#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 22:08 GMT TreeBASE (cc) 1994-2008 Study reference: Levin R., Myers N., & Bohs L. 2006. Evolutionary relationships among the "spiny solanums" (Solanum subgenus Leptostemonum). American Journal of Botany, 93: 157-169. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1391] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=134; TAXLABELS Jaltomata_procumbens Solanum_abutiloides Solanum_accrescens Solanum_acerifolium Solanum_aculeastrum Solanum_aculeatissimum Solanum_adhaerens Solanum_aethiopicum Solanum_agrarium Solanum_allophyllum Solanum_anguivi Solanum_arboreum Solanum_argentinum Solanum_arundo Solanum_asymmetriphyllum Solanum_atropurpureum Solanum_aturense Solanum_aviculare Solanum_bahamense Solanum_betaceum Solanum_campanulatum Solanum_campechiense Solanum_campylacanthum Solanum_candidum Solanum_capense Solanum_capsicoides Solanum_carolinense Solanum_chenopodinum Solanum_cinereum Solanum_citrullifolium Solanum_clarkiae Solanum_cleistogamum Solanum_comptum Solanum_conditum Solanum_cordovense Solanum_crinitipes Solanum_crinitum Solanum_crotonoides 'Solanum cyaneo-purpureum' Solanum_dasyphyllum Solanum_diploconos Solanum_diversiflorum Solanum_drymophilum Solanum_dulcamara Solanum_echinatum Solanum_elaeagnifolium_SA Solanum_elaeagnifolium_TX Solanum_felinum Solanum_ferocissimum Solanum_fraxinifolium Solanum_furfuraceum Solanum_glaucophyllum Solanum_glutinosum Solanum_hastifolium Solanum_heinianum Solanum_hieronymi Solanum_hindsianum Solanum_hirtum Solanum_hoehnei Solanum_hyporhodium Solanum_incanum Solanum_incarceratum Solanum_incompletum Solanum_jamaicense Solanum_kwebense Solanum_laciniatum Solanum_lanceolatum Solanum_lasiocarpum Solanum_lidii Solanum_linnaeanum Solanum_luteoalbum Solanum_lycocarpum Solanum_macrocarpon Solanum_mahoriensis Solanum_mammosum Solanum_mapiriense Solanum_marginatum Solanum_melongena Solanum_microphyllum Solanum_mitlense Solanum_montanum Solanum_morellifolium Solanum_multispinum Solanum_myoxotrichum Solanum_myriacanthum Solanum_nemophilum Solanum_nemorense Solanum_nummularium Solanum_palinacanthum Solanum_palitans Solanum_pancheri Solanum_panduriforme Solanum_paniculatum Solanum_pectinatum Solanum_petrophilum Solanum_platense Solanum_polygamum Solanum_prinophyllum Solanum_pseudocapsicum Solanum_pseudolulo Solanum_ptychanthum Solanum_pugiunculiferum Solanum_pyracanthos Solanum_quitoense Solanum_refractum Solanum_repandum Solanum_reptans Solanum_richardii Solanum_robustum Solanum_rostratum Solanum_sandwicense Solanum_schimperianum Solanum_sessiliflorum Solanum_sessilistellatum Solanum_sisymbriifolium Solanum_sp._nov. Solanum_stagnale Solanum_stelligerum Solanum_stenandrum Solanum_stramonifolium Solanum_tenuispinum Solanum_thelopodium Solanum_thruppii Solanum_toliaraea Solanum_tomentosum Solanum_torvum Solanum_tridynamum Solanum_trisectum Solanum_vespertilio Solanum_vestissimum Solanum_viarum Solanum_violaceum Solanum_virginianum Solanum_wendlandii ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M2804] TITLE 'waxy + ITS + trnS-trnG'; LINK TAXA = Taxa1; DIMENSIONS NCHAR=3688; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Jaltomata_procumbens GATGCTTGGGATACTAGCGTTGCGGTTGAGGTACTCCTA-----TCTTAACTGG-ATATGAT---ACAAT-ATA---TCT-CTTCCATTCCCCGATTCAAGCATGT---GATCCATACTTTGCCTGCAGGTTAAAGTTGGGGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGTTCCTG-----ATACTACAATGTGAATACATAGAACACAT-CATTTT--GAA-TTTCATTT----GACTCTACTGTTGCTTTT-ACCCTTG-AAGGTTTGGGGCAAAACTGGGGCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCCTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACTTTT-GTCTTTAATCGTTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCCT-GTCACACTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCTCAGTTTCAGAAA-ACTCCTTAGCAGTCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTTCCTATTT-CTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATGTGAATGCCAAGGTAAAA-TCTCTTCGTATTCACTTCACTTG-ATGCAGTTTACCCTGCAAAT--CAAGAAGGTTGTACTAATATATGATAAATTTCACATCGCCTACAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTGCCTTATGAATACAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTTATGCTTGAAATCAGAGCACCAACAAATAATGGGAAGCTCTTTCGATGCTAGTAAA--TTGAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATCGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCACCGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGGATTGTAAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGTTTTTTTTTTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCCTGCTAAATCTTAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCTGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTATGTACC-AAATGGACTCATGGTATCTTTCTTGTTGTGTTTACTTGTGCCAATATTGAAATTAACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGGAATTCGAACAGGATATTGAACAGCTTGAAGTGTTGTATCCTGACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACTTGTT-TA--AACA-CGAGG--GCAG-CCGCGCGGTCGGGGGGGCGC--TTCGG-CCC---TCTCC-GTCCGCGCGTCT----GCCCAC----CGTCCCC-GGCGAG-----CGCGCCCGCGCGCGA-GCC-GGGTGA----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAAAG--CCTGCCCC-TCGCG--CCCCGTTCGCGGCG-TGCGCGGG-GGGACCTG--TGCTTCTCTTG----AAAC-GAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-TCGCTCCGCGCCCGATC-TCGGGCTGCGGCCGCGCGGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTAGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAG-CTCAAC----TCTC-GT-AGTGCCGTGGCTACAGCCCGTCGCGCGTATGGCCTCCCTGA-CCCT---TCTCGCGCTT--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGA-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTTAAAAACAAAA-----TGGCTGTT-ATAGTT-------GGAATATTTCATTTTAATT-------------------------------GCATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAAAAAAAAA-----------TATATGAAATAGAAAATTCGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTCTGATTTTA---------------GTGGTTTTGACGACCCTAT-CTTATCTTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGACTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_abutiloides GATGCTTGGGATACGAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGG-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGTATATTCTGAACCCTTA-GAGAGAT-CCTGA-GGGATAC-----------------GAACACGC-CATTTTT-GAA-TTTCTTTT----GACTCTACTGGTGCTTTC-ATCCTTC-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAAAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTCACCTTG-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAGCACATCCCAGTTCCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAAATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--CTTACCCTGCAAAT--CAACAAGGTTGTATAAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGTCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAACCAGACCACCGAATTT-----AGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATATTT--CTTACTTCAGCATATACTAAAATATATCGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGTCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGAGTACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCATTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGC--GCGCGCGGCG---GGGGTGC--TTCGG-CCC---CCCGC--CTCGCGCCTCCC-------TCC---CTCCCGG-GACG-CG----CGCCTGCGCGCTCGTCCGT-GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGGCAG--CCCGCCCCCTCGCG--CACCGTCCGCGGAG-CGCGCGGG-GGGACGCG--TGCTTCTTATG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGACAATGGCCTCCC-GTGCGCCCCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGCGCCGTGGCTGCGGCC-GTCGCGCGTCCGGACTCCCGGA-CCCT---CCTCGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCCTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAACTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAATAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCAGGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACAAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAAAAAAAATGCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATCTCTCTTTCTGCTTTTTTATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTTGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_accrescens GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ACATGAT---ACGAT-ATA---TCT-CTT---------GATTCAAGCACGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACGC-CATTTTT-GAA-TTTCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTG-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTAAGGTGGCATTTTACCTTT-GTCTTTAATCTTTTTCTTT-AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCTCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCTCAGTTTTCAGAA-TCTCCTTAGCAATCATA--GTATATCCTTTTAGGTAATCA----TCTTTA----TTTTGCCCATCT-CTTCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAGTCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGTA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCATCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGGATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAACATTTTATATGCTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCGATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGCCTCATGGTATCTTTCTTGTTATGTTCACTCGCGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCCAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGACTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGCACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCC-------TCC---CGCGTCC-GACGACGCG--CGCGAGCGCGCTCGTTCCT-GGGGG-----CAAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-TGAGAG--CCCTCCCC-CAGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCCTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCACGCCGC----------------ATGGC---GTCGTGGGGGGGCGGAGACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CCCAAC----TCTC-TT-GGTGCCGCGGCCACACCCCGTCGCGCGCGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATAAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTTTTATAAATTATAAAT--------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATTATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_acerifolium GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGGT---ACAAT-ATA---TCT-TTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTGCAATGTGAATGAGCAGAACACAC-CATTTTT-TAA-TTCTTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGATAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCGTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTTTTTTGATGCTAGTAAA--TTAAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTTCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTCT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-----AATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAGGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTAGCTGCAATTCACAAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGG--GGGG-CCGTGCGGCG---GGGGCGC--TTCGG-CGC---CGCCC--CGCGTGTCTCCCC------TC----CGTCCCC-GATG-CG----TGCCTCTGTGCTCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCCGC----------------ACGGT---GTCGTGGGGG--TGGATACTGGCCTCCC-GTGTGCCTTGAGCCCGCGGCCGGCCTAAATGTGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTTGGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACAGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATATAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_aculeastrum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGTACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTATTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAAAATTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGTATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCAGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTAAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CT--AACA-CCGAG--GGAG-CCTCGCGGTGC--GGGGCGC--TCCGG-CGT---CGCCC--CGCGCGTCTCCC-------TCT---CGCCCCC--------------------------TTTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTTCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTCATGCCCGTCGCTCGTGCGTGCTCCCCGA-CCCT---TTAGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGCAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_aculeatissimum ????CTTGGGATACCAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACTAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGTGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATACTTTGTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAGCACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TATCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGTAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTAACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACGGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTTT--CTGACCTCGACATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTC-----AGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGATAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGATTCATGGTATCTTTCTTGTTATGTTCACTCGAACAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACTCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGG--GGGG-CCGCGCGGCG---GGGGCGC--TTCGG-CGC---TGCCC--CGCGCGTCTCCCC------TA----CGCCCCC-GATG-CG----TGCCTCTGCGCTCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGTG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTT-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGTCTCCC-GTGAGCCTCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTGCTCTCTTTTCGTCTTTCTATATTAT----CTTTTCTTCTTTCTATATTATATAGATATGTAC--------------------AACTTTTACCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_adhaerens ??TGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAGT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGTAGGTCAGAGTTGGAGACAACATTGAAATTGTCCGTTTCTTTCACTGCTATAA{AG}CGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGTT-CCTGA-GGGATAC-----------------------GC-CATTTTT-GAA-TTCCTTTTT---GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GCTGTAC-TGTT-GTCTTGACTTAGTGT{AG}GCATTTTACCTTT-GTC------CCTTTTT----AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TTTCCTTAGCAGTCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCTAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAA------------ATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTGAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTTATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGATCATCAAATTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGATTTT-AATGTTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACAGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAA-ATTATGTATGTTTATGAAAATAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTT{AG}CCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TA{CT}GCATCAGGGAACTGGAAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCCAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CA--AGCA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TTCCG-CGC---CGCCCC-CGCGCG-CTCCC-------TCC---CGCCCCCGGGCGGCG----CGCTCGCGCGCTCGTTTCT-GGGGG-----C{AC}AAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAGA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAA-CGTGCGGG-TGGATGCG--TGCT{CT}CTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGAGGGGG--CGGA{CT}ACTGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CTCAAC----TCTC-TT-GGCGCCGCGGC{CT}ACAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCT--TTCCGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AATACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGAATAA---------------------AATA-AATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_aethiopicum ???????GGGATACTAGTGTTGCCATTGAGGTACTCCGA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATT----------A-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGGACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGATGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTCC-GGGGGG----CCAAA--CTAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CTTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---GCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_agrarium ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACCCGTT-CC--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--CTGGG-CGC---CGCCC--CGCTCGTCTCCC-------TCT---CGCCCCCTGGTG-------CGCCCGT-CGC---TCCCC-GGGGG-----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGGT-CGCGCGGG-AGGATGCG--AGCTTCTTTCG---AAAAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGAGACTGGCCTCCC-GTGCGCCACGAGCGCGCGGCCGGCCTAAATGCAAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCAAGCGCTC--------CTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTATTCTATATTATATATTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAACG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTATT----------CCAACAAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAA------------------TATATGAAATAGAAAATTCGAT-AAAAAGAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATTAGTTTA---------------GTAGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------TACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_allophyllum GATGCTTGGGATACTAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAACTGC-ATATCAT---ACTAT-ATA---TCT-CTT---------CATTCAAGCATGTCATGATCCCTACTTTTTCTGCAGCTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCCTGGAGAAAGTAAGCATATTCTGAAC------------------------------------------------ACGC-CATTTTT-GAA-TTTCTTTC----GACTCTACTGGTGCTTTT-ATCCTTT-CAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTAC----------TGTT-GTGTCGACTTTATGTGGCATTTTACTTTT-GTCTTTAATCCCTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGAACATATGGTAACACATCCCAGTTCCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAAGTAAAA-TCTGTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--C---------GTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGATATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTAAA--TGGAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAAACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGCAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATATACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGTATGTACTAAAATATTTTGTATGTTTATGAAATTTAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGGTCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCCTGGTATCTTTCTTATTGTGTTCACTTGTGCAAAAATTGAAATTAACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAAGTCTTGTACCCTAACAAAGCTAAAGGAGTGGCGAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTAGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGCACGACCCGCGAACCCGTT-CA--AACA-CCGGG--GGCG-ACGCGCGGCG---GGGGTGC-CCTCGGCCGCCCCCTCCT--CGCGCCTCCCCCCCCGCCCGCC---CGCCCGC-GGCG-CG----CGCTCGCGCGCCCGTCCGC-GGGCGA----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACCGAAC-TGACAG-GCCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGGG-GGGACGCG--CGCCTCTCTCG----AAACAGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCTC-GCACGCCGC----------------ACGGC---GTCGCGGGG---CGGATACTGGCCTCCC-GTGCGCCCCGAGCTCGCGGCCGGCCCAAATGCGGGTCCACGTCGACGGACGTCACGGCGAGTGGTGGTTGAAA-CTCAGC----TCTC-TC-GGTGCCGTGGCCCCAGCCCGTCGCGCGTCCGGACCCCCGGA-CCCT---CCTCGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCAAAAGGGACCCTCTTAGTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTCAAGCAACAAAAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTAATTTTATGTTT---TACCAACTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGC----TTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC------ATTACCACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_anguivi GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCGA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGAAAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATT----------A-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGGACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGATGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGG{CT}GC--GGGGCGC--TCCG{AG}-CGC---CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTCC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAACCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCTGTCCGCGGGG-CTTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGTCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---GCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_arboreum GATGCATGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTG--------TGATTCAAGCATCT---CATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTAT{AG}AACGTGGGGTCGATCGAGTTTTTGTCGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGC-GGGATACTACAATGTGAATTGGCAGAACACAC-CATTTTTTGAA-TTTCTTTT----GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGTCCCAAAGCTGGACAGGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACCTTT-GTCTTTAATCCTTTGTTTTTCACCTTGTTT-----------------------------------------------------------------------------------------TATTTGTCACTCTCAGGCAGCCCTAGAAGCACCTAGAGTTCTGAATTTGAACTCCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTCTGCCTATTT-CTGCAGGAGAAAATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATGTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAAA-TTGCA--C--TTTACCCTGCAATT--CAACAAGGTTGTGTTTATACACGATAAATTTCACATTGCCTACAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATCGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTGAA--ATGAGTTTTT-ATCATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGCTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACT{AT}GCATTACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--TTGACTTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTCCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAACAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGAAAAATTTGAAGTTGACCTGCACCTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACCCGTT-CA--AACA-CCGGG--GGC--GCGCGCGGCG---GGGGTGC--TCCGG-CCC---CCCGC--CTCGACCCTCCC-------TCC---CGCCCTC-GGCGACGCG--CGCTCGCGCGCTCGCCCTC-GGGCGG----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGATTACTCAAT-TGGCAA--CCCGCCCC-TCGCG-CCCCCGTCCGCGGAG-CGCGCGTC-GGGACGTG--TGCTTCTGTCG----AAACCGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCACGCCGC----------------GCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGAAG-CTCAAC----TCTC-TC-GGTGCCGCGGCTACGGCCCGTCGCGCGTCCGGACTCCCGGA-CCCT---GCTCGCGCTC--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGA-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA-----AGAAACTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_argentinum ??????TGGGATACTAGTGTTGCCATCGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATCT---CATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTCGATCGTGTTTTTGTTGACCATCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTAAGAGTGGT-CCTGC-GGGATACTACAATGTGAATTGGCAGAATACAC-CATTTT--GAA-TTTCTT-CT---GACTCAGCTGGTGCTCTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATATATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTTGGTGGCTTTTTACCTCT-GTCTTTAATCCTTTTTTT--CACCTTGTTT-----------------------------------------------------------------------------------------TATTTGTCACTCTCAGGCAGCCCTAGAAGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAAATGTTCTCTTCATTGCCAACGATTGGCACACTGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATGTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAGTT--CAACAAGGTTGTATTTATACACGATAAATTTCACATTGCCTACAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATCGATGGGTATGAA--TTTAATGCTTGAAATCAGATCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTGAA--ATGAGTTTTT-ATCATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGTCCATACTATGCCCAAGAACTTGTCTCAGCTGCTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTCACTTAAGCATATACTAAAATATTTTTTATGTTTATGAAATTAAAGAGTCCTTGCTAA-TCAAAATCTCTGTACAG{GT}TCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGTTATCTTTCTTGTTATGTTCACTCGTGAAGAAATTGAAGTTGACCTGCACCTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACGCGTT-CCC-AGCA-CCGGG--GGC--GCGCGCGGCG---GGGGCGC--TTCGG-CCC---CTCGC--CTCGCCCCCCCCTC-----TCC---CGTCCGCGGACG-CG----CGCCCGCGCGCTCGTTTTC-GGGCGG----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-CGGCAG--CCCGCCCC-TCGCG-CCCCCGTCCGCGGAG-CGCGCGCG-GGGATGCG--TGCTTCTGTCG----AAACCGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGG---CGGACACTGGCCTCCC-GTGCGCCTCGCGCTCGCGGCTGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGAAG-CTCAAC----TCTC-TC-GGTGCCGCGGCTACGGCCCGTCGCGCGTCCGGACTCCCGGA-CCCC---GCTCGCGCTC--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCT----TTTATCT-CTTTATCTTTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATAGCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGA-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTGCCATTTTTT------------------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCT-GCTGGACTAAAAAAAA-----AGAAACTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_arundo GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCGTTGAAATTG{CT}TCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAG-TTCCTATTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGCTTATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGAT{AG}TTCTCTTCATTGCCAATGATTGGCACACAGCTCTCGTTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTTATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TAAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAGCGACCCGCGAACACGTT-CA--AACA-CCGGG----------------------GGCGC--------CGC------CC--CGCGCGTCTCCCCC-----T-----CGCTCCC--------------------------TCTTC-GGGGGGGG--CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GGCGCGGGGG--CGGATGCTGGCCTCCC-GCGCGCCTCGCGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---TCCGGCGCTA--------CCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_asymmetriphyllum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACGAT-ATG---TCT-CTT---------GATTCAAACATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGAGAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTAAATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCTTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATATATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGAC-ATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAAACACA-TCGGG--GGAG-CCGCGCGGAGC--GGGGCGC--TCCTG-CGC---CGCCC--CGCGCGTATCCC-------TCG---C-CCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTCCTTTCG----AAAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGTATAATGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCATAGCCCGTCGCGCGTGCGTGCTCCCCGA-CCCT---TCCAGCGCTC--------TTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTT---TCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAACAAAATGTCTGTT-AGAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATGGTTTAGTGGTAAA Solanum_atropurpureum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGTT---ACAAT-ATA---TCT-TTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAATTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTGCAATGTGAATGAGCAGAACACAC-CATTTTT-TAA-TTCTTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGATAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCGTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGATTGTACTAATGTATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTA-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTCT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAGGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTAGCTGCAATTCACCAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGGGGGGGGGCCGCGCGGCG---GGGGCGC--CTCGG-CGC---CGCCC--CGCGCGTCTCCCC------TC----CGCCCCC-GATG-CG----TGCCTCTGTGCTCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGT---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGTGCCTTGAGCCCGCGGCCGGCCTAAATGTGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTCCTT-GGTGC{AC}GCGGCCGAAGCCCGTCGCGCGTTCGGACTCCCCGA-CCCT---CCCAGCGCTC--------CGGCGCTCCGACAGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATATAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAACTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_aturense GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAGT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGTAGGTCAGAGTTGGAGACAACATTGAAATTGTCCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGTT-CCTGA-GGGATAC-----------------------GC-CATTTTT-GAA-TTCCTTTTT---GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGA{CT}AATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----{GT}CTGTAC-TGTT-CTCTTGACTTAGTGTGGCATTTTACCTTT-GTC------CCTTTTT----AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TTTCCTTAGCAGTCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAA------------ATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTGAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTTATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGATCATCAAATTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGATTTT-AATGTTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACAGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAA-ATTATGTATGTTTATGAAAATAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCCAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CA--AGCA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--CTCTG-CGC---CGCCC--CGCGCG-CTCCCC-------CC---CGCCCCCGGGCGGCG----CGCTCGCGCGCTCGTTTCT-GGGGG-----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCATA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAA-CGTGCGGG-TGGACGCG--TGCTTCT{CT}TCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGAGGGGG--CGGATACTGGCCTCCC-GTGCGCGTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGACCCCT---TCCGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AATACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGAATAA---------------------AATA-AATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTTATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTAGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_aviculare GATGCTTGGGATACTAGCGTGGCGGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTTCCATTCCCTGATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTTAAAGTTGGAGACAGTATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTG-GAGAGGT-CCTGA-GGGATGCTACAATGTGAAAACGCAGAATACGT-CATTTT--GAA-TTTCTTTT----GACTCTACTGGTGCTTTT-ACCCTTTTAAGGTTTGGGGAAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACGAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACTTTT-GATTTTAATCGTTTTTT---AACATTGTTT-----------------------------------------------------------------------------------------TCTT-GTCACTCTCAGGCTGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAATTTCAGAGA-ACTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTTTTCATTGCCAATGATTGGCACACGGCTCTGATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTCATATTAATATATGATAAATTTCACAATGCCTCCAGGTCGCTTTCTGCATCCACAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGATGCTCTTTTGATGCTAGTAAA--TTTAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGGAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCCTACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAATATAAGATTTTT--CTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAGGAGTTCTTGCTAA-TCAAAATCTATATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAACGGACTCACGGTATCTTTCTTGTTGTGTTTACTTGTGCCAAAACTGAAATTGAT-TGTTACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACTTGTT-AG--AACA-CCGGA--GGGG-CCGCGCGGCG---GGGGTGC--TTCGGCCCC--CCCAGTC-CGCGCGTCTCCC-------TCC---CGCCCCC-GACG-CG----CGCTTGCGCGCTCGTTC---GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTGAAT-TGACGG--CCCGCCCC-CCGCG--CCCCGTCTGCGGAG-TGCGCGGG-GGGACGTG--TGCTTCTTTTG----AAACAAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------CAGGC---GTCGCGGGGG--CGGAAGCTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-GA-TGTGCCGCGGCCGAACCCCGTCGCGCGTCTGGCCTCCCAGA-CCCA---CAGTGCGCTC--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTTTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAA------AACCAAAA-----TGTCTGTT-ATCGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTCTGTTT----CCCACCTTGCTGGACTAAAAAAAA------GAAGCTTTTTAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATCCCCC-TGTTCGACAAAAGCTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_bahamense GATGCTTGGGATACTAGTGTCGCCATCGAGGTATTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GGTTCAAGCACCT---GATCCCTCCTTTATCTGCAGGTCAAAGTTGGAGACAGCGTTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTGTGAACCCTTA-GAGAGAT-CCTGA-GGGACACTACAATGTGAATGCGCAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAGAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTGATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--GACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAACCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATATTTCTCTGGACCATATGGTAACACATCCAAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCCTTCCCTGCTACTTGAAGTCAATGTACCAGTCAAAAGGACTCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATGTATGGTAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATAAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----GAAAGCTCTTTTGATG-TAGTAAA--TTGAGTTTCA-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGAAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGAAGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGAACTAAGCATATCCTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTGTTCCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGTATCTGTTTTGTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCGCA-GCAGAGCGACCCGCGAACGCGTT-CA--GACGACCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCA--CGCGCGT-TCCCCC-----T-T---CGCCCCC-GGCGGCG----CGCCCGCGCGCCCGTCCCC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAGTACCCAAA-CGAGAG--CCCTCCGC-CCGCT--CCCCGTCCGCGGGG-CGTGCGGG-CGGACGAG--CGCTCCCTTCG----AAACCGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC------------ACGGACGGC---GCCGCGGGGG--CGGACACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCCAAATGCGGGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAGC----TCTC-CC-GGTGCCGCGGCCGCAGCCCGTCGCGCGTGACGACCCCCCGA-CCCT---TCCGGCGCTC--------GCGCGCCCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTTTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAGG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTTAATTTGAAAACAAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTTATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_betaceum GATGCTTGGGATACTAGTGTTGACGTTGAGGTACTCTTA-----TTTCAACTGC-ATATGAT---ACAAT-ATATGATCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGCAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CTTGA-GGGATACTACAATGTGAG---------CACAC-CATTTTT-CAA-TTTCTTTT----CACTCTACTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTAGTAC-TGTTTGTCTTGACTTTATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCGGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCAGA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATCGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCCATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGCCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGATTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTAAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGCTGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTCAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAATATTTCGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAGGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTACTTGTATGTACC-AAATGGACTCATGGTATCTTTCTTTTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCCTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGCACGACCCGCGAACACGTT-CA--AACG-CCGAG--GGGG-GCGC{AG}CGGCG---GGGGTGC--TTCGG-CGC-CCCGC----CCCGCGTCTCCC-------TCC---CGCCCGC-GA{AC}G-CG----CGCCCGCGCGCTCGTTCC--GGGCGA----CTAA---CAAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-GGACAG--CCCGTCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG--GGACGCG--TGCTTCTTTCG----AAATCGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------GCGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCCGGCCTAAATGACAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAG-ATCAAC----TCTC-TC-GGTGCCGTGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCT---CATCGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTT----------CCAACAAATTTGAATTTGAAAACAAAAA-----TGTCTGTT-ATAGTT-------ATAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATCAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGTATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_campanulatum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAAACATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATATATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTT----GCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCCTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCACTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTTGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCCTCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGAGTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAGAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAG-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCC-------TCC---CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCGCCCCCCGTCCGCGGGGGCGTGCGGG-CGGGTGCG--TGCTCCTTCAC----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGCGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGCAAAA-TTCCCATTTTTGATATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTATCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_campechiense GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAATGATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAGGTAAGCATATTCTGAACCATTA-GAGAGGT-CCTGA-GGGATATTACAATGTGAATGCGCAGAACACGC-CATTTTT-CCA-TTCCTTTTTT--GACTCTGCTTGTGCTTTT-ATCCTCT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TATT-GTCTTGACTTAATGAGGCATTTTACCTCT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTCGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAGA-TCTATTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCAGTAGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATAAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-TATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACAGGGATTGTGAATGGTATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAGCCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATATTAAAGTATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCTGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAGGTTCATCGGATTGGATGTTCAAATAGTTGTCCTTGTAAGCACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTTACTCGTGCAAAAATTGAGATTGACCTGCAACTCATCC--CATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-TCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCTGG-CGC---CGCCC--CGCGCGTTTCCC-------TCC---CGCCCCC-GACGGCG----CGCTCGCG------CCTCC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAGA-TGAGAG--CCCTCCGC-CCGCG--CCCCGTTCGCGGAT-CGCGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCTACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---TTCGGCGCCT--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACACGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAG-AAAAAAAAAAGTCTCATTTCTCTTTATGCTTTTTGATTTTATGTTT----ACCATCTTGCTGAACTACAAAAAA------GAAGTTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_campylacanthum ???????GGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GA?-TTCCT{AT}TTTTT-AACTTTGCTGG{CT}GCTTTT-ATCCTT--AAGGTTTGGGGCAAAA?????????????????????????????GGACAAG{AC}TT{AG}TTTGG{AT}CAATGAAC{GT}TAGATTCAGCC{AT}G{CT}{CT}GTGTCAAG{CT}AAGTTA{CG}TT{AG}CTGTA--TGTT-GTCTCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTC{AG}TTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGG{AT}ATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTT{AG}CTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGC{CT}CAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGA{AG}ATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGA{AG}CAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GAAG-C----------------CGC------G-CGC-----------GCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGGGG---CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGG-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--CGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGGTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---ACCGGCGCTG--------GCGCTTTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATATTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCC--TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_candidum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCATTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTTT-GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACATTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTG-CT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCT---AATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAACGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATATCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTAGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGTGAACACGTT-CG--AACA-CCGGG--GGGG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCTC--CGCGCGTCTCCCCCCC---TC----CGCCCCCCGACG-CG----CGCTCGCGCGCTCGTCCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTC------GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCGTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_capense GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCGA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATGCTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTGTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTGTTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATATCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTCGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCTG-CGT---CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTCC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGAGCGTGCGTGCTCCACGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCGCTTTTCTTCTTTCTATATTAT----CTTTTCTTCTTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTTCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-TTAAAA------TATATGAAATAGAAACTTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTACTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_capsicoides GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGGT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGAGCAGAACACAC-CACTTTT-TAA-TTCTTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGATAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAAGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTGATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAA--------TTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTTAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTCT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAGGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTAGCTGCAATTCACAAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGG--GGG--GCGTGCGGTG---GGGGCGC--TTCGG-CGA-----CCC--CGCGTGTCTCCCC------TC----CGCCCCC-GATG-CG----TGCCTCTGTGCTCGTTCTT-GGGGG-----CCAAACACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CTGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTTT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCTGC----------------ACGGC---GTTGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTTGAGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGTGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATATAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCG-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AGGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCCTGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAACTAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_carolinense GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGATGATACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---TATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATGC-----------------------GC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGTTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTTTTGACTTAATGTGGCATTTTACCT---GTCTTTAATCCTTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTTACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATAATA--GTATATCCTTGTAGGTAATCG----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAACATTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGGTTTCTCTGACTTCCCTCTTCTCAATCTTCCCGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGACA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGACAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAAACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGCCAAATATGATATAACCACCGTAAGATAAGATTTTT--CTGCCCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAATTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGACCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTAGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAG-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCAG-CGT---CGCCC--CGCGCGT-TCCCC-------CC---CGCCCCCCGACGGCG----CGCCCGCGCGCTCGTCGTT-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTTCGCGGAC-CGCGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCATAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATGCTGGCCTCCC-GTGCGCCTCGAGCGCGCGGCCGGCCTAAATGCGAGCCCGCGCCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCGAC----TCTC-TT-AGTGCCGCGGCCACAGCCCGTCGTGCGTGCGTGCTCCCCGA-CCCT---TTCGGCGCGC--------GAGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTGATCATCAATTTCCTTTATCTC---TTTATCTCCTTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCTTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTT-------TAA-TGTCTGTTATAGTTCATTTTAAATGAATAATTAATATTC---------AAGCAACAAGAAAAAATTCCTATTTTTTATA------ATTTTTTATATT---------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGTTGGACTACAAAAAA------GAAGCTTTCGAGTATTC----TACAATGCATTTTTATGTTATGATTTTA---------------GTTGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATTGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_chenopodinum ???????GGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---{AG}CAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTACTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTGGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GCCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAG{AT}-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTG{CT}ATCCATAACATTGCCTACCAAGGCCGATTT{AG}CTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCAT{CT}GATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCT{AG}CTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTT{AG}TTTTCACTCGTGCAAAAATTGAA-TTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CC--AACA-CCGAG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCC-------TCT---CGCCCCC--------------------------TCTCC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG-CCCCCGTCCGCGGGG-CGTGCGGA-CGGGTGCG--CGCTTCTTTAC----GAACCTAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC-----------------------------GGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTTATATTTTATATTTATA-----------C--AAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATACATTTTTATGTTATGATTTTT---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_cinereum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACCCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTAAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCCTCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCTTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGACGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATGAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATTTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGCACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGAG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCC-------TCT---CGCCCCC------------------------C-TCTTC-GGGGGTGGGGCCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG-CCCCCGTCCGCGGGG-CGCGCGGG-CGGGCGCG--TGCTCCTCTAC----GAACCAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CCCAAC----TCTC-TT-GGCGCCGCGGCAGCAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAAAAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAA------AACAAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGAATAAATTTCTGTTATAGTTCATTTTAATTGAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_citrullifolium GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTGCAATGTGAATACGCAGAACACGC-CATTTTT-GAA-TTCCTT-CTTT-GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAGGATTATTTGGACAATGAACTTAGGTTCAGCTTATTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTTACTCCCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACAACCCAGTTTCAGAAA-CCTCCTTAACA-TCATA--GTACATCCTTGTAGGTAATTA----TCTTTA----TTTTGCCTCTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCATGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCGTTGCAATCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCACAACATTGCCTACCAAGGCCGATTTGCTTTTTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTAT-AAA-TTTAATGCTTGAAATCAGAGCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGTAGACATGAAAAGCCTGTGAAGGGTAGGAAACTCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTTTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTGTGTATGTTTATCAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATTGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCATAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTTCC-AAGTGGACTCATGGTATCTTTCTTGTTATATTCACTCGTGCAAAAATTGAAATTGACCTGGAACTCATCT--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAACTTGAGGTGTTGTACCCTGACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTAGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACCCGTT-CA--AACA-CCGGG--GGAG-ACGCGCGGCG---GGGGCGC--CCAGG-CGC---CGCCC--CGCGCTCGTCCC-------TCG---CGCCCCC--------------------------TGCTC-GGGGG-----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCCCCGC-CCGCG--CCCCGTTCGCGGTG-CGCGCGGG-CGGGCGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCCCCCGCGCGCGGCCGGCCTAAATGCGAGCCCGCGCCGACGGACGTCGCGGCGATTGGTGGTTGTAT-CCCAAC----TCTC-TT-CGCGCCGCGGCCGCAGCCCGTCGTGCGTGCGCGCTCCCCGA-CCCT---CAAAGCGCCTC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAAG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATCGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGTTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_clarkiae GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTAAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-CGGT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTT-AATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATGTCCTTGTAGGTAATCA----TCTTTA-----TTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCGTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCTAGGTCACTTTCTGCATCCATAACATTGCCTACCAAGGACGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCGGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAACGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACTTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCA-CTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-TCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CGCCT--GTCGCGTGTCCC-------TCC---CGCCCCC--------------------------TCTTT-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAT-TGTGCGGG-TGGATGTG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCTCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAA--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTGTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAA------------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_cleistogamum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------CATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGC-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTAAATTTGCACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TTTCCGTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTTCCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACACTGCCTCCAGGTCGCTTTCTGCATGCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATTACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTGAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCATGTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTT-------TTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAAAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACGCGTTACAA-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGCTTCCCC-------CC---CGCCCCC--------------------------TCTTC-GGGGGGGG--CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAACAGAGAG--CCCTCCAC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGACGCG--TGCTTCCTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-ATCAAC----TCTC-TT-GGTGCCGCGGCTACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTA--------GCGCGCTTCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GTAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCC-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAAGCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAAAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-ATTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_comptum ???????GGGATACTAGTGTTGCCATTGAGGTATTCCTA-----TCTTAACTGC-AGATGAT---ACAATGATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCGAATTCTGAACCCTTA-GAGAGGT-CCTC{AT}-GGGATAC-----------------------GC-CATTTTT-GAAATTCCTTTTTT--AACTCTGCTGGTGCTTTT-ATCCTTC-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTTCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCT---GTCTTTAATCCCTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCCCTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACAGCAGCAAATACTTCTCAGGACCATATGGTAACA{CT}ATCCCAGTTTCAAAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTACTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGCATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGATTGTACTAATATATGGCAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGCTTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCACCTTT-----AAAATCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGCCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAATTTTTCCTAA-TCAAAATCACTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGACCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTTTTATGTTTGCTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATAAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGTAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAGCGACCCGCGAACGCGTT-CA--AACA-CCGGG--GGGG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCCCC-----TCG---CTCCCCGCGGCGG------CGCGAG-----{CT}CG{CT}CGTT-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGGG--CCCCC{CT}GC-CCGCG--CCCCGTTCGCGGAG-CGCGCGGG-TGGGTGCG--CGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGTATGCTGGCCTCCC-GTGCGCCTCGCTCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGTGCGTGCCGACTCCCCGA-CCCT---TCCGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTATCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTGATCATCAATTTCCTTTATCTC---TTGATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAAG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCTATTTTTTATATTT------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTTTGTTG----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC----TACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_conditum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAATGATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACGGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCTTATTCTGAACCCTTA-GAGAGGT-CCTCA-GGGATAC-----------------------GC-CATTTT--GAA-TTCCTTTTTTT-AACTCTGCTGGTGCTTTT-ATTCTTC-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTTCTGTAA-TGTT-GTCTTGACTTAATGTGACATTTTACCT---GTCTTTAATCTCTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCGCCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAAAAA-ACTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA-TCATCTTCA----TTTTGCCTACTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATTTATTTGAATGCCAAGGTAAAA-TCTCTTTGCATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGCTTGTACTAATATATGACAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGGCGCTTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCGTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAACCAAACCATCAACTTT-----AAAATCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCATCTGTTGATAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGCCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGCTTATGAAATTAAAGAATTCTTCCTAA-TCAAAATCACTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGACCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTTTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCGTAAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAG-CCTGCCCA-GCAGAACGACCCGCGAACGCGTT-CA--AACA-CCGGG-GGGAG-CCGC{AC}C-----------------------------------CGCGCG-CTCCCC------TCT---CGCCCCC------------------------C-TCGC--GGGGGG----CCAAA--C{CG}AACCCCGGCGCGGAAAG{CG}GCCAAGGAATACTCAAA-{AC}GAGAG-CCCCTCCGC-CCGCG--CCCCGTTCGCCGGG-CTCGCGGG-CGGACGCG--CGCCTCTTACA----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGT{CG}TGCCTGGGCGT{CT}ACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGAAACTGGCCCCCC-GTGCGC---GCGCGCGCGGCCGGCCCAAATGCGAGCCCACGTC{CG}ACGGACGTCGCGGCGAGTGGTGGTTGTAAACTCAGC----TCTC-TC-GGCGCCGCG------GCCCGTCGTGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC-TGTCGAAGAGCGCCCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTTCTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTGATCATCAATTTCCTTTATCTC---TTGATCT-----AA--CTTTATCTCTT-------------------GA--TCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCTATTTTTTAGATTTTTTATATTT---------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTTTGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTCATTCTACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATACGAATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_cordovense GATGCTTGGGATACTAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCAAGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGTATATTCTCAACCCTTA-GAGAGAT-CCTGA-GGGATAC-----------------GAACACGC-CATTTTT-GAA-TTTCTTTT----GACTCTACTGGTGCTTTC-ATCCTTC-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAAAAGATTATTTGGACAATGAGCTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTAC----------TGTT-GCCTTGACTTTATGTGGCATTTCACCTTG-GTCTTTAATCCTTTTTTT------------------------------------------------------------------------------------------------------CTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTCCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAAATGTTCTCTTCGTTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGATGTATAAATATATGATAAATTTTACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGTCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCCTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAACCAGACCACCGAATTT-----AGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACTACTGTAAGATAAGATATTT--CTAACTTCAGCATATACTAAAATATAT{CT}GTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGTCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGAGTACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACTTGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--G----CCGCGCGGCG---GGGGTGC--TTCGG-CCC---CCCTC--CTCGCGCCTCCC-------TCC---CGCCCAG-GACG-CG----CGCCTGCGCGCTCGTTCGT-GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-CGGCAG--CCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGGG-GGGACGTG--TGCTTCTTATG---AAAACCGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCTTCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GCCGTGGGGG--CGGATACTGGCCTCCC-GTGTGCCTCGAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAG-CTCAAC----TCTC-TT-GGTGCCGTGGCCGCGGCC-GTCGCGCGTCCGGACTCCCGGA-CCCT---CTTCGCGCCTC-------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCCTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAACTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCAGGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTTAAAACAAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTACCATTTTTT------------------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGATCAAAAAAAAAAGTCTCATCCCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTTGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGGTTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_crinitipes GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAGAGTTGGAGACAACATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA------------CA-----------AATATGATTGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAAAAGATTACTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTA---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAC--CAACAAGGTTGTACTAATATATGATAAATTTCTCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCGGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGGAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAA-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCCC------------------------CGTCCC--GGGGGG----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCGAA-CGAGGG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGACGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTGGCGGGGG--CGGACACTGGCCCCCC-GCGCGCCCCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTC{AG}CGGC{AG}AGTGGTGGTTGTAA-TCCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGTGCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCCA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CTAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCTAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTTTG-----ATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_crinitum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTAGAGAAAGTAAGCGTATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATACGC--AACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGCGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACAGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTATTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AA-CTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACAACCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCATGCTACTTGAAGTCAATGTATCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTAATCACTTGA-TTGCA--C--TATACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTTCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTTTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGACAAGATTTTT--GTGACCTCAGCATATACTAAAATATTGTGTGTGTATGTGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTGAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCAGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATATTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAATTCGAGCAGGAGATTGAACAACTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCTAGCAGAGGATCATTGTCGAAG-CCTGCAGA-GCAGAACGACCCGCGAACCCGTT-CA--AACA-CCGGG--GGAG-CCGTGCGGCG---GGGGCGC--CCCCG-CGC---CGCCC--CGCGCGCTTCCCC-------CC---CGCCCCC-GGCG-TGCG--CGCTCGCGCGCCCGTCTCC-GGGGG-----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCGCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGACGCG--TGCTTCCTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCCCGGGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCAC-GCCCGTCGCGCGCGCGGACTCCCCGA-CCCT---CGCAGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTTATATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTTATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_crotonoides ?????????????????????GCCATTGAGGT{AG}CTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATT{CG}{AG}AGCACCT---GATCCCTACTTTATCTGCAGGTCA{AG}AGTT{AG}GAGACA{AG}CATTGAA{AG}TTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTA{AC}GCATATTCTGAACCCTTA------------------------CAATGTGAATGC{AG}CAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--G-{AC}TCTGCTGGTGC{CT}TTT-AT{CT}CTTT-{AC}AGG{GT}TTGGGGC{AC}AAACTGG{GT}T{CT}{AC}AAAAT{CT}TATGGCCCC{AC}AAGCTGGACCAGGTTATTTGGAC{AC}ATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACT-GCTGTAC-TGTT-GTCTTGACTTA{AG}TGTGGCATTTTACCTTG-TTCTTTAATCCTTTTT{AT}---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCAC{AG}CAGCT{CG}TCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAA{AG}AGGA{AC}TCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTC{AT}CATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGT{AG}TGTTT{AG}TGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGCCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATC{AG}GATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGGAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGA{GT}GTGTTGTACCCTAACAAAGCTAAAGGAG{CT}{AG}GCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGTG-TCGCGCGGCG---GGGGCGC--TC{CT}GG-CGC---CGCCC--CGCGCG--TCCCC------TCC---CGCCCCC--------------------------TTTTT-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGGG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCCCCTTTC{GT}----AAACCAAAA-TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGC{AG}CGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACACGCCGTCCCGCGTGCGGACTCCCCGA-CCCT---TCCGGCGCCT--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACAACACATAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTCGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA 'Solanum cyaneo-purpureum' GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACGCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CACTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-GTCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTCTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGATA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TGTCTTTGTATTCACTAGA-TTACA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGTATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCA-CC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCG{AG}-CGC---CGCCC--CGCGCGTCTCC{AC}CC-----TCT---CCCCCTC--------------------------TTCG--GGGGG-----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTTGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---GCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAAAGG-----------------AAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGCTATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATCGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_dasyphyllum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-TAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCGCTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TTTCCTTAGCAATCATA--GGATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTTTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTT-GCAGACATGAAAAGCCTGTGATAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT-TCTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTACTTGTTATGTTCACTCGTGCAAAAAATGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGG?TCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CGCCC----CGCGCGTCCCCCCC---T-----CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-TGGATGCG--TGC-TCCTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------GCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCTAAATGCGAGCCCGCGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCACGA-CCCT---ACCGGCGCTA--------ACGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTTAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTACCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_diploconos GATGCTTGGGATACTAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATATGATCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGCAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATCTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTA-GAGAGGT-CCGGA-GGGATACTACAATGTGAG---------CACAC-CATTTTT-CAA-TTTCTTTT----CACTCTACTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTAGTAC-TGTTTGTCTTGACTTTATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTA--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTATCCATTTTGCCTATTT-CTACAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTAACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGTTTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGCTGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTCAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAATATTTCGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTACTTGTATGTACC-AAATGGACTCATGGTATCTTTCTTTTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCCCCTATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCCTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GG---GCGTGCGGCG---GGGGTGC--TTCGG-CGC--CCCTTA--CGAACGTCTCCC-------TCC---CGTCCGC-GACG-CG----CGCTCGCGCGCTCGTT-TC-GGGCGA----CTAA---CAAACCCCGGCGCGAAAAGCGCCAAGGAATACTTAAC-GGACAG--CCCGTCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGGG--GGATTCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATA-CGTCGCCCCCC-GCACGCCGC----------------GCTGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAACGCGAGTCTACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGTGTCGTGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCT---CATCGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATAT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTT----------CCAACAAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTTT----------------------------AGAAAAAT---ATAAAA-ATAAAA------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATAATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGTATTTGTATAC-AATAATTGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_diversiflorum ???????GGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGTAGGTCAAAGTTGGAGACAGCATCGAAATTGTTCGTTCCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAAACCTTA-GAGAGG--CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTTTATCCTTT-GAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTT-AATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCGTGCTAAT--CAACAAGGTTGTACCAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAACGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACGGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACTTCAGCATCTGCCAAAATATTATGTATGTTTATGAAATTAAATAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCGTCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCA-CTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--G-----------------------------GG--GC---CGCCC--CGCGCGTGTCCC-------TCT---CGCCCCC-----------------------T--TTCTC-GGGGG-----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCAC-CCGCG--CCCCGTCCGCGGAG-CATGCGGG-TGGATGCG--TGCTTCTTTGG----AAAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------CCGGC---GTCGCGGGGG--CGGAAACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AATTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTGTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTAGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCCAG-CTTATCCTATCTCAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_drymophilum