCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CGCG-TGAGACAAATT-----------GGTTG-AAT--AGCAGCGCTAA-TCATGCATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCC?GTTTC-- Trichoderma_gelatinosum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_ghanense CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACATTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACTGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCCGTCCTGGGTCTTGAGAGCGGTGGTATCCACGTTACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG-------TTCTTGT----CCCAACACCATAGGTT-------------CTG-GAT--CGTGACGCTAA-T--TGCATTCTCCCAT-TTAGTCTGGTGGTACCACCCTGTACCCCGGTCTC-- Trichoderma_hamatum01 -----------------------------------------TGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCCTCTGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACCGCTGCTCAGAGCTCCAGCCTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTTGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------GGAATTTT----CGCA-TTCAACAATTG-----------ATTTC-TAT--AGCGGCGCTAA----TGTATTTTTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_hamatum02 --------------------CCCCCGAGGAGC-CCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCCTCTGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACCGCTGCTCAGAGCTCCAGCCTGGAGAAGTCATACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTTGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGAATTTC----CGCA-TTCAACAATTG-----------ATTTT-TAT--AGCGGCGCTAA----TGTATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_hamatum03 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCCTCTGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACCGCTGCTCAGAGCTCCAGCCTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGAATTTT----CGCA-TTCAACAATTG-----------ATTTT-TAT--AGAGGCGCTAA----TGTATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum01 ---------------------------------CCCCGTCCAGCTCACCGAGGCCCCCATC-ACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTTGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTCTAA----TTGAGTCGCACAGCTT-----TACGATTTATG-TAT--GGTGGCGCTAA----TGCATTCTCTACT-CTAGTC-GGTGGTACCACCAT-TACCCCGGTCTC-- Trichoderma_harzianum02 TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA----TTAATTTGCACAACTT------CA-GTTTATG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCC-GGTCTT-- Trichoderma_harzianum03 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACTGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA----TTAATCTGCACAACTT------CA-GTTTATG-TAT--GGTGGCGCTAA-T--TGCATTCTCGTCT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum04 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTCTAA----TTGAGTCGCACAGCTT----TACG-ATTTATG-TAT--GGTAGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum05 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGCGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTTAA----TCGAGTCTCACAGCTT----TTCG-ATTTATG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum06 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACTTTCTCCACCACCGCTGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTCTAA----TTGAGTCGCACAGCTT----TACG-ATTTATG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum07 ?TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA----TTGAGTCGCACAGCTT----TA---ATCTATG-TAG--GGTGGCGCTAA-T--TCCACTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum08 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA----TTGATTCGTACAGCTT------CA-GTTTAGG-TAT--AGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum09 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCTACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA----TCGAGTCGCACAGCTT----TACG-ATTTATG-TAT--GGTGGCGCTAA-T--TGCATTGTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_harzianum10 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTTGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGT------TTTTTAA----TTGATTTGCACAGCAT------CA-GTTTATG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTG-- Trichoderma_helicum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_intricatum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_koningii ----------------------------------------------------GCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCTTTCTACGTCTCTATCCAGGCCGTCCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CGCT-CAAGACAAATC-----------GGTTG-AAT--AACAGCGCTAA-TCATGC-TTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_koningiopsis ----------------------CCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT------GCT-CAAGACAAATC-----------GGTTG-AAT--AACAGCGCTAA-TTATGCTTTTCTCAAT-CCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_lieckfeldtiae -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTTGAGCAGGAGATTCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCTTATGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CACA-CTGAACAATCG-----------ATTTG-AATAGAGCGGTGCTAA-TTATACTTTTCTCAAT-TCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_longibrachiatum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_longipile CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGTTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTATG-------TTTTCAG----TCCATTCACACAGCAT------CA-GGTTTTG-TAT--AGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGCTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_martiale CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCTGGTGATGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CGCA-ACAGACAAAGC-----------GGTTG-AAT--AGCAGCGCTAA-TTATGCATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_melanomagnum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTTCTGTCCCTGTATGCCTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTCACCCACGTGGTCCCCATCTACGAGGGTTTCGCCCTTCCCCACGCCATTGCTCGTGTGGACATGGCTGGTCGTGATCTGACCGACTACCTGATGAAGATCCTGGCCGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCCTGGAGAAGTCGTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCCGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGCATCCACGTCACCACCTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG-------CACCCTC----TCCATCT----------------GGCGTTCCA-TGT--GGTGAGCATGC----TAACATCCATTCT-CCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_minutisporum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCCCACGCTATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACTGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGAAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGTGATGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TCATTTTG----TGCATTTCAGCAACCA-----------ATTCT-GAT--AGCGGCGCTAA-TTTTGCATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_novaezelandiae CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACATTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCTCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCCGAGGCTCTGTTCCAGCCTTCTGTCCTGGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATCGTCATGGTATG-------TTCCCCT-------AAT------------------------------------------------------------------------------------------------- Trichoderma_oblongisporum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACTGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTATG--------TTTCAG----TCGATTCAAACAGCAT------CAGGTTTTTG-TAC--AGTGGCGCTAA-T--TGCATTCTCTTAT-CTAGTCTGGTGGTACTACCATGTACCCCGGTCTC-- Trichoderma_ovalisporum01 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCTGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGCGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----TGCA---AGGCAAATC-----------GGCTG-AAT--AACAGCGCTAA-TTATGCTTTCTTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_ovalisporum02 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCTGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----TGCA---AGGCAAATC-----------GGCTG-AAT--AACAGCGCTAA-TTATGCTTTCTTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_pachybasioides ------------------------------GCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACACAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCTGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGCGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACTGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCTCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGAAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGTGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG------TAACTTG-----TGCA-TTCAGCAACCA-----------GTTCT-CAT--AGCGGCGCTAA-TTTTGCATTTCTCAAT-CTAGTCTGGTGGTACCACTATGTACCC--------- Trichoderma_parapiluliferum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_parareseei ----AATGAG-TGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACATTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATTGTGCTCGACTCCGGTGACGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCTACCACCGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTTTTCCAGCCTTCTGTCCTGGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-TGTTTTTTTATGC----CCCAGTATCGTTTGTT-------------CCG-ATC--CGTGATGCTAA-T--TGCATTCTCCCAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_parestonicum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_paucisporum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCTTGGCTGAGCGTGGTTACACTTTCTCTACCACCGCTGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTTGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGATTTTTT---CGCA-TTCAGCAACTG-----------GTTTC-TAT--AGCGGCGCTAA-TCATGCATTTCTCACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_petersenii CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTCTACGGCAACATTGTCATGGTAAG------TGACTTT-----TATA---AGACAAATT-----------GGCCG-AAT--AACAGCGCTAA-TTATGCTTTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_pleuroticola CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGTT-----TTTTTAA----TTGATTCGCACAGCAT------CA-TTATGTG-TAT--GATGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_pleurotum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATGTT-----TTTCTAA----TTGATTCGCACAGCAT------CA-GTTTGTG-TAT--GATGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_protrudens TTATAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG------TTGTGA-T----CCTTTTTGAACGTGAC----ATTTTTTTTTTG-TGC--ATTGACGCTAA-T--TGCATTCTC-ACT-ACAG-------------------------------- Trichoderma_pseudokoningii CTACAATGAGCTGCGTGTGGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACATTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTCCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGCGATCTTACCGACTACCTGATGAAGATCCTGGCCGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAAGAGATTCAGACCGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGCCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCCGAGGCTCTGTTCCAGCCTTCTGTCCTGGGTCTTGAGAGCGGTGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTCCTGT----CCTAGTATCATGACTA-------------CTG-AAT--AGTGACGCTAA-T--CGCATTCTCTCCT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_pubescens CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTCCGTGATATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTGTACGGCAACATTGTCATGGTAAG------TGAATTTT----CACA-TCCAGCAACTG-----------GTTTT-TAT--AGCATCGCTAA-TCATGTATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_reesei ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_rogersonii --ACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGATATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACGTTGTCATGGTAAG------TGATTTT-----CGCA-TTGAGCAAATC-----------GCTTG-AAT--AGCAGCGCTAA-CGATGCATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCTGGTCTC-- Trichoderma_rossicum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCTCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTTACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTGTACGGCAACATTGTCATGGTATG-------TTTTCAA----TCTGTCTCAACAGCAT------CA-AGTTTTG-TAC--GGTGGCGCTAATT--CGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_saturnisporum ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_sinuosum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTTTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCTTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TTCGTTCACGCAGCAG------CC-AGTTTTG-TAC--GGTAGCGCTAA-C--CGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCC-GGTCTC-- Trichoderma_spirale01 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCAACAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TCCATTTTCATAGCC---------------------------------------------------------------------------------------- Trichoderma_spirale02 CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATTCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TCCATTTTCATAGCCG------CA-AGTTTTG-TAC--AGTGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_spirale03 TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TCCATTCTCATAGCCG------CA-GGTTTTG-TAT--GGTGGCGCTAA-T--TGCATTCTCTACT-CCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_stilbohypoxyli ----------------GTTGC?CCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCCATTCAGGCCGTTCTGTCCCTGTACGCCTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCCCTGACTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATTGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCTGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTGCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG------TGATTTTT----CGCT-CAAGACAAATC---------GGGCTTG-AAT--AGTAGCGCTAA-TGATGCATTTCTCAAC-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_strictipile CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATTAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAATGAGCGATTCCGTGCTCCTGAGGCTTTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGATCTCTACGGCAACATCGTCATGGTATG-------TTTTCAG----TCCATTCACACAGCAT------CG-GGTTTTG-TAT--AGTGGCGCTAA-T--TGCATTCTCTACT-TTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_strigosum ---------------------------------------------CACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTATCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTTACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CGCA-ACCGAAAAACC-----------GGTAG-AAT--AGCAACGCTAA-TCATATATTTCTCAAT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_stromaticum CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTTACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGATCTGTACGGCAACATTGTCATGGTATG-------TTTTCAA----TCCGTCCTAACAGCAT------TT-AGTTTTG-TAC--AGTGGCGCTAATT--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_surrotundum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATTCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TT---TCACGCAGCAG------CG-AGTTTTG-TAC--GGTAGCGCTAA-C--CGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_thailandicum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTTTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTTTCCACCACCGCCGAGCGAGAAATTGTTCGTGACATCAAGGAGAAGCTTTGCTACGTCGCCCTTGACTTTGAGCAGGAAATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAACTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTG----TCCATTCGCGCAGCAG------CA-GGTTTTG-TAT--ATTGGTGCTAA-C--TGCATTCTCTTCT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_thelephoricola TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TTCGTCCACGCAGCAG------CA--GTTTTG-TAC--GGTAGCGCTAA-C--CGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCC-GGTCTC-- Trichoderma_theobromicola CTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCTTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTCACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCTTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCTCTTGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCTGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTAAG------TGATTTTT----CGCA-TTCAGCAACTG-----------GTTTC-TAT--AGCGGCGCTAA-TCATGCATTTCTCACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_tomentosum TTACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATTCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCAG----TTGATTCGCACAGCAT------CA-GTTTATG-TAT--GATGGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_turrialbense --ACAATGAGCTGCGTGTTGCTCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACTGCCGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGATGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG------TTGTGAAT----CTTTTTTGAACGTGAC-----CTTTTTTGTTG-TGC--AGTGACGCTAA-T--CGCATTCTC-ACT-ACAGTCTGGTGGTACCACCATGTACCCTGGTCTC-- Trichoderma_velutinum -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCTGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGA?TCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTTGAGCAGGAGATCCAGAC?GCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATTGGCAACGAGCGATTCCGCGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTC----TTGGTTCACACAGCAT------C?-AGTT?TG-TAT--GACAGCGCTAA-T--TGCATTCTCTACT-CTAGTCTGGTGGTACCACCATGTACCCCGGTCTCT- Trichoderma_victoriensis CTACAATGAGCTGCGTGTTGCTCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCTATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAAACCTTCAACGCTCCCGCTTTCTATGTTTCTATTCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCTTGGCTGAGCGTGGTTACACTTTCTCCACTACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTCTGCTACGTCGCCCTTGACTTCGAGCAGGAGATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCCTCTGTCCTGGGTCTTGAGAGCGGCGGTATCCATGTCACCACCTTCAACTCCATCATGAAGTGCGATGTCGACGTTCGAAAGGACCTCTACGGCAACATTGTCATGGTACG------TTAG-AAT----CGGGTATGAATATTAG---------GCTTTTG-GGT--AGTAGCGCTAA-C--CGCATTCTC-AAT-CTAGTCTGGTGGTACTACCATGTACCCCGGTCTC-- Trichoderma_virens TTACAATGAGCTGCGTGTTGCTCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCCCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTGTACGGCAACATTGTCATGGTATGT------TTTCCCA----TCCTTTCACACAGCAT------CA-AGTTTTG-TAC--GGTAGCGCTAA-T--TGCATTCTCTACT-CCAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- Trichoderma_virescentiflava -------------------GCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCTCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATTGTCTTCGAGACCTTCAACGCTCCCGCCTTCTATGTCTCCATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTGCTCGACTCCGGTGACGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTTCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACCTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGACATCAAGGAGAAGCTTTGCTACGTCGCCCTTGACTTCGAGCAGGAAATCCAGACTGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTTATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGTGGTATCCACGTCACCACTTTCAACTCCATCATGAAGTGCGATGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTATG-------TTTTCTG----TCCATTCGCGCAGCAG------CA-GGTTTTG-TAT--AATGGCGCTAA-T--TGCATTCTCTTCT-CTAGTCTGGTGGTACCACCATGTACCCGG------- Trichoderma_viride ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_viridescens -TACAATGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGTCCTGCTCACCGAGGCCCCCATCAACCCCAAGTCCAACCGTGAGAAGATGACCCAGATCGTCTTCGAGACCTTCAACGCTCCCGCCTTCTACGTCTCTATCCAGGCCGTTCTGTCCCTGTACGCTTCCGGTCGTACCACCGGTATCGTTCTCGACTCCGGTGATGGTGTTACCCACGTTGTCCCCATCTACGAGGGTTTCGCTCTGCCTCACGCCATTGCTCGTGTTGACATGGCTGGTCGTGATCTTACCGACTACCTGATGAAGATCCTGGCTGAGCGTGGTTACACTTTCTCCACCACCGCCGAGCGAGAAATCGTTCGTGATATCAAGGAGAAGCTCTGCTACGTCGCCCTCGACTTCGAGCAGGAGATCCAGACCGCTGCCCAGAGCTCCAGCTTGGAGAAGTCCTACGAGCTTCCCGACGGTCAGGTCATCACCATCGGCAACGAGCGATTCCGTGCTCCTGAGGCTCTGTTCCAGCCTTCTGTCCTTGGTCTTGAGAGCGGCGGTATCCACGTCACCACTTTCAACTCCATTATGAAGTGCGACGTCGACGTCCGAAAGGACCTCTACGGCAACATTGTCATGGTAAG------TGATTTT-----CGCC-CACGACAAATC-----------GGTTG-AAT--AGCAGCGCTAA-TGATGCATTTCTAAAT-TTAGTCTGGTGGTACCACCATGTACCCCGGTCTC-- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15966] TITLE ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=798; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_aeruginea ------------------------------------------CATTACCGAGTTTAC-AA--ACTCCCAAA--CCCAATGTGAACGCTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGGG------ACCAAAAAACC-AAA----CTCTT----------------GCAT-GCCCCCTC-GCGGG-------------CTT---------TCTCTAAGCTCTG-AGCC--TTTCTCGGCGCACCCTCGCGGGTCGC---TACG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT----------CGC--------GGGGGCCGGCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGG-G--CCCATGCCGTAAAACAACCCA-ACCTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_alcalifuscescens ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Hypocrea_alni -----------------------------------------------------------A---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTA-TT------------GTGT-ACCCCCTC-GCGGG--------------TTTA---------TTTATAATCTG-AGCC---TTCTCGGCGCCCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------CG----CG--GGGAGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_alutacea ------------------------------------------CATTACCGAGTTTAC-AG---CTCCCAAAC-CCCCATGTGAACGCTACC--AAACCGTTGCCTCGGCGGGG-------------------------------AC-TC---------------------------------------------GCGCCCCGCCGGAGG-------ACCGAACCAA--AAC----CCCTT----------------GCAT-GCCCCCCC-GCGGG-------------C-----------CTTTATCTCTCTG-AACC---GTCTCGGCGACCC-TAGC-GGGCGC---CCTG--------AAAAACGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGC-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGCGCGGCGTTGGGGA--T-CGGCCCT--CTAC-----------------------CGGCCGGCCCCGAAATCCAGTGGCGGTCCCGCCGCGGCCTCCCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GC-CCACGTCCGTAAAACACCCAA---CTTCCGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_americana -------------------------------------------------------------------------------GTGAACGTTACC--AATCCGTTGCCTCGGCGGGT--------------------------TAAACTCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTCGC--AAA----CTCTTTTT-------------GTATCATCCCTTC-GCGGA--------------------TTTTCT-AATAACTTCTG-AGCT---TTCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTAATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTT---ACAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGGCCGTGAAACACCCCAAAC-TTCTGAAAGGTT------------------------------------------------- Hypocrea_andinensis ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Hypocrea_avellanea ----------CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AG---CTCCCAAAC-CCCAGTGTGAACGTTACCGAAAACCGTTGCCTCGGCGGGACGGGGGGC----------GTGAAACCCCCCCCC-AG-GGCCCCGGGCGCGTC-------GCAGCCCCGGA--CGAAAG---GC-GCCCGCCGGAGG-------ACCGAAAAACTTCAAA---CCCTT----------------GCGC-GTCCCGTC-AGCGG-------------ACCTCT------CTAACGAAATCTG-AGCC---TCATCGGCGCCCC-CAGC-GGGCGT---GACG-------AGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--CGTC--------------------AGCGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCCCC-CGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTGAAACGACCCAACCTCTTTGAAGTGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAA------------ Hypocrea_chionea -AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TT-TTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Hypocrea_crystalligena ------------------------------------------CATTACCGAGTTGAC-AA---CTCCCAAAC-CCCAATGTGAACCATACC--ACACTGTTGCTTCGGCGGGA----------------------------------TC--GCCCCGGGCGCGTA-------GCAGCCCCGGG---CCAAG---GC-GCCCGCCGGAGG-------CCCTACAA----ACA----CTCC-TGT-------------ATTT-TTTTTTTT-ACGTA-------------------------------TCTTCTG-AGTT---TTCTCGGCG-CCCCTAGC-GGGCGT---TACG--------AAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAAAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAAAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACACTCGAG-CCCCCCC----GGGGGCTCGGCGTTGGGGA--T-CGGCAGC--CCCCCGGCCCTCCTTGCGAGGGGCGGGGAGCCGTCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACC-CCGTAAAACACACCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_dacrymycella ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAA--CCCGATGTGAACGTTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA--CCCAAG---GC-GCCCGCCGGAGG-------ACCAACCCG---AAA----CTCCTG-AT------------GTAC-G-CCCCTC-GCGGG--------------TCTT---------CTTGCAATCTG-AGCC---TTCCCGGCGCCCCCTCGC-GGGCGC---CTCGGGGGAAAAAAAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCTC------------C----GC--GGGGGCCGCCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTGAAACA-CCC-AAC-TCCAGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCATA-- Hypocrea_danica ------------------------------------------CATTACCGAGTTTAC-AA--ACTCCCAAA--CCCAGTGTGAACGCTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TCTTC-TGGCCCGGGCGCGTC-------GCAGCCCCGGG---CCAAG---GCGGCCCGCCGGAGGG----AAAACAACCAA---AAC----CCATT----------------GCAT-GCCCCCTC-GCGGG-------------CTT---------TCTCACAGCTCTG-AGCC-TAATCTCGGCGCCCCCTCGCGGGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT----------CGC--------GGGGGCCGGCCCCGAAATCCAGTGGCGGTCCCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGG-GCACCAACGCCGTAAAACAACCCAAACTTTCCGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_decipiens -------------------------------------------------------------------------------GTGAACGTTACC--AACCTGTTGCCTCGGCGGG--------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTTAC--AAA----CTCTTTTTTCTTGCACG----GGAG-ACGTCCTC-GCGGA-------------CTCTCTTCGTCTCTTATAGCCT?TG-AGCT---TTCTCGGCGCCCC-TAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCTC--CCGC--------------CTCGGCGGATTGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACAACCCAAACTTCTGAAA------------------------------------------------------ Hypocrea_delicatula ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAGTGTGAACGTTACCTACAACCGTTGCCTCGGCGGGAGGGGGGGCCCCCCCGAAAGGGAGGGCCGCCCCC-TG-AGCCCCGGGAGCGTC-------GCAGCCCCGGA---CCCAG---GC-GCCCGCCGGAGG-------ACCGAAAACCCCAAA----CCCTT----------------GCAT-GTCCCGTCAGCGGA-------------CTCT--------CTTACGAAATCTG-AGCC---TTATCGGCGCCCCTCAGC-GGGCGT---TACG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGCTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACAACCCAAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_epimyces ------------------------------------------------------------------------------------------------------CCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTG-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTTCCTT-----TTTACTATCTG-AGCC--TTTCTCGGCGCCCCCTCGT-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------CG----CG--GTGGGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTTAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_eucorticioides -----------------------------------------------------TTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGT--------------------------TAATTCTTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAAATTGC--AAA----CTCTTTTT-------------GTAT-ATCCCATC-GCGGA--------------------TGAT-----TATATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTT---ACAC-----------------------TTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGGCCGTAAAAAACCCCAAAT-TCTGAAA------------------------------------------------------ Hypocrea_flaviconidia -------------------------------------------------------------------------------------------------------CTCGGCGGGG----------------------------------TCACGCCCCGGGCGCGTA-------GAAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCGACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------AC-CGGGTGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-CTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Hypocrea_fomiticola ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TT-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTCTTT-------------GTAT-ACCCCCTC-GCGGG--------------------T--TTT--TATATATCTG-AGCC---TTCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--TAAC-----------------------CGGCCGTCCCCCAAATACAGTGGCGGCCCCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACAA-CCCAAA-CTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_leucopus ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAGTGTGAACGCTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCCAG---GC-GCCCGCCGGAGG-------ACCAAACCCC--AAA----CTCT-TGT-------------GTAC-ATCCCGTC-GCGGA--------------------T--TAT----TACTTCTG-AGCC---TTCTCGGCG-CCCCCAGC-GGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC--CGGGGGGCCCGGCGTTGGGGA--T-CGGCCGC--CTCG-----------------------CGGCCGGCCCCGAAATCCAGTGGCGGTCCCGCCGCAGCCTCTCC-TGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGG-GC-CCACGGCCGTAAAACAC-ACCAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_lutea --------TACAAGGTCTCCGTTGGTGA--CAGCGGAGGGATCATTA-CGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGG--------------------------------ATTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATCTAC--AAA----CTCTTT---------------GTAT-GTCCCTTT-GCGGA--------------------TTTTT----TACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCTT--CTAC-----------------------CGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACACCC-AACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Hypocrea_megalocitrina -------------------------------------------------------------------------------GTGAACGTTACC--ACACTGTTGCCTCGGCGGGA------------------------------------TCGCCCCGGGCGCGTC-------GCAGCCCCGGG---CCAAG---GC-GCCCGCCGGAGG-------ACCGA-------AAA----CTCC-TGT-------------ATTT-TTGTATTT------------------------------------TACCTCTG-AGCC---TTCTCGGCG-CTCCCAGC-GAGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGCTCGGCGTTGGGGA--T-CGGCACC--CCGC------------CCCTGAGGCGGGCGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACG-CCGTAAAACACCCCAAAC-TT?TGAAA----------------------------------------------------- Hypocrea_microcitrina -------------GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--ATTCTGTTGCCTCGGCGGGT--------------------------T--ATTTTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTTGC--AAA----CTCTTTTT-------------GTAT-ATCCCCTC-GCGGA--------------------TTTTCT--ATTACTTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTT---ACA------------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACACCCCAAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAG----------- Hypocrea_moravica ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------CT-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCT-CCT-------------GTAT-ACCCCCTC-GCGGG--------------------T--CTT--T-TATATCTG-AGCC--TTTCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGCTGGGGA--T-CGGCCCT--TAAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGCCCCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACAA-ACCAAA-CTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_neorufa -AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAA-CCCAATGTGAACGCTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGCGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-T---------------CTGCAGTCCGCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAC---AC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCCCC--CGGGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------ACACGGGTGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-CTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Hypocrea_nigrovirens ----------------------AGGTGAACCTGCGGAGGGATCATTACCGAGTTTAC-AG---CTCCCAAA--CCCAGTGTGAACGCTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCCAG---GC-GCCCGCCGGAGGG------ACCAACCAAAA-AAA----CCCTTACCGT-----------ATCA-GCCCCCTC-GCGGG-------------CGTTTC------CACCCCCGATCTG-AGCC---TTCTCGGCGCCCCCTCGC-GGGCGT---TCCG-------AAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT------------------CGCGGGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCAACGCCGTAAAACACCCAACTCTCTG---------------------------------------------------------- Hypocrea_nybergiana ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACCGTTGCCTCGGCGGGA--------------------------------TTTTCTGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCTCCAAACT----CTCT-TGT-------------ATAC-ATCCCGTC-GCGGA--------------------T--TCT----TACCTCTG-AGCT---CTCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCGC--CTGC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GC-CCACGGCCGTAAAACAC-CCCAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAA----------------- Hypocrea_parepimyces -------------------------------------------ATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACATTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTTCATTTTATCTTTACTATCTG-AGCC---TTCTCGGCGCCCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------CG----CG--GTGGGCCGTCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AACTTTCCGAAACGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_parmastoi ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAACCCCCAGTGCGAACATACCGTTTTCCCGTTGCCTCGGCGGGA-----------------------------------T-CGCCCCGGGAGCGTC-------GCAGCCCCGGG---CCCAG---GC-GCCCGCCGGAGG-------ACCC---CA---AAA----ACACC----------------CCTT-GTATCGTC-AGCGG-------------ATT---------CTTCTGAGCTCAG-CGCC---TCCTCGGAGCGCAC---------------------------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT------------------CGCGGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGG-GCACCAATGCCGTAAAACAACCCAAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAG Hypocrea_patella GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAGTGTGAACGCTACC--AAACTGTTGCCTCGGCGGGA--------------------------------TCTCTTGCCCCGGGCGCGTC-------GCAGCCCCGGA-TCCCACG---GC-GCCCGCCGGAGG-------ACCAACCAA---GGAAACTCACCTCCCTCTCTCCGTC---GCGC-GCGCCCTC-GCGCCGCGGCCCTGTCTTTTTTTTTTTTTTTTACCTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATTGAACAACCCTCGAA-CCCCCCC-----CGGGTTCGGCGTTGGGGA--C-CGGCCCC--TCGC---------------------GGGCGCCGCCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-GCTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTGAAACACCCCAACCGTGACCAGACGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAA------------ Hypocrea_phyllostachydis -----CGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-AC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTGTTT------------GTAT-ACCCCCTC-GCGGG--------------TTTTCT-------CTTACATTCTG-AGCC---TTCTCGGCG-CCCCCCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GC-CCATTGCCGTAAAACA-CCC-AACCTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCAT-------- Hypocrea_pillulifera GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCTATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGT-------------------------------CATTCATGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCA----AAA----CTCT-TTT-------------GTAT-GT-CCCTC-GCGGA--------------------CTTTTT--TATAATTCTG-AACC---ATCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--TTAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACGCCCGTAAAACA--CCCAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_placentula -----------------------------------------------------------A---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG-------------------------------AATTCACGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCA----AAA----CTCT-TTT-------------GTAT-GTCCCCCC-GCGGA--------------------C--TTT--CATGACTCTG-AACC---ATCTCGGCGCCCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--TTAC-----------------------CGGCCGGCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGCCCGTAAAACAC-CCCAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_protopulvinata -------------------------------------------------------------------------------GTGAACGTTACC--AATCCGTTGCCTCGGCGGGT--------------------------TAAACTCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTCGC--AAA----CTCTTCTT-------------GTATCATCCCATC-GCGGA--------------------TTTTCT-AACGACTTCTG-AGCT---TTCTCGGCG-CCCCTAGC-GGGCGT---TCCG---------AAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTAATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTT---ACAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGGCCGTGAAACACCCCAAAC-TTCTGAAAGGTT------------------------------------------------- Hypocrea_pseudostraminea -------------------------------------------------------------------------------GTGAACGTTACC--ATTCTGTTGCCTCGGCGGGT-------------------------CGATTTTTCTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTCGC--AAA----CTCTTTTTTG-----------TTAT-ATCCCTTC-GCGGA--------------------TTTTCT--GTCACTTCTG-AGCT---TTCTCGGCG-CCCCTAGC-GGGCGT---TTC{AG}---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATC{AG}ATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC--CGGGGGGGTCGGCGTTGGGGA--T-CGGCTT---ACA------------------------CTGCCGTCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACACCCCAAAC-TCATGAAAGGTT------------------------------------------------- Hypocrea_psychrophila -----------------------------CCTGCGGAGGGATCATTACCGAGTTTTC-AA---CTCCCAAAC-CCCATTGTGAACGTTACC--ACACCGTTGCCTCGGCGGGA------------------------------------TCGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCCAG---GC-GCCCGCCGGAGG-------ACCAGTAA----ACT----CCAT-TGT-------------ATTT-GTGTACCT------------------------------------TACTTCTG-AGCT---TTCTCGGCG-CTCCCAGC-GAGCGT---TACG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGCCCGGCGTTGGGGA--T-CGGCACC--CCGCC-----------CTCAAAAGCGGGAGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACG-CCGTGAAACACACCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATTA Hypocrea_pulvinata -----------AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCCGTTGCCTCGGCGGGT--------------------------TAAACTCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTCGC--AAA----CTCTTTTT-------------GTATCATCCCATC-GCGGA--------------------TTTTCT-AATAACTTCTG-AGCT---TTCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTAATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTT---ACAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGGCCGTGAAACACCCCAAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAC------ Hypocrea_rodmanii ---------ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGG--------------------------------ATTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATTTAC--AAA----CTCTTTT--------------GTAT-ATCCCATC-GCGGA--------------------TTTTTT---TACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCAC---TTAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACACCC--AAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Hypocrea_semiorbis -------------------GTAGGTGAA??CTG?GGAGGGATCATTAC?GAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------AT-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGCAGG-------ACCAACCA----AAA----CTCTTTAT-------------GTAT-ACCCCATC-GCGGG--------------------T--TTT--T-TATATCTG-AGCC---TTCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--TAAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGCCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTTAAACAC-CCCAAA-CTCTGAAATG-TGACCTCGGATCAGG-AGGAATA-CCCGCTGAACTTAAGCATATC----- Hypocrea_seppoi ------------------------------------------CATTACCGAGTTTAC-AG---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACCGTTGCCTCGGCGGGA------------------------------CTTCTC-TGCCCCGGGCGCTTC-------GCAGCCCCGGG---CCAGG---GC-GCCCGCCGGAGG-------ACCAAACC----AAA----CTCT-TGC-------------ATAC-ATCCCGTC-GCGGA--------------------T--TCT----TACCTCTG-AGCT---CTCTCGGCG-CCCCTAGC-GGGCGT---TCCG-------AAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGC-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCGC--CTGC-----------------------CGGCCGGCCCCTAAATACAGTGGCGGTCCCGCCGCAGCCTCTCC-TGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GC-CCACGGCCGTAAAACAC-CCCAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_spinulosa ------------------------------------------CATTACCGAGTTTAC-AA--ACTCCCAAA--CCCCATGTGAACGCTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGGG----AAAACAACCAA---AAC----CCATT----------------GCAT-GCCCCCTC-GCGGG-------------CTT---------TCTCACAGCTCTG-AGCCTTTTTCTCGGCGCCCCCTCGCGGGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT----------CGC--------GGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGG-GCACCAATGCCGTAAAACAACCCAAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_straminella ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TCTTC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG------AATCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG---------------TTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCC----TCCT-----------TT----AC--GGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Hypocrea_subalpina ------------------------------------------CATTACCGAGTTTGC-AAAGACTCCGAAAC-CCCATTGTGAACCTTACC--GTACCGTTGCCTCGGCGGGA-------------------------------CA-TC-CGCCCCGGGAGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCAGAGG-------ACCGAACCCG--AAA----CTCACATAACGCGC-------CAGG-GCCCCCTC-GCGGG-------------CCTGGG------CCAGCAACCTCTGAAGCC---TCATCGGCGCCCCCCCGG-GGGCGG---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT------------------CGCGGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGG-GCACCAATGCCGTAAAACAACCCAAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Hypocrea_sulawesensis ---------------------------AACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCGATGTGAACCTTACC--AAACCGTTGCCTCGGCGGGA-------------------------------CA-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GCGGCCCGCCGGAGG------AACCAACCCCCAAAAA----CCCCTGTC-------------TCGT-GCCCCCTC-GCGGG-------------CTC---------TCTCTGACCTCTG-AGCC---TTCTCGGCGCCCGCCCGC-GGGCGT---TCCG------AAAAAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGCGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGC-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCCCCCGGGGGGCTCGGCGTTGGGGA--T-CGGCCAC--CCTC----------GCC-------GGGGGGCCGGCCCCGAAATGCAGTGGCGGCCTCGCCGCGGCCTCCCCATGCGCAGTAGCTT------TGCAC-GCTCGCACCGGGACCGCGGCGC-GT-CCAACGCCGTAAAACACCCCGAACCTTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATTA Hypocrea_sulfurea -----------------------------CCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGT-----------------------------TATTTTTCTGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTCTC--AAA----CTCTTTTT-------------GTAACATCCCTTC-GCGGA--------------------TTTTCTAAATACTTTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTTA--ACAC-----------------------TTGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACACCC--AAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Hypocrea_tawa ------GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAAACCA---AAA----CTCTTA-CT------------GAAT-GCCCCCTC-GCGGG--------------TTTCTCTTAT---TTTATGATCTG-AGCC---TTCTCGGCGCCCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT----------CCG----CG--GTGGGCCGTCTCCGAAATTCAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AGCTTCCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Hypocrea_voglmayrii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Hypomyces ----------------------------AACTGCGGAGGGATCATTACCGAGTTTCCAAAA--CTCCCAAA--CCCACTGTGAACCTTACC--ACAACGTTGCTTCGGCGGGA------------------------------------CAGCCCCGGGCCC----------CCGCGCCCGGA---ACCAG---GC-GCCCGCCGGAGG------CCCCAAC------AAA----CTCT-CGT-------------GTCT-ACCCCAGC-GGCAT--------------------C---------TACGTCTG-AGTG---GCCCCGAAA-GGGCAAG------------------------CAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAT-GCCCCCC--CGGGGGCGCCGGTGTTGGGGG--A-CGGCCCG--CCGC-------------CCAGAGCGGATGGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCCCC-TGCGTAGTAG-CTACATACTGAAA-CCTCGCACC-GGAGAGCGGCGC-GG-CTCTG-CCGTCAAAC---CCCAAC-TCACGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Sphaerostilbella ------------------CCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTAT-AA---CTCCCAAA--CCCAATGTGAACATACCT--ATTCTGTTGCTTCGGCGGGA------------------------------------TCGCCCCGGGCGCGGCCGCAAGGCCAGCACCGGA---TCCAACGTGC-GCCCGCCGGAGG------ACCC---------AAA----CTCT-TCT-------------GTTT-CT------------------------------------------CACAGCGA-TATC---TTCTGAGTG-GCTCCATC-GCGAGCAAAACAA---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCTCCT--TGGGGGGATCGGTGTTGGGGA--T-CGGCCTC--CGCC------------CTCGCTGGTGGTCGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCTC-TGCGCAGTAG-TT------TGCAC-ACTCGCACC-GGAGAGCGGCGC-GT-CCAAG-CCGTGAAACCA-CCCAAA-TTTTATTAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_aggressivum AAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG-------------TTATT---------TTTACTATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------C-----GC--GGGGGCCGTCTCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCCGCTGAACTTAAGCATATCAATAA Trichoderma_amazonicum -------------------------------AGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG---------------TTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------CT----GC--GGGGGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCC----------------------- Trichoderma_arundinaceum -----CGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCTATGTGAACGTTACC--AAACTGTTGCCTCGGCGGG--------------------------------ATTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATTTAC--AAA----CTCTTTT--------------GTAT-ATCCCATC-GCGGA--------------------TTCTT----TACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCAC---TTAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACAACCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATTA Trichoderma_asperelloides ---------------------------------CGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------ACACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_asperellum GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------C----------------G-TATT---TCTTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------ACACGGGTGCCGGCCCCTAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_atrogelatinosum -------------------------------TGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------AC-TCATGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCGACC-A---AAA----CTCTTC-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTC---------CCCATAATCTG-AGCC---TTCTCGGCG-CCTCCCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCTC-----------TC----GC--GGGGGCCGTCTCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTTAAACA-CCC-AACTCTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_atroviride -AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGACCT-CGGGAGC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_aureoviride GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGCTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCTTC-------GCGGCCCCGGA--CCCAAG---GCGCCCCGCCGGAGG----AAGAAACAACCA---AAA----CTCCTTTTCCCCATGCCCCTCGCAC-GCCCCCTC-GCGGG-------------CCGCGTCGGGCTCTCTCTCTGAGCA-AAAC---TTCTCGGCGCCCCTCACC-GGGCGC---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCTC--CTCC----------CTCCGCGGGCGGGGGGCCGGCCCCGAAATTCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACAACCCAAACCTTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Trichoderma_austrokoningii -------------------------------------------------------------------------------GTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGCGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTCACAG-CTCTGAGCAAAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAACCCCCCCC----CGGGGGTCGGCGTTGGGGA--T-CGGGGAC--CCCT--------------CAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-CTCTGAAATGTTGACCTCGGAT--------------------------------------- Trichoderma_brevicompactum ---------------------------------CGGAGGGATCATTACCGAGTTTAC-A?---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA--------------------------------TTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATTTAC--AAA----CTCTTTT--------------GTAT-ATCCCATC-GCGGA--------------------TTCTT----TACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCAC---TTAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACAACCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCAT-------- Trichoderma_brunneoviride --------------------------------------AGGACATTACCGAGTTTAC-AA---CTCCCAAA--CCCAGTGTGAACGCTACC--GAACCGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAAACCG---AAA----CCCTTG-AT------------GTAC-ACCCCCTC-GCGGG--------------TTTTC--------CACGTGATCTG-AGCC---TTCCCGGCG-CCCCCCGC-GGGCGC---CCCG---------AAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATG--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT------------C----GC--GGGGGCCGTCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-TT------TGCAC-GCTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTTAAACA-CCC-AACTCTCCGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_candidum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGCTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA--CCCACG---GC-GCCCGCCGGAGG--AAAAAAAACAACC----AAA----ACTCTCCTTTAC---------GCAT-GCCCCCTC-GCGGG-------------CTGC--------CCTATACTCTGAG-CAAC---TTCTCGGCGCCCCTCAGC-GGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCCC----------TTC-----GCGGGGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACAACCCAAAC--TCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATA------- Trichoderma_caribbaeum --AGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_catoptron ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAA----CTCCCT-TC------------GCAT-GCCCCCTC-GCGGG--------------TTTT---------TTCACAATCTG-AGCC---TTCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCTC--CCTC------------T----GC--GGGGGCCGTCTCCGAAATGCAGTGGCGGTCCCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GC-CCACAGCCGTTAAACA-CCC-CAAACTCCGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATA----- Trichoderma_ceraceum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_ceramicum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAC----TCTTA--TT------------GTAT-ACCCCCTC-GCGGG--------------TTTTTTC------TACACTATCTG-AGCC---ATCTCGGCG-CCCCTCGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTCA--------------------CCGGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_cerinum ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------AC-TCATGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTT-TT------------GTAT-ACCCCCTC-GCGGG---------------TTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCTC-----------TT----GC--GGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_chlorosporum -----------------------------ACTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-----AAAAACAACCA---AAA----CTC-TTTT-------------GTAT-ACCCCCTC-GCGGG------------------------TTTTCTTACTTCTG-AGAA--CTTCTCGGCGCCCCTTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT---------------TCGCGGGGCGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACACCCA-ACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAA--- Trichoderma_chromospermum --------------------------------GCGGAGGGATCATTACCGAGCTTAC-AA---CTCCCAAA--CCCCATGTGAACGCTACC--GAACCGTTGCCTCGGCGGGA-------------------------------TC-TC-AGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCGACCCCG--AAA----CTCTTGCCGC-----------AACG-ACCCCCTC-GCGGG-------------TCTCGC------CCCTCACCGTCTG-AGCC---ACCTCGGCGCCCC-TCGC-GGGCGT---TCCG--------AACAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAT-CCCCCCC--CGGGGGGGTCGGCGTTGGGGA--T-CGGCCCC--CCCA--------------------CCGGGGCCGGCCCCGAAATCCAGTGGCGGTCACGCCGCGGCCTCCCC-TGCGCAGTAG-CT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GC-CCACAGCCGTTAAACACCCCAAACCTTC---------------------------------------------------------- Trichoderma_cinereoflava ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_cinnamomeum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCACTGTGAACGTTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TCTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG------AACCAACC-A---AAA----CTC----TT------------GCAT-ACCCCCTC-GCGGG--------------TTTTT--------TCCACAATCTG-AGCC---TTCTCGGCG-CCCCTCGC-GGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGC-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--CCTC-----------TC----GC--GGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTTAAACAACCC-AACTCTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_citrinoviride --------------------------------TCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA------------------------------TTC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAACT-C---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CCTACGTC-GCGGC------------------TCTGTTTTATTTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC--TCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_costaricensis -----------------TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGCTACC--AACCTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTA-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGGAAAAAAAAAACAACCA---AAA----CCCCTT---------------GCAT-ACCCCCCC-GCGGG-----------------------TTTTTTATACCTCTG-AGAA--CTTCTCGGCGCCCCTCCGC-GGGCGC---CCCG---------AAAACCAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGC-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------------CGCGGGCGGCCGGCCCCGAAATGCAGTGGCGGTCCCGCCGCAGCCTCCCC-TGCGCAGTAG-CT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GC-CCAATGCCGTAAAACACCCA-ACC-TTCTGGAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_crassum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_cremeum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG----AAAAAACAACCA---AAA----CTCTTTTT-------------GTAT-ACCCCCTC-GCGGG-------------------------TTTTTTACTTCTG-AGAA--CTTCTCGGCGCCCCTTTGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCAC--TCCC----------TCCTCTTTGGGGGCGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACACCCA-ACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAA--- Trichoderma_cuneisporum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAC----TCTTT--AT------------GTAT-ACCCCCTC-GCGGG--------------TTT----------TTTACAATCTG-AGCC---ATCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCATTGCCGTAAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCAT-------- Trichoderma_dingleyae -AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGGAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_dorotheae -AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_erinaceus -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TTA-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGCAAAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------CAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC---------- Trichoderma_estonicum -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAC----TCTTAT-TT------------GTAC-ACCCCCTC-GCGGG--------------TTTGTTTTT----TTTACTGTCTG-AGCC---ACCTCGGCG-CCCCTCGC-GGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTCA--------------------CCGGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATA----- Trichoderma_evansii ----------CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTA-------AAAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------AC-CGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC---------- Trichoderma_fertile ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCCGTGTGAACGTTACC--AACCTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAA----CCC----TT------------GTAT-G-CCCCTC-GCGGG--------------TTTTTT-------TTAACTGTCTG-AGCC---ATCTCGGCG-CCCCTCGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGCAGC-CCAATGCCGTAAAACA-CCC-AACTTTCCGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATT------- Trichoderma_gamsii -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATA----- Trichoderma_gelatinosum -----------------------GGTGAACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCCATGTGAACCTTACC--AAACCGTTGCCTCGGCGGGA-------------------------------TA-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCCA--AAC----CCTTTGCC-------------GCAT-GCCCCCTC-GCGGG-------------CTCTTTTTTG--TTTCCACAGTCTG-AGCC---GTCTCGGCGCCCC-TCGC-GGGCGT---TCCG---------AAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACACTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--CTCA--------------------CCGGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAT-GCTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTTAAACACCCCAAACCTA----------------------------------------------------------- Trichoderma_ghanense AAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAAC--C---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CTTCCGTC-GCGGC------------------TCTGTTTTAACTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCACG--CCCT----------------CACACGGGTGCCGGCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATA- Trichoderma_hamatum01 GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTA-------AAAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------AC-CGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_hamatum02 ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTA-------AAAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------AC-CGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_hamatum03 -----------AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTA-------AAAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CG-TAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------AC-CGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATA------- Trichoderma_harzianum01 ----------CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAA------------ Trichoderma_harzianum02 ---AGTGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--GCCT-----------TT----GG-CGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATA- Trichoderma_harzianum03 ----------CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG-----------TTTTTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Trichoderma_harzianum04 ----------CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCTA---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GCGGGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC---------- Trichoderma_harzianum05 ----------------------------------------------------TTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGG??G-------ACCAACCTA---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG------------TTTTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA?AACGCAGCGAAATGCGATAAGTAATGTGAATTGCA{AG}AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAG?GGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGC?C-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACC?CGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_harzianum06 ------GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTT-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_harzianum07 ----------CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTT-TT------------GTAT-ACCCCCTC-GCGGG---------------TTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAA------------ Trichoderma_harzianum08 ------GT-ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCTA---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAA------------ Trichoderma_harzianum09 --------------GTCT-CGGTGGTG-ACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTT-TT------------GTAT-ACCCCCTC-GCGGG---------------TTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCTGCCTCT-----------TG----GC--GGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_harzianum10 ------GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTT-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------TA----GC-GGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Trichoderma_helicum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Trichoderma_intricatum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC------------AAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCATTAA Trichoderma_koningii GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_koningiopsis -----------------------------------------------CCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATG--------------------------------------------------- Trichoderma_lieckfeldtiae -----------AAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------ACACGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_longibrachiatum -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA------------------------------TTC-TCTTGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAACTCC---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CTCCCGTC-GCGGC------------------TCTGTTTTATTTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_longipile AAAAGTCGTACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAC----TCTTT--AT------------GTAT-ACCCCCTC-GCGGG--------------TTT----------TTTACAATCTG-AGCC---ATCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCATTGCCGTAAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTG-ACTTAAGCATATCAATAA Trichoderma_martiale -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGACTT-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATA------- Trichoderma_melanomagnum -----------------------------CCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGG--------------------------------ATTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATTTAC--AAA----CTCTTT---------------GTAT-GTCCCTCT-GCGGA--------------------TTTTTATTATACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCTT--CTAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACACCC-AACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATTA Trichoderma_minutisporum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCTATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA----------------------------AAATTTCATCGCCCCGGGCGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG-------ACCAACCA----AAA----CTCT-TTT-------------GTAT-GTCCCCTC-GCGGA--------------------C--TTT--TATTATTCTG-AACC---ATCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACA--CCCAAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Trichoderma_novaezelandiae -------------------------------TGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAGTGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCCTTTTTATCTCCGTC---GCGG-CT-CCGTC-GCGGC------------------TCTGTTTTA-TTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCAAAACATTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_oblongisporum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TT-TA-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCT-TTT-------------GTAT-ACCCCCTC-GCGGG--------------------T--TTT--TTTATATCTG-AGCC---TTCTCGGCG-CCCCTAGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCCT--TAAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGCCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACAA-ACCAAA-CTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATTA Trichoderma_ovalisporum01 ----------------------------------CGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_ovalisporum02 ----------------------GTTGGTGACCGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGT{GT}AACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCG-------------------- Trichoderma_pachybasioides ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCTATGTGAACGTTACC--AAAATGTTGCCTCGGCGGGG---------------------------AATTTATTCATGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAA----CTCT-TTT-------------GTAT-GTCCCCTC-GCGGA--------------------C--TTT--TATAATTCTG-AACC---ATCTCGGCG-CCCCTTGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTACGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACA--CCCAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_parapiluliferum ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCTATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------AATTCATGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCA----AAA----CTCT-TTT-------------GTAT-GT-CCCTC-GCGGA--------------------C--TTT--TATAATTCTG-AACC---ATCTCGGCG-CCCCTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGCCC---TTAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCT-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACA--CCCAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_parareseei ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA------------------------------TTC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAACT-C---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CTTCCGTC-GCGGC------------------TCTGTTTTACCTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC--TCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCAT-------- Trichoderma_parestonicum ------------------------------------------CATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAC----TCTTAC-TT------------GTAC-ACCCCCTC-GCGGG--------------TTTTACCCT----TTTACTGTCTG-AGCC---ACCTCGGCG-CCCCTCGC-GGGCGT---TCCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTCA-------------------ACCGGGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACA-CCC-AACCTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_paucisporum -----------------TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGCAAAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCCCT--CGGGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------ACACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATTA Trichoderma_petersenii ----------------------------------GGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTCACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_pleuroticola AAAATCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------CT----GC--GGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_pleurotum ----TCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT-----------CT----GC--GGGGGCCGTCTCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAAA-- Trichoderma_protrudens -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGG--------------------------------ATTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATTTAC--AAA----CTCTTTT--------------GTAT-ATCCCATC-GCGGA--------------------TTCTTT---TACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCAC---TTAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACAACCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAC------ Trichoderma_pseudokoningii ----------------------------------GGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAAC--C---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CCTACGTC-GCGGC------------------TCTGTTTTA-TTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC--TCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGC---------- Trichoderma_pubescens ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTA-------AAAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------AC-CGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCA--------- Trichoderma_reesei GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA------------------------------TTC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAACT-C---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CTTCCGTC-GCGGC------------------TCTGTTTTACCTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC--TCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_rogersonii ---------------------------------TGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAA----AA-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCCTC----GGGGGTCCGGCGTTGGGGA--T-CGGGGAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCC--AAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGA---------- Trichoderma_rossicum ------GTAACAAGGTCT-CGTTGGTG-ACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTTTT-------------GTAT-ACCCCCTC-GCGGG-------------------------TTTTTTACTTCTG-AGAA--TTTCTCGGCGCCCC-TAGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTCA----------C---------CGGGTGCCGGCCCCTAAATACAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCAC-GTCGTAAAACACCCC-AAC-TTCTGAAATG-TGACCTCGGATCAGGTAGGAATA-CCCGC--------------------- Trichoderma_saturnisporum GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGA-------------------------------TC-TCTTGCCCCGGGCGCGTC-------GCAGCCCCGGAT-CCCATG---GC-GCCCGCCGGAGG-------ACCAACT-C---AAA----CTCTTTTTTCTCTCCGTC---GCGG-CTTCCGTC-GCGGC------------------TCTGTTTTATTTTTGCTCTG-AGCC--TTTCTCGGCGACCC-TAGC-GGGCGT---CTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--TCAC----------------------CGGGCCGCCCCCGAAATCCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GG-CCACAGCCGTAAAACACCCCAAAC--TCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_sinuosum -------------------CCGAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAAA---CTCCCAAC--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG----AAAAAACAACCA---AAA----CTCTTTTT-------------GTAT-ACCCCCTC-GCGGG-----------------------TTTTTTTTACTTCTG-AGAA--CTTCTCGGCGCCCCTTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCAC--TCCC----------TCCTCTTTGGGGGCGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACACCCA-ACT-TT----------------------------------------------------------- Trichoderma_spirale01 -------------------?GTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAC----TCTT---TT------------GTAT-ACCCCCTC-GCGGG--------------TTT----------T--TATATCTG-AGCC---ATCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCATTGCCGTTAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCCC?G- Trichoderma_spirale02 ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAC----TCTT---TT------------GTAT-ACCCCCTC-GCGGG--------------TTT----------TTATATATCTG-AGCC---ATCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCATTGCCGTTAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_spirale03 ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAC----TCTT---TT------------GTAT-ACCCCCTC-GCGGG--------------TTT----------T--TATATCTG-AGCC---ATCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCATTGCCGTAAAACA-CCC-AACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_stilbohypoxyli GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTCT-TTC-------------CTGAAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAGAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGGGAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GC-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_strictipile -----------------------------CCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCCATGTGAACGTTACC--AACCTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCAA---AAA----CCC----TT------------GTAT-GCCCCCTC-GCGGG--------------TTTTTT-------TTTACTGTCTG-AGCC---ATCTCGGCG-CCCCTCGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCCCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC-----------------------CGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGCAGC-CCAATGCCGTAAAACA-CCC-AACTTTCCGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_strigosum ------GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGCGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TTA-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTTT--------------------TACTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--TGCGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_stromaticum AAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCCA---AAA----CTCTTTAT-------------GTAT-ACCCCCTC-GCGGG-----------------------TTTTTTTTACTTCTG-AGAC--TTTCTCGGCGCCCC-TAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCC--GTCA----------C---------CGGGTGCCGTCCCCCAAATACAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCTCGTCCGTAAAACACCCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTA------------- Trichoderma_surrotundum -----------------CCGTAGGTGGAACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGGG-AAAAAAAACAACCA---AAA----CTCTTTTT-------------GTAT-ACCCCCTC-GCGGG-----------------------TTTTTTTTACTTCTG-AGAA--CTTCTCGGCGCCCCTTAGC-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCAC--TCCC----------TCCTCTTTGGGGGCGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCGGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCAATGCCGTAAAACACCCA-ACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAA--- Trichoderma_thailandicum -------------------------------------------ATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG------AAAACAACCA---AAA----CTC-TTTT-------------GTAT-ACCCCCTC-GCGGG-------------------------TTTTTTACTTCTG-AG-A--CTTCTCGGCGCCCCTTAGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT------------------CGCGGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCATTGCCGTAAAACACCCA-ACC-TTC---------------------------------------------------------- Trichoderma_thelephoricola -----------------------GGTGAACCTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGCTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG---AGGAAAAAAACCAA--AAA----CTCCCTTT-------------GTAT-ACCCCCTC-GCGGG-------------------------TTTTCTACCTCTG-AGAA--CTTCTCGGCGCCCCCTAGC-GGGCGT---TCCG---------AAAATGAGTCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGC-ACTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT---------------CCGCGGGGCGGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCCCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GC-CCAATGCCGTAAAACACCCA-ACT-CTC---------------------------------------------------------- Trichoderma_theobromicola -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------AACCAACC-----AAA----CTCT-TT--------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCCCT--CGGGGGGATCGGCGTTGGGGA--T-CGGGACC--CCTC-----------------ACACGGGTGCCGGCCCTGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAACT-TTCTGAAATG--------------------------------------------------- Trichoderma_tomentosum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------AC-TCATGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACC-A---AAA----CTCTTT-TT------------GTAT-ACCCCCTC-GCGGG---------------TTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCTC--CCTC------------T----GC--GGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCC-AAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_turrialbense ------GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGG--------------------------------ATTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAATTTAC--AAA----CTCTTTT--------------GTAT-ATCCCATC-GCGGA--------------------TTCTT----TACATTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCAC---TTAC-----------------------CTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCACGGCCGTAAAACAACCCAAAC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_velutinum ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TCTTC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG------AATCAACC-A---AAA----CTCTTA-TT------------GTAT-ACCCCCTC-GCGGG--------------TTTT---------TTTATAATCTG-AGCC---TTCTCGGCG-CCTCTCGT-AGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCC----TCCT----------------TTCACGGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACA-CCCAACT-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATC----- Trichoderma_victoriensis -------------------------------CT?GGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAAC-CCCAATGTGAACGTTACC--AATCTGTTGCCTCGGCGGGT--------------------------T--ATTTTTC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACTCTC--AAA----CTCTTTTT-------------GTAACATCCCTTC-GCGGA--------------------TTTTCTAAATACTTTCTG-AGCT---TTCTCGGCG-CTCCTAGC-GAGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAG-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCTTA--ACAC-----------------------TTGCCGGCCCCGAAATGCAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCAACGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACACCC--AAC-TTCTGAAAGGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCT--------- Trichoderma_virens -------------------------------CTCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGTGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG-------ACCAACCA----AAA----CTCTTATT-------------GTAT-ACCCCCTC-GCGGG--------------TTT----------TTTACTATCTG-AGCC---ATCTCGGCG-CCCCTCGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--TTAC----------------------GGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCATCGGGAGCGCGGCGC-GT-CCACAGCCGTTAAACACCCC-AAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCA---- Trichoderma_virescentiflava ------------------------------CTGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACGTTACC--AAACTGTTGCCTCGGCGGGA-------------------------------TC-TC-TGCCCCGGGCGCGTC-------GCAGCCCCGGA---CCAAG---GC-GCCCGCCGGAGG------AAAACAACCA---AAA----CTC-TTTT-------------GTAT-ACCCCCTC-GCGGG-------------------------TTTTTTACTTCTG-AG-A--CTTCTCGGCGCCCCTTAGT-GGGCGT---TTCG---------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGA--T-CGGCCCT--CCCT------------------CGCGGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCC-TGCGCAGTAG-TT------TGCAC-ACTCGCACCGGGAGCGCGGCGC-GT-CCATTGCCGTAAAACACCCA-ACC-TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATAT------ Trichoderma_viride GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TT-TTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGGTCGGCGTTGGGGACTT-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA Trichoderma_viridescens GAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTAC-AA---CTCCCAAA--CCCAATGTGAACCATACC--AAACTGTTGCCTCGGCGGGG----------------------------------TCACGCCCCGGGTGCGTC-------GCAGCCCCGGA---ACCAG---GC-GCCCGCCGGAGG------GACCAACC-----AAA----CTC--TTT-------------CTGTAGTCCCCTC-GCGGA--------------------CGTTAT--------------------TTCTTACAG-CTCTGAGC-AAAAAT---TC-----------AAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGT-ATTCTGGCGGGCATGCCTGTCCGAGCGTCATT--TCAACCCTCGAA-CCCCTCC----GGGGGTCCGGCGTTGGGGA--T-CGGGAAC--CCCT--------------AAGAC-GGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCA-TGCGCAGTAG-TT------TGCACAACTCGCACCGGGAGCGCGGCGC-GT-CCACGTCCGTAAAACAC-CCAAC--TTCTGAAATGTTGACCTCGGATCAGGTAGGAATA-CCCGCTGAACTTAAGCATATCAATAA ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15967] TITLE TEF; LINK TAXA = Taxa1; DIMENSIONS NCHAR=845; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_aeruginea ---------------------TTACTTCATTAATTCA---------------------ATTCTCGTTTCACATTTCAAT--GTGGTCGA--A-------CTTTCAACAGAGT------TCTGTCAAC------CAC--------------------GCGTC-A----CCCCGCTTTCTGTTATCGTTA--C--CCCTCCTTCACAGCAACGC------------CAAAAAAAATTT--G-----CAGC-CT--CGA-A---TTTTTTGTGGGG--------------------TT------G------CAC----CCCACCAA------------------------TTATTTTTTTCCGC-GCCGATGT------CTCTCAATATGCTC---------------------------TGCGCCTTTGAT--------CATGTTTTAATCCAT----GCTAATCCC--------ATC-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTACACCTGATGT-ACCAAG---------------TGCTTCT--CATTTTC-AATCCGATGCTAACATG---C---------TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_alcalifuscescens ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Hypocrea_alni ------------------------GATTTTCGCCTCG------------------ATTCTCCCTTCA---CATCCAATT--GTGCTCGATCA-------TTCTGAAGAGAAT------CTTCGTGTC------GA----CAATTTT----------TCACC-A----CCCCGCTTT------GGGTTA--C--CCCTCATTTGCAGCGACGC--------------AAATTTTTTT--G-----CTGT-CG--TTT-G---GTTTTAGTGGGG--------------------TCCCTTGTG------TAC----CCCACTAGCTCAC---TG-CT-TTTTTTGTGCTTCACTCTCACTGC-TCAGCCAT------CATTCAGCGCGCTC-------------------------------TGTCTCTC--------ATCA--TGCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGCGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGCTACATCAACT-TCATGC---------------TGC-------GATTGC-GAGCCAGTGCTAACAGA---CAAT---T--CT-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_alutacea ---------------------------GTTTTTTTTT---------AACTCATTTCTTCCCTTTTTATACCATGTAGCT--GTGCTCGATAA-------TTCTCTGAATTTT------CTTGCCAAT------TTCCTTCTCTCTCCCA-------CCGTC-A----CCCCGCTTTCGCTACCT------A--CCCCTCCTTTTGCCAACGA-----------AAACTTTTTTTGG--G-----CTGGCTC--TTTTG---GCTTTAGTGGGT----------------TGCTCTTTATGTG------GCA----ACTCCATCACTATCTCCGACCACCAGTTCTTCGCCTCTCTTC-------------------TGTTCGATCAACGCTGCATTT------TAATTTATCAAGCCGCGTTGCCTGCTCCGTTTC-CGTCGTTCCGTTAAT----GCTAATCAT-GTTTCCCTCA-ATAGGAAGCTGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGT---TTTGATCTACTTTAGATCGCC---------------GCA-------ATCGAA-AAGCCAACGCTAATACC---AAAT---TC-CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGCACTGGTGAGTTCGAGGCTGG Hypocrea_americana ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Hypocrea_andinensis CGAGAAGGTAAGC-TCA---GTCC---ATTCGATTTTGCG---------TCCATTC--CCA---TTG---CCCATCGTT--GTGCCCAACGT---TC--GTCGA--ACGAAC------TTGGGTATC-A----GCAGGGCTTT--C--------AA-C--C-A----CCCCGCTTT-----CTC-TTCCTA--CCCCTCC-TT---TGAGCGA----CGC-----AAA-TTTTTTT--G-----CTGCCTT---GTCG-G-TTTT-AGTGGGG-GTGCCGCTC----------------GAG------CAA----CCCCACC-ACTGCC-------ATCATG-CCGCTCAAGTCCCCTT---GCTC----------------------------------------TTCGTGTGCATC----ATTACCGCAG----TG--TCCTTCAGCGAT----GCTAACCAT-GTTCCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCA-A--TCTATCGC-CTCGC---TG----------TAT------CGTTCTC-GACATGACACTAACGAC---TACT---C--TG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_avellanea CGAGAAGGTAAGCTTCTATCTTAATCTACCCATTTGT------------CTTTTGCCAGTTTCATTCGACTGCGCAATCGAGCGCTCAACAT---TT---------------------TTTTTTGACTG----GTACCAATTTTTTCTCCCAATCA-----------CCCCGCTTT------CACAGGCTA--CCCCTCCTTTTTACGACAGC------------AAATTTTTTACTGG-----CTACCTT--GATTG-G-TTTT-AGTGGGG-CCGTATTTTTG--------------TGG------CAA----CCCTCACGGCAACC-----------TCTCGGGGTCGCATTCTGC---CTCTTACT---------------ATTGCTCAATAA------GAACCGAAATCAGTCATCTCTTGTAATTC----TCTTCTCGTCAGCCTT----GCTAATCAT-CCTTGACTTG-ATAGGAAGCTGCAGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAGGG---TTT-ACTCCCCTCGC-CTGAACTTTA-------------------AATCATA-ATGGCGGTGCTAATACC---CATC--CC--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TGCCTGGTACCTCCCATG------------------------------------------------------ Hypocrea_chionea CGAGAAGGTAAGC-TCA---ATT-CA-CC--------------------CTTTTTCATCACGCAT-TTTTGGCACAATT--GTGCTCCACGA---CT--CTGTCC-TC----------AGTCTTGTC------AT------TT-----CTCTCTCAGCGTC-ACA--CCCCGCTCTAC----CT--GTCTA--CCCCTCCTTT---GGCACAG----C--A----AAAATTTTCTG--G-----CTGCCTT--GTCTG-G-TTTTTAGTGGGG-TGCCACCTTTTTTCT-----------GG------CAA----CCCCGCT-GTAGTC-----------GT--------------------CCATCGCC------CCAACAGATTACACTCAGTCA------ATCGCGTCGTCTTCT----GCCTCAACTCGGGGTTTTTTTTTTCATCGT----GCTGATCAT-GTTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGT---CTTTTTCTTTC-TTC-TCGTTGCTTG----------ACA--TCT-CGAGA----CCATCGTTCTAACGTT--TCA-----C--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTGT-CCTGATCATCGCTGCC----------------------- Hypocrea_crystalligena -------------------------------------------------------------------------ACTATA--ACTCCCGCCCG--------TATTCTCGTTTT------TTTTGTGCT------CGAATTTTTTTTCCTG-------TTGGC-G----CACCCCGCTCCTCTGCCT-----A--CCCCTCCTTTGGCGCAGAG-----------ACAAATTTGTTTT--G-----GGTGCCT--CAATT---GGTTTGGTGGGG-----------------------------------CAA----ATCTCGCCACATTACTTCACTTTGGCTTCTCTATCACTGTCGTCAACTTGTCATC------TCTGCACCAAGTTT-------------------------------CTTCTGCTGCTGCTGCTTCTTCTTAAATCAT----GCTGACCAT-GTCTTCTTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CGTGTCAACATCTCTCTCATT---------------TCC------ATGTTAC-AACAGTTTGCTAATTAT---AATT---T--TTTTTTTTTTTTTTTCGTTAATAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGTGCTAT-CCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_dacrymycella ------------------TATCGCATCGCCCCCTTCCCCCCCGGCG---------ACCCTCTCTTCA---TAGTCAATT--TTGATGGGCGA-------TTCTGAACAGAAC------TCCCGTATC------AAACAATTTT-------------TCATC-A----CCGCGCTTTCCTTTA--------C--CCCTCGTTGACAGCGACGC-------------AAATTTTTTTT--G-----ATGTCCT--TT--G---GTTTTAGTGGGG--------------------TTTTCTTCA------CGC----CCCACTCGCCAACT--------GGTTTTGTGCTTCCCTCTCACTAT-TCAGTCGC------CATCCAACGTGTCTCTGTGTC----------------------------------------CTCAATTCCAGCGATTCTAACTAACCAA-TGTTATATCG-ATAGGAAGCCTCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTTCTATGTCACCGTCATTGGTATGT---CTGGCTCATCAACT-TCATGC---------------GGC-------AATTAC-AAGCCAGTGCTAATAAA---TGCT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCTGG Hypocrea_danica -----------------------------TAATGCCT---------------------ATTTCCTTTTCGCATTCAATC--GTGATGGGAAA-------ACTCC--CGGTTT------TCTCATGTC------AACCACATTT-------------CTATC-A----CCCCGCTTTCGCCTGTCGCTACCC--CCCTCCTTCGCACCAGCGCA----------CAAAGTTTTTTTT--T-----TTCAGCC--TTGCA---AATCTTTTAGTG--------------------CGGGGGTCA------AAG----CCCCGCTGAGCGCGCCTTCCTTTTTTCTGTCCTTTTTTCGCG-----AATGACCT------CATCCATCGCACAA----------------------------ATGCTCTTAAT--------CGTCTTTTCAGCCAT----GCTAATCAA-TTTCCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCTCATGATGCACT-CACCAT---------------CTT---------------CCATATGGCTAACAAC---C--T---C--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCTCA-GGCCGACTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_decipiens ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_delicatula ---------------------------GTTCACTTTT------------TCGTCGTGATTTTTTTCCTTTCCTTTAGCT--GCGTATTTGCG-------CACCTGCCATTTT------TTTTCCTGC------GCCTGTGTTCCTTCC--------CAATC-A----CCCCGCTTTCACAGGCT------A--CCCCTCCCACAGCAGC--------------AAATTTTTTCCTG--G-----CTACCTT--GTTTG---GTTTTAGTGGGG---------GCACATAATTTTTTTGTGTG------GCG----ATCTCACAATAGCCTCTGGATGTCATTTGTCAATTTCCTGTT---------------------GCCAATCATGACACAAATC------TATCTGTCCACCTCTAGCCTCCTTTC--------TTCTTGGTCAGCTTC----GCTAATCGG-TCATCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAGGT---TTCTTTTCCATTCG-CCTTGC---------------ATCTGATTCCAAAAAA-GTGACGTCGCTAATGCC---AAAC---T--CA-------------------CAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTGGAGGCTGG Hypocrea_epimyces -----------------------------------------------------------------------------TT--GTGCTCGATCA-------TTTCGAAGAGAAT------TTTCGTGTC------GA----TAATTCT----------TCATC-A----CCCCGCTTT------CCGTTA--C--CCCTCCTTTGCAGCGACAC---------------AATTTTTTT--G-----CTGT-CG--TTG-G---GTTTTAGTGGGG--------------------TTCCCTGTG------CAC----CCCACTAGCTCAC---TGCCT-TTTTTTGTGCTTCACTCTCACTGC-CCAGCCGT------CGTTCAACGTGCTC-------------------------------TGTCTC----------GTCA--TTCAGCGAT----GCTAACCACTTTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCCTTCATCATCT-TGATGC---------------AGC-------AATCAC-GAGCCAGTGCTAACAGG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_eucorticioides ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Hypocrea_flaviconidia -GAGAAGGTAAGC-TCG---TTT-CA-CTAC--------------------TTTTCCCCATTCGT-TTTGGGCACAATT--GTGTCCGACAA---TA--CTGTTT-TTCTCA------AGTCTTGTCA-----AC-----------TTTTTCACCAGCATC-GCA--CCCCGCTTTGC----CT--ACCTA--CCCCTCCTTT---GGCACAG----C--A----AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-TTTTTAGTGGGG--GCCAATTGTT-----------TGGCAG------CAA----CCCCGCT-ATCGCC-----------AC-TGGCC-----CTC-GT---CCATCGC-------CCAACACACTCTCGAGTTGCT---------------------------------------CTTTTGGGTTCATGGT----GCTAATCAT-ACTTCGATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCAG-------TC-CGACTAGTCG----------ATA--TTC-CAACA----TCATCTCGCTAACATG--CTGCCG-----TC-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGACTGCGCTGT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_fomiticola ----------------------------------CAG---------------------ATTCTCAGCCTCAATTTTCCT--ATTGTCAGCAA-------TTTTCGAACGAAT------TTGCGCGGC------CACAATGCTCTCCCTTGCCAACATCATC-A----CCCCGCTCTCGT---TGCCTA--C--CCCTCCTTTGCAGCGACGCA----------AATTTTTTTGGCT--G-----CCTGGTT--TTT-G---TTGGTGGGGTTG--------------------CACCTGTGG------CGA----CCCCACCACAGCCTTGGGCCTACTTCATACCTTTGTCTATTACCAC-ACAAAACT------TTTCCATTCCATCCATATCCA------CATCAGGCTTCAAACGTCTTCAACCT--------GTTGCTTTTAGCGAT----GCTAACCAG-ATTTCTCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGT---CTAATACATCACCC-ACATTC---------------AGC-------ATCCAC-AAGCCAGCGCTAATACA---AGTC---C--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCTCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_leucopus --------------TAAGCTCAGTCCACCTCTTGTTT------------ATTGGATCTCCCTGTTTCCGCCTTGCAATC--GTGCCCTGCAA-------TTTTCTTGAT---------TTTCGTATC-------AATTTTCTTTGCCCA-------CCTTC-A----CCCCGCTTGCACTGCCTT-----A--CCCCTCCTTTAGCCAACGC-----------AAATTTTTTTTTG--A-----CTGCGTT--GTTTG---GCTTTAGTGGGG-------------CTGTGCAGTTTGTGTG------GCG----ACCCCACTAGCTCCCTCGAACGCTCATCATTCTACTTTCTCCTTCATTTTGGCT-------TAATCGCCCAGCACTACAAGC------CATAATGGCAAATTACCCTGCCTTCC--------CTTGGTTTCATCTAT----GCTGACCAT-CTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TACTATCCCTCTTGTGCCCGT---------------TGT------CATCGAA-AATCCAGTGCTGACATC---ATTT-CCCCCCA-------------------CAGACGCTCCCGGCCACCGTGACTTTATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_lutea CGAGAAGGTAAGC-GCA---GTCGACTGATTTCCTATAT----------CTTTTTTCCCCCGCTGCTTCCCTCGCAATT--GTG-CCGACAA---TT--CT-----ATGAAT------TTTCGTGTCA-----ACAATTTTTTTTTTTCACTTCC------------CCCCGCTTT------TGTGGCCTA--CCCCTCCTTT--TGGCAGAA----CGC-----AAATTTTTTTT--G-----CTGCCTT---TCTG-G-TTCT-AGTGGGG-GCGCGCATG----------------TAG------CGA----CTCCACC-GTTGGCTCTGGCTCTTATCTCATCAGGCATCAATGC----------------------------------------------------------------CTTCATATC----TTGTCTCTTCAGTTGT----GCTAACCAA-GATTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGT---TTTCCGATTCATGTT-GCGG---ATC----------TGG------TGTCGAT-GAACAAGTGCTAACACA---TGCC---T--CA-------------------CAGATGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_megalocitrina ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_microcitrina ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Hypocrea_moravica ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_neorufa CGAGAAGGTAAGC-CCA---TTA-CAACTTT------------------TTTTTCCATCATTTTTTTTTTGGTATTCACGTGTGCGCGACGA---TT--CTGTTC-TC----------AGCTTTGTCAA----TT------CTTTTCACTCTCCCACAATC---A--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCATGG----TGCA----AAATTTTTCTG--G-----CTGCCTT--GTTTG-GTTTTTTAGTGGGG-TGTTTCAATTCTT---------TGGCAG------CAA----CCCCGCT-ATCGCC-----------AC-TGTCC-----CTC-AT---CCATCG---------CAACACAATTTGT---CTCC------ATTGCACCGTCTGCC------CTCAAATG----CTTTGTGATTCATTGT----GCTGACCAG-GTATTCAATT-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCTG----TTCTT-CTCCCAGACC----------GCG--TCT-GAAGA----TGGCCATTCTAACACG--CTG--C-TT--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- Hypocrea_nigrovirens ----AAGGTAAGC-TCA---ATCA---ACAAAGTCTCCATC--------TCAATTT--GC-CTTTGG---CAATCAATT--GTGCTCGATAA---TT--CTGCA--CGGAAT------GGTCGTGTC-G----ACGA--TTTTTTG--------CG-T--C-A----CCCCGCTTT--CGCTTC-CTATTA--CCCCTCCTTT---GCAGCAA----CGC-AA--A---ATTTTTA--G-----GCGGTGT----TT--G-TTTT-AGTGGGG-TTGCA---C----------------CAC------CAA----CCCCGCT-ACA----------GCTCAC-TGC------CGCTTGT---CCCTGTGC------ACC----A-CTACGCAGTTGT------C---CAACGCGTC-------TTCGTTTTC----ATTTGCAGCGAGCGAT----GCTAACTATGACTCCCCTCA-ACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TGCATCAT-TTTTTCGATG----------TCT------CCGTTAC-GAGCCAGCGTTAACATG---ACTTTTCT--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTG- Hypocrea_nybergiana -------------------TAAACTCGGTCCAATTAT------------TTTTTTTCCCCCTCTTCTCGCTTTGCAATC--GTGCCCAACAA-------TTCTCTTGTAAAT------TTTCGTGTC------GAATTTTTTTTCCCTG-------CCGTC-A----CCCCGCTTTCACTGCCTT-----A--CCCCTCCTTTAGCCGACGCA----------GAAATTTTTGTCT--G-----CTTGCTT------G---GCTTTAGTGGGG---------------GTGCACTTTTGGTG------GCA----ACCCCACCGGCTCCCTCTGACTCTCATCATTCGTC--------------------------TCATCGCCCAGCGAAAGC---------CATTTTGCCAAACCACGTTGCCTGCCTTCGTTTGTTTTATTTCATCCAT----GCTAACCAT-CTGTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTTGATCCCTCTTGTCCCGT---------------GGG------CATCGAA-AACCCAGCGCTAATATA---AACT---TCATC-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-TCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCCGG Hypocrea_parepimyces --------------TAAGCGCCAACTGATTTCGCCTG------------------ATTCTCCCTCCA---CATTCAATT--GTGCGCGATCA-------TTCTGCAGAGAAT------TTTCGTGTC------GA----CAATGTT----------TCATC-A----CCCCGCTTT------CCGTTA--C--CCCTCCTTTGCAGCGACGCA----------AAAAAATTTTTTT--G-----CTGT-CG--TTT-G---GGTTGAGTGGGG--------------------TTCCCTGTG------CAC----CCCACTAGCTCAC---TG-CT-TTTTTTGTGCTTCACTCTCACTGC-CCAGCCGT------CATTCAACGTGCTC-------------------------------TGTCTCTG--------GTCA--TTCGGCGAT----GCTAACCACCTTTTCCATCA-ATAGGAAGCCGCCGAACTCGGTAAGGGCTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTCATTCATCACCT-TGTTGC---------------CGC-------AATTGT-GAGCCGCTGCTAACAGG---CAAT---T--CG-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_parmastoi ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Hypocrea_patella ----GTGGTATCT---------------------------------------------------------CGTACCATT--GCGCCCGAC----------------CGCATT------TTGCGTGTC-G----GCAGGGCTTTTCCAT------CA-T--C-A----CCCCGCTTT--CTCTTC----CTA--CCCCTCCTTT----GAGCGA----CGCAAA--TTTTTTTTTTT--G-----CTGCCTT----ATC-G-CTTT-AGTGGGG-GTGCACCCC----------------AAG------CAA----CCCCGCC-ATTGGCTCAGGGTGCTCAC-AGG----CTCTCTCACATGTCCAAACA------GCA----ACCTCCCCTTTGCC------TTCCCCACTCGCTTT----ATCACTGCTT----CAGCGTTCTCCACCAT----GCTAATCAT-TTTTCTCTCA-ACAGGAAGCCGCTGAGCTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--ATCGTCAC-TTGACCTGC-----------TCG------TCCTCTC-AACACAACACTAACGAG---TTCC---T--GG-------------------CAGACGCTCCCGGTCACCGTGACTTCATCAAGAACATGA-TCACCGGTACTTCCCA-GGCCGACTGCGCTAT---------------------------------------- Hypocrea_phyllostachydis ----GAAGGAAGC-TCA---ATC----AAATGATTCTCGCC--------TCATTTTTTCC-CTTTCA---CACTCAATT--GTGCCCGAGAA---TT--CTGAA----CAGT------TCTCTTGCC-A----ACAT--TTTTTTT--------CG-T--C-A----CCCCGCTTC--CGCTTC-CCATTA--CCCCTCCTTT---GTAGCGA----CGC-AA--A---TTTTTTT--GGCTGTCCCTTTT----TTT-T-TTTA-AGTGGGG-GCGCA---C----------------CGG------CAA----CCCCACC-ACTGCC-------AC---------------TTTTGC---CCTTCACT------GCC----G-TTATCCAGTTAC------CATTTCAAACGCTTT-----TGTGTGTCA----TCACTTTCACAGCGAT----GCTAACCAT-TTTTCCCTCG-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGCATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCTCAACTACGTGGTCACCGTCATTGGTATGT---CTG-A--TCCATCAC-CTCG---ATG----------CGG------CATTCGC-AAGCCTATGCTAACGCA---AACT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGTGCCAT-TCTCATCATTGCCGCCGGAACTGGTGAGTT--------- Hypocrea_pillulifera --AGAAGGTAAGC-TCA---TTCACTGACTTTTTTTCA-----------CTCTTTTTTTCCACTTCATGCCAAACAATT--GCGACGAACAAAATTCTCTT-----CTGAAT------TTTCCTGTCAA--------------TTTTGTTCTCTCACTGTC-A----CCCCGCTTT------CTTTACCTA--CCCCTCCTTT----GCCAGA----CGC-----AAATTTTTTTG--G-----CTGCCTC--GTTTG---GTATTAGTGGGG--TGCTTTTT-------------GTGTAG------CAA----CCCCACC-ATGACCTACGACACTCTGTCTATGTGCCTCTCGT-------------------TCTGTCTACGTCGTCGATCAC------CCCATCAATTCCTTTCATCAAGCCGCTAT----TTTTCGTTTCGTCAAT----GCTAACAAT-GTTTCCCTCT-GTAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGT---CTTGATTCTTTTTCGCTCATCGATTT-------------------CGAAAAA-AATCCAGTGCTAACAAC---AATT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-TCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_placentula -------------------------ATGATTTTTCTT------------GTGCTCGTTTCCCCCTATCCATATGTAATT--GTGCTCGACAA-------TTCTCCTAAAATT------TCTGATGA-------ATTTTTTTTTCTCCCA-------CCGTC-A----CCCCGCTTTCACTGTCT------A--CCCCTCCTTTTTCGGACGC-----------AGATTTTTTTTTG--G-----CTGCCTT--GTTTG---ACTTTAGTGGGG-----------------GTGCTCTGGGTG------GCA----ACCCCACCATCGTCTCCGGCCCTTATCTATTACCTCTTTTGTCT-----------------TCATCGTCCAGCGCTGCAATC------CATTTTATCAAGACGCGTTGCTATTTCAGTTC--ATTCATTTCACCACA----GCTAACCAT-GTGTCCCTTA-ACAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGT---TTTGATTCCTCTTCTCTCGCC---------------GAT----ATCCGAAAG-AAGCCAGTGCCAACATC---AATT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-TCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_protopulvinata --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAGGCTGG Hypocrea_pseudostraminea ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Hypocrea_psychrophila --------------------TCCAACCCTTTTGCCTGTATCT-------TTTTTTTGTTACCTTTTCTGCTACTCAATTTCTTTTTCGCTGG---TC-----------------------------------------------------------------A----CCCCGCTTC-------TCTGTCTA--CCCCTCCTTTTTGGTACAGA----CAACAGTTCTTTTTTTTTT--------TTTGGGTGCCATTG-G-GTTT-GGTGGGGGGTGCACTGG--------------------------------TCGTACCTTTTAGTCACTGCTTCTAGC-TTCTCTGCCCATGCGCCTGTCTTCAGCATCCGTCTCTCAATATTGTCAATTTAT-----------------------CAAGCTTCTTTT----GTTCATTTTCAGTCAT----GCTAACCGC-ATTTTCTTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCCGATACTATGTCACCGTCATTGGTATGTGCTCCCGACATGTGGATTTTTTT-------------------------TGTCCAGTCATCAGCCGCTAATACA--AGCTTCTCT--AA-------------------TAGACGCTCCCGGCC------------------------------------------------------------------------------------------------- Hypocrea_pulvinata ------GGTCAGT------------------------------------TCAATCCAATACTTTTTCCCCCGAATCTCCCCTCATCCAAAGT--------------------------CATCGTACACGATTCCCTCGAATTTTCGAGATTTTTCTGAAAGATGACCCCCCGCTTT------CTCGGCCTA--CCCCTCCTTTGGCGCACGCA------------AAAAAATTTTG--------CAGCTTT--GGACG---GAGTTAGTGGGG-CAACGATCG-------------------------CAA----CCCCGCC-ACATGCCCTCAACTGTGACCAACAGTATCATCTCAA-----------------CAATACGATTCATCATGCTCA---------------------------------------TCTTTACTTCAATTTT----GCTAATCAG-GCTTCGCTTT-ATAGGAAGCTGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACTGTTATTGGTATGT---ATA----TTTACGTC-GTGGATCGCT-------------------TCTTTAT-CATCTGGCGCTAATCCG----ACC---C--CA-------------------TAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGA-TTACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTG- Hypocrea_rodmanii ------GGTAAGC-TCA---GTCGCCTCAGTTTTTTTGTCT--------CATTTTTCATCATATTTC---CATGCAATT--GTGCCCGACAATGCCC----ATC--TGGGAG------TTTCGTGTG-A----ACAATTTTTTTT-TCCCTGCATGGT--C-A----CCCCGCTTT--CCCTGC----CTA--CCCCTCCTTT---GGGGGCGGACTTGC-----AAATTTTTTTTTGC-----TTGTCTT--GATTG-G-TTTT-AGTGGGG-TGAATTCGT-----------------CG------CAA----CCCCACC-ACTGCCTCTG---GCTGTC-TGTTTGGTCGTCACCA---TCATCGTC------GCCCAACGGA----ACCAACT------CAC-AT-TATCTTGT----CTTTGCTCCT----TTCTCTTTTCAGTCAT----GCTAACCAT-GTTTCCCTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTC-ATTTTCATCTC-CCG--CTTTT----------GGT------GCCGACA-AGCCAGGCGCTAACACC---ACCC---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTG- Hypocrea_semiorbis ---------------------------------------------------------------------TTATGCAATT--------------------TTCGA--ACGAAT------TTGCGCGTCG-----ACAATTATTTCCCTTGCACATCA-----------CCCCGCTCT------CATTGCCTA--CCCCTCCTTT---GGGACGA----CGC-----AAATTTTTTTG--------CTGTGGT--TTTTT---TTTTTGGTGGGG---GCATCTG----------------TGG------CAA----CCCCACT-ACTACACCATGCCTTTCAT---------------------TATCATC------ACACAAAAATTGCCCATTCAA------CTCATATTCATATCAACATACAACAGCTT----CACTTCTTTTGGCGAT----GCTAACCAT-ATTCTCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTA---ATTCACCAC-CTCC---ATT----------TAG------AACTCAC-GAACTGGCACTAATACA---GATC---T--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGC------------------------------------------- Hypocrea_seppoi ----------------------------CCCCCCCCC------------CCCCCTTTTTTTTTTTATTGCCTGGCAATT--GTGCCCAACGATTCTCTGTTCTCTTGGAAAT------TTTCGTATC------AATTTTTTTTTTCCTTCCCA---CCGTC-A----CCCCGCTTTCACTGCCTT-----A--CCCCTCATTTAGCCGACGCA----------AAAATTTTTGGCT--G-----CTTGCTT------G---GATTTAGTGGGG---------------TGCATTTTTTTGTG------GCA----ATCCCACTGGCTCGTCTGACTCTATGCACTGGCCCTTACTTTTTGCCTT------------CAATCGCCCAACTCCATAAGC------AATTTTGCCAAACTACGGTGTCTATCTTGGTTT-CATCGTTTCATCCAT----GCTGACCAT-------TTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAATTACTATGTCACCGTCATTGGTATGT---TTTGATCCCTCTTGTACCGTT---------------GGC-------ATCGAA-AGGCCGCCGCTAACGCA---AGCC---TCACA-------------------CAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TTACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_spinulosa -------------------TAAGCTTTTTTATTTTTT---------------------TATTTTTCTTCACATTCAATT--GTGGCAGAAGA-------CTCCCAACGGATT------TCTTCTGTC------AACCACGTTT-------------CCATC-A----CCCCGCTCTCACTTGTCGTTA--C--CCCTCATTGGCACCTACGC--------------AAATTTTTTT--G-----CAG--CC--TTG-A---ATTTTAGTGCGG--------------------GTAGCAGGG------CCC----ACCGAGCGCCTTC---CTTTTTTCTGTCCTTTTTCTCTCTCTTCCG-ATGGACTG------CATCTATCGCACTC------------------------ACGCTTTTGATCATC--------TTTATTTTCAGCCAT----GCTAATCAT-TTTCCCATCA-ATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGCCTCTTAATCT-TGATGC---------------TACT------ATTTGC-CAGCATGTGCTAACCCC---AAG--------A-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_straminella -GAGAAGGTAAGC-TTG---ATC----AACTGATTTTCGCC--------TCGATTT--CC-CATTCG---CATTCAATT--GTGCCCGACAA---TT--CTGAA--AAGAAT------TTTCGTGTC-A----ACAA----CTTTT--------CG-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CTGTCAT----TTG-G-TTTT-AGTGGGG-TTTCC---T----------------GCG------CA-----CCCCACT-A------------GTCAAC-TGC-----TTTTTTGT---GCTTCACT------TTC----A-CTGCCCAGTCAT------CATTCAACGTGC--------CCTACGTC------GTCACTTTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAA-CTTG---ATG----------CAG------CAATTGC-AAGCCAGTGCTAACAGA---TGTT---T--CA-------------------TAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Hypocrea_subalpina -------------------TAAGATCTCCGTGCTCTTTTTTTTCCATCCAGATTATTTCCCCTTGCCACGCCATTGTTT--GCGCCCGACTA-------TTCTCAAGAATAT------CCGAGCCGA------TAAATTCCCCTCCCCTCCCCTCGTGGTC-A----CCCCGCTTTCACTGTCTGCCT--A--CCCCTCCTTTGGGCGACGCAGCAGGAAAGGAAAAATTTTCTGG--A-----CTGTCTT--GTTTG---GTTCTAGTGGGG------------------CACACTTGTGG------CCA----CCCCTCCTCCCATTTATTGATCCCTTATCTTGCCGCCCTTGAAATCA--------------CGTTTGCCCAAAACCCAATTC------ATCCTATCACCATCAGGACACGTTGCCGCCATGTTTTTGTTGTCTCAAT----GCTGACCGA-GTCTGTCTCATACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGGTACTATGTCACCGTCATTGGTATGT---TTTTTGTCCATTCCAAGGAGC---------------GGA-------AGAAGC-AAAACCAGGCCGATAGCTAATCCCATACCTCG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAATTCGAGGCTGG Hypocrea_sulawesensis CGAGAAGGTAAGC-TCA---TGA----ATTTGATTT--GCC--------TCCATTT-----CCCCCA--------AATT--GTGCCGAACCG---TT--CTCAA--CGGATT------CATCGTGCC-A------------ATTCT--------CA-T--C-A----CCCCGCTTT--TGCCTC-CCATTA--CCCCTCCTTT------GCAA----CGC-AA--ATTTTTTTTGC--G-----CTGCGTT----TTG-G-TTAT-AGTGCGG-GACAC---C----------------AAG------A------CCCCACA-ACT----------GCTCAG-TGC-----TTTTTTGC---CCTTGGTT------CTT------CCGAATTTCTGC------CTGTCGACTT----------TGTGTGTCT----CGTCACCTTCGGTCAT----GCTAACCAT-GTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCCTCAT-CTTG---ATGCACTTGATGTCAT------CAATTGC-GAGTTGGTGCTAACGGA---GCCA---C--GA-------------------TAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-TCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGG Hypocrea_sulfurea --------TTAGTCTAT---TCTACTTTTTTTTTCCTC-----------TTTCCGTCTTTTGCCAGCACCCAAGCAATT--CTGCAGGACAA--------TTCGCACGAATT------TTCCATGTCAG-----------TTTTGCTTGGGTGTCGGACGA------CCCCGCTTT------CTCTGCCTA--CCCCTCCTTT---GGCGCA-----CACAAGCAAATTTTTTCTTTCTTTTTGCTGCCTT--------G-GATTTTGTGGAG-ACACTCATCAC-----------------------AAA----CCCCGCC-ACCACCCTCGAGTCCAATC-TATGTGACCATTGCAG-----------------CAACACTACAATGCAGTTCAC------TTCTCGTCATTATGCTCCGCCACTGTGCG----TTTCTGGTTCAAGTAT----GCTAACCAT-GATTTGCTCT-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGT---ATCCCA----------TGTGCGATTC----------TCA------TCTCAAC-GACTCCACGCTAATTCA---AATG------TG-------------------CAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGA-TTACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATTATCGCCGCCGGTACTGGTGAGTTCGAGG---- Hypocrea_tawa ----AAGGTAAGC-T------TC----AACTGATTTTCGCC--------TCGATTC--TC-CCTCCA---CATTCAATT--GTGCTCGATCA---TT--CTGAA--GAGGAT------TTTTGTGTC-G----ACAA----ATTTT--------CA-T--C-CA---CCCCGCTTT--C-------CGTTA--CCCCTCCTTTGCAGCAGCGA----CGC-AA--A----TTTTTT--T-----TGGCTGT----TTG-G-TTTT-AGTGGGG-TTCCC---T----------------GTG------CCA----CCCCACT-G------------GCTCTG-CTC------TTTTTGT---GCTCAACT------CTC----A-CTGCCCAGCCAT------CATTCAACGTGC--------TCTGTCTCT----CGT--CATGCAGCGAT----GCTAACCGC-TTTCCCATCG-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGT---CTG-C--TCCATCCA-CTTC---GTG----------CTG------CGATTGC-AAGCCAGTGCTAACAGA---CAAT---T--CA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCCAT-TCTCATCATTGCCGCCGGCACTGGTGAGTTCGAGGCTGG Hypocrea_voglmayrii ------------------------------------------------------------------------TCTGCCTACTTTCCTGTCAG-----------------------------------------AAATTTTTTCCTCACA-------ATGTC-A----CCCCGCTTTATCTGTCT------A--CCCCTCTCTTTGGCAGAGCA------------AAAATTTTCTG--G-----CTGCCTT--GTTTGG--CCTTTAGCGGGG----------TCGCTTTTTCCTTGTGGCT------GCA----ACCCCGCTATCGCCACCGACTGGGCAGCTCGATTGTCTGTGTT------------------TCGTTGCATAACACAATCATT------TCTTTGCTCACGTCGCGTCGCTTGCCTCAATCA-CTTGGGTTTGTCCAT----GCTAACCAT-GATTCCATCA-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACTATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTTGATCTTTTTTTTTTTTTCCTCCA----------ACCGGCCTCAAATAAA-GCTTTGATTCTAACCTGTCAATCT------TA-------------------CAGACGCTCCTGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Hypomyces -------------------------------------------------TGCACATCTCGT--------------------GAGCCCAACCA--------------TCGGGG------TTTCGTCACCA--------------------------------------TGGCGCTCT---TTTTTTTCTCTA--CCCCGCCCGCATGAAAGAAA------------AAAAAAATCGG--------CTGTCAA--------C-ACTTTGGTGGGGGGTGTGCTTG--------------------------------ACCAGCA-TTACCCCGCCACTGTGGCCGTGCAATTTTTTTCTTT-----------------TCATGCGATCGCTACCACCAC------CCCATTAATATTCCTCTCAATTGCTACTG----ATCATTATCAATCGAT----TCTAACAAT-------GCCC-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCCCTCTGGAAGTTCGAGACTCCCAAGTACGAGGTCACCGTCATTGGTATGT---CGTCCTGCTCGCCCGTCGTC-------------------------TGATATG-ACCCGTATTCTAACACA----------T--CG-------------------CAGACGCCCCCGGTCATCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTGG Sphaerostilbella -GGTAAGCCAATCCTCA------------------------------------------------------------------------------TT--CTCTCTCCTCAAGCCCAAGGGTGCCTCAGCCTGAATAAAGTTTTTCGCTTTATATCC-----------TGCTGCTGCTGGCCATCCTGTCTA--CCCCTCCTTTGCATACGAAA------------AAGTTTTTTTC--G-----GGCACGT----------TTTGGACTAGTG-GGGCTTGTCTG--------------CGA------CTA----CCCCGCC-AATCTGTCCAAAACTTCGCCCAAAAATCTCTCTTCGGTGCAAACGGC------GTCTTTGCTGCGCCTCGACTG------GGCTCGAGATACTCATCGCTATCGCACCT----ATTTATGATCCAATG-----GCTGCTGAC-AATGTCGCCT-ACAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCT----TCAAACTC-GCTTTACGCC----------GCA------TATGCCT-AGCGAAAGACTAACCAG---CA-----T--CT-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCCGT-TCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_aggressivum CGAGAAGGTAAGC-G------CC----AACTGACTTTCGCC--------TCGATTC--TC-CCTCCA---CATTCAATT--GTGCTCGATCA---TT--CTGAA--GAGAAT-----------TGTC-G----ACAA----TTTTT--------CA-T--C-AC---CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CAC-AA--A-TTTTTTTTT--G-----CTGTCGT----TTG-G-TTTT-AGTGGGG-TTCCT---T----------------GTG------CAC----CCCCACT-A------------GCTCAC-TGC---TTTTTTTTGT---GCTTCACT------ATC----A-CTACCCAGCCGT------CGTTCAACGTGC--------TCTGTCTCT----CGT--CATCCAGTGAT----GCTAACCACTTTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTC-C--TTCATCAC-CCCG---ATG----------CAG------CAATTAC-AAGCCAGTGCTAACAGG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAG----------- Trichoderma_amazonicum ----------------------------------------------------------------------CATGCAATT--GTGCCCGACGA-------TTC?GCAGAGAAT------TTTCGTGTCG-----ACAATTTTTTCATCA-------------------CCCCGCTTT---------CCGTTA--CCCCTCCTTT---GCAGCGA----CGC-----AAATTTTTTTG--G-----CAGTCGG----TTG---GCTCTGGTGGGG-TTTCCTGTG-------------------------CA-----CCCCACTAGCCCACTGCTTTTTTTTTTCTGCTTCACTCTCCCCA--------------------------CTGGCCAGTCAT------CATTCAACGTGCTCTATGT--------------CTCGCCATTCAGCAAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_arundinaceum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTA--CCCCTCC-TT---TGGTACAGACCTGC-----AAA-TTTTTTT--G-----CTGCCTT--ACTAG-G-TTTT-AGTGGGG-GCGCTCCTTG------------GGAGCA------ACC----CCCCACT-ACTACCTGTG---CCACTC-TGTTACCTGTTCGCAC---TCTTCATC------GCCCAATGCACCTCATCAACT------GTCAAT-CGTCTCTT----ACTTTTCTTC----TCATCTATTCGATTGT----ACTGACCAA-TTTCCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTG-ACACTCG------TATTTTCCT----------GGT------AAATACA-CATCAGATGCTAATGCC---AACT---T--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_asperelloides CGAGAAGGTAAGC-TAA---TTT-CA-CTGC---------------------TTTTCCCATCAAT-TTTTGGCACAATTATATGCCCGACAA---TT--CTGTTC-TC----------AGTTTTGTCT-------------TTC----TTTTTTCAGCATC-A----CCCCGCTTTGCCAGCCT--ACCTA--CCCCTCCTTT---GGCACAG----CAA-----AAAATTTTCTC--G-----CTGCCTT--GTTTG-G-CTTTTAGTGGGG-TGTCAATTTTGTT---------TGACGG------CAA----CCCCACT-ATCGCC-----------AC-TGTAC-----CTCTTT---CCATCAT-------CCACCACATGCT-TTTGTTCA------ATCGCATCGTCTATTTTCAAT------------ATCTCTTGTTCATTAT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTGGAC---------ACTTCAGTCG----------ACA--TTG-CAAGA----TCGTCATTCTAACATA--CTC--TCCC--CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAA------------------------------------------------------------------------------ Trichoderma_asperellum ---GAAGGTAAGC-TCA---TTT-CA-CTGC---------------------TTTTCCCATCAAT-TTTTGGCACAGTCATATGCCCGACAA---TT--CTGCTC-TC----------AGTTTT-----------------TGTCTTTTTTTTCCAGCGTC-A----CCCCGCTTTGCCAGTCT--ACCTA--CCCCTCCTTT---GGCACAG----CA------AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-CTTTTAGTGGGG-TGTCAAATTTTT----------TGGCAG------CAA----CCCCGCT-ATCGCC-----------AC-TGCAC-----CTC-TT---CCATCAC-------CCACCACATGCTATTTGCTCA------ATCGCGTCGTC----------------------TTTTTTTGTTCATTAT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTGGACTCTTCTCT-CTAGCTATCG----------ACA--TTC-CAAGT----CCGCCATTCTAACATG--CTC--TTCC--CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-T----------------------------------------------------------------------- Trichoderma_atrogelatinosum ------AGTAAGC-TTT---ATC----AACTGATTTTCGCC--------TCGAATC--CCGCCTTCA---CATGCAATT--GTGCTCGACAA---TT--CTGAA--AAGAAT------CATCGTGTCAA----ACAA----ATTTT--------CA-C--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CAGTCTT----TTG-G-TTTT-AGTGGGG-TTCTC---T----------------GCG------TA-----CCCCACT-A------------GCTCAC-TGC-----TTTTTTCT---GTTTCG--------CTC----A-CTACCCAGTCAT------CACTCAACGCGC--------TTTGTGTCT----TGTCACTTTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGC---CTG-A--TTCACCAA-GTTG---ATG----------CAT------CCATTGC-AAGTCAGTGCTAACAGA---CGTT---T--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCTGCCGGTACTGGTGAGTTCGAGGCT-- Trichoderma_atroviride ------AGTAAGC-TCA---TTT----CTGC-------------------TTTTTCACTCCGCTC-CCTGAGCACAATC--GTGTCCGACAA---TT--CTGTCC-TC----------AGTCTTGTCAT----TT------TTTT---TCCTCGCAGCATC-ACA--CCCCGCTTTAC----CT--GTCTA--CCCCTCCTTT---GGCACAG----C-------AAAATTTTCTG--G-----CTGCCTT--GCTTG-G-CTTTTAGTGGGG-TGCCAACTTTTTTTT----GTTTGGCTG------CAA----CCCCGCT-ATCGCC-----------AC-TGTCC------------------CGTC------CCAACGAATTGTAC----TCA------ATTGCATCGTCTT--------CTCCATCT----CTGTGTGGTTCATTGT----GCTAATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAGCTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCGC-------TT-TTCCTCATTG----------ATA--CTT-GGAGA----CCAAGATTCTAACGTG--CCG--C-TC--TG-------------------TAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGT--- Trichoderma_aureoviride ---------AAGC-TGA---ATC----AACGAATTCTCATC--------CCCATTT--T--CCTCGG---GCCTCGATT--GTGACGAGCAA---TT--CTTCA--TCGAAT------TCCCTTGTC-A----ACGA----GTTTC--------CG-T--C-A----CCCCGCTTTCACACTGC-CCATTA--CCCCTCCTTT---GCTGCGG----CGTGCA--ATTTTTTTTTT--G-----GCAGCCT----TCA-T-TTTT-AGTGGGA-CTGCA---C----------------CAG------CTG----CTCCGCC-ACT----------GTTCAA-CAG-----CTTATTGC--AACCTCATT------GCC----TCTTACCTCGTCAA------TTCCATTCGAAC--------GCTTTTAAT----CATCCCTCTCAGTGAT----GCTAACCATCTTTCCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCT-G-CCTCATGACTCTTT---GCT----------CGC------CCTTTGC-AAGCCTGTACTGATGCG---AGTT---TTGTA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCGT-TCTCATCATTGCCGCCGGTACTGGTGAGTTTGAGGCT-- Trichoderma_austrokoningii CGAGAAGGTAAGC-ACA---TTTTCCTGTTTTTTTTTTCTTTCT-----TTCTTTCGCTACACATCTTTGGACACAACC--GTGTCCGACAG---TT--CTGCTC-TC----------AGAGCTGTCA-----AT------TTTTTCCTTTCAGCATCACC-GCA--CCCCGCTTTGC----CA--GTCTA--CCCCTCCTTT---GGCTCAG----C-------AAATTTTTTTCTGT-----CTGCCTT--GTTGG---CTTTTAGTGGGG-TGCCATTTTTTTTG--------TGGCAG------CAA----CCCAGCT-ATCGCC-----------AC-CGTGT--------------------------------------CCATCCACTCA------ATCACATTATATCTT----CGCTCA--------TGTCCTTGTTCATCGT----GCTGATCAT-CATTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTCCAT----GTCCTTGTCCTTGTTG----------ACG--ACG-CGAAAGATGGTCTCATTCTAACATGTTTTGCTT-----TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTGT-CCTCATTATCGCCGCCGGAACTGGGGAGTTC?AGGCTGG Trichoderma_brevicompactum ----------------------------------------------------------------------------------------------------------------------GATTTCGTG------TCAA-----TTTTTTTTTTCATGG---C-A----CCCCGCTTT------CGCGGCCTA--CCCCTCCTTTGGCACAGACC----TGC-----AAAATTTTTTTG-G-----CTGCCTT--ACTAG-G-TTTT-AGTGGGG-GTACTTCTT-------------GGAGCA------AAC----CCCCACT-ACTACCGGTG---ACGCTC-TGTTACCTGTTGATAC---TCGTCATC------ACCCAATGCATCTCATCACAT--------CTCAATCGTCGCT----ACTATCCTTT----TCATCTCTTCAGTTGT----ACTGACCAT-TTCCCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCC?AGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTG-ATATTCGCCAT-TTTTCT--------------AGT------ACATTCG-CTTCGAATACTAATGCC---AATC---TCACG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGT---------- Trichoderma_brunneoviride -----------------------------GCTCGATT------------------CTCCCCGCTTCA---CATTCAATT--GCGTCCGACAA-------TTCTGAAGGGAAT------TTTCGTGTC------GA----CAACTTT----------TCATC-T----CCCCGCTTT------CCGTTA--C--CCCTCCTTTGCAGCAACGC------------AAAATTTTTTTT--G-----CTGTGCT--TTT-G---GTTTTAGTGGAG--------------------TTTCTTGTG------CAC----CCCACTAGCTCAC---TG--C-TTTTTTGTGCTTGACTCTCACTTCGCCAGTCAT------CATTCAACGTGTTC-----------------------------CGTGTCTTTG--------GTCA--TTCAGCGAT----GCTAACCAC-TTTTTCATCA-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGCTTCATCAACT-TTATGC---------------TAC-------AATTGC-AAGCCAGTGCTAACAGG---CAAT---T--CG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_candidum -GAGAAGGTAAGC-TCA---ATC----CACTCGTTCTCATC--------CTCATTC--T--CCTTCA---TCCTCAATT--GTGACGGTCAA---TT--CTTCG--CGGAAT------TCTCTTGTC-A----ACAA----TTTTC--------TG-T--C-A----CCCCGCTTT--CACCTC-CCATTA--CCCCTCCTTT---GCAGCGG----CGC-GC--AAATTTTTTTT--G-----GCAGCCT----TGA-A-TTTT-AGTGGGG-TTTCA---C----------------CAG------CCG----CCCCGCC-AACATC-------CATCAC-TGC----ATTTTTTGC---ATCCCACT------GCC----T-CTACCTCATCAT------TTACCTTGAATG--------CTTTTGGAT----CATCTCTTTTGACGAT----GCTAACCAT-CTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-C--TGCATGAG-TTTT---CTG---------TTTG------TCTTTGC-AAGCCTGTACTAATGCG---TGTT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAAGGCTG Trichoderma_caribbaeum CGAGAAGGTAAGC-TCA---TTT-CA-CACT-------------------GCTTTTTCTGCCC-----TTGGCACCACC----GTTCGACAA---TT--CTGTTC-TC----------AGTCTTGTCC-----AT------CT-----TCCTCGCAGCGTC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCAG--------------CAAATTTTTCT--G-----CTGCCTC--GTTTG-A-CTTTTAGTGGGG-TGCCAAGTTTTTTTT-------CCCTGG------CAA----CCCCGCT-ATTGTC-----------AC-TGTCC-----CTC-AT-----------------------------------------------CCATCGCCTCTT----GACTCAATTT----CTCTGTGGTTCATCGT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGT---TATTTT-----------CGGTCCTTG----------ACA--TGT-CCAGA-TCATCATCATTCTAACATG--CCA-----T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- Trichoderma_catoptron -----AGGTAAGC-TCA---ATCA---AACCGGTTTTCGCC---------TCAATTT-CC-CCTTCA---CATTCAATT--GTACCCGACAA---TT--CTGAA--CAGAAT------TTTCATGTC-AAATTATTT----TTTTT--------CA-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A--TTTTTTTT--G-----CAGTATT----TTG-A-TTTT-AGTGGGG-TTGCC---T----------------CTG------CA-----CCCCACT-A------------ACTTGC-TAC-----TTGTTTAC----CTTCACA------ATC----A-CTGCACAGTCGG------CATTCAACGGTCTCC----ATCCATGCCT----TTTCATTTTCAACGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTTGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTC-A--TTCATCAA-CTCC---ATG----------CAG------CAATTGC-GAGCCAGCACTAACAGA---AATT---C--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGAACTTCTCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_ceraceum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_ceramicum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCCTTT---GCAGCGA----CGC-AG--A---AATTTTT--G-----CTGCCTC----TGG-A-TTTT-AGTGGGG-TTGTA---C----------------CAG------TAA----CCCCACT-ACTACT-------ACTCAC-TAC------TTTTTGC---ACTTCTCT------ACC----A-C-ACCCAGTGGT------CATTCAACGCC---------TTTGTCCCT----CGTCACTTTGAGCGAT----GCTAACCAT-ACTTCTCTCA-ACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAC-CTCA---ATG----------CGG------CTGTGGC-AAACAAATGCTAACAGA---AATC---T--CG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_cerinum --------------------ACT-GATTTTCGCCTCG-------------------ATCCCCCTTCA---CATTCAATT--GTGCTCGACAA-------TTCTGAATAGAAT------TTTCGTGTC------GA----CAATTTT----------TCACC-A----CCCCGCTTT------CTATTA--C--CCCTCCTTTGCAGCGACGC--------------AAATTTTTTT--G-----CTGT-CT--TTG-A---GTTTTAGTGGGG--------------------TTCTTTGTG------TAC----CCCACTAGCTCAC---TG-CT-TTTTTC-TGTTTCGCTCTCACTAC-CCAGTCGT------CACTCAACGCGCTT-------------------------------TGTGTCTT--------GTCACTTTCAGCGAT----GCTAACCAC-TTTTCCGTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGT---CTGATTCACCAACT-TCATGC---------------ATC-------AATTGC-AAGTCAGTGCTAACAGA---AATT---C--CA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_chlorosporum -GAGAAGGTAAGC-TCA---ATC----AACTAATTCCGACC--------CTGGTTT-TCC-GTTCCC---CTTCCAATT--GTGACGGACAA---TT--CTCAAC-CGGAAT------TGTCTTGTC-A----ACA----ATTTTG--------CA-T--C-A----CCCCGCTTT--CACTTC-CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---ATTTTTT--------GCAGCCT----CGA-A-TTTT-AGTGGGG-TCGCT---T----------------GTGCA----TCC----CCCACCA-ACC----------ATTCAC-TGC------TTTTTGC---CCTCGACT------GCG----T-GTGCCT-GTCAT------CATTCCACGC----------TCTTGATCA----TCTC--TTTCAGCGAT----GCTAACCAT-CTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCCCTTTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTT-TACGGATCTCA-TCCC---GTT----------CTT------TGTTCGC-CAGCCTGTACTAATGCC---AGTT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_chromospermum ------------------------------TGATTATCGCA--------TCAACTCTCCCTCCA------CAATCCGTT--GTACTCGACAA---TT--CTGTT--CACAAT------CATCAACTC-------CGACATTTTCCCTCCCCATTCG-----------CCCCGCTTT--CGCTTC-ACTTTA--CCCCTCCTTT---GCAGCGA----CGC-----TTTTTTTTTTT--T-----TTGCCCC--TCTTG-G-TTCT-GGTGGCG-GTGCAC-------------------CAG------CAAACCCCACCACTGACTACCTTGTACCTATCAC-TGC-------TTTTAC---CCTTATCT------GCCACCACCAACCCCAGTCGT------TATTCAACTCAAC--------------------GCTTTTGTGTAGCGAT----GCTGATCAC-TATTCCGTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTTTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCTGA--CTCATCATCATCC---CTC----------GAT------CAACAGC-AAGCAAGTGCTAACCAA---AACC---T--CA-------------------TAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGATTGCGCA------------------------------------------ Trichoderma_cinereoflava ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGTTCGAGGCTGG Trichoderma_cinnamomeum CGAGAAGGTAAGC-T------TC----AACTGATTTTCGCC--------TTGATTT--CC-CATTCG---CATTCCATT--ATGCCCGACAA---TT--CTGAA--AAGAAT------TTTCGTGTC-A----ACAA----GTTTT--------GG-T--C-A----CCCCGCTTT--C-------GATTA--CCCCTCGTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CTGTCTT----TTG-G-TTTT-AGTGGGG-TTTCC---T----------------GCG------CA-----CCCCACT-A------------GTCAAC-TGC-----TTTTTTGT---GCTTCACT------TTC----A-CTGCCCAG---T------CATTCGACGTG---------------------------CTTTCACCGAT----GCTAACCAC-CTTTTCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TGCATCAA-CCTG---ATG----------CGG------CGATTGC-AAGCCAGTGCTAACAGA---TGCT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_citrinoviride ----AAGGTAAGCTTCA---AATC---CTTCAGTTTCGAGC--------CCATTTTCCGCCT--------CATGCCTCT--GTGCCCAATATCTGTC--GTCGA--ACGGAT------GCCCGTTTC-G----ACAGGGACTTGCC--------CATC----A----CCCCGCTTT---------CCCTTA--CCCCTCC-TT---TGAGCGA----CGC-----AAATTTTTTTT--G-----CTGCTTC---ATCA-A-TTTT-AGTGGGG-GTGCATCTC----------------GAG------CAA----CCCCGCT-ACTGCCTTCA---GACCAC-TATTTTCTTGCTGTGT-----------------CCTACAACAGTCTCACTGCAC------TCGTCCGCGTCATCA-----TCACTGCAG------CTGTATTTCGCGAT----GCTAACCAT-CTTCCCCTTA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGCATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATG----TGG-A--TCCATTGC-CTCA---CCG----------CGT------CTCTTCG-GACACGGCACTAACGAT---TCCC---G--CA-------------------CAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_costaricensis CGAGAAGGTAAGC-TCA---ATC----AACTGATCCTCACC--------CTCAGTT---C-CATTCG---GATTCAATT--GTGGCCGACAA---TT--CTGAA--CGGAAT------TATCTGCTC-A----TCAATTTTTCCTT--------CC-T--C-A----CCCCGCTTT--CACTTT-CCCTTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---AAATTTT--------GCAGCCT----CGA-A-TTTT-AGTGGGG-TCGCA---C----------------AAG------CCA----CCCCACT-ATA----------ATCCAC-TGC------TTTTTGC---CCTTCACT------GCT----T-GTACCT-GTCAT------CATTCCACGC----------TTTTGATTG----TCTG--TTTCAGCGAT----GCTGACCAT-ATTTCCTTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATCGGTACGT---CTG---CTTCACGAC-TCTC---ATT----------CGC------CTCTCGC-AAGCCTGTACTAATGCA---GATA---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_crassum --------------------------------------------------------------------------------------------------------------------------------------------TTTTTT--------CG-T--C-A----CCCCGCTTT--CGTT---CCATTA--CCCCTCCTTT---GCAGAGA----CGC-AA--A---TTTTTTT--G-----CTGCCTC----TGG-T-TTTT-AGTGGGG-TTGCT---G----------------GTG------CAA----CCCCACC-ACTA---------CCTCAC-TGC------TCTTTGC---CCTTGTCT------ATC----ACCTCCCCAGTCCT------CATTCAACGA----------TCTGTGTCT----CGTTATTCACAGCGAT----GCTAACCAC-CGTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT----------GGCGTCCC-ATTC---ATC----------CAG------CTCCCGC-GAACCAGTGCTAACCAG---GACC---T--CA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_cremeum --GGAAGGTAAGC-TCA---ATC----AACTGATTCCGACT--------CTGATTT--TC-ATTTCC---TGCTCAATT--GTGACGGACAA---TT--CTCAA--TGGAAT------CGTCTTGTC-A----ACA----ATTTTG--------CA-T--C-A----CCCCGCTTT--CACTTC-CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---ATTTTTT--------GCAGCCT----CGA-G-TTTT-AGTGGGG-TCGCT---T----------------GTGCA----CAC----CCCCACT-ACC----------ATTCACTTGC-----TGTTTTGC---CCTTGACT------GCG----T-GTGCCTCGTCAT------CATTCCACGC----------TCTTGATCA----TCTC-TTTTCAGCGAT----GCTAACCAT-CTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTT-C--TGCACGGA-TCTC---GTT----------CCA------TGTTCGC-CAGCCTGTACTAATGCC---GATT---G--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_cuneisporum ----GAGGTAAGC-TCA---ATC----AACTGATTCACACC--------CAAATTC--TC-CCTTGG---CGTTCAATT--GTGCCCGACAA---TT--C--AA--TGGAAT------TCTCGTGTC-A----ACAA---TTTTTT--------CG-T--C-A----CCCCGCTTT--CGCTTC-ACACTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CTGTCGT----TTG-A-TTTT-AGTGGGG-GCGCA--------------------CAG------CAA----CCCCACC-ACTGCC-------ATTCAC-TGC-----T-TTTTGC---ACTTCACT------ACA----A-C-TCCCAGCTGC------CACTCAGCACC---------TCTATATCT----CGTCACTTTCAGCGAT----GCTAACCAT-CTTTCCCCCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAT-TTCT---GTG----------CTG------TGTCTGC-AAGCTTGTGCTAATGCA---AACA---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_dingleyae ---------TAGC-TCA---TTT-TC-ACTG------------------CTTTTTTACTGCGC------TGGCACAATC--GTGCCCGACAA---TT--CTGTTC-TC---A------AGTCTTGTCT-----CT------TT-----TCCTCGCAGCGTC-ACA-CCCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCA--G----C-------AAATTTTTTCT--G-----CTGCCTC--GTTTG-A-CTTTGAGTGGGG-TGCCAACTTTTTTCTTTCTTCTCCCTGG------CAA----CCCCGCT-ATTGTC-----------GC-TGTCC-----CTC-A----CC-------------------------------------------CATCGCCTCTT----GACTCAATTT----CTCTGTGATGCATCGT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATCGGTATGT---TATTTT-----------CGGTCCTTG----------ACA--TGT-CCAGA-TCATCATCATTCTAACATG--CCA-----T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTGT-CCTGATTATCGCAGCCGGTACTGGTGAGTTCGAG----- Trichoderma_dorotheae CGAGAAGGTAAGC-TCA---TTT-CA-CTGC-------------------TTTTTCACTGCGC-----TTGGCACGATC--GTGTCCGACAA---TT--CTGTCC-TC----------AGTCTTGTCC-----AT------CT-----TCCTCGCAGCGTC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCAG--------------CAAATTTTTCT--G-----CTGCCTC--GTTTG-A-C-TTTAGTGGGG-TGCCAACTTTTTTT-----------GGC------CAA----CCCCGCT-ATTGTC-----------AC-TG-CC-----CTC-AT-----------------------------------------------CCATCGCCTCTT----GACTCAATTT----CTC--TGATTCATCGT----GCTGATCAT-GCTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGT---TATTTT-----------CGGTCCTTG----------ACA--TGT-CCAGA-TCATCATCATTCTAACATG--CCA-----T--CG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- Trichoderma_erinaceus ---GAAGGTAAGC-TAT---TTT-CA-CAGC--------------------TTTTCTCTATGCAT-TCATAGCACAATC--GTGTCGACAAT---TC--TTGTCC-TC----------AGACTTGTCG-----AT------TTT----TCCTCACGGCGTC-ACA--CCCCGCTTTGC----CT-GCCCTA--CCCCTCCTTT---GGCTCAG----CAAA----AAAATTTTCTG--G-----TTGCCTT--GTTTG-G-TTTTTAGTGGGG-TGCCAACTTTT-----------TGGCAG------CAA----CCCCGCT-ATCGCC-----------AC-TGTCC-----TTC-AT---CCATCATC------CCAATGCCTTGTTCTCACTCA------ATCGCATCGTCTTTT----GCCTCA--------ATTTATGATTCATTGT----GCTAATCAT-GTTTCAACCA-ATAGGAAGCCGCCGAACTCGGAAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTTGG---------TTTCCTCATTG----------ACA--TCT-CGAAA---ATCAATATCCTAACGTG--CCACTC-TC--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_estonicum --GGAAGGTAAGC-TCA---ATC----AACTGATTCTCACC--------TCAACCT--TC-CCTTCG---CATTCAATT--TTGCCCGACAA---TT--CTGAA--CGGAAT------TCTCTTGTC------AACACAATTTTTT--------CA-T--C-A----CCCCGCTTT--CGCTTC-CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AATTT---TTTTTTT--G-----CTGTTCT----TTG-G-TTTT-AGTGGGG-TGACA---C----------------CAG------CAA----CCCCACC-ACTGCC-------ACTCGC-TGC------TTTTTGC---ACTTCTCT------ACC----A-CTACCCAGTGGT------CATTCAACGCC---------TTTGTCCCT----CATCACTTTCAGCGAT----GCTAACCAT-ATTTCTCTCA-ACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAC-CTCA---ATG----------CGG------CAATGGC-GAACAAATGCTAACAGA---AATC---T--CG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTGT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_evansii -GAGAAGGTAAGC-TCA---TTT-CA-CTGC--------------------TTTTCCCCATTCAT-TTTGGGCACAATT--GTGTCCGACAA---TT--CTGTTC-TC----------AGTCTTGTCG-----AC---------TTTTTTCACCCAGCATT-GCGCACCCCGCTTTGC----CT--ACCTA--CCCCTCCTTT---GGCCCAG----C--A----AAATTTTTCTG--G-----CTGCCTT--GTTTG-G-TTTTTAGTGGGG-TGTCAAATTTT-----------TGGCAG------CAA----CCCCGCT-ATCGTC-----------AC-TGTCC-----CT-------CCATCAC-------CCGACACATTCTACTTGT----------------------------CAATTAATTT----GATTTTGGTTCATTGT----ACTAATCAT-CTTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCAG-------TC-CGACTAGTCG----------ATA--TTT-CAAGA----CCATCATTCTAACATG--CTC--T-TC--TA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_fertile CGAGAAGGTAAGC-TCA---ATT----CACTGATTCTCGCC--------CAAAATT--TC-CCTTCA---CATTCAGTT--GTGCCCGACGA---TT----------------------CTTGTGTC-G----ACAA--TTTTTTT--------CG-T--C-A----CCCCGCTTT--CGCTTC-ACATTA--CCCCTCCTTT---GCCGCGA----CGC-----AGATTTTTTTT--------GCTGTCT----CTG-G-TTTT-AGTGGGG--TGTA---C----------------CGG------CAA----CCCCACT-GCC----------GCTCAC---------TGTTCTGC---CCTTGATT------ACC----A-CTGCCCAGT-GT------CATTCAACGC----------TTTTGTGCC----TGTCACTTGCAGCGAT----GCTAACCAC-GTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATCGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAC-ATTC---ATG----------CGG------CATCGGC-AAGCATGTGCTAACACA---AACT---T--GA-------------------CAGACGCTCCCGGCCATCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGTGCTAT-CCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGG Trichoderma_gamsii -----AGGTAAGC-TAA---TTT-CA-CTAT------------------TTTTATCACTACGCTT-TATTGGCACAGTCGTGTGTCCGACAA---TC--CTGTTC-TC----------AGTCTTGTCA-----AT------TTTT---TTCTCGCATCGTC-ACA--CCCCGCTCTAC----CTGTCTCTA--CCCCTCCTTT---GGCACAG----C--A----AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-TTTTTAGTGGGG-TGCCAGCTTTTTTTT-------TTCTGG------CAA----CCCCGCTAATCGCC-----------GC-TGTCC-----CTC-AT---CCATCGTC------TT--CACAATTTGTTCACTCA------ATCGCAT--------------CTCATTTT----CTCCGTGGTTCAATGT----GCTGATCAT-GATTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTT-AG----TA-----TCCTCATTG----------GCG--TTT-CGAAA----TCATGATTCTAACGTG--CCA--C-TC--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_gelatinosum --GGAAGGTAAGC-CCA---ATC----AACTGCTTCTCGCG--------TCAACTT--CCACTTGATTGTTATTCAGTT--GTGCTCGACAA---TT--CTGTT--CAGAGT------CATCGAGCC-A----ACAA---TTTTTT--------CA-T--C-A----CCCCGCTTT--CGCTTC-ACTTTA--CCCCTCCTTG---GCAGCAA----TGC-AA--A----TTTTTG--G-----CCGTCTC----TTG-G-CTTT-AGTGGGG-TGGCA---C----------------CAG------CATTCCCCCCCACC-ACCACC-------TCTCAC-TGC------TTTCTGC---TCTTGTCT------ACC----G-CTACACTGTTGC------CATTCAGCGCT---------TTTGCGTCT----CGT--------GCGAT----GCTAACCGC-CTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACTGTCATTGGTATGT---CTG-A--TCTATGAC-CGTC----------------CTC------CGACAGC-TAGCCCGTGCTAATCGA---AGTC---TCACA-------------------CAGATGCTCCCGGCCATCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_ghanense CGAGAAGGTAAGCTTTA---GTCCCTTCAGTAT----------------CAAGTTTCGAGCCCGATTTTTCCTGCCTCT--GTGCCCAACAT---TT--GTCGA--CCGAAT------TTCGCCGTC-G----ACGGGATTTTTCC--------CATT--C-A----CCCCGCTTT---------CTTCTA--CCCCTCC-TT---TGAGCGA----CGCAA---AAAAAATTTTT--G-----CTACGCG---GTTG-G-TTTT-AGCGGGG-GTGCATCTC----------------GAG------CAA----CCCCACC-ATTACT-------CTCTGGCCGCTCTCTGGTCCTCC------------------------AGACAACAGTCAAC------GCACCCGCATCGTCA-----TTCCTCCAG-----CAGTTTCTCCAGGAT----GCTAATCAA-ATTCCACTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTACGT---TTG-A--TCCATTGC-CTTTTCCGTG----------CGT------CGTTGTC--GGCACAAACTAACATG---TCCC---T--CA-------------------TAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_hamatum01 CGAGAAGGTAAGT-TCA---TTT-CG-CTGC---------------------TTTTTTTATTCCT-TTTGGGCACAATT--GTGCCAGACAA---TT--CTGTTC-TC----------AGTCTTGTCA-----AC------ATTTTTTCCCACCAAGCATC-GCA--CCCCGCTTTGTCTGCCT--ACCTA--CCCCTCCTTT---GGCACAG----C--A----AAAATTTTCTG--G-----CTGCCTT--GGTTG-G-TTTTTAGTGGGG-TGCCAAATTTT-----------TGGCAG------TGA----CCCCGCC-ATCGCC-----------AC-TGTTC-----CTC-AT---GCACTAC-------CCAACACATGCTACGTATCAA---------------------------------------CTGCTTGGTTCATTGT----GCTAATCAT-ACTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCAG-------TC-CGACTGGTCA----------CTA--TCC-CAACA----TCATCATGCTAACGTG--CGACTC-----CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAA--------------------------------------------------------------------------------- Trichoderma_hamatum02 CGAGAAGGTAAGC-TCA---TTT-CG-CTGC---------------------TTTTTTCATTCCT-TTTGGGCACAATT--GTGCCAGACAA---TT--CTGTTC-TC----------AGTCTTGTCA-----CC------ATTTTTGCCCACCAAGCATC-GCA--CCCCGCTTTGT----CT--ACCTA--CCCCTCCTTT---GGCACAG----C--A----AAATTTTTCTG--G-----CTGCCTG--GGTTG-G-TTTTTAGTGGGG-TGCCAAATTTT-----------TGGCAG------TGA----CCCCGCC-ATCGCC-----------AC-TGTTCCTCATCTC-AT---GCATTAC-------CCAACATAATCTTCAGTCAA----------------------------------------TTGCTTGGTTCATTGT----GCTAATCAT-ACTTTAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCAG-------TC-CGACTGGTCA----------CTA--TCC-CAACA----TCATCATGCTAACGTG--CGACTC-----TA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCA---------------------------------------------------------------------------------- Trichoderma_hamatum03 ---GAAGGTAAGC-TCA---TTT-CG-CTGC---------------------TTTTTTCATTCCT-TTTGGGCACAATT--GTGCCAGACAA---TT--CTGTTC-TC----------AGTCTTGTCA-----AC------ATTTTTTCCCACCAGGCATC-GCA--CCCCGCTTTGTCTGCCT--GCCTA--CCCCTCCTTT---GGCACAG----C--A----AAATTTTTCTG--G-----CTGCCTT--GGTTG-G-TTTTTAGTGGGG-TGCCAAATTTT-----------TGGCAG------TGA----CCCCGCC-ATCGCC-----------AC-TGTCC-----CTC-AT---GCAGTA-C------CCAACATATTCTACAGTCAA----------------------------------------CGTCTTGGTTCATTGT----GCTAATCAT-ACTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCAG-------TC-CGACTGTTCA----------CTA--TCC-CAACA----TCATCATGCTAACGTG--CGA--C-TC--TA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum01 ------------C-T------TC----AACTGATTTTCGCC--------TCGATTC--TC-CCTCCTCCAAATTCAATT--GTGCCCGACGA---TT--CTGAA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CG-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CTGTCTT----TTG-G-TTTT-AGTGGGG-TTTCT---T----------------GTG------CA-----CCCCACT-A------------GCTCAC-TGC---TTTTTTTTTTTTGGCTTCACT------CTC----A-CTTCC---CCGC------CATTCAACGTAC--------TCTGTGTCT----TTGGTCATTCAGCGAT----GCTAACCAC-TTTTCCGTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTT-C--TTCATCAA-CTTC---ATG----------CTT------CAATTGC-AAGCCAGTGCTAACAGG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_harzianum02 -------------------------------------------------------------------------------------------------------------------------CGTGTC------ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--G-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A--AATTTTTT--G-----CTGTCGT----TTG-G-TTTTAAGTGGGG-TTTCT---T----------------GTG------CA-----CCCCACT-A------------GCTCGT----------TTTTTCT---GCTTCGCT------CTC----A-CTTCCCAGCCAT------CATTCAACGTAT--------TCTGTGTCT----CGTCACTTTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCT-T--TCCATCAA-TTTC---ACA----------CAG------CGATTAC-AAGCCAGTGCTAACAAG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum03 -GAGAAGGTAAGC-T------TC----AACTGATTTTCGCC--------TCGATTC--TC-CCTCCACACCATTCAATT--GTGCCCGACAA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAACGA----CGC-AA--A--TTTTTTTG--G-----CTGTCGT----TTG-G-TTTT-AGTGGGG-TTTCT---T----------------GTG------CAC----CCCCACT-A------------GCTCAC-TTT---TTTTTCCCCT---GCTTCACT------CTC----A-CTTCCCAGCCAT------CATTCAACGTGT--------TCTGTG--T----CGTCACTTTCAGCAAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-C--TCCATCAA-CTGC---ATG----------TTA------CAATTGC-AGGCCAGTGCTAACAGT---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum04 CGAGAAGGTAAGC-T------TC----AACTCATTTTCACC--------TCAACTC--TC-CCTCCT---CATTCAATT--GTGCCCGACAA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA---TTTTTT--------CA-T--C-A----CCCCGCTTT--G-------CATTA--CCCCTCCTTT---GCAGCGA----CGCAAA--A--TTTTTTTT--G-----CTGTTGT----TTG-G-TTTT-AGTGGGG-TTTCT---T----------------GTG------CAC----CCCCACT-A------------ACTCAC-TGC---TTTTTTTTCT---GCTTCGCT------CTC----A-CTTGCCAGCCAT------CATTCAACGTGC--------TCTGTGTCT----CGTCACTTTCAGCGAT----GCTAACCGC-TTTTCTATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCT-T--TCCATCAA-CTTC---ACA----------CAG------CGATTAC-AAGCCAGTGCTAACAAG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTG------------------------------------------------------------------ Trichoderma_harzianum05 CGAGAAGGTAAGC-T------TC----AACTCATTTTCGCC--------TCGATTC--TC-CCTCCA---CATTTAATT--GTGCCCGATAA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CA-T--C-A----CCCCGATTT--G-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A--TTTTTTTG--G-----CTGTCGT----TTG-G-TTTT-AGTGGGG-TTTCT---C----------------GTG------CA-----CCCCACT-A------------GGTCAC-TGC----TTTTTTTCT---GCTTCGCT------CTT----A-CTGCCCAGCCAT------CATTCAACGTGC--------TCTGCGTCT----CATCACTTTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCT-T--TCCATCAA-CTTC---ACA----------CAG------CGATTAC-AAGCCAGTGCTAACAAG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- Trichoderma_harzianum06 CGAGAAGGTAAGC-T------TC----AACTCATTTTCGCC--------TCGATTC--TC-CCTTCA---CATTCAATT--GTGCCCGACAA---TT--CTGCA--GAGAAT------TTTCGTGTC-A----ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--G-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A--TTTTTTTT--G-----CTGTCGT----TTG-G-TTTT-AGTGGGG-TTTCT---T----------------GTG------CA-----CCCCACT-A------------GCTCAC-TAC---TTTTTTTTCT---GCTTCGCT------CTC----A-CTTCCCAGCCAT------CATTCAACGTGC--------TCCGTG--T----CATCACTTTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TGT-T--TCCATCAA-CTTC---ACA----------CAG------CGATCAC-AAGCCAGTGCTAACAAG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum07 ----------------------------------------------------------------------CATTCA?TT--GTGCCCGACAA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--G-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--ATTTTTTTTTT--G-----CTGTCGT----TTG-G-TTTT-AGTGGGG-TTTCT---T----------------GTG------CAC----CCCCACT-A------------GCTCAC-TGC---TTTTTTTTCT---GCTTCAAT------CTC----C-CTTCCCAGCCAT------CATTCAACGTGC--------TCTGTG--T----CATCACTTTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCT-T--TCCATCAA-CTTC---ACA----------CAG------CGATTAC-AAGCCAGTGCTAACAAG---AAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum08 -GAGAAGGTAAGC-T------TC----AACTGATTTTCGCC--------TCGATTCTTCCTCCTTCA---CATTCAATT--GTGCCCGACAA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGCAAA--A--AATTTTTT--G-----CTGTCGT----TTG-GTTTTT-AGTGGGG-TTCTC---T----------------GTG------CAA----CCCCACT-A------------GCTCAC-TGC-----TTTTTCCT---GCTTCACT------CTC----A-CTTCCTAGTCAT------CATTCAACACGC--------TTTGTGGCT----TTGGTCATTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT-------C--CTCATCAA-TCTC---ATG----------GTG------CAACTGC-GAGCTAGTGCTAACATG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum09 CGAGAAGGTAAGC-T------TC----AACTGATTTTCGCC--------TCGATTCCTCTTCTTTCA---TATTCAATT--GTGCCCGACAA---TT--CTTC----AGACT------TTTTGGGTC-G----ACAA----TTTTT--------CG-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A--TTTTTTTT--G-----CTGCCGT----TTG-ATTTTT-AGTGGGG-TTCTC---T----------------GTG------CAA----CCCCACT-A------------GCTCAC-TGC----TTTTTTTGT---GCTTCA--------TTC----A-CTTCCCAGTCAT------CATTCAACGTGC--------TCTGTGTCT----TTGGTTATTCAACGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTA-C--TTCATCAA-CTTC---ATG----------CTG------CAATTGC-AACCCAGTGCTAACAGG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_harzianum10 CGAGAAGGTAAGC-T------TC----AACTGATTTTCGCC--------TCGATTCCTCTTCTTTCA---TATTCAATT--GTGCCCGACAA---TT--CTTCA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A--AATTTTTG--G-----CTGCCGT----TTG-ATTTTT-AGTGGGG-TTCTC---T----------------GTG------CAA----CCCCACT-A------------GCTCAC-TGC----TTTTTTTGT---GCTTCA--------CTC----A-CTTCCCAGTCAT------CATTCAACGTGC--------TCTGTGTCT----TTGGTCATTCAACGAT----GCTAACCACTTTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATCGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTA-C--TTCATCAA-CTTG---ATG----------CTG------CAATTGC-AGTCCAGTGCTAACAGG---CAAT---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGTGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_helicum ------ACTGATC------------------------------------CTCACCTCAATTTTCCATCTACACTCGATT--TTATCGGACAA-------TTCTCAACGGAAT------TTTCGTGTCA-----AGACAATTTTTGCTTGCATCA-------------CCCCGCTTTCGCTATCC---TTTA--CCCCTCCTTT---GCAGCGA----TGC-----AAATTTTTTTT--------TTCCCTG---TCTGAGGTTTTTAG{GT}GGGG-GC{CG}CACAAG-------------------------CAA----CCCCACC-ACGGCCTCGCGG{CT}TTTTTGGCAT---------------------------------------------------------TGCTCTATCACTACACAGCAATTGCGTTC----TCATTA?CTCAGC{AG}AT----GCTAACCAT-{CT}TTTCACTCT-ACAGGAAGCCGCC{AG}AACTCGGTAAGGGTTCTTTCAAGTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_intricatum CGAGAAGGTAAGC-TCA---TCT-CA-CTGCTTCTTTTTTT--------TTTTCTCACTGCGC-----TTGGCGCAATC--GTGCCCGACAA---TT--CTGTTC-TC----------AGTCTTGTCTA----AT------TT-----TCCACGCCGCGTC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCAG--------------CAAATTTTTTT--G-----CTGCCTC--GTTTG-A-CTTTTAGTGGGG-TGCCAACTTTTTTTC----------TGG------CAG----CCCCGCT-ATTGTC-----------GC-TGTCC-----CTC-AT---CCATCGTC------CCAACGAATTGCACTCTCTCA------ATTGCATCACCTCTC----GACTCAATTT----CTCTGTGGTTCATTAT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TGCTTT-----------CAGTCCTTG----------ACA--TGT-CGAGA-TCATCATCATTCTAACGTG--CCA-----C--TG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTATGCCTGATTATCGCTGCCGGACTGGAGTC?----------- Trichoderma_koningii CGAGAAGGTAAGC-TCA---TTTCCA-CTGC-------------------TTTTTTACCACGC-----TTGACACAATC--GTGTCCGACAA---TT--CTGTTC-TC----------AGTCTTGTCC-----AT------CT-----TCCTCGCAGCATC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCAGCA------------AAAATTTTTCT--G-----CTGCATC--GTTTG-G-TTTTTAGTGGGG-TGTCAATTTTTTT------------GAG------CAA----CCCCGCT-ATCGCC-----------GC-TGTCC-----CTC-GT---CCATCGTC------TCAACAAATTGCACTCTTTCA------ATCGCATCGCCT--------------------------TTATTCATTGT----GCTGATCAT-GTTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CATTTC-----------TAACTCTTG----------ACA--TGT-CGAAATTCATCATCATTCTAACGTG--CCG-----C--TG-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- Trichoderma_koningiopsis CGAGAAGGTAAGC-TCA---TTT-CA-CTGC------------------TTTTTCCACCACGC-----GTGGCACCATC--TTGTTCGACAA---TT--CTGTTC-TC----------AGTCTTGT-T-----GT------TT-----TCCTCGCTGCGTC-ACA--CCCCGCTTCAC----CT--GTCTA--CCCCTCCTTT---GGCAG--------------CAAATTTTTCT--G-----CTGTCTC--GTTTG-A-C-TTTAGTGGGG-TGCCAATTTTTTTTT----------TGG------CAA----CCCCGCT-ATCGCC-----------AC-TGTCC-----CTC-AT---CCATCGTC------CCAACAAAATGCACTCATTCA------ATCGCATCGTCTTTT----GACTCGATCT----CTCTTTGGTTCGTTGT----GCTAATCAT-GTTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TATTCC-----------TGGCTCTTG----------ACA--TGT-CGAAA----TCATCATTCTAACGTG--CCA-----C--TA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTG------------------------------------------------------------------ Trichoderma_lieckfeldtiae -----AGGTAAGC-TAA---TTT-CA-CTAT------------------TTTTATCACTACGCTT-TATTGGCACAGTCGTGTGTCCGACAA---TC--CTGTTC-TC----------AGTCTTGTCA-----AT------TTTT---TTCTCGCATCGTC-ACA--CCCCGCTCTAC----CTGTCTCTA--CCCCTCCTTT---GGCACAG----C--A----AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-TTTTTAGTGGGG-TGCCAGCTTTTTTTT-------TTCTGG------CAA----CCCCGCTAATCGCC-----------GC-TGTCC-----CTC-AT---CCATCGTC------TT--CACAATTTGTTCACTCA------ATCGCAT--------------CTCATTTT----CTCCGTGGTTCAATGT----GCTGATCAT-GATTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTT-AG----TA-----TCCTCATTG----------GCG--TTT-CGAAA----TCATGATTCTAACGTG--CCA--C-TC--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_longibrachiatum CGAGAAGGTAAGCTTGA---GATCC--CTTCAATTTTCGGA--------CGA------------TTT---CCTGTGCCT--CTGCCCAACA---------------------------------------------TCTTTTTTTT--------CA-C--C-A----CCCCGCTTT---------CTCCTA--CCCCTCCTTT----GGGCGA----CGC-----AAATTTTTTTT--G-----TTGCGTT----TCGGG-TTTT-AGTGGGG-ATGCACCTC----------------CAG------CA-----AACCACT-ATC--C-------TCT-GC-CGC------CCTCTGC---TCTCGTCT------CCA----ACACCTTTGGCGCT------TGCGTCATCA----------ACCTTCCAA----CAGTCTGCGCAGCAAT----GCTAATCAT-TTTCCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTG-A--TCCCGTGC-ACTCATTGCA----------TCA------TCGCCAC-AACAACATACTAATGCC---CTCT------GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_longipile ---GAAGGTAAGC-TCA---ATC----AACTGATTCACACC--------CAAATTC--TC-CCTTGG---CGTTCAATT--GTGCCCGACAA---TT--C--AA--CGGAAT------TCTCGTGTC-A----ACAA---TTTTTT--------CG-T--C-A----CCCCGCTTT--CGCTTC-ACACTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CTGTCGT----TTG-A-TTTT-AGTGGGG-GCGCA--------------------CAG------CAA----CCCCACC-ACTGCC-------ATTCAC-TGG-----T-TTTTGC---ACTTCACT------ACA----A-C-TCCCAGCTGC------CACTCAGCACC---------TCTATATCT----CGTCACTTTCAGCGAT----GCTAACCAT-CTTTCCCCCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAT-TTCT---GTG----------CTG------CGTCTGC-AAGCTTGTGCTAATGCA---AACA---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCTGGTACTGGTGAGTTCGAGGCTGG Trichoderma_martiale -------GTAAGC-TCA---TTT-CA-CTGC------------------TTTTTTCACTACGCTT-TCCTGGCACGATC--GTGCCCGACAA---TT--CTGTTT-TC----------AGTCTTGTCA-----AT------TTTT---CTCTCGCAGCACC-ACA--CCCCGCTTTAC----CTGTCTCTA--CCCCTCCTTT---TGCACAG----C--A----AAATTTTTCTT--G-----CTGTCTT--GTCTG-C-CTCTGAGTGGGG-TGCCAACTTTTGT---------TGGCAG------CGA----CCCCGCT-ATCGCC-----------AC-TGTCC-----CTC-AT---TCATCGTC------CCAACACATTGTACTCATTCA------ATCGCATCGTCCTTT----GCCTCAATTT----CTTTGTGGTTCATTGC----GCTGATCAT-GTTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCGG------------CTTCATTG----------ACA--TTT-CGACA---TTCATCATTCTAACGTG--CCA--C-TC--TG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_melanomagnum -------------------------TTTTTTTTTTTTTTTT--------ACTTTCCATTTGATTTCC---CTGCCAATT--GTG-CCGACAA---TT--CTCTT--GGGAAT------TTTCGTGTC-A----ACAATTTTTTTTT----CCCAAA-T--C-A----CCCCGCTTT--TGCTGC----CTA--CCCCTCCTTT---TGGCGGA----CGCA----AAATTTTTTTT--G-----TTGGCCA--TTCTG-G-TTTT-AGTGGGA-ACGCATGTG----------------CAG------CGA----CCCCACC-ATTGCCTCTGG--CTCTTA-TCTCTGCTGCCTTTGGCTGCCCTTCATCTCCGGTCGCAACTTTCGTTATCTCAT------TGGGCATCCATCGCC----ATCATATCTT----CTTCGCATTCAATCGT----GCTAACCAT-GATTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---T------------GG-ATGC---ATT----------TGC------CTTTGTA-CAACAATCGCTAACATG---TGCC---T--CG-------------------CAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGATTCACTGGTACTTCCCA-GGCCGACTGCGC------------------------------------------- Trichoderma_minutisporum -------GTAAGC-TCA---GTCGACTGATTTTTCTAC-----------TCATTTTCTCCCTTTCCATGTCATGCAATT--GTGCTCGATAA---TT--CTCTT--CTGAAT------TTTCTTGTCCA-------------TTTTTTCTCCCACTGT--C-A----CCCCGCTTT------CTCTACCTA--CCCCTCCTTT---GGGCAGA----TGC--A--AATTTTTTTTG--G-----TTGCCTC--GTTTG-G-CTTT-AGTGGGG-GTGCTCTTT-------------GTGTGG------CAA----CCCCACC-ATTACCTACGACTACCATT-TGCTGGCCTCTCTTTT---GCTCGATC-------TGCATTGCAATTCATTTCAT------CAAGCCGCGTTGCCT----GCTTTATTTC----ATTCGTATTAATCAAT----GCTAACCAT-GTTTCCTTCA-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAGGT---TTT-TGATCTATTCT-CGCTCGCCGT-------------------ATTCCCA-AACTCAAAGCTAATACC--AAATT---T--CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACCGGAACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGC---- Trichoderma_novaezelandiae CGAGAAGGTAAGCTTGC---GATCC--CTTCGATTTCCGAG--------CGAGATC-----GACTTT---CTTTTGCCT--CTGCCCATAATCTGTC--GACCAA-AATGGT------CCGCGTCGACAGATTTTTTCTCCCTTTC--------CC-T--C-A----CCCCGCTTT---------CTCCTA--CCCCTCCTTT----GGGCGA----CGC-----AAATTTTTTTT-GG-----TTGCGTT----TCGGG-TTTT-AGTGGGGTGCTCACCTG----------------CAG------CA-----ACCCACT-ACC--C-------GCTGGC-CGC------CGTCTGT---TCTGGTCT------CCC----AACACATTTGCACA------CGCGTCATCA--------------CTCAG----CAATCTGTGCAGCAAT----GCTAATCCT-TTTCCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTG-A--TCCATCGC-AC----TGCA----------TCA------TTGCCAC-AACAACATGCTAATATC---CTCT------CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_oblongisporum -GAGAAGGTAAGCTTTA---TCC----ACTCATTTTTGAGC--------TCAATTTCCCTCTTTTCT---CATGCAA------------------TT--CTCGA--ATGAATTTGCGCTTGCGCGTC-C----ACGATTCTGCTCCTTCCGCATCA-T--C-A----CCCCGCTCT--CGTTGCCTGCCTA--CCCCTCCTTT---GCAGCGA----CGCAAAAAAAAAAATTGCT--A-----CCATAAT----TCT-T-TTTT-GGTGGGG-GTACGCACG----------------TAG------CGA----CCCCACC-ACAGCC-------TCAGGC-TGCTTCATGCCTTTGT---CTACCACA------ACACAAGACTCACCCATTCGACTCATGCACATCAAGCTCCAA----TGTCTTCACT----TGTTACTTTCAGTGAT----GCTAATCAT-ATTACCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTC-A--TTCATGAC-T-------TT----------CAA------CATCCAC-GAGCCAGCGCTAATGCA---AATT---C--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-TCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_ovalisporum01 CGAGAAGGTAAGC-TCA---TTC-CA-CTGC-------------------TTTTTCAATACCC-----TTGGCACAATT--GTGTCCAACAA---TT--CTGTTC-TC----------AGTCTTGTCT-----AT------TT-----TCCTCGCAGCGTC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCAG--------------CAAATTTTTCT--G-----CTGCCTT--GTTTG---ACTTTAGTGGGG-TGCCATTTTTTT-------------TGG------CAA----CCCCGCT-ATTGCC-----------AC-TGTCC-----CTC-AT---CCATCGTC------CCAACAAATTGCACTCACTCA------ATCGCATCGCCTTTT----GACTCGATTT----CTCTATGGTTCATTGT----GCTGATCAT-GCTTCAATCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TATTTT-----------CAGTCCTTG----------ACA--TGT-CGAGA-TGGTCATCATTCTAACGTG--CCA-----T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_ovalisporum02 CGAGAAGGTAAGC-TCA---TTC-CA-CTGC-------------------TTTTTCAATACCC-----TTGGCACAATT--GTGTCCAACAA---TT--CTGTTC-TC----------AGTCTTGTCT-----AT------TT-----TCCTCGCAGCGTC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCAG--------------CAAATTTTTCT--G-----CTGCCTT--GTTTG---ACTTTAGTGGGG-TGCCATTTTTTTT------------TGG------CAA----CCCCGCT-ATTGCC-----------AC-TGTCC-----CTC-AT---TCATCGTC------CCAACAAATTGCACTCACTCA------ATCGCATCGCCTTTT----GACTCGATTT----CTCTATGGTTCATTGT----GCTGATCAT-GCTTCAATCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TATTTT-----------CAGTCCTTG----------ACA--TGT-CGAGA-TGGTCATCATTCTAACGTG--CCA-----T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGA------------------------------------------------------------------------------- Trichoderma_pachybasioides ------AGTAAGC-TCA---GTCGATGATTTTTTTTA------------TGCTTCTTCTTCCCTTTCACACATATGATT--GTGCCCGACAAAATTCTCTTCTG--------------AATTTCGTCAA-----------TTTTTCTTCTCCCACTGTCAC-A----CCCCGCTTT------CTGTATCTA--CCCCTCCTTT---TGGCAGA----CGC-----AAATTTTTTTC--GT----CGGCCTT--GTTTG-G-CTTT-AGTGGGG-GCGCTCTGT---------------GTAG------CAA----CCCCACC-ATTGGCCTCTCTTTTTTCTTTGGTCGATCACCA--------------------CTGCAGTCCTTTTCCTCAAGC------CGCATTGCCTATCTT----GTTTTTCTCG----TTTGTTTTTTATCAAT----GCTAACCA--ATGTCCCTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCCGATACTATGTCACCGTCATTGGTATGT---TTTGATTTCTTCTCA-TTCGTCAGTT-------------------TAAAGAT-ACACCAGCGCTAACAAC---AATT---T--CT-------------------CAGATGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGCT--- Trichoderma_parapiluliferum -----------------------------GACATTTT------------ATTTCACTTTCCGCTTCATGCGATACAATT--GTCCCGACAAA-------ATCTTTTCTGATC----------TTGTT------CAATTTTTTCTTCCCA-------CTGTC-A----CCCCGCTTTCTTTACCT------A--CCCCTCCTTTGGCAGACGCA------------AATTTTTTTTG--G-----CTGCCTT-----TG---GCTTTAGTGGGG--------------------TGCTCTCTG------TAACCCCACCATTACCTCACCTCTGATTCTTATCTGTTCCCATCTTTTTCGTCT--------------TCGTCGATCACCACTGCAATC------CAACTTATCAGGCCGTCT----------------TCTTGGTTCCATAAT----GCTAACAAT-ATTTCCCTCA-ATAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCCGTTACTATGTCACCGTTATTGGTATGT---TGTGATTCCTTGCCATTG----------------------------GAAAAA-AATCCAGCGCTAACAAC---AATC---C--TA-------------------CAGATGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_parareseei CGAGAAGGTAAGTTTCA---TTTCAATTCCCAGACTCGAGC--------CCAATTC--------TCC---CTTGCCTAT--CTGTCCAACAT---TT--GTCGA--CCAAAT------GTT-GTGCC-G----ACAGGTTTTTTTT--------CA-T--C-A----CCCCGCTTT-----CTT-C---TA--CCCCTCC-------GAGCGA----CGC-----AAA-TTTTTTT--G-----CTGCCTTACGATGG-G-TTTT-AGTGGGG-TTGCA--TC----------------GAG------CAA----CCCCACC-AATACT-------CTGGCC-GCTCTGTCGGATCCTT------------------CGACAACAGTCACCTCA---------GCACACGCGT-CACC----AACACAGCAG----TCT-TTGATCCGCGAT----GCTAACCAT-GTTCCCCTCA-ATAGGAAGCTGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TGGCA--GCCAACAT-CTCAT---TG----------CGT------CGTTGAC--ACGTCAAACTAACGAT---GCCC---T--CA-------------------CAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_parestonicum ----------------------ATACTGATCTACCTC---------------------ACCCTCCCTTCACATTCAATT--GTGCCCGACAA-------TTCTGAACGGAAT------TCGCGTGTC------AAACACAATTTTC----------TCATC-A----CCCCGCTTTCGCTTCCCATTA--C--CCCTCCTTTGCAGCGACGC--------------AAATTTTTTT--G-----CTGT-TC--TTT-G---GTTTTAGTGGGG--------------------TGACACCAG------CAA----CCCCACCACTGCCACTCACTG-CTTTTTGCACTTCTCTACCACTAC-CCAGTGGT------CCTTCAACGCCTT--------------------------------TGTCCCTC--------GCT---TTCAGCGAT----GCTAACCAT-ATTCCTCTCA-ACAGGAAGCCGCTGAACTCGGCAAGGGTTCCTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTGATTCATCACCT-CAATGC---------------GGC-------AATGAC-GAACAAATGCTAACAGA---AATC---T--GG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGCACTGGTGAGTTCGAGGCTGG Trichoderma_paucisporum CGAGAAGGTAAGC-TCA---TTT-CA-CTAC------------------TTTTTT--CCACGCAT-TTTTGGCACAATT--GTGTCCGACGA---TT--CTGCT--TC----------AGTCTTGTCA-----AT------TTTTTCACTCTCCCAGTGTC-TCA--CCCCGCTTTGC----CC--TTCTA--CCCCTCCTTT---GGCACAG----C-AA----AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-CTTTTAGTGGGG-TGTCAATTTTTTTTC-------TGGCAG------CAA----CCCCGCT-ATCGCC-----------AC-TGTCC-----CTC-AT---CCACTG-C------CCAACACATTTTACCTGCTCA------GTCGTATCGTCTGTT-----CTCAAATTT----CTCTTCGGTTCATTGT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCGG----TCATC-GTCATACTTG----------ACA--TGT-CAAGA----TCATCATTCTAACAAG--CTG--C-TC--TG-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-?CTCATTATCGCTGCC----------------------- Trichoderma_petersenii -------GGAAGC-TCA---TTT-CA-CTGC------------------TTTTTTCACTCTGC-----TTGGCATCATC--GTGTCCTACAA---TT--CTGTTT-TC----------AGTCTTGTCC-----AT------CT-----TCCTCGCAGCGTC-ACACCCCCCGCTTTGC----CT--GCCTA--CCCCTCCTTT---GGCA--G----C-------AAATTTTTTCT--G-----CTGCCTC--GTTTG-A-CTTTTAGTGGGG-TGCCAACTTTTTTTTTTC----CCCTGG------CAA----CCCCGCT-ATTGTC-----------ACTTGTCC-----CTC-AT---CC-------------------------------------------CATCGCCTCTTGCAAGACTCAATTT----CTCTGTGGTTTATTGT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGT---TATTTT-----------CGGTCCTTG----------ACA--TGTCCCAGA-CCATCATCATTCTAACATG--CCA-----T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCT-- Trichoderma_pleuroticola CGAGAAGGTAAGC-T------TC----AACTGATTTTCGCC--------TCAATTC--TC-CCTCCA---CATTCAATT--GTGCCCGACGA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA----TTTTT--------CA-T--C-A----CCCCGCTTT--C-------CGTTA--CCCCTCCTTTG--GCAGCAA----CGC-AA--A-TTTTTTGTA--G-----CAGCCTT----TTG-G-CTTT-GGTGGGG-TTTCG---C----------------GTG------CA-----CCCCACT-A------------GCTCAC-TGC-----TTTTTTCT---GCTTCACT------CTCCC--A-CTGCCCAGTCAT------CATTCAACGTGC--------TCTGTGTCT----CAC--CATTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-C--TCCATCAT-CTTG---ATG----------CAG------GAATTGC-GAGCTGGTGCTAACAGG---TAAT---T--CG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_pleurotum CGAGAAGGTAAGC-T------TC----ACCTGATTTTCGCC--------TCAATTC--TC-CCTCCA---CATTCAATT--GTGCCCGACGA---TT--CTGCA--GAGAAT------TTTCGTGTC-G----ACAA----TTGAT---------A-T--C-A----CCCCGCTTT--C-------CGTTA--CCCCTCCTTTG--GCAGCGA----CGC-AA--A-TTTTTTTTG--G-----CAGCCGT----TTG-G-CTTT-GGTGGGG-TTTTG---T----------------GTG------CA-----CCCCACT-A------------GCTCGC-TGC--TTTTTTTTTCT---GCTTCACT------CCCCCCAC-TGGCCCAGTCAT------GATTCAACGTGC--------TCTGTGTCG--------CCATTCAGCGAT----GCTAACCAC-TTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTCTGCTG-C--TCCATCAC-CTCC---ATG----------CAG------GAATGGC-GAGCTGGTGCTAACAGG---TCAT---G--CG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_protrudens CGAGAAGGTAAGC-GCA---GCCTGATTTTCTCTCTCATTT--------TCATCTTCGCC----CTC---CATGCAGCT--GTGTCCGACAATTCTCAGTTATC--TGAGGA------TATCGTGTC-A----A--------TTT-TTTTTTCATGGT--C-A----CCCCGCTTT--CACTGC----CTA--CCCCTCCTTT---TGGTACAGACGTGC-----AAATTTTTTTT--G-----CTGCCTT--ACTAG-G-TTTT-AGTGGGG-TTGCTTCTT-------------GGAGCA------GAC----CCCCACT-ACTATCTGTG---ACGTCC-TGTTACCGGTTCACAC---TCTTGATTGCTCAAGCCCAATGCACCTCATCAAAT------CCCAAT-CGCC-T-T----TTACTTTCCC----TCATCTACTCAGTTGT----ACTGACCAT-TTTCCCTTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TGG-AAACTCATCTC-CTGGTATTTT----------GGT------AC---------CGACTGCTAATGCC---AATC---T--CA-------------------CAGACGCTCCCGGCCACCGTGATTTCAT------------------------------------------------------------------------------------ Trichoderma_pseudokoningii ------GGTAAGC-TCA---ATCC---CTTCAATTTCGAGC--------CCATTTTCCGCCT--------CAGGTCTCT--GTGCCCAACAT---TT--GTCGA--ACGAAT------GCTCGTTTC-G----ACAGGGCCTGGCA--------CATC----A----CCCCGCTTT---------CCCTTA--CCCCTCCTTT---TGAGCGA----CGC-----AAA-TTTTTTT--G-----CTGCTTC---ATCG-A-TTTT-AGTGGGG-GTGCATCTC----------------GAG------CAA----CCCCACC-ACTGCCCTCA---G---AC-TGTTCTTTTGCTACAT-----------------CCTACAACAGTCTCACTGCAC------TCGTCCGCGTCATCA-----ATATTTGAG-------TGTTTTCAGTGAT----GCTAATCAT-GATTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCATTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TGA-A--TCCATCGC-CCCA---GCA----------CCT------CAGTCCACCACACAGCGCTAACAGT---TTCC---T--CG-------------------CAGACGCTCCCGGCCATCGTGACTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_pubescens --GGAAGGTAAGC-TCA---TTT-CA-CTGC---------------------TTTTCCCCTTCAT-TCTGGGCACAATT--GTGTCCGACAA---TT--CTGTTC-TC----------AGTTTTGTCA-----ACACTTTTTTTTTTTCCCACCAGGCATT-GCA--CCCCGCTTTGC----CT--ACCTA--CCCCTCCTTT---GGCACAG----C--A----AAATTTTTCTG--G-----CTGCCTT--GTTTG-G-TTTTTAGTGGGG-TGCCAAATTT------------TGGCAG------CAA----CCCCGCT-ATTGCC-----------AC-TGT-------CTC-AC---ACATTGC-------CCAACATATTTTACTT------------------------------CAATCAATTT----CTGTTTGGTTCATTGT----ACTAATCAT-ACTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTCAG-------TT-CGACTGGTCG----------GTAATATC-CAACA----TCATCATTCTAACATG---------TT--TA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCCGATTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_reesei --------------------------------GGTAGCTTCGTTCCTTCAATCTCCAGACGCGAGCCCAATCTTCCCTTGCCCATCTGCTCAGCATCT-GGCGA--ACGAAT------GCT-GTGCC-G----ACACGATTTTTTTTTT-----CA-T--C-A----CCCCGCTTT-----CTC-C---TA--CCCCTCCTT----CGAGCGA----CGC-----AAATTTTTTTT--G-----CTGCCTTACGA----G-TTTT-AGGGGGG-TCGCACCTCA------------------------CAA----CCCCAC--TACTGCTCT----CTGGCC-GCTCCCCAGTCACCCAACGTCATCAACGCAGCAG-------------------------------------TTTTC---AATCAGCGAT------------------------GCTAACCAT-ATTCCCTCGA-ACAGGAAGCCGCCAAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TGGCA--GCCATCAC-CTCAC---TG----------CGT------CGTTGAC--ACATCAAACTAACAAT---GCCC---T--CA-------------------CAGACGCTCCCGGCCACCGTGACTTCATCAAGAACATGA-TCAC-------------------------------------------------------------------- Trichoderma_rogersonii -----AGGTAAGC-ACA---TTTTCTACT--------------------TTTTTTCGCTTCACATCTTTGAACACAGCC--GTGTCCGACAA---TT--CTGTTC-TC----------AGAACTGTCAA------------ATTTTTCTCTCAGCATCACC-ACA--CCCCGCTTTGC----CT--GTCTA--CCCCTCCTTT---GGCACAG----C-------AAATTTTTTTCTGT-----CTGCCTT--GTTTG-G-CCTTTAGTGGGG-TACCATTTTTTT----------TGGTAG------CAA----CCCCGCT-ATCGTC-----------AC-TGTGT-----CTT-GT---CCATCGTC------TCAACAAATTCCA--------------ATCGCATCGTCGCTC----------AAGT----CTTTCTTTTTCATTGT----GCTGATCAT-CATTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TCACAT----------GTCCTCGTTG----------ACG--ACG-CGAAAGA--TCATCATTCTAACATG--CTGCTT-----CA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCCGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_rossicum TGAGAAGGTAAGC-TCA---GTC----GCCTTCTTTTTGCA--------TCAATCT---CTTCTTCA---CACTCAGTT--GCGCCCGACAA---TT--CCGAA--CGGAAT------TCTCGTGTC-G----ACAA--TTTTGTT--------CC-T--C-A----CCCCGCTTT--CGCTTC-CCAATA--CCCCTCCTTT---GCAGCGA----CGC-----AAAAATTTTTT--G-----CTGCCTT----TTG-G-CTTT-AGTGGGG-GCGCA---C----------------CAA------CAA----CCCCACT-ATTGACC-------------TGCTGCTGTTCTCTCC---ATTCAACC-----------------------------------------------------CTCTGCTCG----TCTTATGTTCAGTGAT----GCTAACCAT-ATTCCCTTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTC-A--TTTATCAC-ATCA---ATG----------CAG------CATCCGA-AAGCCAGTGCTAACAAA---CACA---T--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-TCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_saturnisporum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_sinuosum -------------------------------------------------------------ATTTCC---TGCTCAATT--GTGACGGACAA---TT--CTCAA--CGGAAT------TCTCTTGTC-A----ACATTTTTTTTTG--------CA-T--C-A----CCCCGCTTT--CACTTC-CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---AATTTTT--------GCAGCCT----CGA-G-TTTT-AGTGGGG-TCGCT---T----------------GTGCACCCCCCC----CCCCACT-ACC----------ATTCAC-TGC-----TTTTTTGC---CCTTGACT------GCG----T-GTACCTTGTCAT------CATTCCACGC----------TCTTGATCA----TCTCTTTTTCAGCGAT----GCTAACCAT-CTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTT-C--TGCACGGA-TCTT---GTT----------CCA------TGTTCGC-CAGCCCGTACTAATGCC---AATT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGC--------------------------------------------- Trichoderma_spirale01 CGAGAAGGTAAGC-TCA---ATC----AACTGATCCTCGCC--------TCAATTT--CC-CCTTCA---CATTCAATT--GTGCTCGACAA---TT--CTGCA--CGGAAT------TCTCCTGTC-A----ACAA-----TTTT--------TA-T--C-A----CCCCGCTTT--CGCTTC--CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--T-----GCAGCTC----TAG-G-TTTT-AGTGGGG-TTGCT---G----------------GTG------CA-----CCCCACT-GCTGCC-------TGTCAC-TGC------TTTTTGT---CCTTCACT------ACG----A-CCACCT-----------------------------------------------TCATTTTCAACGAT----GCTAACCAT-CTTTCCCTCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTGTGGAAGTTCGAGACTCCTAAGTACTATGTCACCGTCATTGGTATGT---TTG-ACATCATTGCC-GTTC---ATG----------CTA------TAACTGC-AACTGGGTGATAACGCA---AACA---T--TA-------------------CAGACGCCCCCGGCCACCGTGATTTCATC----------------------------------------------------------------------------------- Trichoderma_spirale02 ----GAGGTAAGC-TCA---ATC----AACTAATTCTCGCC--------TCAATTT--CC-CCTTCA---CATTCAGTT--GTGCTCGACAA---TT--CTGCA--CGGAAT------TCTCCTGTC-A----ACAA-----TTTT--------TA-T--C-A----CCCCGCTTT--CGCTTC--CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--T-----GCAGCTC----TAG-G-TTTT-AGTGGGG-TTGCT---G----------------GTG------CAC----CCCCACT-GCTGCC-------TGTCAC-TGC------TTTTTGT---CCTTCACT------ACG----A-CTACA----------------------------------------------CTTCATTTTCAATGAT----GCTAACCAT-CTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTG-A--CTCATTAC-TTTC---ATG----------CTA------TATTTGT-AACTCGGTGCTAACGCA---AACA---T--CA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_spirale03 -GAGAAGGTAAGC-TCA---ATC----AACTGATTCTCGCC--------TCAATTT--CC-CCTTCA---CATTCAATT--GTGCTCGACAA---TT--CTGCA--CGGAAT------TCTCTTGTC-A----ACAA----TTTTT--------CA-C--C-A----CCCCGCTTT--CGCTTC--CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--------GCAGCTC----TAG-G-TTTT-AGTGGGG--TGCA---C----------------CAG------CAA----CCCCACC-GCCGCC-------TATCGC-TGC------TTTTTGC---CCTTCACT------ACG----A-CTACACAGTTAC-----------------------------------------TCATTTTCAACGAT----GCTAACCAT-CTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGATATCGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTC-A--TTTATTAC-CTCC---ATG----------CTA------CAATTGC-AACTCGGTGCTAATGCA---AACA---T--TA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_stilbohypoxyli CGAGAAGGTAAGC-TCA---TTT-CA-CTGA-------------------TTTTTCGCTACGCAC-TGTTGGCACAATC--GTGTCCGACAA---TT--CTGTTC-TC----------AGTCTTGTCA-----AT------TT-----TTCTCACGTCGTC-ACA--CCCCGCTCTAC----CT--GTCTA--CCCCTCCTTT---TGCACAG----CA------AAAATTTTCTG--T-----CTGCCTT--GTTGG---CTTTTAGTGGGG-TGTCAATTTTGTT---------TGGCAA------CAA----CCCCGCT-ATTGCC-----------AC-TGTCC-----CTC-AT---CCATCATC------CCGACAATTGATCTCA-----------ATCGCATCGTCATTT---------CTCAT----TTTTGTAATTCATTGT----GCTGATCAT-GTTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTTGT------TTTCTCCCTCATTG----------ACA--TCG-CGAAA----GCATCATTCTAACTTG--CCA-----C--TA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- Trichoderma_strictipile ----------------------T----CACTGATTCTCGCC--------CAAAATT--TC-CCTTCA---CATTCAATT--GTGCCCGACGA---TT----------------------CTTGTGTC-G----ACAA--TTTTTTT--------CG-T--C-A----CCCCGCTTT--CGCTTC-ACATTA--CCCCTCCTTT---GCCGCGA----CGC-----AGAGATTTTTT--------GCTGTCT----CTG-G-TTTT-AGTGGGG--TGTA---C----------------CAG------CAA----CCCCACT-GTC----------GCTCAC---------TGTTCTGC---CCTTCATT------CCC----A-CTACCCAGT-GT------CATTCAACGC----------TTTTGTGCC----TGTCACTTGCAGCGAT----GCTAACCAT-GTTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATCGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCATCAC-ATTC---ATG----------CGG------CATCGGC-AAGCATGTGCTAACACA---AACT---T--GA-------------------CAGACGCTCCCGGCCATCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCAGGGCCGATTGTGCCAT-CCTCATCA------------------------------- Trichoderma_strigosum -----AGGTAAGC-TCA---TTT-CA-TTGC-------------------TTTTTCGCCATGCAC-TTCCAGCA------------CGACAA---TT--CTGTTC-TC----------AGTCTTGTCA-----AT------TTTT---TTCAATCAGCGTC-ACA--CCCCGCTTTGG----TT--GTCTA--CCCCTCCTTT---GGCACAG----C-------AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-CTTTTAGTGGGG-TGCCAGCTTGTTTTT------TGGCAAG------CAA----CCCCGCT-ATCGCC-----------AC-TGTAG-----CTC-GT---CCATCGCC------CCAACACATTCTACTC-TACC------ATCGCATCGTCTTT-----GCCTCGAAAT-----CTCTTGATTCATTAT----GCTGATCAT-CTTTCAATCA-ATAGGAAGCCGCCGAACTCGGAAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTTAG--------T-TTCCTCATTG----------ACA--TCT-CGAAA----TCATCATTCTAACATG--TTG--C-CT--CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCCGGTACTGGTGAGTTCGAGGCTG- Trichoderma_stromaticum CGAGAAGG?AAGC-TCA---GTC----GCCACATTTTTGCA--------TCAAATT--CT-TCATCA---CATTCAATT--GCACCCGACAA---TT--CTGAA--TGGAAT------TCTCCCGTC-T----GCAA--TTTTGCC--------CA-T--C-A----CCCCGCTTT--CGCTTC-TCATTA--CCCCTCCTTT---GCAGCGA----CGCAAA--A---ATTTTTC--G-----CTGTCGT----TTG-G-CTTT-AGTGGGG-GTGCA---C----------------GAG------CAA----CCCCACC-ATT------------------------------------CACCTCTT------CCT----G-TTCTCTCATACC------CATTCGATCC----------TCTGCTCGT----C-GTAT-TACAGTGAT----GCTAACCAT-ATTCCCTTCA-ACAGGAAGCCAATGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCACAAGTACTATGTCACCGTCATTGGTATGT---C---------ATCAT-GTCA---ACG----------CAG------CATCCGC-AAGCCAGTG-TAACAGA---CACC---T--CA-------------------CAGACGCTCCCGGC-------------------------------------------------------------------------------------------------- Trichoderma_surrotundum ------AGTAAGC-TCA---GTC----AACTGATTCCGACT--------CTGATTTCCCC-ATTTCC---TGCTCAATT--GTGACGGACAA---TT--CTCAA--CGGAAT------TATCTTGTC-A----ACA----ATTTGG--------CA-T--C-A----CCCCGCTTT--CACTTC-CCATTACCCCCCTCCTTT---GCAGCGA----CGCAAA--A---AAAATTT--------GCAGCCT----CGA-G-TTTG-AGTGGGG-TCGCT---T----------------GTGCA----CAC----CCCCACT-ACC----------ATTCAC-TGC-TTTTTTTTTTGC---CCTTGACT------GCG----T-GTACCTTGTCAT------CATTCCACGC----------TCTTGATCA----TCTC-TTTTCAGCGAT----ACTAACCAT-CTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTT-C--TGCACGGA-TCTC---GTT----------CCA------TGTTCGC-CAGCCTGTACTAATGCC---AATT---G--GG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-CCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCT-- Trichoderma_thailandicum --GGAAGGTAAGC-TCA---ATC----AAACAATCCGCGTC--------CCATTTC----CACTGCA---AATTCAATT--GTTGCCGACAA---TT--CTGAA--CGGAAT------TCTCTCGTC-A----ACAA---TTCTCC--------CA-T--C-A----CCCCGCTTT--CACTGC-CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTCT--------GCAGCTT----TGG-A-TTTT-AGTGGAG-ATGCT---C----------------CGG------CGA----CCCCACT-ACTGTC--------ATCGC-TGC-----ATTTTTGC---ACTATGCT------GCA----A-CGACC---TCAT------CATTCCACACT---------TTTGAACAT--------CTGTTCAACGAT----GCTAACCAT-CTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATTGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTA-CCATTCACATC-TTTC---AAA----------CGC------TATTCGC-AAACATGTACTAATGCA---AACT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCT-- Trichoderma_thelephoricola CGAGAAGGTAAGC-TCA---TTC----ATCTGATTCCTACT--------CTGATTT--TC-ATTTCA---TGCTCAGTT--GTGACGGACAA---TT--CTCAA--CGGAAT------TATCCTGTC-G----ACA----ATCTTT--------CA-T--C-A----CCCCGCTTT--CACTTC-TCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---ATTTTTT--------GCAGCCT----CGA-A-TTTT-AGTGGGG-TCGGC---T----------------GTG------CAT----CCCCACT-ACC----------ATTCAC-TGC------TTTTTGC---CCTTGACT------GCG----T-GTACCT-GTCAT------CATTCCACGC----------TCTTGATCA----TCTC--TTTCAGCGAT----GCTAACCAT-GTTTCCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTTGAGACTCCCAAGTACTATGTCACCGTCATCGGTATGT---CTT-C--TTCACGGA-TCGC---GTT----------GCC------CATTCTC-CAGCCTGTACTAATGCC---AATT---C--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_theobromicola CGAGAAGGTAAGC-TCATTCTTT-CA-CTGC------------------TTTTTC--CCACGCAT-TTTTGGCACAATT--GTGTCCGACAA---TT--CTGTTTATC----------AGTCTTGTCA-----AT------CTTTTCTCTCTCCCAGCATC-TCA--CCCCGCTTTGC----CC--TTCTA--CCCCTCCTTT---GGCACAG----C-AA----AAAATTTTCTG--G-----CTGCCTT--GTTTG-G-CTTTTAGTGGGG-TGT--AATTTTTTTT-------TGGCAG------CAA----CCCCGCT-ATCGCC-----------AC-TGTCC-----CTC-AT---CCACTG-C------CCAACAGATTTTACTTGCTCA------GTCGTATCGTCTGTT-----CTCAAATTT----CTTTTCGGTTCATTGT----GCTGATCAT-GCTTCAATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTAGGT---TTTCAG----TCCTC-GTGCTACTTG----------ACA--TGT-CAAAA----TCATCAATCTAACATG--TTG--C-TC--TA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCTGACTGCGCTAT-CCTCATTATCGCTGCCGGTACTGGTGAGTTCGAGGC--- Trichoderma_tomentosum -GAGAAGGTAAGC-TTT---ATC----AACTGATTTTCGCC--------TCGAATC--CC-CCTACA---CATTCAATT--GTGCTCGACAA---TT--CTGAA--TAGAAT------TTTCGTGTC-A----ACAA----TTTTT--------CA-C--C-A----CCCCGCTTT--C-------CATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTT--G-----CTGTCTT----TTG-A-TTTT-AGTGGGG-TTCTC---T----------------GTG------TA-----CCCCACT-A------------GCTCAC-TGC------TTTTTCT---GTTTTGCT------CTC----G-CTACCCAGTCGT------CATTCAACGCGC--------TTTGTGTCT----TGTCACTTTCAGCGAT----GCTAACCAC-TTTTTCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCATGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-A--TTCACCAA-CTTC---ATG----------TAT------CAATTGC-AAGTCAGTGCTAACAGA---AGTT---C--CA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_turrialbense -----------------------------------------------------------------------------------------------------------------------TTCGTGTCAA-------------TTTTTTTTTTCATAGT--C-A----CCCCGCTTT------CCCTGCCTA--CCCCTCCTTTGGTACAGACA----TGC-----AAATTTTTTTT--G-----CTGCCTT--GCTAG-G-CTTT-AGTGGGG-GTGCTTCTT-------------GGAGCA------AAC----CCCCACT-ACTACCTGTA---ACGCTC-TGTTACCTGTTGACAC---TCTTCATC------ACCCAATGCATATCATCAAAT--------CTCAATCATCACT----GCTATCCTTC----TCATCTCTTCAGTTGT----ACTGACCAT-TTCCCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTG-ATATTCGCCTT-TTTTTTTTTT----------GAT------ACATTCG-TTTCGAATGCTAATGCC---AACC---TCACA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCA--------------------------------------------------------------------- Trichoderma_velutinum ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_victoriensis T?AGAAGGTTAGTCTAT---TCTAC-TTTTTTTTCCTC-----------TTTCCGTCTTTTGCCAGCACCCAAGCAATT--CTGCAGGACAA--------TTCGCACGAATT------TTCCATGTCAG-----------TTTTGCTTGGGTGTCGGACGA------CCCCGCTTT------CTCTGCCTA--CCCCTCCTTT---GGCGCA-----CACAAGCAAATTTTTTCTTTCTTTTTGCTGCCTT--------G-GATTTTGTGGAG-ACACTCATCAC-----------------------AAA----CCCCGCC-ACCACCCTCGAGTCCAATC-TATGTGACCAATGCAG-----------------CAACACTACAATGCAGTTCAC------TTCTCGTCATTATGCTCCGCCACTGTGCG----TTTCTGGTTCAAGTAT----GCTAACCAT-GATTTGCTCT-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTTATTGGTATGT---ATCCCA----------TGTGCGATTC----------TCA------TCTCAAC-GACTCCACGCTAATTCA---AATG------TG-------------------CAGATGCTCCCGGTCACCGTGACTTCATCAAGAACATGA-TTACTGGTACTTCCCA-GGCC?ACTGCGCTAT-CCTCATTATCGCCGCCGGTACTGGTGAGTTCGA?GCTGG Trichoderma_virens -GAGAAGGTGAGC-TCA---ATC-----AACTGCTTTCGCA--------TTAATTT--CC-CCTTCA---CATTCAATT--GTGCTCGACAA---TT--CTGTT--CAGAAT------CATCGAGGC-A----ACAA---TTTTTT--------CG-T--C-A----CCCCGCTTT--CGTT---CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---ATTTTTT--G-----CTGCCTC----TAGTT-TTTT-AGTGGGG-GTGCA---C----------------CAG------CAA----CCCCACC-ACTA---------CCTCGC-TGC------TCTTTGC---CCTCGTCT------ACC----A-CTTCCCAGTCCT------CATTCAACGA----------TCTGTGTCT----CGTTATTTGCAGCGAT----GCTAACCAC-CGTTCCCTCA-ACAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT----------CTCGTCCC-ATTC---AGC----------CAG------CTCCCGT-AAACCAGTGCTAACCAG---GATC---T--CA-------------------CAGACGCCCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCCAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_virescentiflava --GGAAGGTAAGC-TCA---ATC----AACCGATTCTCGCC--------CCAATTC--CA-TTTCAA---TTTTCAATT--GTGGCCGACAA---TT--CTGAA--CGGAAT------TCTCTTGTC-A----ACAA----TTTCC--------CA-T--C-A----CCCCGCTTT--CACTGC-CCATTA--CCCCTCCTTT---GCAGCGA----CGC-AA--A---TTTTTTC--T-----GCAGCCT----TGA-A-TTTT-AGTGGAG-ATGCA---C----------------CAG------CGA----CCCCACT-ACTGTC--------ATCAC-TGC--------ATTGC---ACTATGCT------GCA----A-CTACC---TCAC------TACTCTACGCT---------TTTGATCAT--------CTTTTCAACGAT----GCTAATCAT-CTTTTCATCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---CTG-C--TTGATAAC-TTTC---ACA----------TTT------CAATCAC-AATTCCGTGCTAATGCA---AACT---T--GA-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACTTCCCA-GGCCGATTGCGCTAT-TCTCATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGG Trichoderma_viride CGAGAAGGTAAGC-TCA---TTT-CA-CTGC-------------------TTTTTCGCTACGCGT-TCATGGCCCAATC--GTGCCCGACAA---TT--CTGTTC-TC----------AGTCTTGTCA-----AC------TTTT---CCCTCGCAGCATC-ACA--CCCCGCTTTGT----CTGCCTCTA--CCCCTCATTT---TGCACAG----CA------AAATTTTTCTG--G-----CAGTCTT--GTTTG-G-CTCTGAGTGGGG-TGTCAATTTTTGT---------TGGCAG------CGA----CCCCGCC-ATCGCC-----------AC-TGTCC-----CTC-AT---CCATCGTC------CCAACACATTGTGCTCATTCA------ATCGCATCGTCTTTT----GCCTCAATTC----CTTTGTGGTTCATTGT----GCTGATCAT-GTTTCAACCA-ATAGGAAGCCGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAGATACTATGTCACCGTCATTGGTATGT---TTTTGG---------TTCCCTCAATG----------ACA--TTT-CGCCA----TCATCATTCTAACGTG--CCACTG-----TG-------------------CAGACGCTCCCGGCCACCGTGATTTCATCAAGAACATGA-TCACTGGTACCTCCCA-GGCTGACTGCGCTAT-CCTGATTATCGCTGCC----------------------- Trichoderma_viridescens CGAGAAGGTAAGC-TCA---TTT-CA-CTGC-------------------TTTTTCACTACGCTT-TCTTGACACAATC--GTGTCCGACAA---TT--CTGTCC-TC----------AGTCTTGACA-----AT----------TTTTTCTCGCGTCGTC-ACA--CCCCGCTCTAC----CT--GTCTA--CCCCTCCTTT---GGCACAG----CA------GAAATTTTCTG--G-----CTGCCTT--GTTTG-G-CTTTTAGTGGGG-GGCCATTTTTTTTTT-------TGGCAA------CAA----CCCCGCT-ATCGCC-----------GT-TGTCC-----CTC-AT---CCCTTGTA------CCAACAATTTGATCTCACTCA------ATCACATCGTCTTCT----GCCTCATGTT----GTCCGTGGTTCATTGT----GCTGATCAT-AATTCAATCA-ATAGGAAGCTGCCGAACTCGGCAAGGGTTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGT---TTTGGT----------TTCCTCATTG----------ACA--CC--TGGAA----TCATTATTCTAACGTG--CCGCTC-----CA-------------------CAGACGCTCCCGGTCACCGTGATTTCATCAAG-------------------------------------------------------------------------------- ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15963] TITLE RPB2; LINK TAXA = Taxa1; DIMENSIONS NCHAR=1063; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_aeruginea -CC-AGCTGTTTCGTGGCATCATGCGGAGGATGAACACCGAGTTGGCCAAC--TATCTGAGACGCTGCGTGGAAGGCAACCGACACTTCAACCTTGCTGTGGGTATCAAGCCCGGCACGCTCTCCAACGGACTGAAATACTCTCTTGCCACTGGAAACTGGGGCGACCAGAAAAAGGCCATGAGCTCGACTGCAGGCGTGTCTCAGGTGCTGAACCGCTACACGTTTGCTTCCACTCTGTCCCACTTGCGTCGTACCAACACACCCATTGGAAGAGATGGCAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGGTTGGTATGCCCGGCCGAGACGCCCGAAGGACAGGCTTGTGGCCTGGTCAAGAACCTATCCTTGATGTGTTACGTCAGTGTCGGCTCCCCCTCGGAACCTCTGATTGAGTTCATGATCAACCGAGGGATGGAGGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCCACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCAAGACCCCAAGCATCTGGTGAACCAGGTTCT-CGACACCCGCCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTGGTACGAGAAATTCGAGATCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTGTTCACCGTTCAGCAAGAGGATGACCCCGAAACGGGAATCAACAAGGGTCATTTGGTCTTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCCGAACCGCCCGAGGATCCAAGCATGAAGATGGGATGGGAGGGCTTGATCAGGGCTGGTGCGGTGGAGTATCTTGACGCCGAGGAAGAGGAGACGTCCATGATTTGCATGACACCGGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATCTCTACCGAAGAGGACATGGGAGATGACCCCAACAAGCGGTT-AAAGACAAAGACCAATCCGACCACTCACATGTACACTCATTGCGAGATTCACCCGAGCATGATTCTGGGCATTTGTGCTAGTATCATTCCTTT Hypocrea_alcalifuscescens ---------------------------------AACACCGAGCTGGCCAAC--TACCTGAGACGATGCGTGGAGGGCAACCGGCACTTTAACCTTGCTGTTGGCATCAAGCCTGGCACGCTGTCCAACGGTCTGAAGTACTCGCTAGCCACCGGCAACTGGGGCGACCAGAAGAAGGCGATGAGTTCAACCGCGGGCGTGTCTCAGGTGCTCAACCGGTACACCTTTGCTTCGACTCTGTCGCATTTGCGACGTACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCAAAGCCGCGACAACTCCACAACACGCACTGGGGCCTGGTCTGTCCTGCCGAGACCCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTGTCGCTGATGTGTTACGTCAGCGTCGGGTCTCCTTCCGAGCCCCTGATTGAGTTCATGATTAACAGGGGCATGGAAGTCGTCGAAGAGTACGAGCCTCTTCGGTATCCCCAT-CCACGAAGATCTTTGTCAACGGCGTCTGGGTCGGAGTTCATCAGGACCCCAAGCACCTGGTCAACCAGGTCTT-GGACACGCGTCGCAAATCCTACCTGCAGTATGAGGTCTCTCTCATTCGAGACATCCGAGACCAGGAGTTCAAAATCTTCTCTGA-TGCCGGCCGCGTCATGCGCCCCGTATTGACTGTGCAGCAAGAGGATGACCCGGACACGGGCATCAACAAGGGCCACCTAGTCTTGACCAAAGACTTGGTCAACCGGCTGGCCAAGGAGCAGGCCGAGCGCCCCGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGCTGATCAGGGCCGGCGCAGTCGAGTATCTCGATGCCGAAGAAGAAGAGACATCGATGATTTGCATGACGCCCGAGGACCTTGAACTTTATCGTCAGCAGAAAGCTGGTGAGGCTGTCGACGAGGATCCCGGTGATGATCCCAACAAGAGGCT-CAAGACGAAGACGAATCCAACCACTCACATGTACACCCACTGCGAGATTCACCCTAGCATGATCCTAGGTATCTGCGCCAGCATCATAC?GTT Hypocrea_alni GCC-AGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAAC--TATCTGAGACGGTGCGTTGAAGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACTCTTTCAAACGGATTGAAGTATTCTCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAATTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-AGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCCGAGCCTCCGGAAGACCCCAGCATGAAGATGGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAGGATCTCGAAATGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-CAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTAGGCATTTGTGCTAGTATCATTCCTTT Hypocrea_alutacea GCC-AGTTGTTCCGTGGTATCATGCGAAGGATGAATACTGAGTTGGCCAAC--TACCTGAGACGGTGTGTTGAGGGTAACCGACATTTCAACCTCGCTGTTGGTATTAAACCCGGCACGCTTTCCAATGGGTTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCTATGAGCTCGACAGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACACATTGGGGCTTGGTCTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCTGAGCCTCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCACTGCGGTATCCCCATGCCACAAAGATTTTTGTGAACGGTGTCTGGGTTGGCATTCACCAGGATCCCAAGCATCTGGTGAACCAGGTGTT-GGACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCTGA-CGCAGGTCGTGTTATGCGTCCTGTTTTTACTGTGCAGCAAGAAGATGATCCGGAAACGGGCATTAACAAAGGCCACCTGGTCTTGACGAAGGATCTCGTCAACAGACTTGCAAAGGAGCAGGTCGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCAGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGACATTGGAGATGATCCAAACAACCAACT-CAAGACTAAGACGAACCCACCAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_americana ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_andinensis GCCAAGCTGTTCCGTGGCATCATGCGAAGAATGAACACCGAGCTAGCCAAC--TATCTGAGACGGTGCGTGGAGGGCAACCGACACTTCAATCTCGCCGTCGGCATCAAGCCCGGCACGCTTTCAAACGGCTTGAAGTATTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCTGGAGTGTCTCAGGTGCTCAACCGTTACACGTTTGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACCCACTGGGGTCTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTTGTCAAGAACCTGTCACTGATGTGTTACGTCAGTGTCGGCTCCCCATCAGAGCCGTTGATTGAGTTCATGATCAATAGAGGCATGGAAGTGGTCGAGGAATACGAGCCGCTGCGTTATCCTCACGCTACCAAGATCTTCGTCAACGGTGTCTGGGTGGGTATCCACCAGGACCCCAAGCATCTGGTTCAACAGGTCGT-CGACACTCGTCGCAAATCCTACCTTCAGTACGAGGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAGTTCAAGATCTTTTCCGA-CGCAGGCCGCGTCATGCGACCTGTCTTTACCGTCCAGCAAGAAGACGAAGCTGAGAATGGCATTCCCAAGGGCCACCTGGTACTGACCAAAGACCTGGTTAATAAGTTGGCCGAAGAGCAGGCCGATCCTCCAGAAGATCCAAGCATGAAGATTGGATGGGAGGGACTCATCAGGGCTGGCGCCGTTGAATATCTCGACGCCGAGGAGGAGGAGACGGCCATGATTTGCATGACTCCCGAGGATCTCGAGCTGTACCGTGCGCAGAAGGCAGGTATTGCCACCGAAGAGGACGTTGGTGACGATCCGAACAAGCGACT-CAAGACGAGGACAAACCCAACGACGCACATGTACACGCACTGTGAGATTCATCCAAGCATGATCTTGGGTATCTGTGCGAGCATCATTCCTTT Hypocrea_avellanea --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGGTACACTTTTGCCTCGACGCTATCACATTTGCGCCGTACCAACACGCCCATCGGCAGAGACGGCAAGTTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGCTTGGTCTGTCCCGCCGAGACACCCGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCCTCGGAGCCCCTGATCGAGTTCATGATCAACAGAGGCATGGATGTCGTGGAAGAGTACGAGCCGTTGCGGTATCCCCACGCCACAAAGATCTTTGTGAACGGTGTCTGGGTGGGAGTCCACCAGGACCCCAAGCATCTGGTGAACCAAGTTCT-GGACACGCGTCGCAAATCCTACCTGCAGTACGAGGTCTCCCTGATTAGAGACATTCGTGACCAGGAGTTCAAAATCTTCTCCGA-CGCAGGTCGGGTCATGCGTCCTGTCTTTACCGTTCAGCAGGAGGATGACCCGGAAACGGGCATCAACAAGGGCCATTTGGTTTTGACCAAGGATCT?GTCAACAGACTGGCAAAGGAGCAGGCTGAGCCTTCGGAAGACCCGAGCACAAAGGTTGGATGGGAGGGTTTAATTAGAGCCGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGACTATGATTTGCATGACGCCGGAGGACCTTGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACCGATGAAGACCCGGGTGATGACCCGAACAAGCGACT-CAAAACCAAGACGAACCCGACCACGCACATGTACACTCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_chionea -----------------------------------------------------------------TGTGTTGAGGGCAACCGCCACTTCAACCTCGCTGTTGGCATTAAGCCCGGCACACTCTCCAACGGACTAAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCTATGAGTTCGACTGCGGGTGTTTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTCGGAATTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTTTCTCTGATCAGGGAAATTCGAGACCAAGAGTTCAAAATCTTCTCTGA-TGCCGGCCGTGTGATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACGCCGGAAGATCTTGAGCTCTATCGTCTTCAGAAGGCCGGCAT---------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_crystalligena ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_dacrymycella GGCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAAC--TATTTGAGACGGTGCGTTGAGGGCAACCGACACTTTAACCTTGCTGTCGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACGGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCCATCGGAAGAGACGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAGGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTCAACGGCGTCTGGGTTGGGGTTCACCAAGACCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGAGACCGGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAATCGATTGGCCAAGGAGCAGGCTGAGCCCCCGGAAGACCCCGGCATGAAGGTCGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTTGAGCTGTACCGTCTTCAGAAGGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACGAAGACGAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATATTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_danica GCT-AGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGCTGGCCAAC--TACCTGAGACGCTGCGTCGAAGGCAACCGACACTTCAACCTTGCCGTCGGTATCAAGCCCGGCACGCTATCCAACGGGTTGAAGTACTCTCTCGCCACCGGAAATTGGGGCGATCAGAAAAAGGCCATGAGCTCAACGGCGGGCGTGTCTCAGGTGCTCAACCGCTACACGTTCGCTTCCACCCTGTCACATTTGCGTCGCACCAACACGCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTACACAACACGCATTGGGGCTTGGTATGCCCAGCCGAGACGCCCGAAGGACAAGCTTGCGGTCTGGTCAAAAACCTGTCATTGATGTGTTATGTCAGTGTAGGTTCCCCCTCGGAACCTCTGATCGAGTTCATGATCAACCGAGGGATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATACCCTCATGCGACCAAGATTTTCGTCAATGGTGTCTGGGTTGGAGTTCACCAAGACCCCAAGCATCTGGTCAACCAGGTTCT-GGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTGTCTCTCGTGAGAGAGATCCGAGACCAGGAATTCAAAATCTTTTCGGA-CGCAGGCCGTGTCATGCGACCGGTATATACCGTTCAGCAAGAAGACGACCCCGATACGGGTATCAACAAGGGTCATTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCAAAGGAGCAGGCCGAACCCCCGGAGGATCCAAGCCTCAAGATTGGATGGGAGGGCTTGATCAGGGCCGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATCTCCACCGACGAGGATATTGGAGATGATCCGAACAAGCGATT-AAAGACGAGGACCAATCCGACAACGCACATGTACACTCATTGCGAGATTCACCCAAGCATGATTTTGGGCATATGCGCCAGTATCATTCCCTT Hypocrea_decipiens ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_delicatula GCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACGGAATTGGCCAAC--TACCTGAGACGGTGTGTGGAGGGCAACCGACACTTCAACCTCGCCGTGGGTATCAAGCCCGGCACGCTCTCCAACGGACTGAAGTATTCACTCGCCACTGGAAATTGGGGCGATCAGAAGAAGGCGATGAGCTCGACCGCGGGCGTGTCCCAGGTGCTCAACCGCTACACTTTCGCCTCGACGCTATCGCATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGTTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGCTTGGTCTGTCCTGCCGAGACGCCTGAGGGTCAGGCTTGCGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGATCTCCCTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAAGTTGTTGAAGAGTATGAGCCGCTGCGGTATCCTCACGCCACCAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCAAGATCCTAAACACCTGGTGAACCAGGTTCT-GGACACCCGTCGCAAATCTTACCTGCAGTACGAAGTCTCCCTGATCAGAGACATTCGTGACCAGGAGTTCAAGATCTTCTCCGA-CGCAGGTCGCGTCATGCGTCCTGTCTTTACCGTCCAGCAGGAGGATGATCCCGACACGGGCATTGACAAGGGTCATCTGGTTTTGACCAAGGATCTGGTGAACAGACTGGCTAAGGAACAGGCTGAGCCTCCGGAAGACCCGAGCATGAAAGTTGGATGGGAGGGGTTAATCAGAGCCGGTGCGGTTGAATATCTCGATGCAGAGGAAGAAGAGACGTCTATGATTTGCATGACGCCAGAGGATCTTGAGCTCTATCGTCTCCAGAAAGCTGGTCTCTCTACTGACGAAGACCCGGGCGATGATCCGAACAAGCGACT-CAAGACCAAGACGAACCCGACGACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATTTTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_epimyces ------------------------------------------TTGGCCAAC--TATCTGAGACGGTGCGTTGAAGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTCTCAAACGGATTGAAGTATTCTCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACTCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCAAGACCCGAAGCACTTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-CAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCAACCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_eucorticioides ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_flaviconidia GCCAAGCTGTTCCGTGGTATCATGCGCAGAATCAATACAGAGTTGGCCAAC--TCCCTGAGACGATGTGTTGAGGGTAATCGCCACTTCAACCTTGCTGTGGGCATCAAGCCCGGCACACTCTCCAACGGATTGAAGTATTCACTTGCCACCGGAAATTGGGGTGACCAGAAGAAGGCCATGAGCTCGACTGCAGGCGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCTCATCTGCGTCGTACAAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTACACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAGTATGAACCGCTGAGAAATCCCCATGCGACAAAGATCTTTGTGAATGGAGTTTGGGTTGGAATCCACCAAGACCCCAAGCATCTTGTGAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGCCGTGTTATGCGTCCCGTCTTTACTGTACAACAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGACCTTGTCAACAGACTGGCTAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGGCCATGATTTGCATGACACCGGAGGATCTTGAATTTTATCGTCTTCAGAAAGCTGGCATATCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACA-GTACACGCA------------------------------------------------------ Hypocrea_fomiticola GCTAGGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGCTGGCCAAC--TATCTAAGACGATGCGTGGAGGGCAACCGCCATTTTAACCTTGCTGTTGGTATCAAGCCCGGTACGCTTTCAAACGGGTTGAAGTACTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAACTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCTTTGATGTGCTACGTCAGTGTCGGGTCCCCCTCCGAACCCTTGATTGAGTTCATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTCCACCAAGATCCTAAGCATCTAGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCGGGCCGTGTTATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAGACGGGCATTAACAAGGGCCACTTGGTATTGACCAAGGAACTCGTCAACAAACTGGCGAAAGAGCAGGCTGAACCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTGCTACTGAGGAGGACGTGGGAGAAAATCCGAACCAGCGACT-CAAGACAAAGACGAATCCAACAACTCACACGTACACACATTGTGAGATTCATCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_leucopus GCC-AGCTGTTCCGTGGCATCATGCGAAGGATGAATACCGAACTGGCCAAC--TACCTGAGACGATGCGTAGAGGGCAACCGGCATTTCAACCTTGCCGTTGGTATCAAACCCGGCACGCTTTCCAACGGGTTGAAGTATTCACTTGCCACTGGGAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCACAGGTGCTTAACCGTTACACTTTTGCCTCGACGCTATCGCATCTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGGCAGCTTCATAACACCCATTGGGGTCTTGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTTCTCCGTCCGAGCCCCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTACGAGCCACTGCGGTATCCGCACGCAACCAAGATCTTCGTGAACGGCGTCTGGGTCGGAGTTCATCAGGATCCCAAGCATCTGGTGAACCAAGTCTT-GGACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAGGAATTCAAAATCTTCTCCGA-CGCGGGCCGTGTTATGCGTCCTGTTTTCACTGTGCAGCAGGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGATCTCGTCAATAGACTGGCAAAGGAGCAGGCTGAGCCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCCGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAAGACATCGGAGATGATCCAAACAAGCGTCT-CAAGACCAAAACAAACCCGACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATCCCTTT Hypocrea_lutea GCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAATACCGAGTTGGCCAAC--TACCTGAGACGATGTGTGGAGGGTAACCGACACTTCAACCTTGCCGTCGGTATCAAGCCCGGCACGCTTTCAAACGGCTTGAAGTACTCCCTCGCCACTGGAAACTGGGGCGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACTTTTGCTTCGACCCTGTCGCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAATTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCTGAGACACCCGAGGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCTCTGATGTGTTATGTCAGTGTTGGATCTCCCTCTGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTGGAAGAATACGAGCCTCTGCGATATCCTCATGCCACAAAGATCTTTGTAAACGGTGTCTGGGTTGGAGTTCACCAGGACCCTAAGCATCTGGTGAACCAAGTTCT-GGACACTCGTCGCAAATCCTATCTCCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGTCCCGTCTTCACTGTCCAGCAGGAGGACGACCCAGACACGGGCATTAACAAGGGCCACTTGGTGCTGACGAAAGAGCTTGTCAACAGATTGGCAAAGGAGCAGGCGGAACCCCCAGAAGACCCGAGCATGAAGCTCGGATGGGAAGGGCTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGGCCATGATTTGCATGACCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAGGCTGGCATTGCTACAGAAGAAGACATAGGAGATGATCCGAACAAGCGACT-CAAGACCAAGACGAATCCTACGACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATCCTTTC Hypocrea_megalocitrina --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCTATGAGTTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACTTTTGCTTCAACACTGTCACATTTACGTCGTACCAACACACCCATCGGAAGAGATGGCAAATTGGCAAAGCCGCGACAACTTCATAACACGCACTGGGGCTTGGTCTGCCCAGCTGAGACTCCTGAGGGGCAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTATGTCAGTGTCGGGTCTCCCTCCGAACCTTTGATCGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTATGAACCGCTGCGATATCCTCATGCCACAAAGATCTTTGTGAACGGCGTCTGGGTCGGAGTCCATCAGGACCCCAAGCACCTTGTGAATCAGGTTCT-GGATACTCGTCGCAAATCCTATCTACAGTATGAAGTCTCCCTGATCAGAGACATTCGAGATCAGGAATTCAAAATCTTCTCTGA-TGCGGGTCGTGTTATGCGGCCTGTGTTTACCGTTCAGCAGGAGGATGACCCAGAAACGGGCATTAACAAAGGCCACTTGGTTTTGACAAAGGAACTCGTCAATAGGCTTGCAAAGGAGCAGGCTGAGCCCCCAGAAGACCCGGGCATGAAGATTGGATGGGAGGGCTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACATCTATGATTTGCATGACCCCGGAGGATCTTGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACGGAAGAAGATATGGGAGACGATCCAAACAAGCGACT-CAAGACAAAGACGAATCCAACAACTCACATGTACACGCACTGTGAGATTCACCCAAGCATGATCTTAGGTATCTGTGC?AGTATCATTCCTTT Hypocrea_microcitrina ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_moravica GCTAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAAT--TATCTGAGACGGTGCGTAGAGGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGTACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTCGCTTCGACCTTGTCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCATAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAGGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCGTTGATGTGCTACGTCAGCGTCGGGTCTCCTTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAGGTCGTGGAAGAGTATGAGCCGCTGCGATATCCTCACGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTACACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGCCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGA-TGCAGGCCGTGTTATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATTAACAAGGGCCACTTGGTATTGACCAAAGAACTCGTCAACAGACTGGCGAAAGAGCAGGCTGAGCCTCCAGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACACCAGAGGACCTCGAGCTGTATCGTCTCCAGAAAGCAGGTATTGCGACAGAGGAGGACATAGGAGACAACCCGAACCAGCGACT-CAAGACAAAGACCAATCCAACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_neorufa GCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAAGGTAACCGCCATTTCAACCTTGCGGTTGGCATCAAGCCCGGCACGCTTTCCAATGGATTGAAATATTCACTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCGCAGGTGCTTAACCGTTACACTTTTGCTTCAACACTATCCCATTTGCGTCGTACCAATACCCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCCCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAAGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGATCCCAAGCATTTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCTTATCTGCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTAATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGATCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCCCCAGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGTCTATGATCTGCATGACGCCGGAGGATCTTGAACTCTATCGTCTTCAGAAAGCTGGCATTGCCACAGATGAAGACATAGGAGACGATCCAAACAAGCGTCT-CAAAACCAAGACAAATCCAACCACACACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATCCCTTT Hypocrea_nigrovirens --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAAAAGGCCATGAGCTCGACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCATAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAATCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACCGGGGTATGGAAGTCGTTGAAGAGTATGAGCCGTTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTACATCAAGACCCCAAGCATCTGGTGAACCAGGTTCT-GGACACCCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCCCTGGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCCGTGTTTACCGTCCAGCAGGAAGATGACCCTGAAACAGGCATCAACAAGGGACACTTGGTATTGACCAAGGAGCTTGTCAACAGGCTGGCCAAGGAACAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCAGTCGAATACCTCGACGCCGAGGAAGAGGAGACGTCCATGATTTGTATGACACCAGAGGATCTCGAGCTGTATCGTCTGCAAAAGGCCGGTATTTCTACCGAAGAAGACATGGGAGATGATCCGAACAAGCGACT-CAAGACGAAGACAAATCCTACAACTCACATGTACACCCATTGTGAGATTCACCCAAGTATGATCCTGGGTATCTGTGCTAGTA---------- Hypocrea_nybergiana GCC-AGCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAAC--TACCTGAGACGATGTGTGGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATCAAACCCGGTACGCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCGCGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACTTTTGCCTCGACACTATCACATTTGCGTCGTACCAACACGCCCATCGGGAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCATAACACCCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTATGTCAGTGTTGGTTCTCCCTCCGAGCCCCTGATTGAGTTTATGATCAACAGAGGCATGGAAGTCGTCGAGGAGTACGAGCCACTGCGATATCCCCACGCAACAAAGATCTTTGTGAACGGTGTCTGGGTCGGAGTTCACCAAGATCCCAAGCATTTGGTGAACCAAGTTCT-GGACACTCGTCGCAAATCTTATCTACAGTACGAAGTGTCTCTGATCAGAGACATTCGTGAACAGGAATTCAAAATCTTCTCTGA-CGCGGGCCGTGTCATGCGCCCTTGTTTCACTGTACAGCAGGAGGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGATCTCGTTAATAGGCTGGCAAAGGAGCAGGCCGAGCCTCCAGAAGACCCGAGCATGAAGGTTGGATGGGAGGGGTTAATCAGGGCCGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGGCCCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTGCCACGGAAGAAGACGTGGGAGATGACCCGAACAAGCGAAT-CAAGACTAGAACGAACCCGACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_parepimyces GCC-AGCTGTTCCGTGGCATCATGAGAAGGATGAACACCGAAGTGGCCAAC--TATCTGAGACGGTGCGTTGAAGGTAACCGACACTTCAACCTCGCTGTTGGTATCAAGCCCGGCACTCTTTCAAACGGATTGAAGTATTCTCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCCACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGGCTGGTCAAGAACTTATCTTTGATGTGTTACGTCAGTGTCGGTTCTCCATCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCTCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCAGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCAGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACT-CAAGACCAAGACAAACCCCACAACTCACATGTATACCCATTGCGAGATTCACCCAAGTATGATCTTGGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_parmastoi ---------------------------------AACACTGAATTGGCTAAT--TACTTGAGGCGATGTGTGGAAGGCAACCGGCATTTCAATCTTGCTGTCGGCATTAAGCCCGGCACGCTTTCAAACGGCTTGAAGTATTCGCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTATCCCAGGTGCTTAACCGGTACACTTTCGCTTCAACCCTGTCACATTTGCGGCGTACCAACACACCCATTGGAAGAGATGGCAAGCTGGCAAAACCCCGACAGCTTCACAATACTCACTGGGGCTTGGTCTGTCCAGCCGAGACTCCCGAAGGGCAGGCTTGTGGTCTGGTGAAAAACCTGTCCCTGATGTGCTACGTCAGTGTCGGATCCCCCTCCGAGCCTCTGATAGAATTCATGATCAACAGAGGTATGGAAGTTGTTGAGGAATACGAACCTCTGCGCTACCCTCACGCTACCAAGATTTTTGTGAACGGTGTTTGGGTTGGAGTCCATCAAGACCCTAAGCATCTTGTGAATCAGGTTTT-GGACACTCGTCGCAAATCCTATTTACAGTACGAAGTCTCTCTTATCAGAGATATCCGAGATCAGGAGTTCAAAATCTTCTCTGA-CGCGGGCCGTGTTATGCGTCCCGTGTTCACTGTTCAGCAAGAGGACGATGCGGAGACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGAGCTGGTAAATAGGCTGGCCAAGGAGCAGGCTGAACCTCCGGAGGACCCGTCCATGAAGATCGGATGGGAAGGATTGATTAGGGCTGGCGCAGTTGAATACCTCGATGCCGAGGAAGAAGAGACATCCATGATCTGCATGACACCGGAGGACCTCGAGTTATATCGTCTTCAGAAAGCTGGTATCGCTACGAACGAGGATATGGGAGATGATCCGAACAAGCGACT-CAAGACAAAGACGAATCCAACGACTCACATGTATACGCACTGTGAGATTCATCCCAGCATGATTTTGGGCATCTGTGCTAGTATCATCCCTTT Hypocrea_patella ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_phyllostachydis --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTTTCCCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTAATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACAAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTACAGTACGAAGTCTCTCTCATCAGAGAAATTCGAGATCAGGAATTCAAAATCTTTTCTGA-CGCGGGCCGTGTCATGCGACCTGTATTCACCGTTCAGCAAGAAGATGACCCCGAAACGGGCATCAACAAGGGCCACTTGGTCTTGACCAAGGAGCTCGTCAACAGGCTGGCTAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCCTAAAGATTGGATGGGAGGGGTTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAGGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGCCTTCAGAAAGCTGGTATTTCCACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-CAAGACTAAGACGAATCCAACGACTCACATGTACACCCACTGTGAGATTCACCCAAGTATGATCTTGGGCATCTGCGCTAGTATCATTCCTTT Hypocrea_pillulifera --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAAAAGGCAATGAGCTCAACCGCAGGTGTCTCACAGGTGCTAAACCGTTATACTTTTGCCTCGACGCTATCACATTTGCGCCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGTCCGGCCGAGACACCTGAGGGACAGGCCTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCCTCCGAGCCCCTGATTGAGTTTATGATCAACCGAGGTATGGAAGTCGTTGAGGAATACGAGCCGCTGCGGTATCCCCATGCCACGAAGATCTTTGTGAACGGTGTCTGGGTTGGAATCCACCAGGATCCCAAGCATCTGGTGAACCAAGTTTT-GGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCTCTGATCAGAGAAATCCGTGACCAGGAATTCAAAATCTTCTCTGA-CGCAGGTCGTGTTATGCGCCCTGTTTTCACTGTACAGCAAGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACCTGGTATTGACGAAGGATCTCGTCAACAGACTAGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTAGGATGGGAGGGATTAATTAGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTAGAACTATATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAAGACATGGGAGATGATCCAAACAAGCGACT-CAAGACAAAGACGAATCCAACAACTCACATGTACACGCATTGCGAAATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_placentula GCC-AGCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGACATTTCAATCTTGCTGTTGGTATTAAACCCGGCACCCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGCTACACTTTTGCTTCAACACTATCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTAGCGAAGCCTCGGCAGCTTCACAACACACATTGGGGTTTGGTCTGCCCAGCCGAGACGCCTGAAGGACAGGCTTGTGGCCTGGTCAAAAATTTGTCTTTGATGTGCTATGTCAGTGTCGGGTCTCCCTCCGAGCCCTTGATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCACTGCGGTATCCCCATGCCACAAAGATCTTTGTGAACGGCGTCTGGGTTGGAATTCACCAGGATCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAGGAATTCAAAATCTTCTCTGA-CGCAGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCAGAAACGGGCATCAACAAAGGCCACCTGGTCTTGACGAAAGATCTCGTCAATAGGCTGGCAAAGGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTTGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACACCGGAGGATCTCGAACTCTATCGTCTTCAGAAAGCTGGCATTGCCACAGAAGAGGACATCGGAGATGATCCAAACAAGCGACT-CAAGACTAAGACAAATCCAACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_protopulvinata --------------------------------------------------------------------------------------------------------ATTAAACCCGGCACGCTTTCCAACGGCTTGAAGTATTCTCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCGCGACAACTGCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAATTTGTCCCTGATGTGCTATGTGAGTGTCGGATCTCCCTCCGAGCCTCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCAGGATCCCAAACATCTCGTGAACCAAGTTCT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTGTCTCTCATCAGAGACATCCGAGACCAGGAATTTAAAATCTTCTCTGA-CGCAGGTCGTGTTATGCGGCCTGTCTTTACAGTCCAGCAGGAAGATGACCCGGACACGGGCATCAACAAGGGTCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAGGCCGAACCTCCAGAAGACCCGAGCCTGAAACTTGGTTGGGAGGGCTTAATTAGAGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAAGATCTTGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACGGATGAAGACATAGGAGATGATCCGAATAAGCGACT-CAAGACAAAGACGAATCCAACGACTCACATGTACACGCATTGTGAAATCCACCCCAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_pseudostraminea --------------------------------------------------------------------------------------------------------ATTAAACCTGGCACGCTTTCCAACGGCTTGAAGTACTCGCTTGCCACTGGCAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACCTTTGCTTCTACTCTATCACATTTGCGTCGTACCAACACACCCATCGGACGAGACGGCAAGCTGGCAAAGCCACGACAACTGCACAACACGCATTGGGGCCTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGCTTAGTCAAAAATTTGTCTCTAATGTGTTATGTCAGTGTCGGATCTCCCTCCGAGCCCCTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCCACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCAGGATCCCAAACATCTCGTGAACCAAGTTCT-GGATACTCGTCGTAAATCCTACCTACAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGA-CGCGGGTCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAAGATGACCCGGATACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAACAGGCTGAACCCCCAGAAGACCCGAGCCTGAAACTTGGTTGGGAAGGCTTAATTAGGGCTGGTGCGGTTGAATATCTTGATGCAGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCTGGCATTGCCACGGAAGAAGACATGGGAGACGATCCGAATAAGCGACT-CAAGACCAAGACGAATCCAACAACTCACATGTATACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_psychrophila --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTATACTTTTGCTTCAACGCTGTCACATTTACGTCGTACCAACACGCCCATCGGGAGAGATGGTAAATTGGCAAAGCCTCGACAGCTTCATAACACGCATTGGGGTTTGGTCTGTCCAGCCGAGACTCCTGAGGGACAGGCTTGTGGCTTGGTCAAAAACTTATCGTTGATGTGCTATGTCAGTGTCGGGTCTCCATCTGAACCTCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCACTGCGATACCCTCACGCCACCAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAGGACCCCAAGCATCTCGTGAACCAAGTTCT-GGACACTCGTCGCAAATCTTATCTACAGTACGAAGTCTCTCTAATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCCGA-CGCAGGCCGTGTTATGCGGCCTGTGTTTACAGTTCAGCAAGAGGATGACCCAGAAACGGGCATCAACAAGGGCCACTTGGTTTTAACAAAGGAACTGGTCAATAGGATTGCAAAGGAGCAGGCTGAGCCTCCGGAAGACGCAAGCGCGAAGATTGGTTGGGAGGGTTTAATTAGGGCTGGTGCTGTTGAGTATCTTGACGCCGAGGAAGAAGAGACATCCATGATTTGCATGACTCCGGAGGATCTTGAGCTTTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGATTTGGGAGACGATCCAAATAAGCGACT-CAAGACAAAGACAAATCCAACAACCCACATGTACACCCACTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_pulvinata --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAACACGCCCATTGGACGAGACGGCAAGTTGGCAAAGCCCCGACAACTGCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAGAATTTGTCTCTGATGTGCTATGTGAGTGTCGGATCCCCCTCCGAGCCT?TGATCGAGTTCATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTATGAGCCACTGCGGTATCCTCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTCCATCAGGATCCCAAACATCTCGTGAACCAAGTTCT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTGTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTCTCTGA-CGCAGGTCGTGTTATGCGGCCTGTCTTTACAGTCCAGCAGGAAGATGACCCGGACACGGGCATTAACAAGGGTCACTTGGTCTTGACCAAGAGCCTCGTCAATCAGCTTGCGAAGGAGCAGGCCGAACCTCCAGAAGACCCGAGCCAGAAACTGGGTTGGGAGGGCTTAATTAGAGCTGGTGCGGTTGAATATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAAGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACAGATGAAGACATAGGAGATGATCCGAATAAGCGACT-CAAGACAAAGACGAATCCAACGACTCACATGTACACGCATTGTGAAATACACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_rodmanii GCCAAGCTGTTCCGTGGTATTATGCGAAGGATGAACACCGAGTTGGCCAAC--TACCTGAGACGATGTGTAGAGGGCAACCGGCATTTCAACCTTGCTGTGGGCATTAAACCCGGTACGCTTTCAAACGGATTGAAGTATTCACTTGCCACTGGTAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGTTACACTTTTGCTTCTACCCTATCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGTTGGCGAAGCCTCGACAGCTTCATAACACGCACTGGGGTCTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCCTGTGGCTTGGTCAAAAACTTGTCGTTGATGTGCTACGTCAGTGTTGGATCTCCTTCCGAACCCCTGATCGA-TTTATGATCAACAGAGGCATGGAGGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACAAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCAGGATCCCAAGCATCTGGTGAACCAAGTCCT-GGACACTCGTCGCAAGTCCTATCTACAGTATGAAGTCTCTCTGATCAGGGACATTCGTGACCAGGAATTCAAAATCTTCTCCGA-CGCAGGCCGTGTTATGCGGCCTGTCTTTACTGTTCAGCAAGAAGACGACCCAGAAACGGGTATCAACAAGGGCCATTTAGTTTTGACGAAGGAGCTCGTCAACAGACTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGGTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCTGAAGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGACATGGGAGATGATCCAAACAAGCGACT-CAAGACCAAGACGAATCCGACGACTCACATGTACACGCATTGCGAGATTCACCCAAGCATGATCTTAGGCATTTGTGCTAGTATCATTCCTTT Hypocrea_semiorbis GCTAAGCTGTTCCGTGGTATCATGCGAAGAATGAACACCGAGTTGGCCAAC--TATCTGAGACGATGCGTAGAGGGCAACCGGCACTTCAACCTTGCTGTTGGTATCAAACCCGGTACCCTTTCAAACGGATTGAAGTACTCTCTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCATGAGTTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTATACGTTCGCTTCGACCCTATCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCTGCCGAGACACCCGAAGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAGGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCTCTCATCAGAGAGATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTTATGCGACCTGTCTTTACTGTTCAGCAAGAAGATGACCCGGAAACTGGCATTAACAAGGGCCACTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCGAAAGAGCAGGCTGAACCTCCAGAAGACCTGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAACTATATCGTCTTCAGAAAGCTGGTGTTGCTACTGAAGAAGACATATTAGAAAACCCGAACCAGCGACT-CAAGACAAAGACGAATCCAACAACTCACATGTACACACATTGTGAGAT--------------------------------------------- Hypocrea_seppoi GCC-AGCTGTTCCGTGGCATCATGCGAAGGATGAATACTGAATTGGCCAAC--TACCTGAGACGATGTGTAGAGGGTAACCGACATTTCAACCTTGCTGTTGGTATCAAACCCGGCACGCTTTCCAACGGGTTGAAGTATTCACTTGCCACCGGAAACTGGGGTGATCAGAAGAAGGCCGCGAGCTCGACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACTTTTGCCTCGACGCTATCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCATAATACCCATTGGGGTTTGGTCTGTCCGGCCGAGACACCAGAAGGACAGGCTTGTGGTCTGGTAAAAAACCTGTCTTTGATGTGCTACGTCAGTGTTGGTTCTCCCTCCGAGCCCCTGATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTGGAAGAGTACGAGCCACTGCGGTATCCCCACGCAACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGATCCCAAGCATTTGGTGAACCAAGTTCT-GGACACTCGTCGCAAATCCTATCTACAATACGAAGTCTCCCTGATCAGAGACATTCGTGAGCAGGAATTCAAAATCTTCTCTGA-CGCAGGCCGTGTTATGCGTCCTGTTTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGCATTAACAAAGGCCACTTGGTCTTGACGAAGGAACTCGTCAATAGACTGGCAAAGGAGCAGGCTGAGCCTCCAGAAGATCCGAGTATGAAGGTTGGATGGGAGGGGTTAATTAGGGCCGGTACGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATTTGCATGACCCCGGAGGATCTCGAGCTTTATCGTCTCCAGAAAGCTGGCATTGCCACAGAAGACGACATAGGAGATGATCCAAACAAGCGAAT-CAAGACTAAAACGAACCCGACAACTCACATGTACACTCATTGTGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_spinulosa GCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAGTTGGCCAAC--TACCTGAGACGCTGCGTCGAAGGCAACCGACACTTCAACCTTGCCGTTGGTATCAAGCCGGGCACGCTATCCAACGGATTGAAGTACTCTCTCGCCACCGGAAACTGGGGAGATCAGAAAAAGGCCATGAGCTCAACGGCAGGCGTGTCGCAGGTGCTTAACCGCTACACGTTTGCTTCCACTCTGTCGCATTTGCGTCGCACCAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTATGCCCAGCCGAGACGCCTGAAGGACAAGCTTGCGGTCTGGTCAAGAACCTGTCATTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATACCCTCATGCGACCAAGATTTTCGTCAACGGTGTCTGGGTTGGAGTTCACCAAGACCCCAAGCATCTAGTCAACCAGGTTCT-GGACACTCGCCGCAAGTCTTATCTGCAATACGAAGTCTCTCTCGTAAGAGAAATCCGAGATCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTTTTTACTGTTCAGCAAGAAGATGACCCCGAAACGGGTATCAACAAGGGTCATTTGGTATTGACCAAGGAACTCGTCAACAGGCTGGCAAAAGAACAGGCCGACCCCCCCGAGGATCCAAGCATGAAGACTGGATGGGAGGGCTTGATCACGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATTTCTACCGATGAGGACATTGGAGATGATCCGAACAAGCGATT-AAAGACAAAGACCAATCCGACAACGCACATGTACACCCACTGCGAGATTCATCCAAGCATGATTTTGGGTATCTGCGCTAGTATTATTCCCTT