GATGCTTGGGATACTAGTGTCGCCATCGAGGTATTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GGTTCAAGCACCT---GATCCCTCCTTTATCTGCAGGTCAAAGTTGGAGACAGCGTTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTGTGAACCCTTA-GAGAGAT-CCTGA-GGGACACTACAATGTGAATGCGCAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGCTCAAAAATCTATGGCCCCAAAGCTGGAGAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTGATGTGGCATTTTACCTTC-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATATTTCTCTGGACCATATGGTAACACATCCCAGTTTCAGGAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCCTTCCCTGCTACTTGAAGTCAATGTACCAGTCAAAAGGACTCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTAATAATGTATGGTAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGTTAAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----GAAAGCTCTTTTGATG-TAGTAAA--TTGAGTTTCA-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGAAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGAAGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTGTTCCTAA-TCAAAATCTATATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGTATCTGTTTTGTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCGCA-GCAGAACGACCCGCGAACGCGTT-CGG-ACGA-CCGGG-GGGGG-CCGCGCTACG---GGGGCGC--TCCGG-CGC---CGCCA--CGCGCG-CTCCCCCCAC---CC---AGCCCCC-GGTGGCG----CGCCCGCGCGCTCGGCT{CT}C-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGACTACCCAAA-CGAGAG--CCCTCCGC-CCGCT--CCCCGTCCGCGGGG-CGCGCGGG-CGGACGCG--CGCTCCCTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GCGGCGGGGG--CGGACACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAGC----TCTC-CC-GGCGCCGCGGCCGCAGCCCGTCGCGCGTGACGACTCCCCGG-CCCT---TCCGGCGCCC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTTTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAGG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTTAATTTGAAAACAAAAG-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTTTT---------------------------ATAAAAATAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTTATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_dulcamara GATGCTTGGGATACTAGCGTGGCGGTTGAGGTACTCCTA-----TATTAACTGCAATATGAT---GCAAT-ATA---TCT-CTTCCATTCCCTGATTCAAGCATGT---GATCTCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTCCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTGTTTGTTGACCACCCAATGTTTTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGAGGGGATACTACAATGTGAATACACAGAACATGT-CATATT--GAA-TTTCTTTT----GACTCTACTGGTGCTTTT-ACCCTTG-AAGGTTTGGGGCAAAACTGCTTCAAAAATCTATGGCCCCAAAGCTGGACTAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTACTTGTAC-TCTT-GTCTCGACTTTATGTGGCATTTTACTTTT-GTCTTTAATCGTTTTAT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCTAGTTTCAGAGA-ACTCCTTAGC-ATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTTTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATGTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCAACAACTTT-----AGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGGAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGCTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGAATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAGCCACTGTAAGATAAGATTTTT--CTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAGGAGTTCTTGCTAA-TCAAAATCTCTATGCAGGTCATGGACGCAAAACCTTTACTGAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGCATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGGTATCCTTCTTGTTGTGTTTACTTGTGCCAAAATTGAAATCGATCTGCAACTCATCC--TATGCTTCAGGGAACTGGTAAAAAGAAGTTCGAGAAGGAGATTGAACAACTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CAA-AACA-CCGGG--GGAG-GCGCGCGACG---GGGGTGC--TCCGG-TGC--CCCCTC--CGCGCGCGTCCC-------TCC---CGTCCCC-GACGG------CGCGAGC-------TTTTC-GGGCGA----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTGAACTCGAGGG--CCTTCCCCCTCGCG--CCCCGTCCGCGGAG-CGCGCGGGGGGGACGTG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCTC----------------AGGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGGAATCTCAAC----TCTC-TCTTCCGTCGCGGCCACAGCCCGTCGCGCGCTGGGGCTCCCAGA-CCCT-TTTTTCGCGCCT---TACTTAGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GTAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTACTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTGCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCACATAATTTTAATTTTAAAACCAAAA-----TGTCTGTTTATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTAGATCA-AAAGAAAAGTATCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----CCCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTCTGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATTTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_echinatum ?ATGCTTGGGATACTAGTGTTGACATTGAGGTACTCCTA-----ACTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAG{GT}T-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTAAATTTGAACTGCAGCAAATACTTCTCGGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAATAGGAATCTATTTGAATGCCA{AG}GGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTGT-----AAAAGCTCTTTTGATGCTAGTGA{AG}--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTGAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGA{CT}GTTCAAATAGTAGTCCTTGTAAGTACCCAAGTGGACTCGTGGCATCTTT-------TTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAAAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAAAAACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-?GC---CGCCC--CGCGCGCATCCC-------TCC---CGCCCCC----------------------CTC-TTC---GGGGGGG---CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAACAGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGACGCG--TGCTTCCTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCACGCCGC----------------TCGGC---GTCGTGGGGGG-CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCG{CT}GCTCCCCGA-CCCT---TCAGGCGCTCGC------GCGC-CTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCCC----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATAT------------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAAATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCCATCTTAATTAC-----------CACAACACCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_elaeagnifolium_SA ????CTTGGGATACTAGTGTTGCCATTGAGGTACTCCTC-----TCATAACCGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTAAGAGAGGT-CCTAA-GGGATGCTACCATGTGAATGCACAGAACACGT-CATTTTT-GAA-TTCCTTTTTT--AACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCTTGTTCTGTCAAGTAAGTTACTAGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTGGCAATCA{CT}A--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGC-----------AGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACGAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCCGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TCTAATGCTTCAAATCAGA---TCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTACAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGCGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGATAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAGTATGATATAACCACTGTAAGATAAGATTGTT--CTGACCTCAGCATCTGCTAAAATATTATGTAGGTTTATGAAATTAAATAGTTCTTCCTAA-TCAAAATATCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGATATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGAGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAA???????????????????????????????????????????????????????????????GGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAC-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TTCGG-CGT---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCCC-------------------------GTTCTC-GGGGG-----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGGTGCG--TGCTCCTTTCG----GAACGAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCACGCCGC----------------TCGGCGT-GTCG-GGGGG--CGGAGACTGGCCCCCC-GTGCGCCCCGCGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGC{AG}AGTGGTGGTTGTAA-CCCAAC----TCTC-TC-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TGCGGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTCCTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCTCATTTTTTAGATTTTTT---------------------------ATAAAAGGAAAATCAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTTATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAATTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_elaeagnifolium_TX GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCATAACCGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACC{CG}TTAAGAGAGGT-CCTAA-GGGATGCTACCATGTGAATGCACAGAGCACGC-CATTTTT-GAA-TTCCTTTTTT--AACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCTTGTTCTGTCAAGTAAGTTACTAGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGC-----------AGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACGAGGTTGTACTAATTT{AG}TGATAAATTTC{AG}CATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCCGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TCTAATGCTTCAAATCAGA---TCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTACAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGCGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTAGGTTTATGAAATTAAATAGTTCTT{CT}CTAA-TCAAAATATCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGATATCTTTCTTGTTATGTTCACTCG{CT}GCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGAGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCATATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACCCGTT-CAC-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TTCGG-CGT---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCTC-------------------------GTCCTC-GGGGG-----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGATTACTAAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGGTGCG--TGCTTCTTTCG----GAACGAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTGGCGGGGG--CGGAAACTGGCCCCCC-GTGCGCCCCGCGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TC-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGG-CCCT---TCCGGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTCCTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGGAAAATCAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTTATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAATTGCATTTGTATAC-AA??????????????????????????????????? Solanum_felinum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACATTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCT---AATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAACGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACTCAGCAACTGACAAATACACAGATATCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTAGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG-GGGGG-CCGCGCGGCG---GGGGCGC--TCCTG-CGC---CGCTC--CGCGCGTCTCTCCCCCCC-TCCG--CCCCCCC-GACG-CG----CGCTCGCGCGCTCGTCC-C-GGGGG-----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCCCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCT--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATGGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_ferocissimum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---{AG}CAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTACTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTGGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GCCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAG{AT}-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTG{CT}ATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCAT{CT}GATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTGTTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CC--AACA-CCGAG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCC-------TCT---CGCCCCC--------------------------TCTCC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG-CCCCCGTCCGCGGGG-CGTGCGG{AG}-CGGGTGCG--CGCTTCTTTAC----GAACCTAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC-----------------------------GGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTTATATTTTATATTTATA-----------C--AAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATACATTTTTATGTTATGATTTTT---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_fraxinifolium GATGCTTGGGATACTAGCGTTGCGGTTGAGGTACTCCTA-----TCTTAACTAC-TTATGAT---ACAGT-ATA---TCT-CTTCCATTTCCTGATTCAAGAATGT---GATCTCTACTTTATCTGCAGGTCAAAATTGGAGACAGCATTGAAATGGTTCGTTTCTTTCACTGTTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATCTTCTTGGAGAAAGTAAGCATATTATGAATCCTTA-GAGAGAT-CCTGA-GGGATACTACAATGTGCATACGCAGAAAACAT-CATTT---TAA---CTTT-CTTTTAACTCTACTGCTGCTTT--ACCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTG----------TCTTGATTTTATGTGGCATTTTACTTTT-GTCTTTAATCGTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGTAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-ACTCCTTAGCAATTATA--GTATATCATTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-ATGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAAAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTAGCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCACAACATTGCCTACCAAGGCCGATTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----TGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTCTAA-ATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTGGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTGGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACGGTAAGATAAAAATTTT--CTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAAGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGACGTTCAAATTGTAATCCTTGTAAGTACC-AAACGAACTCATGGTATCTTTCTTGTTGTGTTTACTTGTGCCAAAAGTGAAATTGACCTGCTAATCGTCC--TATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACGTGTTTC---AACA-CTTGA-GGGAG-CCGCGCGGCTGGGGGGCCGAAGCTTCGTCCC---CCCGCC-CGTGCGTCCCCC-------TCC---CGTCCCC-GCCG-CGCG--CGCCCGCGTGCGCGTC----GGGCGA----CAAA---CGAACCCCGGCGCGGAAAGCGCCAAGGACTACTAAAC-TAGCAG--CCCTCCCC-TCGCG--CCCCGTCCGCGGAG-CGTGCGTG-GGGATGCG--TGCTTCTTTTA----AAACACAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TAGGC---GTCGTGGGG---CGGAAGCTGGCCTCCC-GTGCGCCTCCAGCGCGCGGCTGGCCTAAATGCGAGTCCACGCCGACGGACGTCGCGGCAATCGGTGGTTGA{AG}A-CTCAAC----TCTC-TTTGTCGTCGCGGCTACAGCCCGTCGCGCGTTCGGACTCCCAGA-CCCTCCGTGCGCCGCCT-AATCGAAG-GCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTAATACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATTGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGAAAGGGCTCAGAAGAGCCAAGAATAGCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTTGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACAAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAT----------------------------------AT-AAAGTCAAATAAAA-------------TATATGAAATAGAAAATTAGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_furfuraceum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTGGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGTATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTACTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCACCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCGCA-GCAGAACGACCCGCGAACGCGTT-CA--AACA-CCGGG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCC-------TCT---CGCCCCC--------------------------TCTTC-GGGGGG----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG-CCCCCG--------------CGGG-CGGGCGCG--CGCTCCTTTAC----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCA------ATCTCTCCCC-----ATTGAAAAAGGATAATTTCTACATGAGATAACACA-----TAAGATAAAAG------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-TTTATCTCTTTATCTTCTCTTTATCT---TTTATCT--------CTTTATCTAAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTTATATTTT-----------------------------CTAAAAATAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTATCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_glaucophyllum GATGCTTGGGATACTAGTGTTGCCGTTGAGGTACTCCTA-----TTTCAACTAC-ATATGAT---ACAAT-ATATGATCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGCAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTCGATCGTGTTTTTGTTGACCACCCAATCTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTA-GAGAGGT-CCTGA-GTGATACTACAATGTGAC---------CACAC-CATTTTT-CAA-TTTCTTTT----CACTCTACTCGTGCTTTT-ATCCTTA-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTGCTTGTAGTAC-TGTTTGTCTTGACTTTATGTGGCAATTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCGGGACCATATGGTACCACATCCCAGTTTCAGAAA-ACTCCTTAGTAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATCGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCCATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--AAACAAGGTTGTATTAATATATGATAAATTTCATATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGCTGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATGTGAAAAGCCTGTCAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATGAGATTTTT--CTGACTTCAGCATATACTAAAATATTTCGTATGTTTATGAAATTAATGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTGCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTAGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTACTTGTATGTACC-AAATGGACTCATCGTATCTTTCTTTTTATGTTCACTTTTGCGAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAATTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCCTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACGCGTT-CA--AACA-CCGGG--GG---GCGCGCGGCG---GGGGTGC--TTCGG-CGC---CCCTC--CACGCGTCTCCC-------TCC---CGCCCGC-GACG-CG----CGCTCGCGCGCTCGTT-TC-GGGCGA----CTAA---CAAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-GGACAG--CCCGTCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCTGG-GGGATGTG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATGTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACCG-G-CGTCGTGGGG---CGGATACTGGCCGACC-GTGCGCCCCGAGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TC-GGTGTCGTGGCTACAGACCGTCGCGCGTCCGGACTCCCCGA-CCCT---CATCGCGCTG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTT----------CCAACAAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------ATAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTCTATTT------------------------------AGAAAAGTAAAA------------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGTATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_glutinosum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAGAGTTGGAGACAACATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTGGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA------------------------CAATATGACTGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAAAAGATTACTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATTCTTTTTA---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA-----TTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCTCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCGGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGGAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAG-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-{AC}GC---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCCC--------------------------TT-CC-GGGGGGG---CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGGTTGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGGG-CGGACACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTGA-CTCAAC----TCTC-TT-GGTGCCGCGACTACGGCCCGTCGTGCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCCA--------TCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CTAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATCGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATG-----ATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_hastifolium GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTA--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACGAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTCTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCA---AATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGATTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCCTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACCCGTT-CA--AACA-CCGGG--GGAG-C---------------------------------CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTCC-GGGGGGGG--CCAAA--CGAACCCCGGCGCGAGAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTCCGGG-CGG?CGCG--CGCTTCTTTCG----AAACGAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCCCGCGGCCGGCCCAAACGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCCCAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---GCCGGCGCTAGCTAGCTAGCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAGGATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AAATTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT---------------------------AAATTTATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTTAGATTTT-----------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTTATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_heinianum GATGCTTGGGATACTAGTGTGGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTC-GAA-TTCCTTTTTTT-AACTTTGCTGGGGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGACATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTGCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGCGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATGTTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGGCTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTCATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTACCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGT--CAA-AACA-TCGGG--GGAC-TCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CCCCC--{CT}GTGCGCGTCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--C{GT}AACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGCGCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGGAAAAG-ATAATTTCTCCCTGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTTCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_hieronymi GATGCTTGGGATACTAGTGTTGCCATTGAGGTATTCCTA-----TCTTAACTGC-AAATGAT---AAAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTTAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAACGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTCTGCTGGTGCTTTT-ATCCTTG-AAGGTTTGGGGCAAAACTGGTTCAAAACTCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAT-TGTC-GTCTTGACTTAATGTGGCATTATA-TTTTTGTCTTTAATCCTTTCTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTCGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTAAATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCGTTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCAGAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCTTCCAGGTCTCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGATTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAAACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAGTCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGCAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAATAGATGATATTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAAATAAAGAGTTCTT---AA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTAATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTATCTTGTTACGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGC{AG}TCAGGGAACTGGAAAAAAGAAGTT{CT}GAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCGCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAG-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTCGG-GGGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGT---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCCCGGGCGG------CGCGAG-----CCGTCCT--CGGGGG----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-TGAGGG-GCCCTCCGC-CCGCG--CCCCGTCCGCGGGC-CGCGCTGG-CGGATGCG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCCCGAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCGATTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGTGCGTGCCGGCTCCCCGA-CCCT---CACAGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTGATCATCAATTTCCTTTATCTC---TTGATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAAGTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCTATTTTTAAAATTTTTTATATTT---------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTTTGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC----TACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTTCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_hindsianum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTT-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACCATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCTTGTTCTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGGCTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCTTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCT{AC}TTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACAAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CA{AG}CAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCGATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGTTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTACAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTATATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGCTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATTCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGC{AC}AAATTCAATGTCCCTTTGGCTCACATGATCACCGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAAACCTGCACA-GCAGAACGACCCGCGAACACGTT-CA{CT}-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TTCGG-CGT---CGCCC--CGCGCGT-TCCC-------TCC---CGCCCCC-GACGGTG----CGCTCGCGCGCCCGATTTT-CGGGGG----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATTCG--TGCTTCTTTCT----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGAGATTGGCCTCCC-GTG{CG}GCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CTCAAC----TCTC-TT-GGTGCCGCGGCTACAGGCCGTCGTGCGTGCGCGCTCC{AC}CGA-CCCT---TCCAGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTCCTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCTTCTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGGAAAATCAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTTATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAATTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_hirtum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----T{CT}TTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GA{GT}TCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGTGGT-CCTGA-G{CG}GATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--CACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAA-TGTT-GTCTTGATTTAATG{CT}GGCATTTTACCTTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGAAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--A--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATAAGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAGCGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAAGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTTGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG--GGGG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CACTC--CGCGCGTCTCCCCC-ACCCTC----CGCCCCCCGACG-CGCG--CTCGCGCGC--TCGTTCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGAGCCTCGTGCCCGCGGCCGGCCCAAATGCGAGGCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCCAGTTTATCT-CTTTATCT---------------------------AAAGTAATCTAAA------GTAATCTAAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAAACCTCTTT-----------TCTTTTTGTCTTGATTTTGTTCGAAAAG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGAATAA-----------------TTTTAATTGAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_hoehnei GATGCTTGGGATACTAGTGTTACCGTTGAGGTACTCCTA-----TCTTAACTGC-ATACGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATGGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATACGCAGAACACGC-CATTTTT-GAA-TTTCTTTT----GACTCTACTGGTGCTTTT-ATCCTTT-CAGATTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCT-GACTTTATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATATTTCTCAGGACCATATGGTAACACATCCCAGTTCCAGAAA-TTTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCT----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTATTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTTA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCACAACATTGCCTACCAAGGCCGATTTGCTTTCTCCGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCATGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGGTATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTCGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCCCACATGATCACTGCTGGTGCTGATTTTATGTTGGT{GT}CCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGGACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCC---GGGGTGC--TTCGG-CGC---CCCTC--CTCGCGTCTCCC-------TCC---CGTCCCC-GACG--GCG--CGCCCGTGCGCTCGTTTTC-GGGCGA----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACCTAAC-TGAGAG--CCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGTGCGGG-GGGATGCG--TGCTTCTTCTG----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------GCGGC---GTCGTGGGG---CGGATAATGGCCTCCC-GTGCGCCTCGAGCTCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGTGCCGTGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCT---CCTCGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACCTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_hyporhodium GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAGGTAAGCATATTCTGATCCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACATTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGAAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTAACTTGA-TTGCA--A--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATAAGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAGCGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGC-AAAATTGAAATTGACCTGCAACTCATAC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGGGGGGGGGCCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCTT--CGCGCGTCTCCCCCCCCCCTC----CGCCCCCCGACG-CGCG--CTCGCGCGC--TCGTCCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-ATCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGTGCGCTCCCCGA-CCCT---ACCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_incanum ???????GGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAG-TTCCTATTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAAC{GT}TAGATTCAGCCTG{CT}{CT}GTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCATGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACC{CG}AGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTA{AG}CACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTC{AG}TTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGG{AT}ATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTT{AG}CTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATA{AT}CTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGA{AG}ATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGA{AG}CAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTG{CG}TTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGG{CT}GC--GGGGCGC--TCCG{AG}-CGC---CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTCC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAACCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCTGTCCGCGGGG-CTTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGTCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---GCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATATTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_incarceratum ?????????????????????????????????CTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGTGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTGTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAGCACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TATCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGTAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTAACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTTT--CTGACCTCGGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGATTCATGGTATCTTTCTTGTTATGTTCACTCGAGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGCACGACCCGCGAACACGTT-CA--AACA-CTGGG--GGGG-CCGCGCGGCG---GGGGCGC--TTCGG-CGC---TGCCC--CGCGCGTCTCCCC------TC----CGCCCCC-GATG-CGT----GCCTCTGTGCTCGTTCTT-GGGGG-----CCAAAA-TGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCG{CG}GGCTGGCCTAAATGCGAGTCCACGT{AC}GACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGC{AC}GCGGCCACAGCCCGTCGCGCGTGCGGACTCCCC{CG}A-CCCT---CCCAGCG{AC}TC--------A{CG}GCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGGAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCTCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_incompletum ???????GGGATACTAGTGTTGCCATTGAGGTAGTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTATTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTAGTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGCTTTTTAATATTTTGCAGACTTGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATATCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACTGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGCATCTT-CTTGTTATTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTATACCCTAACAAAGCTAAAGGAGCGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGGG--CG{ACT}G-----------------------CGC---{GT}CCG---CGCGCGTCCCCCCC-----T-----CGCCCCC--------------------------T{CG}TTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG-CCCCTCCGC-CCGCG-CCCCCGTC{AC}GCGGGG-CGTGCGGG-CGGGCGCG--TGCTCCTTCAC----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCTGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-TTTATCTCTTTATCT-------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTTATATTTT--------------------CTAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_jamaicense GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAGT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGTAGGTCAGAGTTGGAGACAACATTGAAATTGTCCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGTT-CCTGA-GGGATAC-----------------------GC-CATTTTT-GAA-TTCCTTTTT---GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAGTGTGGCATTTTACCTTT-GTCTTTAATCCCTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAGTCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTCCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTACTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGATTGTACTAATATCTGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTGAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGATCATCAACTTT-----AAAAGCTCTTTTGATGATAGTAAA--TTGTGATTTT-AATGTTTTGCAGACATGAAAAGCCCGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACAGTAAGATAAGATTTTT--CTGACCTCAACATA-ACTAAAA-ATTATGTATGTTTATGAAAATAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGAACTCATGGTATCTTTCTTGTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTCGTACCCCAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAG-GCAGAACGACCCGCGAACACGTT-CA--ACCA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGT-TCCC-------TCC---CGCCCCCGGGCG--GCG--CGCCCGCGCGCTCGCCTCC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAGA-CGAGGG--CCCTCCGC-CCGCG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGC{AG}TCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGAGGGGG--CGGAGACTGGCCCCCC-GTGCGCCCCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TC-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT--TTCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTAGCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAATAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AATACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAA------AACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGAATAA---------------------AATA-AATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTCGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTACTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_kwebense ???GCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTAATGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATGCTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTTTAACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAAAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAAAACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCCTTA----TTTTGTGTATTT-CTGCAGGAGAAGATGTTCTCTTC{AG}TTGGCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTCTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCAT{AC}TGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTAGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGTGTCTTTCTTGTTATGTTGACTTGTGCAAAAATTGAAATTGACCTGCAACTCACCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTTCCTTTGGCTCACATGATTACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAA-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGT--TCCTG-CGC---CGCCC--CGCGCGTGTCCC-------TCT---CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCGAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCCCGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTTGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTATAGCCCGTCGCTCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAATG-ATAATTACTCCATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-------TCTTTATCT-------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTTAATTTGAAAACAAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTT---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_laciniatum GATGCTTGGGATACTAGCGTGGCGGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTTCCATTCCCTGATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTTAAAGTTGGAGACAGTATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTG-GAGAGGT-CCTGA-GGGATGCTACAATGTGAAAACGCAGAATACGT-CATTTT--GAA-TTTCTTTT----GACTCTACTGGTGCTTTT-ACCCTTTTAAGGTTTGGGGAAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACGAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACTTTT-GATTTTAATCGTTTTTT---AACATTGTTT-----------------------------------------------------------------------------------------TCTT-GTCACTCTCAGGCTGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAATTTCAGAGA-ACTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTTTTCATTGCCAATGATTGGCACACGGCTCTGATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATT-ACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTATATTAATATATGATAAATTTCACAATGCCTCCAGGTCGCTTTCTGCATCCACAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGATGCTCTTTTGATGCTAGTAAA--TTTAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGGAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCCTACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAATATAAGATTTTT--CTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAGGAGTTCTTGCTAA-TCAAAATCTATATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAACGGACTCACGGTATCTTTCTTGTTGTGTTTACTTGTGCCAAAACTGAAATTGAT-TGTTACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACTTGTT-TG--AACA-CCGGA--GGGG-CCGCGCGGCG---GGGGTGC--TTCGGCCCC-{CT}CCAGTC--CGCGCGTCTCCC-------TCC---CGCCCCC-GACG-CG----CGCTTGCGCGCTCGTTC---GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTGAAT-TGACGG--CCCGCCCC-CCGCG--CCCCGTCTGCGGAG-TGCGCGGG-GGGACGTG--TGCTTCTTTTG----AAACAAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------CAGGC---GTCGTGGGGG--CGGAAGCTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACCTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-GA-TGTGCCGCGGCCGAACCCCGTCGCGCGTCTGGCCTCCCAAA-CCCA---CAGTGCGCTC--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTTTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATCGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTCTGTTT----CCCACCTTGCTGGACTAAAAAAAA------GAAGCTTTTTAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATCCCCC-TGTTCGACAAAAGCTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_lanceolatum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAGAGTTGGAGACAACATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA------------------------CAATATGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTA---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTTAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCTCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCGGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCGTGCAAAAATTGAAATTGACCTGCAAATCATCC--TATGCATCAGGGAACTGGGAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAA-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCAGG-CGC---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCCCTTACG---------------------------GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCGAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTTCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTAC----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGCCGACGGACGTCGCGGCAATTGGTGGTTGTGA-GTCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGTGCGTGCGTGCTACCCGA-CCCT---TCAGGCGCCA--------TCGCGCTCCGACCGCGACCCCAGGTCA------------CCC------AT-GAAAAAG-ATAATT-CTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCTCCTTTATCTCTTTATCT---------------------------------------------AAAGTAAAGAAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCTTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CTAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTCGATTGTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATG------TTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_lasiocarpum ??????TGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTATTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACATTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTG-CT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCT---AATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAACGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATATCAAATATGATATAACCACTGTAAGATGAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTAGTGC-AAAATTGAAACTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG--GGGG-CCGCGCGGCG---GGGGCGC--TCAGG-CGC---CGCTC--CGCGCGTCTCCCCCCC---TC----CGCCCCCCGACG-CG----CGCTCGCGCGCTCGTCCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_lidii GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCGA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGATCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTCGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCC{AC}AAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTTTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTTACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGACACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTA{CG}C-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCGTGCTTCTTTCGAAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGGCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCACGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_linnaeanum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTATGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAG-TTCCTATTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTGGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGGTAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTTGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGT--GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTGCCCC-----T-----CGCCCCC-GACG-CG------------------------GGGGGGG---CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-TGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATATTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTGCGCGCTCCACGA-CCTT----CCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_luteoalbum GATGCTTGGGATACTAGTGTTGCCGTTGAGGTACTCCTA-----TTTCAACTGC-ATATGAT---ACAAT-ATATGATCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGCAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATCTTCTTGGAGAAAGTAAGCATATTCTCAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAC---------CACAC-CATTTTT-CAA-TTTCTTTT----CACTCTACTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGCTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTAGTAC-TGTTTGTCTTGACTTTATGTGCCCTTTTACTTTT-GTCTTTAATC--------------------------------------------------------------------------------------------------------------CTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCGGGACCATATGGTAACACATCCCACTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGCTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATCGTCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCCATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTTATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----ACTAGCTCTTTTGCTGCTAGAAAA--TTGAGTTTTT-AATATTTTGCAGATGTGAAAAGCCTGTCAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCGTATACTAAAATATTTCGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTCTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTACTTGTATGTACC-AAATGGACTCATGGTATCTTTCTTTTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCCTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACTTGTT-CG--GACA-CCGAG--GGGG-GCGCGCGGCG---GGGGTGC--TTCGG-CGC---CCCTT--CGGTCGTCTCCC-------TCC---CGTCCGC-GGCGGG-----CGCCCCCGCGCTCG-CTTC-GGACGA----CTAA---CAAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAACGGAAAG--CACGTCCC-CCGCG--CCCCGTCCGCGGTG-CGCGCGGG-GGGATGCG--TGATTCTTTCG----AAATCGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGCGCCGTGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCA---AACCGCGCTA--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC-----TATCT--TTC----CTTTATCTCTTTATCT-------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAATACCCAGCCGGGCCTCTTTTGTT----------CCAACAAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------ATAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTT------------------------------ATAAAAGTCAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGTATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_lycocarpum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT----------ATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATACGCAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTTCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACGAGATTATTTGGACAATGAACTTAGGTTCAGCTTATTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTATTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACAACCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTTATCA----TCTTTA----CTTTGCCTATTT-CTGCAGGAGAAGATGTTCTTTTCATTGCCAATGATTGGCACACAGCTCTCATTCCATGCTACTTGAAGTCAATGTACCAGTCTAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTAATCACTTGA-TTGCACAC--TTTACCCTGCAAAT--CAACAAGGTTGTTCTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----TAAAGCTCTTTTGATGCTATTAAA--T----TTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAACTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCAAAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-TAGTGGACTGATGGTATCTTTCTTGTTATATTCACTCGTGCAAAAATTGAAATTGACC--------------TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCTGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACCACCCGCGAACACGTT-CA--AACG-CCGGG--GGAC-CCGTGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTATCCCCCC----ACC---CGCCCCCCG-CG-CGAGCGCGCGAG--CGCTCGCCTCC-GGGGG-----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGGC-CGCGCGGG-TGGACGCG--CGCTTCTTTCG----AAACCAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCA-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGAGACTGGCCCCCC-GTGCGCCCCGGGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCAC-GCCCGTCGTGCGTGCGGACTCCCCGACCCCC---CCCAGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATCTCAAGAAAAATAAAG---------------------------------------------AAGACCTCTTTTCTTTGTCTCTTTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTT-----------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTTTGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_macrocarpon GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-TAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCGCTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TTTCCTTAGCAATCATA--GGATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTTTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTT-GCAGACATGAAAAGCCTGTGATAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT-TCTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTACTTGTTATGTTCACTCGTGCAAAAAATGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTC?CCCCCC----T-----CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-TGGATGCG--TGCTCCTT-CG----AAAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------CCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCGCGCGGCCGGCCTAAATGCGAGCCCGCGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCACGA-CCCT---ACCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTTAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTACCATTTTTGATATTTTTTATATTTTATATTTTAATTTTATATTTTATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_mahoriensis GATGCTTGGGATACTAGTGTGGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTA--------------TGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTT----GCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGCGGCACCCAGAGTTCTGAATTTGAACTGCAATAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTGCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGTGAAGATGTTCTCTTCATTGCCAATGACTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGGATGCCAAGGTAAAA-TCTCTTTGTATTCATTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTGATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATTTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTACTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTTCC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTTATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACGCGTT-CA--AACA-CCGGG--GGAC-CCGCGCGGCGT--GGGGCGC--TCCGG-CGT---CGCCC--CGCGCGTGTCCC-------TCT---CGCCCCC--AC----------------------TTC---GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCT----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATAGCGTCGCCCCCC-GCACGCCGC----------------TCGGCGTCG-CGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCCCGA-CCCT---CCTGGCGCCA--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATAT-AT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_mammosum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TGGCA--C--TTTACGCTGCAAAT--TAACAAGGTTGTACTAATGTATGATAAATTTCACATTGCCTTCAGGTCGCCTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCCGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAAACACTGTAAGAAAAGATTTTC--CTGACCTCAGCATATACTAAAATATTTTGTACGTTTACGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTTCTGCAATTCACAAATTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGACGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGA?GATCATTGTCGAAG-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CCA-AACA-CCGGGGGGGGG-CC-CGCG-CGTGGGGGGCGC--TCTGG-CGC---GGCCC--CGCGCGTCTCCCCCCC---TCGCT-CGCCCCC-GACGATGCG--TGCCTCCGGGCGCGTTTTT-CGGGGG----CCAAAA-CGAACCCCGGCGCGGAAAGCGTCAAGGAATACAGAAT-CGAGGG-CCCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCC----GGAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGCCGCCC-GTGCGCCCCTAGCGCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---GCCGGCGCTC--------AGGCGCTCCGGACGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTTTT---------------------------AGAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GGCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTACATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_mapiriense GATGCTTGGGATACTAGCGTTGCCGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAGATT-CAAT-ATA---TCT-CTTC--------CATTCAAGCATGT---CATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-CAGAGGT-CCTGA-GGGATACTACAA----------CAGAACACCT-CATTTT--GAA-TTTCTTTTT---CACTCTACTGCTGCTTTT-ACCCTTTTAAGGTTTGGGGCAAAACTGGGTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTCTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACTTTT-GTTTTT--------------AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAATTTCAGAAA-ACTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----T{AC}TTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGTTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACGAGGTTGTAATAATATATGATAAATTTCACATCGCCTGCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTAGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGTACATACTAAAATATTTTGTATGTTTATGAAATTAATGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGATGCCAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGGTATCTTTCTTGTTGTGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTATAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTG-----------------------GGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--TGCG-ACGCACGGCG---GTGGTGC--TTCGG-CCC---CCCC?--TTTGCGTCTCCC-------TCC---TGCCCAC-GAC---GCG--TGCTCGCGCGCTCGTCTTT-GGGCT-----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAACACTGAAATTGAGAG--CCCGCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-GGGATGCG--TGCTTCTTTGG----AAACCAAAA-TGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AGGGC---ATCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAAAGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGTGCCGTGGCTACAGCCCGCCGCGTGTCCGGACTCCCAGA-CCCT---CTTCGCGCTCAG------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGGGACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAA------AACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTT------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAAGAAAAGTCTCATTTCTCTTTCTGCTTTTTAATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGC----TTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_marginatum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTATGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCGG-CGT---CGGCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTCTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGGG-CGGATACTGGCCTCCC-GTGCGCCTCGCGCTCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGGCGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACAGCCCGTCGCTCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCAT--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAAATAACACA-----AAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCTTTTCT--------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGG-TATAGTTTAGTGGTAAA Solanum_melongena GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAG-TTCCTATTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTT-GCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGT--GGGCCGC--TCCGG-CGC---CGCCC--CGCGCGTCTGCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGGGG---CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAG-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCACGG-CCCC---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_microphyllum ??????????????????????CCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAGTTGTTCGTTTCTTCCACTCCTATAAACGTGGGGTTGATCGTGTTTTTGTCGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTAAATGCGCAG{AG}ACACGC-CATTTTT-GAA-TTTCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTG-AAGGTTTGGGGCAAAACTGGTTCAAAAATTTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTGC-TGTT-GTCTTGACTTAA{AG}GTGGCATTTTACCTTT-ATCTTTAA-CCTT-------------G{CT}TT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCTCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCTCAGTTTCAGAAA-TCCCCTTAGCAATCATA--GTATATCCTTGTAGGTCATCA----TCTTTA----TTTTGCCTGTCT-CTTCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGG{CT}AAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGAAAAT--AAACAAGATTGTACTAATATATTATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATTCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTTCATCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAGCTTT-----AAAAG{AC}TCTTTTGATGCTAGTAAC--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAACTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGAATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAACATTTTATATGTTT---AAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAATAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTAACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAGCAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCCAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATG---------------GGATCATTGTCGAAA-TCTGC{AC}CA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGT--GGAG-CCGCGCGGCG-GGGGTGC-C--TC-GG-CGC---CGCCC--CGCGCGTCTCC{AC}C-------CC---CGCCCCC-GGGG-GGCG--CCCGT-CGC-----TCCCC-GGGGG-----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAA{CT}-GGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAT-CG{CT}GCGGG-AGGATGCG--AGCTTCTTTCG----AAAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AGGGC---GTCGTGGGGG--CGGAGACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCTAAACGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGAAA-CCCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTGCGTGCTCACCGA-CCCT---CCAAGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCA--------------------------------------------TGCGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTATTCTATATTATATATTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAACG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTATTCCAATTTATTCCAACAAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTTATTGAATA-------GTTAATATTCAAT--AATTGAATAGTTAATATTC---------AAGCAACAAGAAAAAATGCCCATTTTTTCTATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGAATTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGAGTTTA---------------GTAGTTTTGACAACCCTAT-CTTATCCTATCTTAATTACTACAACTCCACCGCAACTCCCC-TGTTCGACAAAAGTTGCATT-GTATAC-????????????????????????????????????? Solanum_mitlense GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCGTATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATACACAGAACATGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTATTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACAACCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTTTTCATTGCCAATGATTGGCACACAGCTCTCATTCCATGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTAATCACTTGA-TTGCA--CACTTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTATTAAA--T----TTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTGGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-TAGTGGACTCATGGTATCTTTCTTGTTATATTCAGTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAACTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACACGTT-CA--GACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTGCCCCCCC----TCC---CGCCCCC-GACG-CGCG--CTCGCGCGC--TCGTCCC--GGGGGG----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-CGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGTG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-CTGCGCCTCGAGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCAC-GCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT-----TTGTTCCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTATATATTTT--------------------CTAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_montanum GATGCTTGGGATACTAATGTGGCGGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---GCAAT-ATA---TCT-CTTC--------CATTC-----CCT---GATTCCTACTCTATCTGCAGGTCAAAGTTGGAGACAACACTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATACGCAAAACACGT-CATTTT--GAA-TTTCTT-CT---GACTCTA-TGCTGCTTTT-ACCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGAAAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACTTT--GTCTTTAATAGTTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCTTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-ACTCCTTGGCAATTATG--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTCTTCGTTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTT-------ACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCGTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-GAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAGTCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGTATATACTAAAATAGTTTGTATGTTTATGAAACTAAAGAGTTCTTGCTAA-TCAAAATCTCTGTACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCCCTTCAAGCAACAGTTGGCTTGCCTGTTGACGGGAAGATCCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCCGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACT-AAATGGACTCATGATATCTTTCTTATTGTGTTTACTTGTGCCAAAACTGTAATTGACCTGCTACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAAAGCAGAACGACCCGCGAACACGTT-CG--AACA-CCGGG--GGCG-CCGCGCGGAT---GGGGTGC--TTCGG-CCC--CCGCCC---GTGCGTCTCCACCCC---ACC---CGTCCCCGGGCG-------CGCGAGCGC--TCGT-----GGGCGG----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGACTACTGAAT-TGAGAG-CCTCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGTGCGGG-GGGACGTG--TGCTTCCTTTG----AAACCTAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GCCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGAGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TTTGTTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACTCCCAGA-CCCT---GCACGCGCTT--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTTTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAACG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------AGAAAAGTAAAAAAAAAA------------TATATGAAATCGAAAATTTGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_morellifolium ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CATGG--GGCG-ACGCGCGGCG---GGGGTGC--TTCGG-CCC---CCCTC--CTCGCGCCTCCC-------TCC---CGTCCGC-GACG-CG----CGCCCGCGCGCTCGTCTTT-GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACCGAAT-TGAGAG--CCCGCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-GGGATGCG--TGCTTCTTTTG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACG{CT}AGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ATGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGTGTCGTGGCTACAGCCCGTCGCGCGTCCGGACTCCCGGA-CCCT---CTTCGCGCACAAC-----AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGGGACCCTCTTAGTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAAGAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTAATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGC----TTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCATATCTTAATTAC-----------CACAACCCCCT-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_multispinum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAACATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA------------------------CAATGTGAATGC---------GC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTTTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTCAATCCCTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGTCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTACATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGCATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAA-TTTCTCATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACATT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATATTAAAATATTATGTATGTTGATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCAAAAGTTCATCGGATTGGATGTTCAAATGGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGA------TTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAA{CT}GCGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCCCCCC------T-----CGCCCCC------------TTCCGG--------------GGGGGC----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCTCGGCG-CGCGCGGG-CGGATGCG--CGCTCCTTTCG----AAACCAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGA{CT}GGAAGTCGCGGCGAGTGGTGGTTGTAA-CCCAAC----TCTC-TC-GGCGCCGCGGCCGCAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---GCCAGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGT--TCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTTCTTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTA--------------------AAAATAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTT-TTTGTCTTGATTTTGTTCGAAAGG-ACCTTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT--AAAAAAAAAGTCTCATTTATCTTTCTGCTTTTTAATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_myoxotrichum ????CTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATCCACAGAA{CT}ACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTT----GCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTGCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATTGGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCC{AT}GTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CAA-AACA-CCGGG--GG{AG}G-C---------------------------------CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAT-CGCGCGGG-TGGATGCG--TGCTCCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGCGTCGTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGCGCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCCA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTACCATTTTGGAGATTTTTT---------------------------AGAAAAGTAAAA------------------TATATGAAATAGAAAATTCGAT---AAAAAAAA-TCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CAAAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-TATAATCGGATTGTAGCGGGTATAGTTTAG??????? Solanum_myriacanthum GATGCTTGGGATACCAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGTGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTGTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAGCACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TATCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGTAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTAACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTTT--CTAACCTCGACATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGATTCATGGTATCTTTCTTGTTATGTTCACTCGAGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGG-GGGGG-CCGCGCGGCG---GGGGCGC--TTCGG-CGC---TGCCC--CGCGCGTCTCCCC------TC----CGCCCCC-GATG-CGTG--CCTCTGCGC--TCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGGGTGGATGTG--TGCTTCTTTAT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGTCTCCC-GTGCGCCTCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT----CTTTTCTTCTTTCTATATTATATAGATATGTACTATATTATATAGATATGTACAACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_nemophilum ???????GGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACA{AG}T-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTATTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT{GT}GCCTTTAATCCTTTTTTT--AACCTTG{GT}TT-----------------------------------------------------------------------------------------TC{CT}TTG{GT}C???????????????????????????????????????????????????????????????????????????????????????????????-?????????????????--?????????????????????----??????----????????????-??????????????????????????????????????????????????????????????????????????????????????????????????????CC{AG}AGGT{AC}{AC}AA-{GT}{CG}TCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAA{CT}TTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTT{AG}CTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCAT{GT}GATGGGTATGAAA-TTTAATGCTTCAAATTAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATTAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGA{CG}TAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAG{CT}TCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTC{AT}GATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTTGTGGCATCTTTCTTGTTATGATCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACCCGTT-CGG-AACG-CCGGG--GGAG-CCGCGCGGCG-------CGC--TACGG-{AC}GC---CGCCCCGCGCGCGTCCCCC-------TCG---TGCCCCC------------CCCCTCGGGGC---------CGGGG-----CGAA---CCAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAGA-CGAGAG-CCCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-CGGATGCG--TGCTCCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGCGGGG-CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-GTCAAC----TCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TTCGGCGCCA--------GAGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC---AACTTTTAGATATGTACAACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCTATTTTTGAGATTTTTTATATTATAATT----------------ATAAAAGTAAAATAAA--GTAAAATAAAA-TATAGGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTTG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_nemorense GATGCTTGGGATACTAGTGTTACCGTTGAGGTACTACTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATATGCAGAACACGC-CATTTTT-GAA-TTTCTTTC----GACTCTACTGGTGCTTTC-ATGCTTT-CAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTAAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTTGTGTGGCATTTTACTTTT-GTCTTTAATCCTTTGTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCATTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGTAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTCCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGATAATCT----TCTTTAT---TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAAATCTCTTTATATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTGTTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCCGACTTCTCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCA--CCACCAACTTT-----TGAAGCTCTTTTGGTGCTAGTATA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGAATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTT---CTGACTTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAAAAAGGTTCAGATATTCTTGTTACTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGGTATATTTCTTGTCATGTTCACTTGTGCATAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAGCAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTTCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAG-CCTGCAAA-GCAGAATGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGTGC--TTCGG-CGC---CCCTC--CCCGCGTCTCCC--------CC---TGCCCCA-GACG-CGCG--CTCGCGCGC--TCGTTTGT-GGGCGA----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACCTAAT-CGAGAG--CCCGCCCC-CCGCG-CCCCCGTCCGCGGAG-CGAGCGGG-GGGACGCG--CGCTTCTCTTG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTC-GCACGCCGC----------------GCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TC-GGTGCCGTGGCCAAAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCA----------------------------------------TACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACCTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAACCAAGAATATCAAGAAAAATAAAGTAAAGGAAGGGCTCAGAAGAACCAAGAATATCAAGAAAAATAAAGAAGACCTCT-------------TTTCTTTGTCTTGATTTTGGTCGAAAGA-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTGGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAAGAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTACTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACCCCCCCTGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_nummularium GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATACAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCAAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTTTAT-GGTT-GTCTTGACTTAATGAAGCATTTTACTTTT-GTCTTTAATCCTTTTTTTTTAACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAAGCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGACAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACACTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCCGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATTAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATAAAAAGCCTGTGAAAGGTAGGAAAATTAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGAGTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTTGTGGCATCTTTCTTGTTATGATCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACCCGTT-CGG-AACG-CCGGG--GGAG-CCGCGCGGCG-------CGC--TCCGG-CGC---CGCCGCGCGCGCGTCCCCC-------TCG---CGCCACG------------CCCC{AC}TCGGGG--G------CGGGG-----CGAA---CCAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAGA-CGAGAG-CAGCTCCGC-CCGCG--CCCCGT{AC}CGCGGAG-CGCGCGGG-CGGATGCG--TGCTCCATTGG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGCGGGG-CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CTCAAC----TCTC-TC-GGTGCCG{CT}GGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TTCGGCGCCA--------GAGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC---AACTTTTAGATATGTACAACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCTATTTTTGAGATTTTTTATATTATAATT----------------ATAAAAGTAAAATAAA--GTAAAATAAAA-TATAGGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTGTGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTTG-CTTATCCTATCTTAATTAA-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATT-GTATAC-????????????????????????????????????? Solanum_palinacanthum