Hypocrea_straminella --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACTCTGTCACATTTACGTCGTACCAACACTCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAATACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGCTCTCCTTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGTTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAGTTCAAGATCTTTTCTGA-CGCAGGTCGTGTCATGCGACCTGTCTTCACTGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTTGTATTGACCAAGGAGCTCGTCAATAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCCAGCATGAAGATCGGATGGGAGGGATTAATCAGAGCCGGTGCGGTTGAATATCTTGACGCCGAGGAAGAGGAGACGTCTATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCCACTGATGAAGACATGGCAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_subalpina GCCAAGCTGTTCCGCGGCATCATGCGAAGGATCAACACCGAGCTGGCCAAC--TACCTGAGGCGGTGCGTAGAGGGCAACCGACACTTCAACCTCGCCGTGGGTATCAAGCCCGGCACGCTCTCCAACGGGCTCAAGTACTCGCTTGCCACCGGAAACTGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCGGGCGTGTCTCAGGTGCTCAACCGTTACACCTTTGCCTCGACGTTGTCCCATCTGCGTCGTACCAACACGCCCATCGGAAGGGATGGCAAGCTGGCGAAGCCTCGACAGCTCCACAACACGCACTGGGGCTTGGTCTGTCCGGCCGAGACTCCCGAAGGGCAGGCCTGCGGTTTGGTCAAGAACTTGTCCCTGATGTGTTACGTCAGCGTCGGGTCTCCCTCCGAGCCCCTGATCGAGTTCATGATCAACCGGGGCATGGAGGTGGTCGAGGAGTACGAGCCGCTGCGGTATCCTCACGCCACGAAGATCTTTGTCAACGGTGTCTGGGTCGGCATCCACCAGGATCCCAAGCACCTGGTGAACCAGGTGCT-GGACACGCGTCGCAAGTCTTATCTGCAGTACGAGGTCTCCCTGATCAGGGACATCCGCGACCAGGAATTCAAGATCTTCTCCGA-CGCAGGTCGCGTCATGCGGCCCGTCTTCACCGTCCAGCAGGAGAACGACCCGGAGACGGGCCTCGACAAGGGACAGTTGGTCCTCACCAAGGATCTCGTCAACAGGCTTGCCAAGGAGCAGGCAGAGCCGCCAGAAGACCCCAGCACGAAGATTGGGTGGGAGGGCCTTATCAGGGCCGGTGCGGTCGAGTATCTCGATGCCGAGGAAGAAGAGACGTCCATGATCTGCATGACGCCGGAGGACCTCGAGTTCTACCGTCTCCAGAAAGCTGGCATAGCCCAGGAGGAAGATACCGGAGAAGACCTGAACAAGCGACT-CAAGACGAAGACGAACCCGACGACTCACATGTACACCCACTGCGAGATTCACCCAAGCATGATCTTGGGTATCTGTGCTAGTATCATTCCTTT Hypocrea_sulawesensis --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGATCAGAAAAAGGCCATGAGCTCGACTGCGGGCGTGTCGCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGAACTAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTTGTCAAGAACCTGTCGCTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCCCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTGGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTCGTCAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTCTT-GGACACCCGCCGCAAGTCGTATCTGCAGTACGAAGTCTCTCTCGTCAGGGAGATTCGAGACCAGGAGTTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAGGAAGACGACCCCGAAACGGGCATCAACAAGGGTCACCTGGTATTGACCAAGGAGCTCGTCAACAGGCTGGCCAAGGAGCAGGCCGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCAGAGGACCTCGAGCTATATCGCCTGCAGAAAGCCGGCATCTCGACGGAGGAAGACATGGGAGACGACCCGAACAAGCGACT-GAAGACGAGGACAAACCCCACGACTCACATGTACACGCATTGCGAGATCCACCCCAGCATGATCTTGGGTATCTGCGCTAGTATCATCCCTTT Hypocrea_sulfurea ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_tawa --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAGGTTGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCATCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGATACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTTGTGAGAGAAATTAGAGACCAGGAATTTAAAATTTTTTCCGA-CGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACT-CAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Hypocrea_voglmayrii ---------------------------AGAATGAATACGGAGCTGGCCAAC--TACCTGAGACGATGTGTCGAGGGTAACCGACATTTCAATCTTGCTGTTGGTATCAAACCCGGCACGCTTTCTAACGGGTTGAAATATTCGCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCAACCGCAGGCGTATCACAGGTGCTTAACCGATACACATTTGCTTCGACACTCTCCCATTTGCGTCGTACTAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTATGCCCGGCTGAGACGCCCGAAGGTCAGGCTTGTGGCCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCATCTGAGCCTCTGATCGAATTCATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTACGAACCACTGAGGTATCCTCATGCGACAAAGATCTTTGTAAACGGTGTTTGGGTCGGAATCCACCAAGACCCCAAGCATCTGGTGAACCAAGTTCT-GGACACCCGTCGCAAGTCCTATCTACAATACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAGATCTTCTCTGA-CGCCGGTCGTGTGATGCGTCCTGTATTCACTGTGCAGCAAGAAGATGACCCCGAAACGGGCATAAACAAAGGCCACTTAGTATTGACCAAAGATCTCGTCAATAGACTGGCAAAGGAGCAGGCTGAGCCTCCGGAAGACCCAAGTATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCAGAGGAAGAAGAAACGTCCATGATTTGCATGACACCAGAGGATCTTGAGCTTTATCGTCTTCAGAAAGCAGGCATCGCCACAGACGAAGACATGGGAGATGATCCCAACAAGCGTCT-CAAGACCAAGACGAATCCAACCACCCACATGTACACGCATTGCGAAATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Hypomyces GCTAAGCTGTTCCGTGGCATTATGCGAAGAATGAACACGGAACTTGCCAAT--TACCTCCGACGATGTGTTGAAGGAAACAGGCATTTCAACCTTGCCGTCGGTATCAAGCCCGGAACTTTGTCCAACGGTCTCAAGTACTCGCTTGCAACGGGTAACTGGGGTGATCAGAAGAAGGCGGCAAGCTCAACTGCCGGTGTGTCTCAGGTGCTTAACCGTTACACATTTGCCTCTACGTTGTCCCATCTTCGACGTACCAACACACCCATCGGAAGAGACGGTAAAATCGCTAAGCCGCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACTCCTGAAGGTCAGGCTTGTGGTTTGGTCAAAAACCTATCTTTGATGTGCTATGTCAGTGTCGGTTCTCCGTCAGAACCCTTGATTGAGTTCATGATCAACCGAGGCATGGAAGTCGTCGAAGAGTATGAGCCCCTGCGATACCCTCATGCGACCAAGATTTTCGTCAATGGTGTTTGGGTCGGTGTGCACCAAGATCCCAAGCATCTCGTTAACCAGGTTCT-CGACACGCGTCGTAAATCGTACCTCCAGTACGAAGTCTCGCTGATTAGAGAGATCAGAGATCAAGAGTTTAAGATTTTCTCTGA-TGCGGGACGAGTGATGCGACCAGTCTTCACCGTTCAGCAGGAGGATGATCCCGAGACAGGAATCAACAAGGGACATCTTGTCATAAGCAAGGATTTGGTCAACCGACTAGCCAAAGAACAGGTTGAGCCTCCCGAAGACCCTAGTATGAAGCTCGGCTGGGAAGGCCTCATTCGAGCAGGTGCAGTCGAGTATCTCGACGCTGAAGAAGAAGAGACGTCCATGATTTGCATGACACCAGAAGATCTGGAGCTTTATCGTCTCCAGAAAGCGGGTATCAACACGGATGAGGACATGACCGACGATCCCAACAAACGATT-GAAGACCAAGACAAATCCAACAACACACATGTATACGCACTGCGAGATCCACCCCAGTATGATTCTTGGTATTTGTGCTAGCATTATTCCTTT Sphaerostilbella GCGAAGCTCTTCCGTGGTATTATGCGAAGAATGAACACCGAGCTTGCCAAC--TACCTTCGAAGGTGTGTTGTGGGCAACCGTCATTTCAACCTTGCGGTCGGTATCAAGCCTGGTACTCTTTCCAACGGCCTGAAGTACTCGCTTGCCACCGGCAACTGGGGTGATCAGAAGAAGGCCGCCAGTTCCACTGCCGGCGTGTCTCAGGTGTTGAACCGTTACACATTTGCATCAACACTCTCGCATTTGCGACGAACCAACACTCCTATCGGAAGAGATGGCAAGCTCGCTAAGCCTAGACAACTTCACAACACACATTGGGGTCTGGTTTGCCCAGCCGAGACCCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCCTTGATGTGTTATGTTAGTGTCGGTTCTCCTTCCGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTAGTGGAGGAGTATGAGCCGCTGCGATATCCCCATGCCACCAAGATCTTTGTAAACGGTGTCTGGGTTGGTGTGCACCAAGACCCTAAGCATTTGGTGAACCAAGTTCT-CGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTTTCTCTTATTAGGGAAATTCGAGATCAGGAATTCAAGATTTTCTCGGA-CGCAGGTCGTGTGATGAGACCAGTTTTTACTGTTCAACAAGAGGATGACCCTGAGACGGGAATCAACAAGGGCCACTTGGTGTTGACAAAGGACTTGGTGAATAAGCTTGCAAAAGATCAAGCCGAGCCTCCGGAAGACCTTAGCATGAAGATTGGCTGGGAAAGCTTGATTCGTGCAGGTGCCGTCGAGTATCTCGATGCAGAGGAAGAGGAGACGTCGATGATTTGCATGACGCCAGAAGATCTGGAAATGTACCGTCTCCAGAAGGCCGGTGTGTTAATGG-------------------------------------------------------------------------------------------------------------------------------- Trichoderma_aggressivum GCCAAGCTGTTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAAC--TATCTGAGACGGTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGTACGCTTTCAAACGGATTGAAGTATTCTCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAATCGTTACACATTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGGCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTCGGAGTTCACCAAGACCCTAAACATTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAGATCAGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-CAAGACAAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATCCCTTT Trichoderma_amazonicum ---------------------------------------------------------TGAGACGGTGCGTTGAGGGCAACCGACACTTCAACCTTGCCGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCACGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCCCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCTGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACTGAGGAGGACATGGGAGATGATCCGAACAAGCGACT-CAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGAT--------------------------------------------- Trichoderma_arundinaceum GCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAGTTGGCCAAT--TATCTGAGACGTTGTGTGGAGGGCAACCGACATTTCAACCTTGCTGTGGGTATCAAGCCCGGCACGCTTTCAAACGGTCTGAAGTATTCTCTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAATCGCTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCATAATACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCTGAAGGCCAAGCTTGTGGTTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCGTTGCGGTATCCCCACGCTACGAAGATCTTTGTCAACGGTGTATGGGTGGGAGTTCATCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTGCAGTATGAAGTCTCCCTGATCAGGGACATTCGTGACCAGGAATTCAAAATCTTCTCCGA-CGCAGGTCGTGTTATGCGTCCCGTCTTTACTGTTCAGCAAGAAGACGACCCAGAAACTGGCATTAATAAGGGCCATTTGGTTTTGACAAAGGAGCTGGTCAACAGGCTGGCAAAGGAGCAGGCCGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGGCAATGATTTGCATGACCCCCGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATATCCACAGAAGAAGACATGGCAGATGATCCAAACAAGCGACT-CAAGACGAAGACGAATCCAACAACTCACATGTACACGCATTGTGAGATTCACCCGAGTATGATCTTAGGCATCTGTGCTAGTATCATCCCTTT Trichoderma_asperelloides GCCAAACTGTTCCGTGGTATCATGCGTAGAATGAACACCGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTGGCTGTTGGCATCAAGCCCGGTACACTCTCCAACGGATTGAAATATTCGCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAATACGAACCGCTGAGGTATCCCCATGCGACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGCAAATCCTATCTGCAATACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCTGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAGGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTAACCAAGGATCTTGTCAACAGACTGGCTAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGTTAATTCGGGCTGGCGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTCTACCGTCTTCAGAAGGCTGGCATTTCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_asperellum GCCAAGCTGTTCCGTGGTATCATGCGTAGAATGAACACCGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGTCACTTCAACCTGGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGATTGAAGTATTCTCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACCCCTGAGGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAGTACGAACCGCTGAGGTATCCCCATGCGACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAATACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAGGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTAACCAAGGATCTTGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGTTAATTCGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTTTACCGTCTTCAGAAGGCTGGCATTGCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_atrogelatinosum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACCTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTAGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGTATCGACAAGGGCCACCTGGTGTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAAGAGACATCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_atroviride GCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACAGAGCTGGCCAAC--TACCTCAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATTAAGCCCGGCACACTTTCCAACGGACTAAAGTACTCGCTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGCCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGTCAAGCTTGTGGTCTGGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGCCGTGTCATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTTGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAAGGGCTGATTAGAGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAGGATCTGGAGCTCTATCGTCTTCAAAAGGCCGGCATTGCCACGGATGAAGACATAGGAGACGATCCAAATAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_aureoviride --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAAGCCATGAGTTCAACAGCTGGTGTGTCCCAGGTGCTTAATCGTTACACGTTTGCTTCGACCCTGTCACATTTGCGCCGTACCAACACACCCATTGGAAGAGATGGTAAACTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCCGAAGGCCAAGCCTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAAGTCGCCGAAGAGTACGAGCCACTGCGATATCCCCCCGCTACCAAGATTTTTGTGAATGGCGTCTGGGCCGGAGTCACCCAAGACCCTAAGCCCCTGGTGAACCAGGTTCT-GGACGCTCGCCGCGAGTCTTATTTGCAGTACGAAGTCTCTCTGGTCAGAGAAATTCGAGACCAGGAGTTCAAAATCTTTTCGGA-CGCAGGTCGTGTCATGCGGCCCGTGTTTACAGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGTCATCTGGTATTGACCAAGGAACTCGTCAACAGACTGGCCAAAGAGCAGGCCGAACCCCCAGAGGACCCAAGCATGAAGATGGGGTGGGAGGGGTTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACATCCATGATTTGCATGACTCCAGAAGATCTCGAGCTCTATCGTCTTCAAAAGGCCGGTATTTCTACGGAAGAGGACATGGGAGATGATCCGAATAAGCGACT-CAAGACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAAATTCACCCAAGCATGATATTGGGCATCTGCGT--------------- Trichoderma_austrokoningii --------------------------------------------------------------------------------------TTCAACCTTGCTGTCGGCATCAAGCCCGGCACGCTTTCCAACGGATTGAAGTACTCGCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCAACCGCGGGTGTATCCCAGGTGCTTAACCGTTACACTTTTGCTTCCACACTATCCCATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCTGCCGAGACTCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAATAGAGGCATGGAAGTTGTTGAAGAGTATGAGCCACTGAGGTATCCCCACGCCACAAAAATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGATCCCAAGCATCTGGTGAACCAGGTTCT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAGGAATTCAAAATCTTCTCCGA-CGCCGGTCGTGTCATGCGTCCCGTCTTTACTGTGCAGCAAGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTTGTGTTGACCAAGGATCTCGTCAACAGACTTGCCAAGGAACAGGCTGAGCCCCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCGGGTATCTCCACGGAGGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTATACGCA------------------------------------------------------ Trichoderma_brevicompactum ---------------------------------------------------------------------------------------------TTGCTGTGGGTATCAAGCCCGGTACGCTTTCAAACGGATTGAAGTATTCACTTGCCACTGG???CTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCCGGTGTGTCTCAGGTGCTTAATCGCTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAATTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCTGAGACTCCTGAAGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCCTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAGGTTGTCGAAGAGTACGAGCCGCTGCGGTATCCCCATGCTACAAAGATCTTTGTAAACGGTGTCTGGGTGGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTGATTAGGGACATTCGTGATCAGGAGTTCAAAATCTTCTCCGA-TGCAGGTCGTGTTATGCGTCCCGTCTTCACTGTTCAGCAAGAAGACGACCCGGAAACTGGCATTAATAAGGGCCATTTGGTTTTGACAAAGGAGCTGGTCAACAGGCTGGCAAAGGAGCAGGCTGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCTGGCGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGGCCATGATTTGCATGACCCCTGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGCATTAACACAGAAGAAGATATGGC-GATGATCCAAACAAGCGACT-CAAGACGAAGACGAATCCAACAACTCACATGTACACGCACTGTGAGATTCACCCGAGCATGATCTTGGGCATCTGTGCTA------------- Trichoderma_brunneoviride GCC-AGCTGTTCCGTGGCATCATGCGAAGGATGAACACTGAATTGGCCAAC--TACCTGAGACGGTGCGTTGAGGGCAATCGACACTTCAACCTTGCTGTGGGCATCAAGCCCGGCACGCTCTCAAACGGTTTAAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTCGCTTCGACCTTGTCACACTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGCAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCCGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGGTTGGCCAAGGAGCAGGCTGAACCTCCAGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAGTATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCCACTGAGGAAGACATGGCAGATGATCCGAACAAGCGACT-AAAGACCAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGCGCCAGTATCATTCCTTT Trichoderma_candidum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGATCAGAAGAAAGCCATGAGTTCAACTGCAGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCCTCGACCCTATCGCATTTGCGCCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGCCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCTTCCGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTCGTCGAAGAGTACGAGCCTCTGCGATATCCCCATGCCACTAAGATTTTTGTAAATGGTGTCTGGGTCGGAGTTCACCAAGATCCTAAGCACCTGGTGAACCAGGTTCT-GGACACTCGCCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCGGA-CGCAGGCCGTGTCATGCGGCCTGTGTTCACAGTTCAGCAGGAAGATGACCCTGAAACGGGTATCAACAAGGGTCATCTGGTACTGACCAAGGAGCTCGTCAACAGACTGGCCAAAGAGCAGGCCGAACCCCCAGAGGACCCAAGCATGAAAATTGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATTTGCATGACACCAGAAGATCTCGAGCTCTATCGTCTTCAAAAAGCCGGTATTTCTACGGAAGAGGACATGGGAGATGACCCGAATAAGCGACT-AAAGACCAAGACAAACCCAACGACTCACATGTACACTCATTGTGAAATCCACCCAAGCATGATTTTGGGCATCTGCGCTAGTATTATTCCTTT Trichoderma_caribbaeum GCCAAGTTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCAAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCATTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAGTCCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCGCTTATCAGAGAAATTCGAGACCAGGAGTTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAACAGATTGGCCAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTGTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGTGAGATTCACCCGAGTATGATCTTGGGTATCTGCGCCAGTATC-------- Trichoderma_catoptron GCAAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAAC--TATCTGAGACGGTGCGTTGAGGGTAACCGACACTTCAACCTTGCTGTCGGTATCAAGCCCGGCACCCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCGCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACGCCGAAACGGGCATCAACAAGGGCCACCTTGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGCTGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACTTCCATGATCTGCATGACGCCAGAGGATCTCGAACTGTATCGTCTTCAGAAGGCCGGCATCTCTACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACCAAGACAAACCCGACGACTCACATGTATACCCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_ceraceum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACCTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTAGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGTATCGACAAGGGCCACCTGGTGTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAAGAGACATCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_ceramicum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTCAACCGTTACACGTTTGCTTCGACCCTGTCACACTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCCCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTAGGCTCTCCCTCCGAGCCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCAAGCATGAAGATTGGGTGGGAGGGATTAATCAGGGCTGGCGCGGTCGAATATCTCGACGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCAACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAACCCAACAACTCACATGTACACCCATTGCGAGATCCACCCAAGCATGATCTTAGGTATCTGTGCCAGTATCATTCCTTT Trichoderma_cerinum ------------------ATCATGCGAAGGATGAACACCGAATTGGCCAAC--TATCTGAGACGGTGCGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACTAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACCTGGTATTAACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCTGAAGACCCAAGCATGAAGATGGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAGGAGACATCTATGATTTGCATGACGCCAGAAGATCTCGAGCTGTATCGTCTTCAAAAGCCTGGTATTTCCACTGAGGAAGACATGGGAGATGATCCGAACAAGCGTCT-AAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTAGGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_chlorosporum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCCGAAGGGCAAGCTTGTGGTCTTGTCAAAAATCTGTCGTTGATGTGTTATGTCAGTGTCGGTTCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAAGTTGTAGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTATGGGTTGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCTTACTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCGGGCCGTGTCATGCGACCTGTGTTTACCGTCCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAACCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATGGGAGACGATCCGAACAAGCGATT-GAAAACAAGGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCCAGTATTATTCCATT Trichoderma_chromospermum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGATCAGAAGAAGGCCATGAGCTCAACTGCGGGCGTGTCCCAGGTGCTTAACCGTTACACGTTTGCCTCAACCCTATCGCATTTGCGTCGTACCAACACACCCATCGGGAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACGCACTGGGGTTTGGTCTGCCCGGCAGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAATCTGTCTTTGATGTGCTACGTCAGTGTTGGTTCACCCTCCGAACCGTTGATTGAGTTCATGATCAACAGAGGAATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGATACCCGCATGCTACCAAGATTTTTGTTAACGGTGTCTGGGTTGGAGTTCACCAAGACCCCAAGCACCTGGTGAACCAGGTGTT-GGACACTCGTCGCAAATCATATCTGCAGTACGAAGTTTCGTTGGTCAGAGAAATCCGAGATCAGGAATTCAAAATCTTTTCCGA-TGCGGGCCGTGTCATGCGACCCGTATTCACCGTCCAGCAGGAAGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAACAGGCTGAACCGCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGGCTGATTAGGGCTGGTGCGGTTGAATACCTCGATGCCGAGGAAGAGGAGACGGCTATGATTTGCATGACGCCAGAGGACCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCTACCGAGGAAGACATGGGAGACGATCCGAACAAGCGACT-GAAGACAAAGACAAATCCAACGACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTGGGCATCTGCGCCAGTATCATTCCTTT Trichoderma_cinereoflava ---------------------------------AACACTGAACTGGCCAAC--TACCTGAGACGTTGCGTGGAAGGCAACCGCCACTTTAACCTTGCCGTGGGCATCAAGCCCGGCACCCTGTCAAACGGTCTCAAGTACTCGCTCGCCACTGGTAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCTGGTGTGTCTCAGGTGCTCAACCGATACACATTCGCATCGACCTTGTCCCATTTGCGACGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCGCGACAACTTCACAACACCCACTGGGGTTTGGTCTGCCCTGCCGAGACCCCTGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCTCTGATGTGCTACGTCAGTGTTGGATCCCCGTCTGAGCCCCTCATTGAATTTATGATCAACAGAGGCATGGAAGTCGTCGAGGAGTATGAACCCCTTCGATATCCTCATGCCACCAAGATCTTTGTCAATGGTGTCTGGGTCGGTGTTCATCAGGACCCCAAGCATCTGGTCAACCAGGTCTT-GGATACCCGTCGCAAGTCCTACCTGCAGTATGAAGTGTCCCTCATTCGAGATATCCGAGACCAGGAGTTTAAGATTTTCTCTGA-TGCCGGTCGCGTCATGCGCCCCGTATACACTGTCCAGCAAGAGGACGATCCGGAGACGGGCATCAACAAGGGCCACCTGGTTCTCACCAAGGACCTGGTCAACAGGCTGGCCAAGGAGCAGGCCGAGCCTCCCGAAGACCCGAGCATGAAGGTTGGATGGGAAGGGCTGATTAGGGCTGGTGCGGTCGAGTATCTCGATGCCGAAGAAGAAGAGACTTCGATGATTTGCATGACGCCGGAGGACTTGGAGCTCTACCGTCTCCAGAAGGCCGGTCACGCTATCGACGAGGACATGGCTGACGACCCCAACAAGCGACT-CAAGACGAAGACGAATCCCACAACTCACATGTATACCCACTGTGAGATTCACCCTAGCATGATTCTCGGTATTTGCGCCAGTATCATTCCCTT Trichoderma_cinnamomeum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTGTCGCATTTGCGTCGTACCAACACTCCCATTGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGTTATCCTCATGCGACAAAGATCTTTGTGAACGGCGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTCTCCGA-CGCAGGCCGTGTCATGCGACCTGTCTTTACTGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCTAGCATGAAGATCGGATGGGAGGGATTAATCAGAGCCGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCCGAGGATCTTGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCTACTGACGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAATCCGACAACCCACATGTACACCCATTGCGAGATTCACCCAAGTATGATTTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_citrinoviride ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_costaricensis --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCTATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCGCATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCCGAAGGGCAAGCTTGTGGCCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCATCCGAACCTCTGATTGAGTTCATGATCAATCGAGGTATGGAAGTTGTCGAAGAGTACGAGCCATTGCGATATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTCGGAGTTCACCAAGATCCTAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCTTACTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTCACCGTTCAGCAAGAAGATGACCCCGAAACGGGTATCAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAAGAGCAGGCCGAGCCTCCAGAGGACCCAAGCATGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAAACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATTTCCCCTGAAGAGGACATGGGAGATGATCCGAACAAGCGACT-GAAGACAAAGACAAACCCAACGACTCACATGTCCACTCATTGCGAAATTCACCCA-------------------------------------- Trichoderma_crassum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCCGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACCCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTGTGTCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAACCACTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-AGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAGGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGATTGGCCAAGGAACAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGACTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCGATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATCTCTACCGATGAAGACATGGGAGATGACCCGAACAAGCGACT-CAAGACAAAGACCAACCCAACAACCCACATGTACACACATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_cremeum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAAGTTGTGGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATCTTTGTGAACGGTGTATGGGTTGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATCGGAGACGATCCGAACAAGCGATT-GAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCCAGTATTATTCCATT Trichoderma_cuneisporum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCTTCAACCCTGTCACATTTGCGTCGAACCAACACACCTATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCGTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGATCCTAAGCATCTGGTGAACCAAGTTCT-GGACACTCGTCGCAAGTCCTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACTGTTCAGCAGGAAGATGATCCTGAAACGGGTATCAACAAGGGCCATTTGGTATTGACCAAAGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGCCTTCAGAAAGCCGGCATTTCTACTGAGGAAGACATTGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATTCATCCAAGTATGATCTTGGGTATTTGCGCCAGTATCATTCCTTT Trichoderma_dingleyae GCCAAGTTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCAAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTCCACAACACGCACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTTAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAATAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAACGGTGT-TGGGTTGGGATTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTATGAAGTCTCTCTGATCAGAGAAATTCGAGATCAGGAATTCAAAATTTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCTGAGGAGGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGCCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTGGGCATCTGTGCCAGTATCATTCCTTT Trichoderma_dorotheae GCCAAGTTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCAAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGACTGAAGTACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTGCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGTTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAA?GATCTTTGTGAACGGTGTCTGGGTTGGAATTCACCAAGATCCTAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGAAATTCGAGACCAGGAGTTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAACAGATTGGCCAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTGTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGTGAGATTCACCCGAGTATGATCTTGGGTATCTGCGCCAGTATCATTCCTTT Trichoderma_erinaceus GCCAAGCTGTTCCGTGGTATTATGCGCAGAATGAATACCGAGCTGGCCAAT--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGACTAAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCGGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGACGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGTCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTCATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGATCCCAAGCATCTGGTAAACCAAGTTCT-GGATACTCGTCGCAAATCTTATCTGCAATACGAAGTCTCTTTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCCGTCTTTACTGTGCAGCAAGAAGATGACCCAGAAACGGGCATCAACAAGGGCCACCTGGTGTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCGAGCATGAAGCTTGGATGGGAGGGACTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTAGAGCTTTATCGTCTCCAGAAGGCCGGCATTGCCACGGATGAGGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACCACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_estonicum GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACCGAATTGGCCAAC--TATCTGAGACGGTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTCAACCGTTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCCCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAATCTGTCGTTGATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCCGAACCTCCGGAAGACCCAAGCATGAAGATTGGGTGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCTACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATCCACCCAAGCATGATCTTAGGTATCTGTGCCAGTATCATTCCTTT Trichoderma_evansii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_fertile ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTTGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCAGGATCCTAAGCATCTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCTTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCAAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGACTTCAGAAAGCCGGTATTTCTACCGAGGAAGACGTGGGAGATGATCCGAACAAGCGACT-A-------------------------------------------------------------------------------------------- Trichoderma_gamsii GCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTCAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCGGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGTTACGTCAGTGTTGGATCTCCTTCCGAGCCTTTGATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCAAAGCATCTGGTAAACCAAGTCTT-GGATACTCGTCGCAAGTCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGACCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAGGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTGCCACGGATGAAGACATAGGAGATGACCCAAATAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATTCTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_gelatinosum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGATCAGAAGAAGGCCATGAGCTCAACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCCTCGACCCTATCGCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGGCAGGCTTGTGGCCTGGTCAAAAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCGCTAATTGAGTTCATGATCAATAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCCCATGCCACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAGCCAGGTCCT-AGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCGCTGGTCAGAGAAATTCGAGACCAGGAGTTCAAAATATTTTCCGA-CGCAGGCCGTGTCATGCGACCCGCATTTACCGTTCAGCAGGAAGATGACCCCGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCCGGCGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGGCTATGATTTGCATGACGCCGGAGGATCTCGAGCTGTATCGTCTACAGAAAGCCGGTATTTCTACCGAGGAAGATATGGGGGATGATCCGAACAAGCGACT-AAAGACGAAGACAAATCCAACGACTCACATGTACACCCATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGTGCCAGTATCATCCCCTT Trichoderma_ghanense ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_hamatum01 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACAGCTTCACAACACACATTGGGGTTTGGTGTGCCCAGCCGAGACCCCCGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAATAGGGGTATGGAGGTTGTTGAGGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTATTGACCAAGGACCTCGTCAACAGACTTGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAACTTTATCGTCTTCAGAAGGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-TAAGAC--------------------------------------------------------------------------------------- Trichoderma_hamatum02 -----------------------------------------------------------AGACGATGTGTTGAGGGCAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGATTGAAGTATTCACTTGCTACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCCTCGACACTTTCTCATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTGTGCCCAGCCGAGACCCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAATAGGGGTATGGAGGTTGTTGAGGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTATTGACCAAGGACCTCGTCAACAGACTTGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGACCTTGAACTTTATCGTCTTCAGAAAGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCA------------------------------------------------------------------------------------- Trichoderma_hamatum03 GCTAAGCTGTTCCGTGGTATCATGCGCAGGATGAATACCGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGATTGAAGTATTCACTTGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCCTCGACACTTTCTCATTTGCGTCGTACCAACACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTGTGCCCAGCCGAGACCCCCGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAATAGGGGTATGGAGGTTGTTGAGGAGTACGAACCACTGAGGTATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTATTGACCAAGGACCTCGTCAACAGACTTGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAACTTTATCGTCTTCAGAAAGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-TAAGACCAAGACAAATCCGACAACTCACATGTACACGC------------------------------------------------------- Trichoderma_harzianum01 GCCAAGCTGTTCCGTGGTATCATGCGAAGGATG{ACG}ACACTGAATTGGCCAAC--TATCTGAGACGATGCGTTGAGGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACCCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTAT{AGT}GAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGATCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACT-AAAGACAAAGACGAATCCGACAACTCATATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTAT?ATTCCTTT Trichoderma_harzianum02 --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCTGGTGTGTCTCAGGTGCTTAACCGTTACACATTTGCTTCGACCTTGTCACATTTGCGTCGTACCAACACCCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAATACGAGCCTCTGCGATATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCCGAAACGGGCATCAACAAGGGCCACCTTGTATTGACCAAGGAACTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGATT-GAAGACCAAGACGAACCCGACAACCCATATGTACACCCACTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_harzianum03 GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAAC--TATCTGAGACGTTGCGTTGAGGGTAACCGACACTTCAACCTGGCCGTGGGTATCAAGCCCGGTACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACGTTGTCACATTTGCGTCGTACCAACACACCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAAACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGGCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACCAAGACGAACCCGACAACTC------------------------------------------------------------------- Trichoderma_harzianum04 GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAAC--TACCTGAGACGGTGTGTTGAGGGTAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTCTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCACAGGTGCTTAACCGTTACACGTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGTCCTGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAATTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGACCGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGACTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCTGAGGATCTCGAGCTGTATCGCCTTCAGAAGGCCTGGATTAACACTGAGGAAGACATGGGAGATGATCCGAACA?GC?ACTAAAAGACGAAGACGAACCCGACAACTCATAT--------------------------------------------------------------- Trichoderma_harzianum05 --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTCGCAAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTGGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTT-CCGACCGCAGGCCGTGTAATGCGGCCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCTGGTATTAACACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACT-AAAGACCAAGACAAACCCGACTACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGGTAGTA---------- Trichoderma_harzianum06 GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAGTTGGCCAAC--TACCTGAGACGATGCGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGCAACTGGGGTGATCAGAAGAAGGCTATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGATACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCTCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-AGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCTAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCTGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-GAAGACCAAGACGAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCA?T?CCT? Trichoderma_harzianum07 GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAAC--TACCTGAGACGGTGTGTTGAGGGTAACCGACACTTCAACCTGGCTGTTGGTATCAAGCCCGGCACGCTCTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCACAGGTGCTTAACCGTTACACGTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGTCCTGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGATTGAATTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCGCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCCAGCATGAAGATCGGATGGGAGGGACTGATTAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCTGAGGATCTCGAGCTGTATCGCCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACGAAGACGAACCCGACAACTCATATGTACACCCACTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCAATCCCT? Trichoderma_harzianum08 GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAGTTGGCCAAC--TACCTGAGACGATGCGTTGAGGGCAACCGACACTTCAACCTGGCTGTGGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGATACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACCCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTTGTCGAAGAGTACGAGCCGCTGAGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTTAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAACACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACT-AAAGACCAAGACGAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTTCCTT Trichoderma_harzianum09 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_harzianum10 GCCAAGCTGTTCCGTGGTATTATGCGAAGGATGAACACTGAATTGGCCAAC--TATCTGAGACGGTGCGTTGAGGGTAACCGACACTTCAACCTGGCTGTGGGTATCAAGCCCGGCACACTTTCCAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACCTTTGCTTCGACTCTGTCGCATTTGCGTCGTACAAACACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTAAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGCTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-AGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGA-CGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATTAACAAGGGTCACTTGGTATTGACAAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTAATACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-GAAGACCAAGACGAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCAT?CCTTT Trichoderma_helicum -------TCTTCCGTGGTATCATGCGGAGAATGAACACCGAATTGGCCAAC--TACCTAAGACGCTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTCGGTATCAAGCCCGGCACGCTTTCAAACGGACTGAAATACTCGCTTGCTACAGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCAACTGCTGGTGTGTCTCAGGTGCTTAACCGATACACGTTTGCTTCGACCTTGTCACATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCCAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCCGAAGGACAAGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCCCTGATTGAGTTCATGATCAACAGAGGTATGGAGGTCGTCGAAGAGTATGAGCCTCTGCGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCAAGACCCCAAGCATTTGGTGAACCAGGTTCT-AGACACTCGTCGCAAGTCCTATCTCCAGTATGAAGTCTCTCTTGTCAGAGAAATCCGAGACCAGGAATTCAAGATCTTTTCCGA-CGCGGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAAGAAGATGATCCTGAAACAGGCATCAACAAGGGCCACTTGGTACTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGCTGGGAGGGATTGATCAGGGCCGGTGCGGTCGAATACCTTGACGCCGAGGAAGAAGAGACGTCCATGATTTGCATGACGCCAGAGGACCTCGAGCTGTATCGCCTTCAGAAAGCTGGTATTAATACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACT-AAAGACAAAGACAAATCCAACAACTCAC----------------------------------------------------------------- Trichoderma_intricatum GCCAAGCTGTTCCGCGGTATCATGCGCAGAATGAATACTGAGCTGGCAAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGGTCTCCTTCTGAGCCTTTGATTGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCCACAAAGATCTTTGTGAATGGTGTTTGGGTTGGAGTTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTACCTGCAGTACGAAGTCTCCCTGATTAGAGAAATTCGAGATCAAGAGTTCAAAATTTTCTCTGA-CGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCATCTGGTTCTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTGGGTATCTGTGCCAGTATCATTCCCTT Trichoderma_koningii ------------------------------------------------------------------------------------------------------------------------------ACGGATTGAAATACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAATCGCTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACATTGGGGCTTGGTGTGCCCGGCTGAGACCCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGCGTTGGATCTCCTTCTGAGCCTCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCTAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGA-TGCTGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCTGAGGAAGAAGAAACGTCTATGATTTGCATGACACCTGAAGATCTTGAACTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGAAAATCCAAATCAGCGTCT-CAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTATCATTCCTTT Trichoderma_koningiopsis GCCAAGTTGTTCCGTGGTATCATGCGCAGAATGAATACTGAGCTGGCAAAC--TACCTGAGACGATGTGTTGAGGGCAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTACTCACTCGCCACTGGAAACTGGGGTGATCAAAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTACGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCCGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAATTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATTAGAGAAATTCGAGACCAAGAGTTCAAAATCTTCTCTGA-TGCCGGACGTGTTATGCGTCCTGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGATTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCGGGTATTGCCACGGATGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACCCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTGGGTATCTGCGCCAGTATC-------- Trichoderma_lieckfeldtiae GCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACCGAGTTGGCTAAT--TACCTGAGACGATGTGTTGAAGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGATTAAAATATTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCTATGAGCTCGACCGCAGGTGTATCTCAGGTGCTTAACCGTTACACTTTTGCTTCGACACTATCTCATTTGCGTCGTACCAATACACCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGCTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCCTCCGAGCCTTTGATTGAGTTTATGATCAACAGAGGCATGGAGGTCGTTGAGGAGTACGAACCGCTGAGGTATCCCCACGCGACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCCCTGATCAGAGACATTCGTGATCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTTGTCAATAGATTGGCCAAAGAGCAGGCCGAGCCTCCGGAAGATCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTTTACCGTCTCCAGAAGGCTGGCATTTCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACCCACATGTACACGCATTGTGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_longibrachiatum -------------------------------------------------------------------------------------------CCTCGCGGTCGGCATCAAGCCTGGCACGCTCTCCAACGGCTTGAAGTATTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGAGTGTCTCAGGTGCTCAACCGATACACGTTCGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGAGACGGCAAGCTGGCGAAGCCTCGACAGCTGCACAACACCCATTGGGGTCTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTTGTCAAGAACCTATCTCTGATGTGTTATGTCAGTGTCGGCTCTCCCTCAGAGCCGTTGATCGAGTTTATGATCAATAGGGGCATGGAAGTGGTCGAGGAATACGAGCCGCTGCGTTATCCTCACGCTACCAAGATCTTTGTCAACGGTGTCTGGGTGGGCATTCACCAAGATCCCAAACATCTGGTGCAGCAGGTCGT-GGACACTCGTCGTAAGTCGTACCTGCAGTACGAGGTCTCTCTGGTCAGAGAAATTCGAGACCAGGAGTTCAAGATCTTCTCCGA-CGCAGGCCGCGTCATGCGACCCGTCTTTACCGTCCAGCAAGATGACGAGTCGGACACTGGCATTCCCAAGGGCCACTTGGTCCTGACCAAAGACCTCGTTAATAAATTGGCCCAGGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGATTGGTTGGGAGGGACTCATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACTCCCGAGGATCTCGAGCTGTATCGTGCGCAAAAGGCAGGTATTGCCACCGAAG----------------------------------------------------------------------------------------------------------------------------- Trichoderma_longipile ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_martiale GCCAAGCTGTTCCGTGGCATCATGCGCAGAATGAATACTGAGCTGGCCAAC--TACCTGAGACGATGTGTTGAGGGCAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGATTGAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCTCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGA-TGCCGGTCGTGTCATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGGCTGGCCAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTGGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATCTCCACAGATGAAGACATAGGAGATGACCCAAATAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGAT{CT}TTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_melanomagnum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCAGGCGTGTCCCAGGTGCTGAACCGTTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGACGAGATGGTAAACTGGCCAAGCCTCGTCAGCTTCACAACACGCACTGGGGCTTGGTCTGCCCGGCTGAGACGCCCGAGGGACAAGCTTGTGGCTTGGTCAAGAACTTGTCTCTGATGTGTTATGTCAGTGTCGGATCTCCCTCTGAACCCCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAAGAATATGAACCTCTGCGATATCCTCATGCCACCAAGATCTTTGTCAACGGTGTCTGGGTTGGCGTTCACCAAGATCCTAAGCACCTGGTGAACCAAGTCTT-GGACACGCGTCGCAAATCCTATCTCCAGTACGAGGTCTCTCTGATCAGAGACATTCGTGATCAGGAATTCAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGTCCTGTGTTTACGGTCCAACAGGAGGATGACCCCGAGACGGGCATTGAGAAGGGCCACTTGGTCCTGACGAAGGAGCTCGTCAACAAGTTGGCAAAGGAGCAGGCAGAGCCCCCCGAAGACCCGAGCATGAAGGTCGGATGGGAAGGGCTCATTCGGGCGGGTGCGGTTGAATATCTCGATGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACGCCGGAGGATCTCGAGCTCTATCGTCTTCAGAAGGCTGGCATTGCCACGGAAGAAGACATGAGCGACGATCCGAACAAGCGACT-CAAGACGAAGACGAATCCTACGACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTGGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_minutisporum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_novaezelandiae -------------------------------------------ATGGCCAC--CACCTGAGACGGTGCGTGGAGGGCAACCGACACTTCAACCTCGCTGTTGGTATCAAGCCCGGCACCCTTTCAAACGGCTTGAAGTATTCGCTCGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCCGGCGTGTCTCAGGTGCTCAACCGCTACACGTTTGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGAAGGGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACCCATTGGGGTCTGGTCTGTCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCCTTGTCAAGAACCTGTCTCTGATGTGTTATGTCAGCGTCGGTTCTCCATCAGAGCCGCTGATTGAGTTCATGATCAATCGAGGGATGGAAGTTGTCGAGGAATACGAGCCACTGCGGTATCCTCACGCCACCAAGATCTTCGTCAACGGTGTCTGGGTGGGCGTTCACCAAGACCCTAAGCATCTCGTGGGCCAAGTTCT-GGACACGCGTCGTAAGTCGTACCTGCAGTACGAAGTCTCTCTCATCAGAGAAATTCGAGACCAGGAATTCAAAATCTTCTCCGA-CGCAGGCCGTGTCATGCGACCCGTCTTTACCGTCCAGCAAGGTGACGAGGCTGATGCTACCGTTGAAAAGGGCCACTTGGTGCTGACCAAAGAGCTTGTCAACAAGTTGGCGAAGGAGCAAGCAGAGCCTCCAGAAGACCCCAGCATGAAGATTGGTTGGGAGGGTCTCATCAGGGCTGGTGCGGTCGAATACCTCGACGCCGAGGAGGAGGAGACGGCTATGATTTGCATGACGCCCGAGGATCTGGAGCTGTATCGTCTTCAGAAGGCAGGTATTGCCACTGATGAGGACGTTGGCGACGATCCGAACAAGCGACT-CAAGACCAAGACAAATCCAACGACGCA------------------------------------------------------------------ Trichoderma_oblongisporum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTCGCTTCGACCTTATCACATTTGCGCCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAGGGACAAGCTTGTGGCTTGGTCAAAAACCTGTCGTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGCATGGAGGTCGTCGAAGAGTATGAGCCGCTGCGATATCCTCATGCCACCAAAATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTACAGTACGAAGTTTCTCTCATCAGAGACATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTTATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATTAACAAGGGCCACTTAGTATTGACCAAGGAACTCGTCAACAAACTGGCGAAGGAGCAGACTGAGCCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCAGGTATTGCTACTGAGGAGGACATAGGAGAAAACCCGAATCAGCGACT-CAAGACAAAGACAAATCCAACAACGCACATGTACACACATTGTGAGATTCACCCGAGCATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_ovalisporum01 --------------------------------------TGAGCTGGC-?AC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTATTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTTGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAGTTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGCCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATTAGAGAAATTCGAGACCAAGAGTTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGATTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCC{AGT}ACAACTCACATGTATACTCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTAT--------- Trichoderma_ovalisporum02 GCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAACACTGAGCTGGCAAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCTAACGGATTGAAGTATTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGCTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTCTGATCGAGTTTATGATCAACAGAGGCATGGAAGTTGTTGAGGAGTACGAGCCACTGAGATATCCCCATGCTACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAGTTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATTAGAGAAATTCGAGACCAAGAGTTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGATTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACTCACATGTATACTCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTATCATTCCTTT Trichoderma_pachybasioides ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_parapiluliferum GCC-AGCTGTTCCGTGGTATCATGCGAAGGATGAATACTGAATTGGCCAAT--TACCTGAGACGATGTGTTGAGGGTAACCGACATTTCAATCTTGCTGTTGGCATTAAACCCGGCACGCTTTCCAACGGATTGAAGTATTCACTTGCTACTGGAAATTGGGGTGATCAGAAGAAGGCAATGAGCTCGACTGCAGGTGTGTCACAGGTTCTTAACCGTTATACTTTTGCTTCGACACTATCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCCTGGTCAAAAACTTGTCTTTGATGTGCTATGTTAGTGTCGGATCTCCCTCTGAGCCCCTAATTGAGTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAATATGAGCCTCTGCGATATCCTCATGCCACGAAGATCTTTGTCAACGGTGTATGGGTTGGAATTCACCAGGATCCTAAGCATCTGGTGAACCAAGTTTT-GGACACTCGTCGTAAATCTTATCTACAGTATGAAGTCTCTCTGATTAGAGACATTCGTGATCAGGAATTCAAAATCTTCTCTGA-CGCAGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGATCCGGAAACGGGCATTAACAAAGGTCACCTGGTATTGACGAAGGATCTCGTCAACAGACTGGCAAAGGAGCAGGTTGAGCCTCCAGAAGACTCAAGCATGAAGCTTGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAGGAGACGACTATGATTTGCATGACGCCAGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGACATCGGAGATGATCCAAACAAGCGACT-CAAGACTAAAACGAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCGAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_parareseei ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_parestonicum -------TGTTCCGTGGTATCATGCGAAGGATGAACACCGAACTGGCCAAC--TATCTGAGACGGTGTGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTACTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTCAACCGTTACACATTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGACGGTAAGCTGGCGAAGCCCCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCCACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATACGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCCAGCATGAAGATTGGGTGGGAGGGATTGATCAGGGCTGGCGCGGTCGAATATCTCGACGCTGAGGAAGAGGAGACGTCTATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCTACTGAGGAAGACATGGGAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAATCCAACAACTCACATGTACACCCATTGCGAGATCCACCCAAGCATGATCTTAGGTATCTGTGCCAGCATCATTCCTTT Trichoderma_paucisporum -------------------------GCAGAATGAACACCGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCTGGCACGCTCTCCAACGGATTGAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCAACACTTTCTCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCAAAGCCTCGACAGCTTCACAATACACACTGGGGTTTGGTGTGCCCGGCCGAGACGCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCCTTGATCGAGTTCATGATCAACAGAGGTATGGAGGTCGTTGAAGAGTACGAACCGCTGAGATATCCCCATGCGACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCCAAACATCTGGTGAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGGGATATTCGTGACCAAGAGTTCAAGATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACCGTACAGCAAGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTC-ATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGACCTTGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACCACTCACATGTACACG-------------------------------------------------------- Trichoderma_petersenii GCCAAGTTGTTCCGTGGCATCATGCGCAGGATGAATACTGAGCTGGCAAAC--TACCTTAGACGATGTGTTGAGGGTAACCGCCACTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCCAACGGATTGAAGTACTCACTCGCTACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTATCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGCTTGGTGTGCCCGGCTGAGACACCTGAAGGACAGGCTTGTGGCCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTCGAGGAGTACGAGCCACTGAGATATCCCCATGCAACAAAGATCTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCATCAGAGAAATTCGAGATCAAGAATTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAACAGATTGGCTAAAGAGCAGGCTGAGCCTCCTGAAGACCCAAGCCAGAAGCTTGGATGGGAAGGGCTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCAGAAGATCTTGAGCTTTATCGTCTTCAGAAGGCCGGCATTGCCACGGAGGAAGACATAGGAGACAATCCGAACCAGCGTCT-GAAGACCAAGACAAATCCAACAACTCACATGTATACGCATTGCGAGATCCATCCGAGTATGATCTTAGGTATCTGTGCCAGTATC-------- Trichoderma_pleuroticola --------------------CATGCGAAGGATGAACACCGAATTGGCAGG------CTGAGACGGTGCGT-GAGGGC-ACCGAC-CTTAAAAAACGGGGGAGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATTCTAAAAAGGCCATGAGCTCAACTGCTGGTGTGTCCCAGGTGCTCAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGTTGGCGAATCCTCTACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTTTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCTGGCCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTTGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACTGAGGAGGACATGGGAGATGATCCGAACAAGCGACT-CAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_pleurotum GCCAAGCTATTCCGTGGCATCATGCGAAGGATGAACACCGAATTGGCCAAC--TATCTGAGACGGTGCGTTGAGGGCAACCGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTATCCCATTTGCGTCGTACCAACACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCGGCCGAGACGCCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTCGGAGTTCACCAAGACCCCAAGCACTTGGTGAACCAGGTCCT-GGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTTTCTCTCGTGAGAGAAATCCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCTGGCCGTGTCATGCGGCCAGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGGTTGGCCAAGGAGCAGGCTGAGCCTCCGGAAGACCCCAGCCTGAAGATTGGATGGGAGGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAAAAGGCCGGTATCAACACGGAGGAGGACATGGGAGATGATCCGAACAAGCGACT-CAAGACCAAGACAAACCCCACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATTCTAGGCATCTGTGCTAGTATCATCCCTTT Trichoderma_protrudens -----------------------------------------GTTGGCCAAC--TATCTGAGACGATGTGTCGAGGGCAACCGGCATTTCAACCTTGCTGTGGGCATCAAGCCCGGTACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCCGGTGTGTCTCAGGTGCTTAATCGTTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAATACGCATTGGGGTCTGGTCTGCCCAGCCGAGACACCTGAGGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCACACGCTACAAAGATCTTTGTAAACGGTGTCTGGGTGGGAGTTCATCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGGGATATTCGTGATCAGGAATTCAAAATTTTCTCCGA-TGCAGGTCGTGTTATGCGTCCCGTCTTTACTGTTCAGCAAGAAGACGATCCTGAAACTGGCATCAACAAGGGCCATTTGGTTTTGACAAAGGAGCTGGTCAACAGGCTGGCAAAGGAGCAGGCTGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGATGCTGAGGAAGAAGAGACGGCCATGATTTGCATGACCCCCGAGGATCTCGAGCTTTATCGTCTTCAGAAAGCTGGTATTTCCACAGAAGAAGACATGGCAGATGATCCAAACAAGCGACT-CAAGACAAAGACGAATCCGACAACCCACATGTACACGCATTGTGAAATTCACCCGAGTATGATCTT--------------------------- Trichoderma_pseudokoningii ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_pubescens GCCAAGCTGTTCCGTGGTATCATGCGCAGAATGAATACCGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAGGGCAACCGTCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGCTTGAAGTATTCACTTGCCACCGGAAACTGGGGTGACCAGAAGAAGGCTATGAGCTCGACTGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACGCTTTCTCATTTGCGTCGTACAAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAATTTGTCTCTGATGTGCTACGTTAGTGTCGGATCTCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTACGAACCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGTATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGACATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACTTGGTTTTGACCAAGGATCTCGTCAACAGACTGGCTAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGCTAATTAGGGCTGGTGCGGTGGAATATCTCGATGCCGAGGAAGAAGAAACGTCTATGATTTGCATGACACCGGAGGATCTTGAACTTTACCGTCTTCAAAAAGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGA---------------------------------------------------------------------------------- Trichoderma_reesei GCCAAGCTGTTCCGTGGCATCATGCGAAGAATGAACACCGAGCTGGCCAAC--TATCTGAGACGGTGCGTGGAGGGCAACCGACACTTCAATCTCGCCGTCGGCATCAAACCCGGCACGCTTTCAAACGGCCTAAAGTACTCGCTCGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGCTACACGTTTGCCTCGACCCTCTCGCATTTGCGGCGTACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACCCATTGGGGTCTCGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGTGGCCTTGTCAAGAACCTGTCTCTGATGTGTTATGTCAGTGTCGGCTCTCCGTCAGAGCCCTTGATTGAGTTTATGATCAATAGGGGCATGGAAGTGGTCGAGGAATACGAGCCACTGCGTTATCCTCACGCGACCAAGATCTTCGTCAACGGTGTCTGGGTGGGCATTCACCAGGACCCTAAGCATCTCGTCCAGCAGGTCGT-GGACACTCGTCGTAAATCCTACCTGCAGTACGAGGTCTCTCTCGTCAGAGAAATTCGAGACCAAGAGTTCAAGATCTTCTCGGA-TGCTGGCCGTGTTATGCGACCCGTTTTTACCGTCCAGCAAGATGAAGAGTCGGACACTGGCATTCCAAAGGGCCACTTGGTACTGACCAAAGACCTCGTTAATAAGTTGGCCCAAGAGCAGGCCGAGCCGCCAGAAGACCCAAGCATGAAGATTGGATGGGAGGGGCTCATCAGGGCTGGTGCGGTTGAGTATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACTCCCGAGGATCTCGAGCTGTATCGTGCCCAGAAGGCAGGCATTGCCACCGAAGAGGACGTGGGCGACGATCCGAACAAGCGACT-CAAGACGAGGACAAACCCAACAACCCACATGTACACGCACTGCGAGATTCATCCAAGCATGA------------------------------- Trichoderma_rogersonii ---------------------------------AATACTGAGCTGGCCAAC--TACTTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTCGGCATCAAGCCTGGCACGCTTTCCAACGGATTGAAGTACTCACTCGCCACCGGAAATTGGGGTGATCAGAAGAAGGCAATGAGCTCAACCGCGGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTGTGCCCTGCTGAGACTCCAGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCACGCCACAAAGATCTTCGTGAATGGTGTTTGGGTTGGAATCCATCAAGATCCCAAGCATCTGGTAAACCAAGTTTT-GGATACCCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATCCGTGACCAAGAGTTCAAAATCTTCTCCGA-CGCCGGTCGTGTCATGCGTCCCGTCTTTACTGTACAGCAAGAAGATGACCCGGAAACAGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGGCTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCTGGTATCAACACGGAGGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTATCATTCCTTT Trichoderma_rossicum ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_saturnisporum -------------------------------------------------------------------------------------------------------------------------------CGGCTTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGCTACACGTTTGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATCGGACGAGATGGCAAGCTGGCGAAGCCTCGACAGCTTCACAACACCCATTGGGGTCTGGTCTGCCCAGCCGAAACCCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAATCTGTCTCTGATGTGTTACGTCAGTGTCGGCTCTCCATCAGAGCCGTTGATTGAGTTTATGATCAACAGGGGCATGGAAGTTGTCGAGGAATACGAGCCGCTGCGTTATCCTCACGCTACCAAGATATTTGTCAACGGTGTCTGGGTGGGCATCCACCAGGATCCCAAGCATCTGGTTCAACAGGTCGT-GGACACTCGTCGTAAATCTTACCTGCAGTACGAGGTCTCTCTCGTCAGAGAAATTCGAGACCAAGAGTTCAAGATCTTCTCCGA-CGCAGGCCGCGTCATGCGACCCGTCTTTACCGTCCAGCAAGATGAAGAATCGGACACTGGCATTCCAAAGGGCCACTTGGTACTGACCAAAGAGCTTGTTAATAAGCTGGCCCAAGAGCAGGCCGACCCTCCAGAAGACCCAAGCATGAAGATTGGTTGGGAGGGACTCATCAGGGCTGGTGCTGTTGAATATCTCGAC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_sinuosum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCCACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGTTACGTCAGTGTCGGTTCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTGGTAGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTATGGGTTGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATCAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATTGGAGACGATCCGAACAAGCGATT-GAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCTAGTATTATTCCATT Trichoderma_spirale01 GCCAAGCTGTTCCGTGGTATCATGCGTAGAATGAACACCGAGTTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGTCACTTCAACCTGGCTGTTGGCATCAAGCCCGGCACACTCTCCAACGGATTGAAGTATTCTCTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGTTTGGTATGCCCGGCCGAGACCCCTGAGGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAGGAGTACGAACCGCTGAGGTATCCCCATGCGACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGACACTCGTCGTAAATCCTATCTGCAATACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACTGTACAGCAAGAGGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTAACCAAGGATCTTGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAAGGGTTAATTCGGGCTGGTGCGGTGGAATATCTCGATGCTGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTTTACCGTCTTCAGAAGGCTGGCATTGCCACAGATGAAGACATGGGAGACGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_spirale02 GCCAAGCTATTCCGTGGTATTATGCGAAGAATGAACACTGAGTTGGCCAAC--TATCTAAGACGATGTGTTGAGGGCAACAGACACTTCAACCTTGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAATATTCGCTTGCCACTGGAAACTGGGGAGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCCTCGACCCTGTCGCATTTGCGTCGAACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCTTTGATGTGTTACGTCAGTGTGGGTTCTCCCTCCGAACCCCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTACTTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAAGAATTCAAAATCTTTTCTGA-CGCTGGCCGTGTCATGCGACCTGTCTTTACTGTTCAGCAGGAAGATGATCCGGAAACAGGCATCAACAAGGGCCACCTAGTATTGACCAAGGAGCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACAGCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCTGGTATTTCTACTGAGGAAGATATGGGAGATGATCCAAACAAGCGACT-AAAGACAAAGACCAATCCAACCACTCACATGTACACCCATTGTGAGATTCACCCAAGTATGATCTTGGGCAT-TGCGCTAGTATCATTCCTTT Trichoderma_spirale03 --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCCTCGACCCTGTCGCATTTGCGTCGAACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTTTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTGGGTTCTCCCTCTGAACCCTTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-AGACACTCGTCGCAAATCCTACTTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAAGAATTCAAAATCTTTTCTGA-CGCAGGCCGTGTCATGCGACCTGTTTTTACTGTTCAGCAGGAAGATGACCCGGAAACAGGTATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGACTGGCCAAGGAGCAGGCTGAACCTCCTGAAGACCCAAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAAGAAGAGGAGACAGCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCTGGTATTTCTACTGAGGAAGACATGGGAGATGATCCAAACAAGCGACT-AAAGACGAAGACAAACCCAACCACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTGGGCATTTGCGCTAGTATCATTCCTTT Trichoderma_stilbohypoxyli --------------------------------------------------------------------------GGGTATCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTCAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCCCAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCTCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACACACTGGGGCTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTGGAGGAGTACGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGTAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGGGACCAAGAATTCAAAATCTTCTCTGA-TGCCGGCCGCGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGGCTGGCCAAAGAGCAGGCCGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGTTGATCAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTCGAGCTTTATCGTCTTCAAAAGGCCGGCATTGCCACGGACGAAGACATAGGAGATAACCCAAACCAGCGTCT-TAAGACAAAGACGAATC---------------------------------------------------------------------------- Trichoderma_strictipile --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGTGGTCTGGTCAAAAACCTGTCGTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTGGTTGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCAGGATCCTAAGCATCTGGTGAACCAGGTCCT-GGACACTCGTCGCAAGTCTTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTGAAACGGGCATCAACAAGGGTCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAGGCTGAACCTCCGGAAGACCCAAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGACTTCAGAAAGCCGGTATTTCTACCGAGGAAGACGTGGGAGATGATCCGAACAAGCGACT-AAAGACAAGGACAAATCCAACAACTCACATGTACACCCATTGCGAGATTCACCCAAGCATGATCTTGGGCATCTGCGCTAGTATCATTCCTTT Trichoderma_strigosum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCGCCTTCTGAGCCCTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCACGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGTATCCACCAAGATCCCAAGCACCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTGGTCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACCGTGCAGCAAGAAGATGACCCGGAGACGGGTATCAACAAGGGTCACCTGGTCTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCGCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTAATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGGCCATGATCTGCATGACACCGGAAGATCTTGAGCTGTACCGTCTTCAGAAGGCCGGTATTTCCACAGAGGAAGACATGGGAGATGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTACACGCATTGCGAGATTCACCCTAGTATGATCTTAGGTATCTGTGCTAGTATTATTCCTTT Trichoderma_stromaticum GCTAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAACTGGCCAAC--TATCTGAGACGGTGCGTTGAGGGCAACCGACATTTCAATCTTGCTGTTGGCATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCTCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTCTCACATTTGCGTCGTACCAACACGCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAAGGACAAGCTTGCGGTCTGGTCAAAAACTTGTCTCTGATGTGTTACGTCAGTGTCGGCTCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTATGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTTGTCAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTTGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGATCCGGAAACAGGCATCAACAAGGGCCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTTGCCAAGGAGCAGGCCGAACCTCCGGAAGACCCTAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAAGAGACGTCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCTGGTATTTCTACTGATGAGGACATGGGAGATGATCCGAACAAGCGACT-CAAGACTAAGACGAATCCAACCACGCACATGTACACGCATTGTGAGATTCACCCGA-CATGATTTTGGGTATCTGTGCCAGTATCA?TTCCTT Trichoderma_surrotundum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGTTACGTCAGTGTCGGATCCCCATCTGAACCTCTGATTGAGTTCATGATCAACCGAGGTATGGAGGTTGTAGAGGAGTATGAGCCACTACGATATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAATAGGCTGGCCAAGGAGCAGGCCGAGCCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAAGATCTCGAGCTTTATCGCCTTCAAAAGGCTGGTATCTCTACTGAAGAGGACATCGGAGACGATCCGAACAAGCGATT-GAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCCAGTATTATTCCATT Trichoderma_thailandicum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAAGCCATGAGTTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCAACCCTGTCTCATTTGCGTCGAACCAATACACCCATTGGAAGAGATGGCAAGCTAGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCTGAAGGACAAGCTTGTGGCCTGGTCAAAAACCTTTCATTGATGTGCTACGTCAGTGTCGGTTCCCCCTCTGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCCCATGCTACCAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAGGACCCCAAGCATCTGGTAAACCAGGTTTT-GGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTCTCTCTCGTCAGGGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGA-CGCAGGTCGTGTCATGCGACCTGTTTTTACTGTTCAGCAGGAAGATGACCCTGAGACGGGTATCAACAAGGGCCACTTGGTCTTGACCAAGGAACTCGTCAACAGACTGGCCAAAGAACAGGCCGAACCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAAGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCTGAGGAAGAGGAGACTTCCATGATTTGCATGACGCCAGAAGATCTCGAGCTGTACCGCCTTCAAAAAGCCGGTATTTCTACTGAGGAAGACATGGGAGATGACCCAAACAAGCGACT-AAAGACGAAGACAAACCCAACCACTCACATGTACACTCATTGTGAAATTCACCCAAGCATGATTCTGGGCATCTGCGCTAGTATTATCCCTTT Trichoderma_thelephoricola --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTCAACCGCTACACGTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACGCCCATTGGAAGAGATGGCAAGTTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCCGCCGAGACACCTGAAGGGCAAGCTTGTGGTCTGGTCAAAAATCTGTCGTTGATGTGTTACGTCAGTGTCGGTTCCCCCTCTGAACCTCTGATTGAATTCATGATCAACCGAGGTATGGAAGTTGTAGAGGAGTATGAGCCACTGCGATATCCTCATGCTACCAAGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCTTATTTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGA-CGCGGGCCGTGTCATGCGACCTGTGTTTACCGTTCAGCAAGAAGATGACCCTGAAACGGGTATTAACAAGGGCCATTTGGTACTGACCAAGGAACTCGTCAACAGGCTGGCCAAGGAGCAGGCCGAACCTCCAGAGGACCCGAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGCGCAGTTGAATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTTTATCGCCTTCAGAAGGCTGGTATCTCTACTGAAGAGGACATGGGAGACGATCCGAACAAGCGATT-GAAAACAAAGACAAACCCAACAACTCACATGTACACTCATTGTGAGATTCATCCAAGCATGATTTTGGGCATCTGCGCTAGTATTATTCCATT Trichoderma_theobromicola ----------------------------------------------------------GAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACGCTCTCCAACGGTTTGAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAAAAGGCAATGAGCTCGACCGCAGGTGTATCACAGGTGCTTAACCGTTACACTTTTGCTTCGACACTTTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAATACACACTGGGGTTTGGTGTGCCCGGCCGAGACGCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAACTTGTCTCTAATGTGCTACGTCAGTGTCGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAGGTCGTTGAAGAGTACGAACCACTGAGATATCCCCATGCGACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCACCAAGACCCCAAGCATCTGGTGAACCAAGTCCT-GGATACTCGTCGTAAATCCTATCTGCAGTACGAAGTCTCTCTGATCAGAGATATTCGTGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGTCGTGTTATGCGTCCTGTCTTTACCGTACAGCAAGAAGATGACCCGGAAACGGGCATCAACAAGGGCCACCTGGTTTTGACCAAGGATCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCTCCGGAAGACCCAAGCATGAAGCTTGGATGGGAGGGGTTAATTAGGGCTGGTGCGGTGGAATATCTTGATGCCGAGGAAGAAGAAACGGCTATGATTTGCATGACACCGGAGGATCTTGAGCTTTATCGTCTTCAGAAGGCTGGTATTTCCACGGATGAAGACATGGGAGACGATCCAAACAAG--------------------------------------------------------------------------------------------------- Trichoderma_tomentosum --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAGGCCATGAGCTCAACCGCAGGTGTCTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTCCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACGCCCGAAGGACAGGCTTGTGGTCTAGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGAGTTCATGATCAACAGAGGCATGGAAGTCGTCGAAGAATACGAGCCGCTGCGGTATCCTCATGCTACTAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACCTGGTGAACCAGGTTCT-GGATACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGTCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACCTGGTATTAACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGATTAATTAGGGCTGGTGCGGTTGAATATCTCGACGCTGAGGAAGAAGAGACATCCATGATTTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATTTCCACCGAGGAAGACATGGGAGATGATCCGAACAAGCGTCT-AAAGACAAAGACAAACCCGACAACTCACATGTACACCCATTGCGAGATTCACCCAAGTATGATCTTAGGCATCTGTGCTAGTATCATTCCTTT Trichoderma_turrialbense ---------------------------------------------------------------------------------------------------------------------CTCTTTCCAACGGATTGAAGTATTCACTTGCCACTGGAAACTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAATCGCTACACTTTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAATTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTCTGGTCTGCCCGGCTGAGACTCCTGAAGGACAAGCTTGTGGCTTGGTCAAAAACTTGTCCTTGATGTGCTACGTCAGTGTCGGATCTCCTTCCGAACCCCTGATCGAGTTCATGATCAACAGAGGCATGGAGGTTGTCGAAGAGTACGAGCCGCTGCGGTATCCCCATGCTACAAAGATCTTTGTAAACGGTGTCTGGGTGGGAGTTCACCAAGATCCCAAGCACCTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTGATCAGGGACATTCGTGATCAGGAATTCAAAATCTTCTCCGA-TGCGGGTCGTGTTATGCGTCCCGTCTTTACTGTTCAGCAAGAAGACGACCCGGAAACTGGCATTAATAAGGGCCATTTGGTTTTGACAAAGGAACTGGTCAACAGGCTGGCAAAGGAGCAGGCTGAGCCTCCGGAGGACCCGAGCATGAAGATTGGATGGGAGGGGTTAATTAGGGCCGGTGCGGTTGAATATCTCGATGCCGAGGAAGAAGAGACGGCCATGATTTGCATGACGCCTGAGGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGCATTTCCACAGAAGAAGACATGGCAGATGATCCGAACAAGCGACT-CAAGACGAAGACGAATCCAACAACTCACATGTACACGCATTGTGAGATTCACCCGAGCATGATCTTGGGCATCTGTGCTAG------------ Trichoderma_velutinum GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAATTGGCCAAC--TACCTAAGACGGTGCGTTGAGGGTAACCGACACTTCAACCTGGCTGTGGGTATCAAGCCCGGCACGCTTTCAAACGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATTTGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCTCTGATTGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTACGTTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCATCAAGACCCTAAGCACTTGGTGAACCAGGTTCT-GGACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTGAGAGAAATTCGTGACCAGGAATTCAAAATCTTTTCCGA-CGCAGGCCGTGTCATGCGACCTGTCTTTACTGTTCAGCAGGAAGATGACCCGGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAGGCTGAACCTCCGGAAGATCCCAGCATGAAGATCGGATGGGAGGGATTAATCAGAGCCGGTGCGGTTGAATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATCGTCTTCAGAAGGCCGGTATTTCTACTGATGAAGACATGGCAGATGATCCGAACAAGCGACT-AAAGACAAAGACAAACCCGACAACTCACATGTATACCCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_victoriensis GCCAAGCTGTTCCGTGGTATCATGCGAAGGATGAACACTGAGCTGGCCAAC--TATCTCAGACGCTGTGTCGAGGGCAACAGGCATTTCAACCTTGCCGTTGGTATCAAGCCCGGCACGCTGTCCAATGGCTTGAAGTATTCTCTTGCCACCGGCAATTGGGGTGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTTAACCGCTATACCTTCGCTTCCACTTTGTCACATTTGCGCCGTACCAACACACCCATTGGACGAGACGGCAAGTTGGCAAAGCCTCGACAACTGCACAACACGCATTGGGGCTTGGTCTGCCCGGCCGAGACACCCGAAGGACAGGCTTGTGGCTTGGTCAAAAACTTGTCTTTGATGTGTTATGTCAGTGTCGGATCTCCCTCCGAGCCTTTGATCGAATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCACTGCGGTATCCTCATGCCACAAAGATCTTCGTCAACGGTGTTTGGGTTGGCGTTCACCAAGATCCCAAGCATCTCGTCAACCAAGTCTTGGGATACTCGTCGTAAATCCTACCTTCAGTACGAAGTCTCTCTCATCAGAGACATTCGAGACCAAGAATTCAAAATCTTCTCTGA-CGCCGGCCGTGTTATGCGGCCTGTCTTTACCGTCCAGCAGGAGGATGACCCGGACACGGGCATTAACAAGGGCCACTTGGTCTTGACCAAGAGCCTCGTCAACCAGCTTGCGAAGGAGCAGGCTGAGCCCCCAGAAGATCCAAGCATGAAGCTTGGCTGGGAAGGCTTGATTAGGGCTGGTGCGGTTGAGTATCTCGATGCGGAAGAAGAGGAGACGTCTATGATTTGCATGACGCCGGAAGATCTCGAGCTCTATCGTCTTCAGAAAGCTGGCATTGTCACGGAAGAAGACATGGGCGACGATCCCAACAAGCGTCT-CAAGACAAAGACGAACCCGACGACTCACATGTACACGCATTGTGAAATTCACCCCAGCATGATCTTAGGTATCTGTGCTAGTATCATTCCTTT Trichoderma_virens -------------------------------------------------------------------------------------------------------------------------------CGGATTGAAGTATTCGCTTGCCACTGGAAACTGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCTGGTGTGTCTCAGGTGCTTAACCGTTACACGTTTGCTTCGACCCTATCACATTTGCGTCGTACCAACACCCCCATTGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAACTTCACAACACGCATTGGGGTTTGGTGTGTCCAGCCGAGACACCCGAAGGGCAGGCTTGTGGTCTGGTCAAAAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTTCTCCCTCCGAACCACTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCATCTGGTGAACCAGGTTCT-AGACACTCGTCGCAAATCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAGATTCGAGACCAGGAATTCAAAATCTTTTCCGA-TGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAGGATGACCCTGAAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAACAGATTGGCTAAGGAGCAAGCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAGGGACTAATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAAGAAGAGGAGACGTCGATGATTTGCATGACACCAGAGGATCTCGAGCTGTATCGTCTTCAGAAAGCCGGTATCTCTACCGATGAAGACATGGGAGATGATC----------------------------------------------------------------------------------------------------------- Trichoderma_virescentiflava --------------------------------------------------------------------------------------------------------------------------------------------------------------TGGGGTGATCAGAAGAAAGCCATGAGTTCAACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCAACCCTGTCTCATTTGCGTCGAACCAATACACCCATTGGAAGAGATGGCAAGCTAGCAAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTGTCCAGCCGAGACACCTGAAGGACAAGCTTGTGGCCTGGTCAAAAACCTGTCATTGATGTGCTACGTCAGTGTCGGTTCCCCCTCTGAACCTCTGATTGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGATATCCTCATGCTACCAAGATTTTCGTGAACGGTGTCTGGGTTGGAGTTCACCAGGACCCCAAGCATCTGGTAAACCAGGTTTT-GGACACTCGCCGCAAGTCTTATCTGCAGTACGAAGTCTCTCTCGTCAGGGAAATTCGAGACCAGGAATTCAAAATCTTTTCTGA-CGCAGGCCGTGTCATGCGACCTGTTTTCACTGTTCAGCAGGAAGATGACCCTGAGACGGGTATCAACAAGGGCCACTTGGTCTTGACCAAGGAACTCGTCAACAGACTGGCCAAAGAGCAGGCCGAACCTCCGGAAGACCCGAGCATGAAGATTGGGTGGGAAGGATTAATCAGGGCTGGTGCGGTTGAATATCTCGATGCTGAGGAAGAGGAGACTTCCATGATTTGCATGACGCCAGAAGATCTCGAGCTGTACCGCCTTCAAAAAGCCGGTATTTCTACTGAGGAAGACATGGGAGATGATCCAAACAAGCGACT-AAAGACGAAGACAAATCCAACCACTCACATGTACACTCATTGCGAAATTCACCCAAGCATGATTCTGGGCATCTGCGCTAGTATTATCCCTTT Trichoderma_viride -----------------------------------------------------------------------------------------------------------------GGCACACTTTCCAACGGACTAAAGTACTCACTCGCCACCGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGACAGCTCCACAACACACATTGGGGTTTGGTGTGCCCGGCTGAGACCCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTCTGATGTGCTACGTTAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATTTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCCAAGCATCTGGTAAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAAGTTTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCAGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACTGTACAGCAGGAAGATGACCCGGAAACGGGAATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGGCCAAAGAGCAGGCTGAGCCCCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGAGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTAT?GTCTTCAAAAGGCCGGCATTTCCACAGATGAAGACATAGGAGATGATCCAAATAAG--------------------------------------------------------------------------------------------------- Trichoderma_viridescens GCCAAGCTGTTCCGTGGTATCATGCGGAGAATGAATACCGAGCTGGCCAAC--TACCTGAGACGATGTGTTGAGGGTAACCGCCACTTCAACCTTGCTGTTGGCATCAAGCCCGGCACACTTTCCAACGGACTCAAGTACTCACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTCCACAACACACATTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTTGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCCAAGCATCTGGTGAACCAAGTTTT-GGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGA-TGCCGGTCGTGTTATGCGTCCCGTCTTCACCGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGACTGGCTAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTTCCACGGAAGAAGATATAGGAGATGATCCAAACAAGCGTCT-CAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTATCATTCCTTT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M15965] TITLE CAL; LINK TAXA = Taxa1; DIMENSIONS NCHAR=465; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hypocrea_aeruginea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_alcalifuscescens --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_alni ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CCCCCC--------CTTTTGCGAATAGGCATCGGAACACCGAATGACTTG----CT-TCGACCGA-T-ATTTC-C--CTTGCCAG-C-CCGTTTTATGATGGACGAGCAAAGAAA----------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAAATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAGAGTCCAAGTATTGGATCGTTACCACATTCGGGCTAATACGGAGCGGTGTAAAATTCCTGACCATGATGGCAGG------ Hypocrea_alutacea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_americana --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_andinensis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_avellanea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_chionea GCGGT-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTGGTGCGAACCATTGTCGGAGAGCCTGAACCTGCG----ACACCGATCGA-A-ATTTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAG-ACATGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATTCGCTGAAACACATGACGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTCACCATGATGGCCAGAAA-GA Hypocrea_crystalligena --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_dacrymycella --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_danica --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_decipiens --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_delicatula --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_epimyces CCGGT-TTGTGTGCTAAC-CCAGCTTG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CCCCCC--------CTTTTGCGAATAGGCATCGGAGC-CCGAATGACTTG----CTGCCGACCGA-T-ATTTTCC--CTTGCCAG-C-CCGTTTCATGATAGACGAGCAAG--------------------AAAAA-AACTGACAG-GCTTGAA-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTTGGTCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAAAAGCCCAAGTATTGGATCGTTATCACATTCGGGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGAGCAAA---- Hypocrea_eucorticioides --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_flaviconidia GCGAT-TTGGGTACTAAT-CTACG-GGCCTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTGGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAGCTATTACTGGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATTTA-C--CCGGCTGG-C-AATTTTT-TGACGAATAAACGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCCGGTATGTCAATAGCAGAAACACATGGCGGGTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCGAAAAAT Hypocrea_fomiticola --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_leucopus --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_lutea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_megalocitrina --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_microcitrina --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_moravica --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_neorufa GCGAT-TCGGGTGCTAAT-CGGAT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTGGTGACGCGATACTCCTC-TACCCCCTCCTCACCAATTCTGTGCGAACTATTGCTAGAGCACTAGAACCTGCG----ATACCGATCGA-A-ATTTC-T--GCGGCTGT-C-ATATTTTATTACGAATACACAGA--------------------CAAAACAACTAACAA-CCTTGAC-TTGGCAGGCCAGATTACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGGTCCATCGATTTCCCTGGTATGTCAATAGCAGAAACTCCCGACGGCTGCCGAATACGGACTAATATAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAAGAT Hypocrea_nigrovirens --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_nybergiana --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_parepimyces --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_parmastoi --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_patella --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_phyllostachydis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_pillulifera --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_placentula --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_protopulvinata --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_pseudostraminea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_psychrophila --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_pulvinata --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_rodmanii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_semiorbis GCGAC-TCGAGTGCTAAC-CAAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGT-AGCGAGTGACGCGACACCACCC-TT---CCCCT--------TTTTTGCGAACAGGCACCAGAGAACCGAATGATTTG----CTGCCGACCGA-G-ATTTC-C--CTTGCCGG-C-CCGTATCATGGTGAATGGAC-------------------------AAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCAGAGTTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAGAGTGGAAACATTCGGCCGTTGCTGTATTTGGGCTAATTTGGAGCGGTGAAGAATTTCTTACCATGATGGCCCAGAAAGA Hypocrea_seppoi --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_spinulosa --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_straminella ACGAT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AACGAGTGACGCGACACCACCC-CT---CCCCC--------CCTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-AATTT-C--CTTGCCAG-C-CCGTTTGATGATAGATGAGTAAAG-------------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTTGAAGTATTGGGTCGTTACCGCATTCGGGCTAATACGGAGCGGTGTAGAATTCCTGACCATGAG------------ Hypocrea_subalpina --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_sulawesensis GCTGTTTTGAGTGCTAAC-GCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-ACCGAGTGACGCGACACCTAGT-ACCTCCCCCCCCTTTTTTTGTGTGCGAAGAGGCACCAGAGCACCGGAGAAATT-----CTACCGACCGA-T-ATTTT-C--CTTGTCCG-C-CCGTTTCATGATAGTTGAGCAGAGAAGGGGAAGAAA-------AAGAA-AACTGACAG-GCTTGAC-TATGCAGGCCAGATCACCACCAAGGAGTTGGGCACCGTGATGCGCTCTCTCGGACAAAACCCGTCCGAGTCAGAGCTGCAGGACATGATCAATGAAGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAATAGTCGAGGCGTCGGGTGGTTGCCGTATCGGTGCTAATATGGAGCGGTGTAGAATTCCTGACCATGATGG---------- Hypocrea_sulfurea --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypocrea_tawa ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-GGCGAGTGACGCGACACCACCT-CT--CCCCCC--------CTTTTGCGAATAGGCATCGGAACACCGAATGACTTG----CCGCCGACCGA-T-ATGTC-C--CTTGCCAG-C-CCGTTTCATGATAGACCAGCAAAGAAAAG--------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCCAAGTATTGGATCGTTACCACATGCGGGCTAATACGGAGCGGTGTAGAATTCCTGACCATGT------------- Hypocrea_voglmayrii --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Hypomyces GGTCT-TTTCTTGCTAACTTT----TG-CTTCAGGACAAGGACGGCGATGGTATGTAACAACAGCTTAACGCGAACCTCCCCTCTGCCTTTTC---------TTTCGCGATCCTTGGCTCGCACGCC-AATGTTACA----TCTCAGATCCA---GATAC----TTCTACAT---CATGATTATTAGGGATGGGTTTATAAATTG-------------TTGTA-TGCCGAGGCTAACTCAT-GTGGTAGGCCAGATCACCACCAAGGAGCTCGGCACCGTCATGCGATCTCTGGGCCAGAACCCTTCCGAATCTGAACTTCAGGATATGATCAACGAGGTCGATGCTGACAA-CAACGGCTCCATCGATTTCCCTGGTACGGCCACGATTAACATGTCTGGATGCGAACG-----AAGCTAATACATATGATTTCAGAATTCCTTACCATGATG----------- Sphaerostilbella