GATGCTTGGGATACCAGTGTTGCTATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACA-TGTGAAAGCGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTC-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GCATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--TAGCAAGGCTGTACTAATGTATGGTAAATTTCTCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAACCAGACCACCTTCTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACACGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTTTCAGCTGATGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTTT--CTGACCTCAGCATATACTAAAATAATTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAATTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGT-CC-AAGTGGCCTCATGGTATCTTTCTTGTTATGTTCACTCGTGTACAAACTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACCGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACACGTT-CC--AACA-CCGGG--GGGG-------------------------------C---CGCCC--CGTGCGTCTCCCCC-----TC----CGCCCCC----GATGCG--TGCCTCCGCGCTCGTTCT--CGGGGG----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-CGAGGG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGACGCG--TGCTCCTTTGT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AGGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGGGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCAAC----TCTC-TC-GGTGCCGCGGCCGCAGCCCGTCGCTCGTGCGGACTCC{AC}{AC}GA-CCCT---CCCGGCGCTC--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-CTAATT----------------CATTTTAATT-------------------------TTAATTGAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATCAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGGTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_palitans GATGCTTGGGATACTAGCGTTGCGGTTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATAT-ATCTTC--CCATTCCCTGATTCAAGCATGT---GATCCCTACTTCATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGAGGGGATACTACAATGTGAAT----------------TTT---AAA-TTTCTTTT----GACTCTACTGGTGCTTTT-ACCCTTTTAAGGTTTGGGGCAAAACTGCTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTACTGTGTCAAGTAAGTTACTTGTTATATTTGTT-GTCTCGACT-------GCATTTTACTTTT-GTCTTTAATCGTTTTTT---AACCTTGTTC-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCTTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCGCATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-ACTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACGAGGTTGTATTAATATATGATGAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAC--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTCGTAAA--TTGAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGGAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACGGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGTTGACAGGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTCCATTACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCGACTGACAAATACACAGATGTCAAATACGATATAACCACTGTAAGATAACATTTTT--CTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTACACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATAGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACGAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTAAC-AAATGGACTCATGGTATCTTTCTTCTTGTGTTTACTTGTGCCAAAATTGAAATTGACCTGCCACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAAGAGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACC-GCAGAACGACCCGCGAACACGTT-CC--AACA-CCGGG--GGAG-CCGCGCGGCGC------CGC--TTCGG-CGT--CCG-TC--CGCGCGCACCCC-------TCCC--CGCCCGG------------CC--TCC-------------GGGCGG----CTAA---CGAAACCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCGCCCC-CCGCG--CCCCGTGCGCGGGG---AG--------GCGCG--CGCTTCTTCTG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-GT-AGTGCCGCGGCTACAGCCCGTCTCGCGTTCGGACTCC-GGA-CCCT---CAACGCGCTT--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAT--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTCTCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTTTATAGTTGTTAGTTGTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAA------------------TATATGAAATAGAAAATTCGATT-AAAAGAAAAGTAGCATTTCTCTTTCTGCTGTTTGATTTTATGTTT----CCCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGTATTTTTATGTTATGATTTTA---------------GTCGTTTTGCCGACCCTAT-CTTATCCTATTTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_pancheri GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-ATGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAAAGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTAGTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAGGCTCTTTTGATGCTAGTGAA--TTGAGTTTTTTAATATTTTGCAGACTTGAAAAGCCTGTGAAAGGT{AC}GGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATAATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCCAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGATAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATC{AG}GATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATTTTCACTCATGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTATTCCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGGG-C----------------CGC------G-CCC---CG-----CGCGCGTCCCCC-------TCT---CGCCCCC-----------------------TC-TTC---GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG-CCCCTCCGC-CCGCG-CCCCCGTTCGCGGGG-CGTGCGGG-CGGGTGCG--TGCTTCTTCAC----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-TTTATCTCTTTATCT-------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TTTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTTATATTTT--------------------CTAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_panduriforme ???????GGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAG-TTCCTATTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTT{CT}T--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTC{AG}TTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTT{AG}CTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGC{CT}CAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGA{AG}ATTGACCTGCAACTCATCC--TATGCATCAGGG{AT}ACTGGAAAAAAGAAGTTCGA{AG}CAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GAAG-CCGCGCGCGGCTTGGGGCGC--TCCGG-CGC---CGCACC-CGCGCGTCTCCCCC-----TCG---CCCCC{AT}C--------------------------TTCGG-GGGGG-----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGC--GCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCTCTCCACGA-CCCT---ACCGGCGCTG--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_paniculatum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----T{CG}TTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAGAGTTGGAGACAACATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA------------------------CAATATGACTGCACAGAACA{CT}GC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCC{CT}AAAGCTGGACAAGATTACTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAAT{AC}CTTTTTA---AACCTTGTTT-----------------------------------------------------------------------------------------TCTT{CT}GTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACA{CT}ATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTT{CG}TCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCGGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCC{AT}TTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTT{AG}CCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGGAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACG-GCAGAACGACCCGCGAACCCGTT-CGG-AACA-CCGGG--GGAG-CCGCGCG-C-------------TCCCT-C-C---CGCCC-----------CCC-------TCC---CG-------------------------------------GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCGAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-CGGTCGCG--TGCTTCTTTAG----AAACCAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGCGTCG-CGAGGGGGGGCGGACACTGGCCTCCC-GTGCGCCTCGCGGCCGCGGCCGGCCGAAATGCGAGCCCGCGTCGACGGACGCCGCGGCAAGTGGTGGTTGTGA-CCCAAC----TCTC-TT-GGCGCCGCGGCTACGGCCCGTCGTGCGCGCGCGCTCCCCGG-CCCT---TCCGGCGCCA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CTAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATG-----ATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_pectinatum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTGACCTTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCACA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGAAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTACA--A--TTTACCCTGGAAAT--CAACAGGGTTGTACTAATATAAGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATAGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAGCGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTAGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGCGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGA?????????TCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG-GGGGG-CCGCGCGGCG---GGGGT??--?????-???---?????-????GCGTCTCCCCCCC---TC----CGCCCCCCGGCG-CGCG--CTCGCGCGC--TCGTTCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCT{CG}TCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGG-G-CGTGGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCA--------AGGCGCTCCGACC??????????????TCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAATAAAAAATAAAATAAAAATATATGAAATAGAAAATTCGAT-AAAAATCAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATTTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_petrophilum ?????TTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCATACTT{CT}ATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GA{GT}AGGT-CCTAA-{GT}GGATACTACAATGTGAATGCA{CT}AGAACACAC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTT----GCTGTAT-GGTT-GTCTTGACTTAATGTAGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCCTCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAG-TTTAATGCTTCAAATCAGACCATCAACTTT-------AAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTAACCTCAGCATCTGCTAAAATAT{CT}ATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTT{AG}CTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCA{AG}ATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAGAATTGAAATTGATCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG---------------------------G-CGC-----CC---CGCGCGGCTCCC-------TCT---CGCCCCC------------CTC-C-------CG------GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG-CCCCCGTCCGCGGGG-CGTGCGGT-CGGGTGCG--TGCTTCTTTAC----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGCCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACAGCCCGTCGCGCGTGCGAGCTCCCCGA-CCCT---TCCGGCGCTA--------CTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTAAAAAAG-ATAATTACTAGATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTTTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTTAGATTTTTTATAT--------------------------AAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAACTTTCGAGTATTC---C-ACAATGCATTTTTATGTTCTGATTTTTTATGTTCTGATTTTTTTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGAGGTAAA Solanum_platense GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGATAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACA-TGTGAATGCGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGTAAAACTGCTTCTAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATACCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACGCAGCGCTCATTCCCTGCTACTTGAAGTCGATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--TAACAAGGTTGTACTAATGTATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCA---ACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCTACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTTT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAATTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCTGCGAACACGTT-CA--AACA-CTGGG-GCGGG-GCGCGCGGCG---GGGGTGC--TTCGG-CGC---CGCCC--CACGCGTCTCCCC------TC----CGCCCCC-AATG-CGTG--CCTCTGTGC--TCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT------------CTTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CAGAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_polygamum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGTATTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCCGA-GGGATACTACAACGTGAATGCGCAGAACACGC-CATTT{AT}--AAA---CCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGTCATTTTACCGTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTTTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACCCAACCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATATACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTACTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTG-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAATTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACTGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCTTAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATTCTAAAATATTTTGTATGTTTGTGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATAGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAATAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCATGCAAAAATTGAAATTGACCTGCTACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAA{AC}-GCAGAACGACCCGCGAACTCGTT-TG--AACA-CCGGG--GGGC-TCGTCCCCCCC----GCCG---TCC-----C---CG------------------------T-----CGCCC---------------TCGC-GGG---CGT-C---GGGCG-----ACTAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACCGAAC-CGACGG---CCTGCCCCCCGCG--CCCCGTCCGCGGCG-CGCGCGGG-GGTGCCAG--CGCCTCGCTTG----AAACACGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-TCGCCCCGC----------------GGGGC---GCGGTGGGA---CGGATACTGGCCCCCC-GTGAGCCCCGAGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAC-CTCAAC----TCTC-GT-GGTGCCGCGGCCGAA-CCCGTCGCGCGTGTCGGCTGTTAGACCCCT---AC-GGCGCCTCCT-----GGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAACTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTTCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_prinophyllum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-ATCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGTTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTAGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGATAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGAG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCC-------TCT---CGCCCCC--------TC----------------TTC---GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAGAGCCCTCCGC-CCGCG-CCCCCGTCCGCGGGG-CGTGCGGG-CGGGTGCG--TGCTTCTTTAC----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCA---GCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTATCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_pseudocapsicum GATGCTTGGGATACTAGTGTTGCCATCGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATCT---CATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTCGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGC-GGGATACTACAATGTTAATTGGCAGAACACAC-CATTTTT-TAA-TTTCTTTT----GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGTCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTTATGTGACATTTTACCTTT-GTCTTTAATCCTTTTTTTT-CACCTTGTTT-----------------------------------------------------------------------------------------TATTTGTCACTCTCAGGCAGCCCTAGAAGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAAATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATGTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACATGA-TTGCA--C--TTTACCCTGCAATT--CAACAAGGTTGTATTTATACACGATAAATTTCACATTGCCTACAGGTCTCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATCGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AGAAGCTCTTTTGATGCTAGTGAA--ATGAGTTTTT-ATCATTTTGCAGATATGAAAAGCCTATTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGTCCATACTATGCCCAAGAACTTGTCTCAGCTGCTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTCACTTAAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGTGTCCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGTCTTTACTAAAGGAGACTCTTCAAGCAACAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGAGAAAAAATTGAAGTTGACCTGCACCTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGCACGACCCGCGAACGCGTT-CA--AACA-CCGGG--GGCG--CGCGCGGCG---GGGGTGC--TCCGG-CCC---CTCGC--CTCGCCCCTCCC-------TCC---CGTCCATGAACG-CGCG--CTTGCGCGC--TCGTTTTTTGGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTTAAC-TGGCAG--CCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGCG-GGGATGTG--TGCTTCTGTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGAGACTGGCCTCCC-GTGCGCCTCGTGCTCGCGGCTGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGAAA-ATCAAC----TCTC-TT-GGTGCCGCGGCTACAGCCCGTCGCGCGTCCGGACTCC-GGA-CCCT---GCTAGCGCTT--------AGGCGCTCCGACCGCGACCCCAGGTCA---------------------------AAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCCTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--TTTATCTCTTTATCTTTTTATCT---CTTTATCT-------------------------------AAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACC------------------TCTTTGTCTTGATTTTGTTCGAAAGA-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCT-GCTGGACTAAAAAAAAAAAAAAGAAACTTTCGAGTATTC----TACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_pseudolulo GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGG-TTATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGAAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTCTATTCACTTGA-TTGCA--A--TTTACCCGGCAAAT--CAACAGGGTTGTACTAATATAAGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAGCGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTAGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-AG--AACA-CCGGG--GGGG-CCGCGCG-CGCGGCGGGGGCGCTCCGG-CGC---CGCTC--CGCGCGTCTCCCCCCCC--TC----CGCCCCCCGACG-CGCG--CTCGCGCGC--TCGTCCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGTGCCCGCGGCCGGCCCAAATGCGAGCCGACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TA-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT------AAAGTAATC----CTTTATCTAAAGTAATCTAAAGTAAAAGTAATCTAAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_ptychanthum GATGCTTGGGATACTAGCGTGGCGGTTGAGGTA-TGCTATCATATCTTAACTGC-ATA-------------------TCT-CTTCCATTCCCTCATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACACCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTCGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGA------------TACTACTATG---CT--------------CATTAATTGAA-TTTCTTTTT---GACTCTACGGGTGCTTTT-ACCCTTTCAAGGTTTGGGGAAAAACTCGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-GGTT-GTCTCGACTTTATGTGGCATTTTACTTTT-GGCTTTAATCGTTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCTTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCACATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-ACTCCTTAGCAATCATA--GCATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCTATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGACGGGTATGAATTTTTAATGCTTGAAATCAGATCACCAACTGT-----GGAAGCTCTTTTGATGCTCGTAAA--TTGAGTTTTTAAAAATTTTGCAGATATGAAAAGCCTGTTAAGGGGAGGAAAATCAACTGGATGAAGGCTGGGATATTGGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCCGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATACGATATAACCACAGTAAGATAAGATTTTT--CTGACTTCAGTATATACTGAAATATT--------TTATAAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTTATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGGTATCTTTCTTCTTGTGTT-----GTGCTAAAATAGAAATTGAACTGCTACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGGAGTTTGAGGAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGTGCGGCG---CGGGTGC--TTCGG-CGC---CCATC--CGCGCGTGTTCCC------TCT---CGTCCCC-GGCT-CGTT--CC------------------GGGCGA----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTTAAATTGAGAG--CCCTCCCC-TCGCG--CCCCGTCCGCGGAG-TGTGCGTG-GGGATGCG--CGCTTCTTTTG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AAGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-TGTGTCGCGGCTACAGCCCGTCGCGCGTCCGGACTCC-AAA-CCCT---CTAAGCGCTT--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGACCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGATCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTAGTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAA------AACCAAAA-----TGTCTGTTTATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------AGAAAGGTAAAA------------------TATATGAAATAGAAAATTCGATCATAAAGAAAAGTATCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----CCCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTATACTTATCCTATTTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_pugiunculiferum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TTTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------CATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACTCAATGTTCTTGGAGAAAGTAAGCATATTCTGAATCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGTTCATGCTTTT-TTCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCGAGTAAGTTAACTGCTGTGT-GGTT-GCCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAGTACTTCTCTGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTAT--------------------------------T--CAACAAGGTTGTACTAATATATGATAAATTTCTCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGTCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACGGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATG------AAATTAAAGAGTTCTTCCTAA-TTAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCCAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGCTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCCG--------GAACGACCAGCGAACACGTT-CG--GACG-CCGAG--GG{AT}G-TCGCGCG-CG-------CGT--TCC------------TC----C-CGCCCCCC-------TCCC----TCCCC--GCG--G-G--TTCGGGGGG-----------GGGGGG----C-AAA--CGAACCCCGGCGCGGGAAGCGCCAAGGAACACTCACA-CGAGAG--CCCCCCGC-CCGCG--CCCCG----------CGGGCGGG-----CGCG--CGCTCCTTTCG----AAACCAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC-----------------------------GGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCTAAACGCGAGCCCACGTCGACGGACGTCGCGGCGAGTGGTGGTTGCAT-CTCAAC----TCTC-TC-GGCGCCGCGGCTACGGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCGC------GCGCCGTCCGACCGAGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGGTAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCTTTTC---------TTT-TTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------CTAAAAGT-AAATAAAA-GTAAAATAAAA-TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTTGAGTATTC---C-ACAATGCATTTTTATGTTCTGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_pyracanthos GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGATAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGATGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTT----GCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTGCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTCCTCAATCTTCCTGATGAGTTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAAACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGATTTTTTTAATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGCATGTATATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTACCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATGTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAACTCGAGGTGTTGTACCCCAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG----------------------------------CCGCCCC-CGCGCGCCTCCCCC-----T-----CGCCCCC----T---CT--CC------------------GGGGG-----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAT-CGCGCGGGGCGGATGCG--TGCTCCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCCCGCGCCCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCCA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAA------------------TATATGAAATAGAAAATTCGAT---AAAAAAAA-TCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_quitoense GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCGTTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAACGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG-GGGGG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCTC--CGCGCGTCTCCCCCC----TCCCTCCGCCCCCCGACG-CGCG--CTCGCGCGCG--CGTCCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---ACCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_refractum