AGTTT-TCGTTTGCTAAT-ATAGT-CG-CTGTAGGACAAGGACGGAGATGGTATGTTCAACCTTAGTGGCGCGACTCTTCTT-TTTCC-----------ACCATTCCGAACCATGTCCCGTAACCCAAGGTGTTGAG--------CGGCGAA-T-ATCGA-C--CCGAACTA-C-CCCGTCTATAACAGAAACATGGAGAAGCGCCCAGTGATTTGGAACCAA-AGCTGACCC-AGTCGAT---CCTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCCTTGGGCCAGAACCCTTCAGAGTCTGAACTTCAGGACATGATCAACGAGGTTGACGCCGACAA-CAATGGCTCTATTGACTTCCCTGGTATGTCAAAGCTGGAATCATGACGTTAACACATGGCACATGCTGATATTGGACAATGAAGAGTTTCTCACCATG-------------- Trichoderma_aggressivum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_amazonicum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_arundinaceum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_asperelloides GCGAT-TTGGGCACTAAC-CCGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGGGTTACTACTAGAGCGCCTGAACCTACG----ATAGCGATCGA-A-ATTTC-C--CCGACTGG-C-CATTTTTATGACGGATAGGAGGA--------------------CGCAA-AGCTAACAG-CCTTGAC-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACGCATGACGGCTGCCGAATACGCACTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATG----------- Trichoderma_asperellum TCGAT-TTGGTCACTAAC-CCGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGGGCTATTACTAGAGCGCCTGAACCTGCG----ATAGCGATCGA-A-ATTTC-C--CCGACTGC-C-CATTTTTATGACGGATAGGAGGA--------------------CGCAA-AGCTAACAG-CTTCGAC-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAAGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTC----------------------- Trichoderma_atrogelatinosum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_atroviride --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_aureoviride --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_austrokoningii GCGAT-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCATTGTTGGAGCGCCTGGAGTTACG----AACGCGATCGA-A-ATTTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAGAATGTGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACAGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAAAAGCTGAAACACAAGACGGCTGCCGAGTGCGGGCTAATCTAGAGCGGTGAAGAGTTCCTCACCATGATGGCCCAGAAAGA Trichoderma_brevicompactum -CGGT-TTGGGTGCTAAC-CCAGC-TC-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT-CTCCCCC---------TTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTTCCGACCGA-T-ATTTG-C--AACCCCCTT-------TCATGATATCTGAGCAAAGAAA-------------------CG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTGTTGGGCCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCACGAAAGAT Trichoderma_brunneoviride ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT---CCCCC--------CTTTTGCGAATAGGCATCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-CTTTT-C--CTTGCCAG-C-CCGTTTCATGATGGACGAGCAAAGAAGAAG-------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCCAAGTATTGGATCGTTGCCACATTCGGGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCCAGAAAGAT Trichoderma_candidum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_caribbaeum GCAAT-ATGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCAGTGTTGGAGCACCTAAGCCTGCG----ACACCGATCGA-A-AATTC-A--CCGACTGG-C-AATTTTTATGACGAAGAGACGGA--------------------CAAGA-CACTAACAG-GCGTGGT-TTCGCAGGCCAGATTACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAATGGATCTATCGATTTCCCTGGTATGTCACTATCTGAAACACTTGGCTGCGACCGAATACGGGCTAATGTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCA------- Trichoderma_catoptron ACTGT-TTGAGTGCTGAC-CCAGC-TG-CTCCAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACAAGCC-TT--CCCCCC--------CTTTTGCGAACAGGCACCAGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTTA-C--CTTGCCGG-C-CCATTTCATGATATATGGTCAAAGAA-----------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATTAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCGAAATATTGGGTCGTTGCCACATTCGGGCTAATACGGAGCGGTATAGAATTC----------------------- Trichoderma_ceraceum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_ceramicum GCTGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGCGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-TT---CCCCC--------CTTCTGCGAACAGGCACCAGAGCACCGAATGATTTG----CTGCCAACCAACT-ATTTC-C--CTCGCCAG-C-TCGTTTCATGACATATGGGCAAAG-------------------AAAAA-AACTGACAG-GCCTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAAGTCGACGCAGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAATAGTCGAAATGATGGGTCGCTACCGTATTTGGGCTAATGTGGAGCGGTGTAGAATTCCTGACCATGATG----------- Trichoderma_cerinum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_chlorosporum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_chromospermum ACTGT-TCGAATGCTAACCCAAGC-GG-CTACAGGATAAGGATGGTGATGGTACGTAGC-AGCGGGTGCCACGACACTCAACCTCTT-CCCCC--------TCTTTGCGAACAGACACCAGAGCACCGAAAGATTCACCGCCTACCGACCGA-T-AATTT-C--CCCGCCTG-C-CCGCTTCATAATACTTGAGAAAAGAAGGGG-------------GGGGA-AACTAACAA-GCTTGAC-CCTGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTGATGCGCTCTCTGGGGCAAAATCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCATCAGTCGAAACGTTTGGTTGTTAAAGTATTGGGATTAATATGGAGCGGTGTAGAATTCCTGACCATGAG------------ Trichoderma_cinereoflava --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_cinnamomeum ACGCT-TTGAGTGCTGAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CTCCCACCCC----------TTTGCGAACAGGCACCGGAGCACCGAATGGCTTG----CTGCCGACCGA-T-AATTT-C--CTTGCCAG-C-CCGTTTGATAATAGATGGGTAAAGAAG----------------AAGAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCGTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTATTGGGTCGTTGGCACATTCGGGCTAATACGGGGCGGTGTAGAGTTCCTGACCATGATGGCACGAAAGAT Trichoderma_citrinoviride --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_costaricensis --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_crassum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_cremeum GCTGC-TTGAGTGCTAAC-CCAACGGG-CTGCAGGACAAGGACGGTGATGGTACGTAGC-AGCAAGTGGCGCGACACCACAC-TTTC-CCCTC--------TCTACGCGAACAGGCATCAGAGCACCGAACGACTGG----CTGCCGACCGA-T-ATTTT-CCTCTTGCCAG-C-TTGATTCACGATACATGAGTAAAGAAAGCAA----AAAGAA-AGAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAAGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAATAGCTACGGTGTTGGGTCGTTGGCGTGTGTGGGCTAATTTGGAGCGGTGTAGAATTCCTCACCATGATG----------- Trichoderma_cuneisporum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_dingleyae GCGAT-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGTATTTGTGCGAACCATTATTGGAGCACCTGAACCTGCG----ACACCGATCGA-A-ATTCC-A--CCGACTGG-C-AATTTTTATGACGAAGGAACGGG--------------------CAAGA-AACTAACAG-ACGTGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATTAGCTGAAACACATGACGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAA-GA Trichoderma_dorotheae GCAAT-ATGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCAGTGTTGGAGCACCTGAACTTGCG----ACACCGATCGA-A-AATTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAG-ACGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAATGGATCTATCGATTTCCCTGGTATGTCACTAGCTGAAACACTTGACTGCTACCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCAGAAAGA Trichoderma_erinaceus GCGGT-TTGAGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGTATTTGTGCGAATCATTGTTGGAGCACCTGAACGTGCG----ACTCCGATCGA---ATTTT-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAAA-AACTAACAG-ACGTGAT-TTCGCAGGCCAGATTACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGTCTTGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATTAATTGAACTATTTGATGGCTGCCGAAACCGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAAGAT Trichoderma_estonicum GCTGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGCGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-TT-CCCCCCT----------TTTGCGAACAGGCACCGGAGCACCGAATGATATG----CTGCCGACCAACT-ATTTC-C--CTTGCCAG-C-TCGTTTCATGACATGTGGGCAAAGA------------------AAAAA-AACTGACAG-GCCTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTTGGCCAGAACCCTTCCGAGTCAGAGCTGCAGGACATGATCAACGAAGTCGACGCAGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAATAGTCGAAATGATGGGTCGCTACCGTATTTGGGCTAATGTGGAGCGGTGTAGAATTCCTGACCATGATGGCACGAAAGAT Trichoderma_evansii GCGAT-TTGGGTACTAAC-CTGCT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAGCTATTACCAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATTTC-C--CCGGCTGG-C-AAATTTTATGACGAATAAGCGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTGGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCAGAAAGA Trichoderma_fertile GCTGT-TTGAGTGCTGAC-ACAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACTC-TT---CTCCC--------CTATTGCGAACAGGCACCAGAGCACCGAATGATTTG----CTGCCGATCGA-T-ATTTT-T--CTAGCCAG-C-TCGGCTCATGATACATGAACAAG--------------------GGAAA-GACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAATAGTCGAAATGATGGGTCGTCACCGTATTTGGGCTAACATGGAGCGGTGTAGAATTCCTGACCATGATGG---------- Trichoderma_gamsii GCGAC-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCATTGTTGGACCACCTGAACCGGCG----ACACCGATCGA-A-ATTTC-A--CCGACGGG-C-AATTTTTATGACGAAGAATCGGA--------------------CAAGA-AACTAACAG-ACATGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTCGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATTAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATTAGCTGAAACGCCTGATGGCTGCCAAACGCGGGCTAATTTAGAGCGGTGAAGAGTTCCTTACCATGAT------------ Trichoderma_gelatinosum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_ghanense GTCTT-CAGGGTGCTAAC-CGAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTGAC-GGCGAGTGACGCGACAACAGAG-TTATTTCCCT---------CTCCACGAACCCGCACAG--------AAGCATTTG----CTGCCGATCGA-T-CGCTC-C--CTCGTCAG-C-TTGAATCATGATAAATGGAC------------------------AAGA-AACTGACAG-GCTTGACACCCGTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGTTCTCTGGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGCTCCATCGACTTCCCTGGTACGTGACTCGCCGGAACACTTGGTGGCCGAGGAA-ACGGGCTAAC------------------------------------------ Trichoderma_hamatum01 GCGAT-TTGGGTACTAAT-CTGCT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-ACCTAGTGACGCGATACTCCTCTTTTCCCCTCCTCACCGATTTTGTGCGAGCTATCACTAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATATC-C--CCGGCTGG-C-AATTTTTATGACGAATAAACGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTGGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGGATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCAGAAAGA Trichoderma_hamatum02 GCGAT-TTGGGTACTAAT-CTGCT-GG-TTACAGGACAAGGACGGCGATGGTACGTAGT-ACCTAGTGACGCGATACTCCTCTTTTCCCCTCCTCACCGATTTTGTGCGAGCTATCACTAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATATC-C--CCGGCTGG-C-AATTTTTATGACGAATAAACGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTGGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGGATATGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAAGAT Trichoderma_hamatum03 GCGAT-TTGGGTACTAAT-CTGCT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-ACCTAGTGACGCGATACTCCTCTTTTCCCCTCCTCACCGATTTTGTGCGAGCTATCACTAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATATC-C--CCGGCTGG-C-AATTTTTATGACGAATAAACGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTGGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGGATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCA{AG}AAAG-- Trichoderma_harzianum01 ACGAT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTTT-C--CTTGCTAGCC-CCTTTTCATGATATCTGAACAAA--------------------AGGAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCTGACAA-CAACGGATCTATCG?TTTCCCCGGTATGTCAAAAGTCACAGTG--------------------------------------------------------------------- Trichoderma_harzianum02 ACGGT-TTGAGTGCTAAC-CCAGCTTG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AACGAGTGACGCGACACCACCC-CT--CCCCCC--------CTTTTGCGAACAGGCACCGGAGCATCGAATGACTTG----CTGCCGACCGA-T-ATTTT-C--CTGACCAACC-CCTTTTCATGATCTCTGAGCAAAG-------------------AAAAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGATATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTATTGGGTCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGC--------- Trichoderma_harzianum03 ACGGT-TTGAGTGCTAAC-TCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT-CCCCCCC----------TTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTTT-C--CTTGCCAGCC-CCTTTTCATGATATCTAAGCAAAG-------------------AAAGG-AACTGACAA-GCTTGAC-CCCGCAGGCCAAATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAAAAGTTATAGTGTTGGGTCGTTACCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCACGAAAGAT Trichoderma_harzianum04 ACGAT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTCT-C--CTTGCTAGCC-CCTTTTCATGATATCTGAACAAA--------------------AGGAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTTAAAGTGTTGGGTCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCCAGAAAGAT Trichoderma_harzianum05 ACGGT-TTGAGTGCTGAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CTTTTGCGAACAGGCACTGGAGCACCGAATGACTTG----CTGCCGGCCGA-T-ATTTT-C--CTTGCCAACC-CCTTTTCATGATATCTGAGCAAAGA------------------AAAAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCAGAGCTCCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTGTTGGGTCGTTGCCACATTCGGGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCC-------- Trichoderma_harzianum06 ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTTT-C--CTTGCTAGCC-CCTTTTCATGATATCTGAACAAC--------------------AGGAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTATGGGGTCGTTACCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCCAGAAAGA- Trichoderma_harzianum07 ACGGT-TTGAGTGCTAAC-CCAGCTTG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACTC-CT-CCCCCCT----------TTTGCGAATAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATCTT-C--CTTGCCAGCC-CCTTTTCATGAGATCTAAGCAAAG-------------------AAAAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAAAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTGTTGGGTCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCACGAAAGAT Trichoderma_harzianum08 ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTTA-C--CTTGCCAGCC-CCTTTTCATGATATCTGAGCAAAAG------------------AAAAG-GACTGACAA-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAAAAGTCGAAGTACTGGGTCGTTATCCCATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCCAGAAAGAT Trichoderma_harzianum09 CCGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CCTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-T-ATTTT-G--CTTGCCAGCC-CCTTTTCATGATATTTGAGCAAAG-------------------AAAAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCGAGTTATTGGGTCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGCCAGAAAG-- Trichoderma_harzianum10 ACGGT-TTGGGTGCTAAC-CCAGC-TC-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-CT--CTCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTTCCGACCGA-T-ATTTG---------CAACC-CCCTTTCATGATATCTGAGCAAAG-------------------AAACG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCCCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTCAAAGTGTTGGGCCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGGTCC------- Trichoderma_helicum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_intricatum GCAAT-ATGGGTGCTAAC-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTCCCGCTCCTCACCGATTTTGTGCGAACCAGTATTGGAGCACCTGAGCCTGCG----ACACCGATCGA-A-AATTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGG--------------------CAAGA-AACTAACAG-ATGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAATGGATCGATCGATTTCCCCGGTATGTCACTAGCTGAAACACCTGACCGCCACCGAATATGGGCTAATCTAGA------------------------------------- Trichoderma_koningii GTAAT-ATGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCG-TTTTGTGCGAACCAGTGTTGGAGCACTTAAACCTGCG----ACACCGATCGA-A-ATTTT-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAG-ATGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCACTAGCTGAAACACTTGACTGCTACCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCAGAAAGA Trichoderma_koningiopsis ACAAT-ATGAGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTCTGTGCGAACCAGTGTTGGAGCACCTGAACCTGCG----ACACCGATCGA-A-ATTTC-T--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAG-ATGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCACTAGCTGAAACACTTGACTGCTACAGAATACGAGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCA------- Trichoderma_lieckfeldtiae GCGAT-TTGGGTACTAAT-CTGCT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCATTACTAGAGCGCCTAAACCTGCG----ATACCGATCGA-A-ATCCC-C--CCGGCTGG-C-AATTTTTATGCCGAAGAAACGGA--------------------CAAGA-AGCTAATAG-ACTTGAC-TTCGCAGGCCAGATCACTACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCAACAACATAAACAAATGACGACTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCGAAAAAT Trichoderma_longibrachiatum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_longipile GCCGT-TTGAGTGCTAAC-CAAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCT-TTT--CCCCC--------CCTTTGCGAACAGGCACCAGAGCACCGAATGATTTG----CTGCCGATCGA-T-ATTTT-C--CTTGCCAG-C-CCGTTACATGATGCATGAGCAAAG-------------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCCGAGCTGCAGGACATGATCAACGAAGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAATAGTCGAAATATTGGGTCGTTACCGTATTTGGGCTAATATGGAGCGGTGTAGAATTCCTGACCATGATG----------- Trichoderma_martiale GCGAT-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCT-ATTTGTGCGAACCATTGCTGGAGCACTTGAACCTGCG----ACACCGATCGA-A-ATTCC-A--CCGACTGG-C-AATTTTTGTGACGAAGAAACGGG--------------------CAAGA-AACTAACAG-AAGTGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATCCG?TGAACCACATGGCGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATG----------- Trichoderma_melanomagnum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_minutisporum GCCAT-ATGAGTGCTAAT-CCGGT-GG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCTAGTGACGCGATAACGGTC-TTCTCCCCCC------CTTTTTTGCGAACAATCACCAGAGCACCGAAA-CCTCG----ATACCAATCGG-G-AATTT-C--TTTATCTGCC-TTTTTTTATGACGAATAGACAG---------------------GCACA-AGCTGACAG-CCTTGAC-TTCGTAGGCCAGATCACCACCAAGGAGCTAGGCACCGTGATGCGCTCTTTGGGCCAGAACCCCTCCGAATCAGAGTTGCAGGATATGATTAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAATAGCGGAAATATTCGACGGTCGCCGTATATGGGCTAATATAGAGCGGTGAAGAGTTTCTTACCATGATGG---------- Trichoderma_novaezelandiae GCTGT-TGGGGTGCTAAC-CGAGC-TG-CTGCAGGACAAGGACGGTGATGGTACGTAAC-GGCGAGTGACGCGACAACGCCC-TTTATTCCCT---------CTCTACGAACAGGCATCG--------AACCCTCTG----CTGCCGACCGA-T-AGCTC-T--CCCGACAG-C-TCGAATCATGATAAATTGGA-----------------------CAAGA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCTGAACTGCAGGATATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCCGGTATGTGAATCGCCGAAACCCATGGTGGCTGAGGTATACAAGCTAACGGGGAGCGGTGAAGAATTTCTCACCATGATGGCCCGAAAAAT Trichoderma_oblongisporum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_ovalisporum01 GCAAT-ATGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCAGTGTTGGAGCACCTGAACCTGCG----ACACCGATCGA-A-ATTTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAA-ATGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCACTAGCTGAAACACTTG----------------------------------------------------------------- Trichoderma_ovalisporum02 GCAAT-ATGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCAGTGTTGGAGCACCTGAACCTGCG----ACACCGATCGA-A-ATTTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAA-ATGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCACTAGCTGAAACACTTGACTGCTACCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAA-GA Trichoderma_pachybasioides GCGAT-TTCAGCGCTAACATGGGC-GG-ACACAGGACAAGGACGGCGATGGTATGTAGT-AGCTAGTGACGCGATAACGGTC-TTCTCCCCCC-------CTTTTGGCGGACAATCACCAGAACACCGAAA-TCTTG----ATACCGATCGG-G-ATTTT-C--TTTATTAG-C-CTCTCTCATGACGAATAGACGG---------------------ACACA-AGCTGACAG-CCTTGAC-CTGGCAGGCCAGATTACCACCAAGGAGCTAGGCACCGTTATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCCGAGTTGCAGGATATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTTAATAGCGGAAATATTCGACGGCTGTCGGGCATGGGCTAATTTAGAGCGGTGAAGAATTTCTTACCATGATGG---------- Trichoderma_parapiluliferum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_parareseei GTTTA-CAGGGTGCTGAC-CGAGCTGCTCTCCAGGACAAGGACGGCGATGGTACGTGAT-GGCGAGTGACGCGACAACACAC-TTATTGCCCT---------CTCTACGAAGCCGCACCGAAGCA--------CTTT----TTGCCGATCGA-T-CACTC-T--CTCGTCGA-C-TCGAATCATGATACATGGAC------------------------AAGA-AACTGACAG-GCTTGAC-CTCGTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGA--------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_parestonicum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_paucisporum GCGAT-TTGGGTACTAAT-ATGGT-GG-CGACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATCTTGTGCGAGCTATTACCAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATTTC-C--CCGGCTAG-C-AATTTTTGCGACGAATACAAGAA--------------------CAAGA-AACTAACAG-ACTTGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACGCGTGACGGCTGCCGAATACGGACTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCAGAAAGA Trichoderma_petersenii GCAAT-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGGCGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCAGTGTTGGAGCACCTGAGCCTGCG----ACACCGATCGA-A-AATTC-A--CCGACTGG-C-AATTTTTATGACGAAGAAACGGA--------------------CAAGA-AACTAACGG-GCGTGGT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCACTATCTGAAACACTCGGCTGCGACCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATG-------------- Trichoderma_pleuroticola ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGCAAGCGAGTGACGCGACACCACCC-CT-CCCCCCC--------CTTTTGCGAATAGGCATCGGAGCACCGAATGACCTG----CTGCCGACCGA-T-ATTTC-T--CTTGCCAGCC-CCTTTCCATGATGGACGAGCAAAG-------------------AAAAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAAAAGTTGAAAGATTGGATCGTTGCCACATTCGAGCTAATACGGAGCGGTGTAGAGTTCCTGACCATGATGGCCCGAAAAAT Trichoderma_pleurotum ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGCAAGCGAGTGACGCGACACCACCC-CTCCCCCCCC--------CTTTTGCGAATAGGCATCGAGGCACCGAATGACCTG----CTGCCGACCGA-T-ATTTC-C--CTTGCCAGCC-CCTTTCCATGATAGACGAGCCAAG-------------------AAAAG-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTTGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTGTCGATTTCCCCGGTATGTCAAAAGTTGAAAGATTGGATCGTTGCCACATTCGAGCTAATACGGAGCGGGGTAGAATTCCTGACCATGATGGCCCGAAAGAG Trichoderma_protrudens GCTC--TTGAATGCTAAT-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTTAC-CTCTGGTGACGCGATACTGCTC-TTCCCTCCCC--------CTTTTGCGAACAATACGCAGGGCACCAAACCCTTC-----TTCCCGACCGA-G-ATCTC-C--CTTTTTGG-C-CCTTCTTATGACGAATGGAC-------------------------ACA-AGCTGACAG-CCTTGAC-CCTGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTTTGGGCCAGAATCCCTCCGAGTCAGAGTTGCAGGATATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAATCCTGGGAATATTCGGCGATTTCCGGACATGGGCTAATTTAGAGCGGTGAAGAGTTCCTTACCATGATG----------- Trichoderma_pseudokoningii GTTTT-CAGGGTGCTAAC-CGAGC-TG-CTACAGGACAAGGACGGCGATGGTACGTGAC-GGCGAGTGACGCGACAACAACACTTATTTCCCT---------CTCTACGAACCCGCACCG--------AATCATTTG----CTGCCGATCGA-TAAGCTC-T--GTCGTCGG-C-TCGAATCATGACAAATGGAC------------------------AAGA-AACTGACAG-GCTTGAC-CCTGTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTGGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGCTCCATCGACTTCCCTGGTACGTGACTCGCCGGTAGACCTGGTGGCTGAGGTATACGGGCTAACGTGGAGCGGTGAAGAATTTCTCACCATGATGGCCCGAAAAAT Trichoderma_pubescens GCGAT-TTGGGTACTAAC-CTGCT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAGCTATTACTAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATTTC-T--CCGGCTGG-C-AATTTTTATGACGAACAAACGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTGGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGCCAGAACCCCTCCGAGTCTGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATG----------- Trichoderma_reesei --TT--CAGGGTGCTGAC-CGAGCTGCTCTACAGGACAAGGACGGCGATGGTACGTGAT-GGCGAGTGACGCGACAACACAC-CTATTGCCCT---------CTCGACGAAGCCGCACCGAAGCA--------CTTT----GTGCCGATCGA-T-CACTC-T--ATCGTCGA-C-TCGAATCATGATACATGGAC------------------------AAGA-AACTGACAG-GCTTGAC-CTCGTAGGCCAGATCACCACCAAGGAGTTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCTTCCGAGTCGGAGCTGCAGGACATGATCAACGAGGTTGACGCCGACAA-CAACGGCTCCATCGACTTCCCTGGTACGTGAATTGTTGGGAGATCTGGTGGTTGAGGTATACGGGCTGACGTGGAGCGGTGAAGAATTTCTCACCATGATGGCCGAAAAATG Trichoderma_rogersonii GCGAT-TTGGGTGCTAAT-CTGGC-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTCGTGCGAACCATTGTTGGAGCGCCTGAACATGCG----AACCCGATCGA-A-ATTTC-A--CCGACCGG-C-AATTTTTATGACGAAGGAGCGGA--------------------CAAGA-AACTGACAGAATGTGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCAATAGCTGAAACACATGACGGCTACCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTTCTTACCATGAG------------ Trichoderma_rossicum GCGGT-TTGAGTGCTAAC-CAAGC-TG-CTACAGGACAAGGACGGCGATGGTACGTAGT-AGCGAGTGGCGCGACAACCCAC-CT---TTCCC--------CCTTTGCGAACAGGCTTCAGAGCACCGAATAATTTG----CTGCCGACTGA-T-ATTTTCG--CTTGCCAG-C-TCGTTTCATGATCTATGGGAGAA--------------------AAAAA-TACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGAACCGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAATAATGAACGAATTTGGTCTTTGTCGGATTGGGGCTAATATGGAGCGGTGTAGAGTTCCTGACCATGATGGCCCGAAAAAT Trichoderma_saturnisporum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_sinuosum GCTGCTTTGAGTGCTAAC-CCAACGGG-CTGCAGGACAAGGACGGTGATGGTACGTAGC-AGCAAGTGGCGCGACACCACAC-TTTTCCCCTC--------TCTACGCGAACAGGCATCAGAGCACCGAACGACTGG----CTGCCGACCGA-T-ATTTT-C--CTTGCCAG-C-TCGGTTCACGATATATGAGTAAAGAAAGAAAGAAAAAAGAAGAAAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAAATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAAGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAATAGCTACGGTGTTGGGTCGTTGGCGCATGTGGGCTAATTTGGAGCGGTGTAGAATTCCTCACCATGATG----------- Trichoderma_spirale01 GCTGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAAC-TGCGAGTGACGCGACACCACTC-TT----CCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGATTTG----CTGCCGACCGA-G-ATTTT----CTTGCCAG-C-CTGTTTTATGATATA-GGGTGAAGA------------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAATAGTCGAAGTGTTTGGTCGTTAGCGTATTTGATCTAATACGAAGCGGTGTAGAATTCCTGACCATGATGGCCCAGAAAGA Trichoderma_spirale02 GCTGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAAC-AGCGAGTGACGCGACACCACTC-TT---CCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGATTTG----CTGCCGACCGA-G-ATTTT----CTTGCCAG-C-CTGTTTTATGATATATGGGTGAAGAA-----------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAATAGTCGAAGTGTTTGGTCGTTAGCGTATTTGATCTAATACGAAGCGGTGTAGAATTCCTGACCATGATGG---------- Trichoderma_spirale03 GCGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAAC-TGCGAGTGACGCGACACCACTC-TT---CCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGATTTG----CTGCCGACCGA-G-ATTTT----CTTGCAGG-C-CTGTTTTATGATATTTGGGTAAAGA------------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAATAGTGGAAATATTTGGTCGTTAGCGCATTTCATCTAATACGAAGCGGTGTAGAATTCCTGACCATGATG----------- Trichoderma_stilbohypoxyli GCGAT-TCGGGTGCTAAC-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTCTGTGCGACCTATTGTCAGAGCGCTTGAACCCGCG----GCACCGATCGA-A-ATTTC-G--CCGACTGG-C-AATTTCTATGACGAAGAAACGGA--------------------CAAGA-AACTAACAG-ACATGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTGGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATTAGGTGAAACACATGCCGGCTGCCGAACACGGGCTAATCTAGAGCGGTGAAGAGTTCCTGACCATGATGGCCAGAAAGAT Trichoderma_strictipile GCTGT-TTGAGTGCTGAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACTC-TT---CTCCC--------CTATTGCGAACAGGCACCAGAGCACCGAATGATTTG----CTGCCGATCGA-T-ATTTT-T--CTAGCCAG-C-TCGGCTCATGATACATGAACAAG--------------------GAAAA-GACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGTCAATAATCGAAATGATGGGTCGTCACCGTATTTGGGCTAACATGGAGCGGTGTAGAATTCCTGACCATGATGG---------- Trichoderma_strigosum GCGAT-TTTAATACTAAT-CTGGC-GG-CTACAGGAC-AGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATCTTGTGCGAACCATTGCTAGAGCACCTGAACCTTCG----AAGTCGATCGA-A-ATTTT-A--CCGACTGG-C-AATTTTTATAACGAAGAAACGGA--------------------CAAGA-AACTAACAG-ATGTGAT-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGATATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCAA-AACTGAAACGCATGTGGGCTGCCGAATACGAGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCCGAAAAAT Trichoderma_stromaticum GCGGT-TTGAGTGCTAAC-CCAGC-TA-CTACAGGACAAGGACGGTGATGGTACGTCA------------------ACCC---TTT----AC---------CCGTTGCGAACAGGCTTCAGAGCACCGAATGATTTG----CTGCCGACCGA-T-ATTTTTT--CTTGCCAGCC-TGTTTTTATGATCTATGGGAGAA--------------------AAAAA-TACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGAACCGTCATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCTATCGACTTCCCTGGTATGTCAATAACGAAGGAAATTTGGCATTACCGGGTTGGGGCTAATATGGAGCGGTGTAGAGTTCCTGACCATGATGGCCCGAAAAAT Trichoderma_surrotundum GCTGC-TTGAGTGCTAAC-CCAACGGG-CTGCAGGACAAGGATGGTGATGGTACGTAGC-AGCAAGTGGCGCGACACCACAC-TTTTCCCCTC--------TCTACGCGAACAGGCATCAGAGCACCGAACGACTGG----CTGCCGACCGA-T-ATTTT-TCCCTTGCCAG-C-TTGATTCACGATACAAGAGTAAAGAAAGAAAGAACAAAGAA-AGAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAAGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAAGTTGACGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAATAGCTACGGTGTTGGGTCGTTGGCGCATGTGGGCTAATTTGGAGCGGTGTAGAATTCCTCACCATGAG------------ Trichoderma_thailandicum GCTGT-TTGAGTGCTAAC-CCAGC-GG-CTGTAGGACAAGGACGGCGATGGTACGTAGC-AGCGAGTGACGCGACACCACAC--TTCCCCTCC--------CCTTTGCGAACGGGCACCAGAGCACCGAATGATCTG----CTGCCGACCGA-C-ATTTC-T--CTCGCTAG-C-TTGATTCAAGATACATGGGTAAAGAAAAGAAGAAG--------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAACTGGGTACTGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAAGACATGATCAACGAAGTTGATGCCGACAA-CAACGGATCCATCGACTTCCCCGGTATGTTAATAATCGAAATATTGGGTTGTTGGTGTATGTGGGCTAATATGAAGCGGTGTAGAATTCCTGA------------------- Trichoderma_thelephoricola GCTGC-TTGAGTGCTAAC-CCAAC-GG-CTGCAGGACAAGGACGGCGATGGTACGTAGC-AGCGAGTGGCGCGACACCACAC--TTC-CCCTC--------TCTTTGCGAACAGGCATCAGAGCACCGAATGACTGG----CTGCCGACCGA-T-ATTTT-C--CTTGCCAG-C-TTGATTCGCGATACATGAGTAAAGAAAGGAA------------GAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAAGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAATAGCTACAGTGTTGGGTCGTTGGCGCATGTGAGCTAATGTGGAGCGGTGTAGAATTCCTCACCATGATG----------- Trichoderma_theobromicola GCGAT-TTGGGTACTAAT-ATGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAGCTATTACCAGAGCGCCTGAACCTGCG----ATACCGATCGA-A-ATTTC-C--CCGGCTGG-C-AATTTTTATGACGAATACAAGGA--------------------CAAGA-AACTAACAG-ACTTGAC-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAATGGATCCATCGATTTCCCTGGTATGTCAATAGCAGAAACACATGACGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATG----------- Trichoderma_tomentosum ACGGT-TTGAGTGCTAAC-CCAGC-TG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACCACCC-TT--CCCCCC--------CTTTTGCGAACAGGCACCGGAGCACCGAATGACTTG----CTGCCGACCGA-C-ATTTT-C--CTTGCCAG-C-CC-TTTCATGATATATGAGCAAAG-------------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTACAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCCATCGATTTCCCCGGTATGTCAAAAGTCGAAGTATATGGTCGTTACCACATTCGAGCTAATACGGAGCGGTGTAGAATTCCTGACCATGATGG---------- Trichoderma_turrialbense GCTG--TTGAATACTAAT-CCGGC-TG-CTACAGGACAAGGACGGTGATGGTACGTTTC-CTCTAGTGACGCGATACTGCTC-TCCCCCCCCC------CTTTTTTGCGAACAATACGCAGAGCACCAAAT-CCTTC----TTTCCGACCGA-G-ATCTC-C--CTTTTTGG-C-CCCTCTTATGACGAATGGAC-------------------------ACA-GACTGACAG-CCTTGAC-TCTGTAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTTTGGGCCAGAATCCTTCCGAGTCAGAGTTGCAGGATATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCCGGTATGCTAATAGTGGAAATATTCGGCGATTTCCGGACATGGGCTAATTTAGAGCGGTGAAGAGTTCCTTACCATGA------------- Trichoderma_velutinum --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Trichoderma_victoriensis GCTTC-TTGTGTGCTAAC-CCGCT-TT-CTATAGGACAAGGACGGCGATGGTATGTAGC-AGCCAGTGACGCGACGCTGCCT-TTCCC------------ATCTTTGCGAACAATGTCCAAAAGCATCGAATCCTTC----CTATCGGCCGA-CCTTTCCTTGCCTTTTCAGCC-TCTTTTCGTGTCGAATGGCC-------------------------AAA-AGCTGACAG-CCCTGAC-CTCGTAGGCCAGATTACCACCAAGGAGCTGGGCACCGTGATGCGCTCTTTGGGCCAAAACCCTTCCGAGTCAGAGCTGCAAGACATGATCAACGAGGTCGATGCTGACAA-CAACGGATCTATTGATTTCCCTGGTATGTGACTGGTGAAGATGCTCGGCGGCCGCCGTATGGGAGCTGACCCAAAGCGGTGTAGAGTTCCTTACCATGATGGCCAGAAAGAT Trichoderma_virens GCTGT-TTGAGTGCTAAC-CCAGC-GG-CTACAGGACAAGGACGGTGATGGTACGTAGC-AGCGGGTGACGCGACACCACCC-TC---CCCCC--------CTTCTGCGAACAGGCCCCAGAGCACCGAATCTTTTG----CTGCCGACCAA-T-ATTTT-C--CTTGCCAG-C-CCGTTTCATGATATGTGAGCAAAGAA-----------------AAAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTGATGCGCTCTCTGGGCCAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTTGATGCCGACAA-CAACGGATCTATCGATTTCCCTGGTATGTCAAAAGTCGAAATGTTTGGTCGTTACC-CATGTGGGCTAATATGGAGCGGTGTAGAATTCCTGACCATGATGG---------- Trichoderma_virescentiflava GCTGT-TTGAGTGCTAAC-CCAGC-GG-CTGTAGGACAAGGACGGTGATGGTACGTAGC-AGCGAGTGACGCGACACACCACACTTCCCCTCC--------CCTTTGCGAACGGGCACTAGAGCACCGAATGATCTG----CTGCCGACCGA-C-ATTTC-T--CTCGCTAG-C-TTGATTCAAGATACATGGGTAAAGAAAGAA-------------AGAAA-AACTGACAG-GCTTGAC-CCCGCAGGCCAGATCACCACCAAGGAGCTGGGTACTGTGATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCAGAGCTGCAAGACATGATCAACGAAGTTGATGCCGACAA-CAACGGATCCATCGACTTCCCCGGTATGTTAATAATCGAAATATTGGGTTGTTGGCGTATGTGGGCTAATATGAAGCGGTGTAGAATTCCTGACCATGAG------------ Trichoderma_viride GCGAT-TTGGGTGCTAAT-CTGGT-GG-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCG-ATTTGTGCGAACCATTGCTGGAGCACCTGAACCTGCG----ACACCGATCGA-A-ATTTT-A--CCGACTGG-G-AATTTTTATGGCGAAGAAACGGG--------------------CAAGA-AACTAACAG-ACGTGAT-TTCGCAGGCCAGATCACCACCAAGGAGCTGGGCACTGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCTTTAGCTGATACACATGGCGGCTGCCGAATACGGGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAA-GA Trichoderma_viridescens GCGAT-TTGGGTGCTAAT-CTGGT-GA-CTACAGGACAAGGACGGCGATGGTACGTAGT-GGCTAGTGACGCGATACTCCTC-TTTCCCCTCCTCACCGATTTTGTGCGAACCATTGTTGGAGCACCTGAACCTACG----ACACCGATCGA-A-ATTTC-A--CCGACGGG-CAAAGTTTTATGGCGAAGAATCGGA--------------------CAAGC-AACTAACAG-ACATGAT-TTCTCAGGCCAGATCACCACCAAGGAGCTGGGCACCGTCATGCGCTCTTTGGGACAGAACCCCTCCGAGTCAGAGCTGCAGGACATGATCAACGAGGTCGATGCCGACAA-CAACGGATCCATCGATTTCCCTGGTATGTCATTAGCTGAAACACAAGGCGGCTGCCGGATACGAGCTAATCTAGAGCGGTGAAGAGTTCCTTACCATGATGGCCAGAAA-GA ; END; BEGIN TREES; TITLE 'Maximum Likelihood, multilocus result'; LINK TAXA = Taxa1; TRANSLATE 1 Hypocrea_aeruginea, 2 Trichoderma_aggressivum, 3 Hypocrea_alcalifuscescens, 4 Hypocrea_alni, 5 Hypocrea_alutacea, 6 Trichoderma_amazonicum, 7 Hypocrea_americana, 8 Hypocrea_andinensis, 9 Trichoderma_arundinaceum, 10 Trichoderma_asperelloides, 11 Trichoderma_asperellum, 12 Trichoderma_atrogelatinosum, 13 Trichoderma_atroviride, 14 Trichoderma_aureoviride, 15 Trichoderma_austrokoningii, 16 Hypocrea_avellanea, 17 Trichoderma_brevicompactum, 18 Trichoderma_brunneoviride, 19 Trichoderma_candidum, 20 Trichoderma_caribbaeum, 21 Trichoderma_catoptron, 22 Trichoderma_ceraceum, 23 Trichoderma_ceramicum, 24 Trichoderma_cerinum, 25 Hypocrea_chionea, 26 Trichoderma_chlorosporum, 27 Trichoderma_chromospermum, 28 Trichoderma_cinereoflava, 29 Trichoderma_cinnamomeum, 30 Trichoderma_citrinoviride, 31 Trichoderma_costaricensis, 32 Trichoderma_crassum, 33 Trichoderma_cremeum, 34 Hypocrea_crystalligena, 35 Trichoderma_cuneisporum, 36 Hypocrea_dacrymycella, 37 Hypocrea_danica, 38 Hypocrea_decipiens, 39 Hypocrea_delicatula, 40 Trichoderma_dingleyae, 41 Trichoderma_dorotheae, 42 Hypocrea_epimyces, 43 Trichoderma_erinaceus, 44 Trichoderma_estonicum, 45 Hypocrea_eucorticioides, 46 Trichoderma_evansii, 47 Trichoderma_fertile, 48 Hypocrea_flaviconidia, 49 Hypocrea_fomiticola, 50 Trichoderma_gamsii, 51 Trichoderma_gelatinosum, 52 Trichoderma_ghanense, 53 Trichoderma_hamatum01, 54 Trichoderma_hamatum02, 55 Trichoderma_hamatum03, 56 Trichoderma_harzianum01, 57 Trichoderma_harzianum02, 58 Trichoderma_harzianum03, 59 Trichoderma_harzianum04, 60 Trichoderma_harzianum05, 61 Trichoderma_harzianum06, 62 Trichoderma_harzianum07, 63 Trichoderma_harzianum08, 64 Trichoderma_harzianum09, 65 Trichoderma_harzianum10, 66 Trichoderma_helicum, 67 Hypomyces, 68 Trichoderma_intricatum, 69 Trichoderma_koningii, 70 Trichoderma_koningiopsis, 71 Hypocrea_leucopus, 72 Trichoderma_lieckfeldtiae, 73 Trichoderma_longibrachiatum, 74 Trichoderma_longipile, 75 Hypocrea_lutea, 76 Trichoderma_martiale, 77 Hypocrea_megalocitrina, 78 Trichoderma_melanomagnum, 79 Hypocrea_microcitrina, 80 Trichoderma_minutisporum, 81 Hypocrea_moravica, 82 Hypocrea_neorufa, 83 Hypocrea_nigrovirens, 84 Trichoderma_novaezelandiae, 85 Hypocrea_nybergiana, 86 Trichoderma_oblongisporum, 87 Trichoderma_ovalisporum01, 88 Trichoderma_ovalisporum02, 89 Trichoderma_pachybasioides, 90 Trichoderma_parapiluliferum, 91 Trichoderma_parareseei, 92 Hypocrea_parepimyces, 93 Trichoderma_parestonicum, 94 Hypocrea_parmastoi, 95 Hypocrea_patella, 96 Trichoderma_paucisporum, 97 Trichoderma_petersenii, 98 Hypocrea_phyllostachydis, 99 Hypocrea_pillulifera, 100 Hypocrea_placentula, 101 Trichoderma_pleuroticola, 102 Trichoderma_pleurotum, 103 Hypocrea_protopulvinata, 104 Trichoderma_protrudens, 105 Trichoderma_pseudokoningii, 106 Hypocrea_pseudostraminea, 107 Hypocrea_psychrophila, 108 Trichoderma_pubescens, 109 Hypocrea_pulvinata, 110 Trichoderma_reesei, 111 Hypocrea_rodmanii, 112 Trichoderma_rogersonii, 113 Trichoderma_rossicum, 114 Trichoderma_saturnisporum, 115 Hypocrea_semiorbis, 116 Hypocrea_seppoi, 117 Trichoderma_sinuosum, 118 Sphaerostilbella, 119 Hypocrea_spinulosa, 120 Trichoderma_spirale01, 121 Trichoderma_spirale02, 122 Trichoderma_spirale03, 123 Trichoderma_stilbohypoxyli, 124 Hypocrea_straminella, 125 Trichoderma_strictipile, 126 Trichoderma_strigosum, 127 Trichoderma_stromaticum, 128 Hypocrea_subalpina, 129 Hypocrea_sulawesensis, 130 Hypocrea_sulfurea, 131 Trichoderma_surrotundum, 132 Hypocrea_tawa, 133 Trichoderma_thailandicum, 134 Trichoderma_thelephoricola, 135 Trichoderma_theobromicola, 136 Trichoderma_tomentosum, 137 Trichoderma_turrialbense, 138 Trichoderma_velutinum, 139 Trichoderma_victoriensis, 140 Trichoderma_virens, 141 Trichoderma_virescentiflava, 142 Trichoderma_viride, 143 Trichoderma_viridescens, 144 Hypocrea_voglmayrii; TREE Best_ML_tree = [&R] (118:0.24898397,((((((34:0.10071914,77:0.0027856):0.02575729,107:0.07026088):0.04254849,(((7:1.0E-8,(103:0.00657285,109:0.00672979):0.00435999):0.01780547,106:0.02473138):0.01144112,(((38:0.07036936,45:0.01792213):0.01650497,79:0.00976545):0.0158276,(130:0.00270704,139:0.00704462):0.03322119):0.00669528):0.05325916):0.01804319,(((((144:0.0573716,(82:0.03411767,(((112:0.01772506,15:0.03301357):0.01102887,(126:0.02635164,(43:0.02645443,(((13:0.01650132,(142:0.01027961,76:0.00997208):0.00250538):7.5193E-4,((143:0.01432431,50:0.01512006):8.4162E-4,123:0.02972879):0.0012712):0.0024389,(((((87:0.00151118,88:0.00169971):0.0083287,(((20:0.00677735,41:0.00537002):0.00322629,97:0.01183202):0.00218084,68:0.01679151):9.8195E-4):0.0010745,(70:0.0104912,69:0.0122227):0.00152016):0.00410649,40:0.01265232):0.00816446,25:0.02116275):0.00711665):0.00389789):0.00525939):0.00238924):0.01513557,((((96:0.01223833,135:0.00545909):0.01137505,(((53:0.00381667,(55:0.00102478,54:0.00442671):0.00100974):0.01147164,(108:0.00798398,46:0.01015653):0.00409358):0.00224736,48:0.02697431):0.00593061):0.00251281,(11:0.00730036,10:0.00743257):0.01923806):0.00311162,72:0.02560214):0.00485449):0.00867759):0.01579192):0.03697623,((80:0.02878186,(99:0.0325374,(89:0.02345657,90:0.0190534):0.01638366):0.00501127):0.00416763,(5:0.06107639,100:0.02102544):0.00419796):0.00918773):0.01436487,(71:0.03622835,(85:0.02501474,116:0.02483508):0.0071626):0.02397511):0.01602019,((75:0.01680884,78:0.05863191):0.05257448,((17:0.03342462,(137:0.01133016,(9:0.01881491,104:0.01667593):0.00447026):0.00989566):0.01841268,111:0.0253131):0.00956467):0.01057707):0.0028791,(128:0.14969433,(16:0.07887768,39:0.04919956):0.02735826):0.03735793):0.00208872):0.01719353,(((84:0.04380939,((30:0.01483993,73:0.01108648):0.01148854,(8:0.03408269,((52:0.02152728,(105:0.00864888,114:1.0E-8):0.01863226):0.00235218,(110:0.00888584,95:0.15372062,91:0.00545345):0.02836446):0.00647286):0.00596444):0.02867635):0.07874816,((113:0.01182735,127:0.02141303):0.0263992,(66:0.06717731,(((32:0.00253379,140:0.00560443):0.02312982,(21:0.02578801,(((24:0.00954015,136:0.00629542):0.00532542,(12:1.0E-8,22:1.0E-8):0.01830339):0.00593438,((29:0.02438837,(138:0.01252735,124:0.01230899):0.0041542):0.00824212,((((101:0.01176545,(6:0.00473883,102:0.00531276):0.00257239):0.00881762,(2:0.01259138,((4:0.01186243,(132:0.01482169,92:0.01686269):0.0014403):0.00299101,42:0.01401495):0.00351772):0.00187879):0.0060413,(((57:0.01201091,58:0.01089153):0.00253006,(((61:0.00783346,(56:0.01051592,(62:0.0097506,59:0.00284298):0.00811605):9.2602E-4):0.00378146,(60:0.01166238,64:0.00984129):0.00108162):0.00130937,63:0.01116854):0.00163139):0.0012958,65:0.01510125):0.0096108):0.00394243,(36:0.03478044,18:0.02541627):0.009329):0.00107845):0.00361691):0.00399653):0.00879925):0.00396224,((83:0.06436995,((51:0.03238468,27:0.07144594):0.00892138,129:0.08398376):0.01538996):0.00882035,(98:0.04576274,(((((((117:0.00769098,131:0.0062366):7.1375E-4,33:0.00418284):0.00722611,134:0.01349293):0.00285049,26:0.0068472):0.01326901,31:0.03743345):0.01555447,((14:0.04725425,19:0.03091657):0.0215653,(1:0.05131041,(119:0.01765362,37:0.04011238):0.02058575):0.02873167):0.00954416):0.00786832,(141:0.00454757,133:0.00853372):0.03246533):0.01954743,((23:0.00499312,(44:0.00608369,93:0.00767362):0.00256609):0.01550199,((120:0.05527208,(122:0.00993731,121:0.0086408):0.00367235):0.02325138,((47:0.00287352,125:7.8077E-4):0.02457009,(35:0.00586757,74:0.00425735):0.01020507):0.00351065):0.00436822):0.00331088):0.00316911):5.8721E-4):0.0024518):0.00737636):0.00641717):0.0057807,(115:0.02841395,((86:0.00948325,81:0.02219676):0.00811345,49:0.02709941):0.00347725):0.01831801):0.01546659):0.03040345,(94:0.12000149,(28:0.09178458,3:0.11198549):0.09089744):0.02474404):0.06357668,67:0.23537421); END;