GATGCTTGGGATACTAGTGTTGCCGTCGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCCTGGAGAAAGTAAGCGTATTCTGAACTCTTA-GAGAGGT-CCTGA-GGGGTACTACAATGTGAAT---------ACGC-CATTTTT-TAA-TTTCATTC----GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGACTATTTGGACAATGAACTTAGGTTCAGCTTGTTCTGTCAAGTAAGTTACTTG-TG--C-TGTT-GTCTTGACTTTATGTGGCATTTTACCGTT-GTCTTTAATCCTTTTTTTTAAACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCAAGAGTTCTGAATTTGAACAGCAGCAAATTCTTCTCAGGACCATATGGTAACACATCCCAGTTTCGGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCAATCATCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCTAATTACAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTTTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCA---ACTTT-----ATAAGCTCTTTTGATGCAAGTAAA--TTGAGTTTTT-AATATTTTACAGACATGAAACGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCATCAT-TACTAAAATATTTTGTATGTTAATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGAAGTTGGCTTGCCTGTTGACAGGATGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGATATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTGACCTTCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGAAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCCGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GG-C-ACGCGCGGCG---GGGGTGC--TTCGG-CGC---CCCTC--CGCGAGT--CCCCC-----TCC---CGTCCGC-GACG-CGCG--CTCGCGCGC--TCGTCTTC-GGTCGG----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-CGGCAG--CCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGGG-GGGACGTG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AGGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGCGCGTCCGGACTCCCGGA-CCCT---CCCAGCGCTC--------ACGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAAATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTATTCGAAAGGGACCCTCTTAGTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAAACAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTATA---------------------------------C--AAAGTAAAA------------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTGTCATTTCTCTTTCTGCTTTTTAATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCAAGTATTC---C-ACAATGC----TTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CAAAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_repandum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTATTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACATTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTG-CT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCT---AATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAACGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATATCAAATATGATATAACCACTGTAAGATGAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTAGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG--GGGG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCTC--CGCGCGTCTCCCCCCC---TC----CGCCCCCCGACG-CGCG--CTCGCGCGC--TCGTCCT--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTCTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_reptans ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGGACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCC---GGGGTGC--TTCGG-CGC---CCCTC--CTCGCGTCTCCC-------TCC---CGTCCCC-GACG--GCG--CGCCCGCGCGCTCGTTTTC-GGGCGA----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACCTAAC-TGAGAG--CCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGTGCGGG-GGGATGCG--TGCTTCTTCTG----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------GCGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCTCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-TC-GGTGCCGTGGCTACAGCCCGTCGCGCGTCCGGACTCCCCGA-CCCT---CCTCGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACCTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_richardii GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTG-----TATTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTA-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTCTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GT-TTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCTGTTTCAGAAA-TCTCCGTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TGTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGAATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTGCC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACATAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TACGG-CGC---CTCCC--AGAGCGTCTCTCCCC----T-----CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTAGTGGGGG--CGGATAATGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCACGA-CCCT---TCCGGCGCCA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAATTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTAGTATTTTTTATATTTTATATTT--------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_robustum GATGCTTGGGATACCAGTG????????????TACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACGC-CATTTTT-GAA-TTTCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTG-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACCTGTTGTAC-TGTT-GTCTTGACTTAGGGTGGCATTTTACCTTT-GTCTTTAATCCTTTTCTTT-AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCTCTAGAGGCACCTAGAGTTCTGAATTTGCACTGCAGCAAGTACTTCTCAGGACCATATGGTAACACATCTCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTTTAGGTAATCA----TCTTTA----TTTTGCCCATCT-CTTCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTAAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCATCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTA------AAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAACGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGGATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCTGCATATACTAAAACATTTTATATGTTTATGAAATTAAAGAGTTCTTGCCAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTCCAATTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCCAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCCC-------CC---CGCCCCC-GGCGACGCG--CGCCCGCGCGCTCGTTCCC-GGGGG-----CAAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAC-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCGCACGCCGC----------------GCGGC---GTCGTGGGGG--CGGAGACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCACTCCCCGA-CCCT---ACCGGCGCTC--------CTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTTATAAAT---------------------ATAAAAGTAAAATAAAA-------------TATATGAAATCGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_rostratum ???GCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTGCAATGTGAATACGCAAAACACGC-CA{GT}TTTT-GAA-TTCCTT-CTTT-GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCTTATTGTGTCAAGTAAGTTACTTGCTGTAC-TATT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTTACTCCCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACAACCCAGTTTCAGAAA-CCTCCTTAACAATCATA--GTATATCCTTGTAGGTAATTA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCT{CG}ATTCCATGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCGTTGCAATCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGAGAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTAT-AAA-TTTAATGCTTGAAATCAGAGTACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTGT-AATATTTTGTAGACATGAAAAGCCTGTGAAGGGTAGGAAACTCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGTCCATACTATGCCCAAGAACTTGTTTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATAC{AG}CAAGAGTGGAACCCAGCAACTGACAAATACACTGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTTATATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGAAT{AG}TTCAAATAGTAGTCCTTGTAAGTTCC-AAGTGGACTCATGGTATCTTTCTTGTTATATTCACTCGTGCAAAAATTGAAATTGACCTGGAACTCATCT--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAACTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTAGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACCCGTT-CAA-AACA-CCGGG--GGAG----------------------------------GCGCCC--CGCGCGCGTCCC-------TCA---CGCCCTC--------------------------TCCTC-GGGGG-----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-TGAGAG--CCCCCCGC-CCGCG--CCCCGTTCGCGGAG-CGTGCGGG-TGGGTGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCCCCCGCGCGCGGCCGGCCTAAATGCGAGCCCGCGTCGACGGACGTCGCGGCGATTGGTGGTTGTAA-CCCAAC----TCTC-TT-CGCGCCGCGGCTACAGCCCGTCGTTCGTGCGTGCTCCCCGA-CCCT---CGCAGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATTTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATCGAAAATTCGAT--AAAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGTTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_sandwicense GATGCTTGGGATACTAGTGTTGCCATTGAGGTAGTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-TAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTGTATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTAGTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTTTAATATTTTGCAGACTTGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCATTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCGCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATTTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTATACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGGG-CCG-------------------------CGC---CCCG---CGCGCGTCCCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG-CCCCCCCGC-CCGCG-CCCCCGTCCGCGGGG-CGTGCGGG-CGGGCGCG--TGCTCCTTCAC----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCT--TTTATCT-CTTTATCT-TTTATCTCTTTATCT-------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTTATATTTT--------------------CTAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGTTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTTTATGTTATGATTTTTGTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_schimperianum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACCGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAGGTAAGTTACTTGCTGTAT-GGTT-GT-TTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTTCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGGATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTCTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTAGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCGTCTTTCTTGTTATGTTGACTTGTGCAAAAATTGAAATTGGCCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATTACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGAGAACACGTT-CA--AACA-CCGAG--GGAG-CCGCGCGGCG---GGGGCGT--TCCGG-CGC---CGCCC--CGCGCGTGTCCC-------TCT---CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TAGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCTCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTTGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGACTATAGCCCGTCGCTCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCTT--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACGTGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCTTCTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAAAAGAGCCAAGAATATCAATAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGAATAA---------------------------ATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCACATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_sessiliflorum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TAT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACA---ATTTTT-GAA-TTCCTTTTTT--GACTCCGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGATTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATTATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCATTGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTGCATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTT-GCAGACATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGACATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGAGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG-GGGGG------------------CGC--TTCGG-CGT---CGCTCC-?GCGCGTCTCCCCCCC---TC----CGCCCCCCGACG-CGCG--CTCGCGCGC--TCGTTCT--GGGGGG----CGAAA--TGAACCCCGGCGCAGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACG-CG-CGT-GCTGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAAGAGATAAAGGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAA------------------TATATGAAATAGAAAATTCGAT-AAAAATCAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_sessilistellatum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTATGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAG-TTCCTATTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGGTAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTACCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTTGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCG?C?GGC--GTGGGGC--G??????CT------??--C???CG-GCGC--------------CGCCCCGCG-CGT?CTG--C?CCCTCGCCCCCTC?TTC-GGGGGGGG--CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-TGAGAG-CCC?TCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATATTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------TTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACCCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_sisymbriifolium GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ACA---TCT-CTT---------GATTCAAGCACGT---GATCCCTACTTTATCTGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGAT-CCTGA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACAACCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTTTGTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTAATCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAA-TCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACGGTAAGATAAGATATTT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTGTACAGGTCATGGATGCAAAGCCTTTATTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATTCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATATTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAG-CCTGCACA-GCAGAACGACCCGCGAACGCGTT-CA--GACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-TGC---CGCCC--CGCGCGTGTCCCC-------CC---CGCCCCC------------CTC-----------------GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-CGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCGCCC-GTGCGCCCCGGGCGCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCTGCTGCCCGTCGCGCGTGCTGACTCCCCGA-CCCT---CCCAGCGCCA--------GCGCGCTCCGTCCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTTCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTCTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTGGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTTATAAAT---------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTTGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_sp._nov. GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACGAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGAGAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CC{GT}AA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCT{AG}TTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTCTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTAAATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCTTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGAC-ATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATGACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATAATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-TCGGG--GGAG-CCGCGCGTAGC--GGGGCGC--TCCGT-CGC---CGCGC--CGCGCGTATCCC-------TCT---CGCCCCC--------------------------TTTTC-GGGGGGG---CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-CGGATGCG--TGCTCCTTTCG----AAAACAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATAATGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGCGCCGCGGCCGTAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCAGCGCTC--------CTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCCCCT----------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_stagnale GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACGC-CACTTTT-AAA-TTTCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTG-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTAAGGTGGCATTTTACCTTT-GTCTTTAATCCTTTTCTTT-AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCTCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCTCAGTTTCAGAAA-TCTCCTTAGCAATCATT--GTATATCCTTTTAGGTAATCA----TTTTTA----TTTTGCCCATCT-CTTCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGAAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCATCTTCTTAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTA------AAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAACGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGGATGGATACACAAGAGTGGAACCCCGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAACATTTTATATGTTTATGAAATTAAAGAGTTCTTGCCAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACGTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCCAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGTGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---TGCCC--CGCGCGTCTCCC-------TCC---CGTCCCC-GACGACGCG--CGCTCGCGCGCTCGTTCCT-GGGGG-----CAAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------GCGGC---GTCGTGGGGG--CGGAGACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGTGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT------------------------------------AAAGTAAAGG----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTTATAAAT---------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_stelligerum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---{AG}CAAT-ATG---TCT-CTT---------GATTCAAGCA{CT}GT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACAC-CATTTTT-GAA-TTACTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTGGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GCCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGCCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATT{CG}ACTAG{AT}-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTG{CT}ATCCATAA{CT}ATTGCCTACCAAGGCCGATTT{AG}CTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCAT{CT}GATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCT{AG}CTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTT{AG}TTTTCACTCGTGCAAAAATTGAA-TTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAC{AG}-GCAGAACGACCCGCGAACACGTT-C{AC}--AACA-CCGAG--GGGG-CCGCGCCCCGC--G---CGC-----G?---C---C-CCC----------TC---------TCG---CCCCCTC--------------------------TTC---GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCG{AC}G-CCCCCGTCCGCGGGG-CGTGCGGG-CGGATGCG--CGCTTCTTTAC----GAACCTAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC-----------------------------GGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCGCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GG{CT}GCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTCC-------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT----AAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_stenandrum ?????????????CTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCA{GT}GTCATAGTTGGAGACAGCATTGAAGTTGTTCGTTTCTTTCACTCCTATAAACGTGGGGTTGATCGTGTTTTTGTCGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTCAATGCGCAGAACACGC-CATTTTT-GAA-TTTCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTG-AAGGTTTGGGGCAAAACTGGTTCAAAAATTTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTTGACTTAAGGTGGCATTTTACCTGT-GTCTTT--------------AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCTCTAGAGGCACCTAGAGTTCTGAACTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCTCTGTTTCAGAAAATCCCCTTAGCAATCATA--GTATATCCTTGTAGGTCATCA----TCTTTA----TTTTGCCTATCT-CTTCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TGTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGAAAAT--CAACAAGATTGTACTAATATATTATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATTCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTTCATCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAC--TTGAGTTTTT-AATATTT-GCAGACATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCA{AT}CTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGAATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATACTAAAACATTTTATATGTTTA---AATTAGAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTAACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCCAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACCCGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--CTCGG-CGC---CGCCC--CGCGCGTCTCCC-------TCC---CGCCCCC-GGGGGG-----CGCCCG-----TCGCTCCC-CGGGGG----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAT-CGCGCGGG-AGGATGCG--AGCTTCTTTCG----AAAACAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AAGGC---GTCGTGGGGG--CGGAGACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCAAGCGCTC--------GTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTATTCTATATTATATATTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATCTCAAGAAAAATAACG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTATT----------CCAACAAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTCTATTTTTT---------------------------ATAAAAGTAAAATAAAA--TAAAA------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGAGTTTA---------------GTAGTTTTGACAACCCTAT-CTTATCCTATCTTAATTACTACAACTCCACCACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_stramonifolium GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AGGTTTT-GAA-TTCCTTTATT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACC-------------CCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATATGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAGCACCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTATATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCGTTCTTTTTATGTTCATTCGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--GACAACCGGG--GGGG-CCGCGCGGCG---GGGGCGC--TCCGG-CGC---CGCTC--CGCGCGTCTCCCCCCC---TC----CGCCCCCCGACG-CGCG--CTCGCGCGC--TCGTTCTG-GAGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTGCCGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATCAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_tenuispinum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-ATATGTT---ACAAT-ATA---TCT-TTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTGCAATGTGAATGAGCAGAACACAC-CATTTTT-TAA-TTCTTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGATAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAAAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCGTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTA-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTCT--CTGACCTCAGCATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAGGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTAGCTGCAATTCACCAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGGGGGGATGCCGTGCGGCG---GGGGCGC--TTCGG-CGC---CGCCC--CGCGCGTCTCCCC------TC----CGCCCCC-GATG-CGTG----CCTCTGTGCTCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCGCGCCGC----------------ACGGT---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGTGCCTTGAGCCCGCGGCCGGCCTAAATGTGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCT{CG}-TT-GGTGCCGCGGCCAAAGCCCGTCGCGCGTTCGGACTCCCCGA-CCCT---CCCAGCGCTC--------CGGCGCTCCGACAGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATATAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATAGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCACC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_thelopodium GATGCTTGGGATACTAGCGTTGTGGTTGAGGTAC-CCTA----ATCTTAACTGC-ATATGAT---ACAAT-GTA---TCT-CTTCCATTCCCTGGTTCAAGCATGT---GATCCCTACTTCATCTGCAGGTCAAAGTTGGAGACCGCATTGAAAGTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-TAGAGGT-CCTGA-----TACTAGAATCTGAATACACAGAACACAT-CATTTT--GAA-TTTCGTTT----GACTCTACTGGTGTTTTT-ACGCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAACTGGACAAGATTATTTGGACAATGAAATTAGGTTCAGCTTGTTGTGTCAAGTAAGCTGCTACTTGTAC-TGTT-GTCTTGACTTTATGTAACATTTTACTTTT-GTCTTTAATCGTTTTT----AATCTTGTTT-----------------------------------------------------------------------------------------TCTT-GTCACTCTCAGGCGGCCCTGAAGGCACCTAGAGTTCTGAATTTGAAATGCAGCAAATACTTTTCAGGACCATATGGTAACACCTCCCAGTTTCAGAAA-ACTCCTTGGCAGTCATATTGTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTTCAGGAGACGATGTTCTCTTCATTATCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAATCAATGTACCAGTCGAGAGGAATCTATGTTAATGCCAAGGTAAAA-TCTCTTCGTATTCACTTGA-TTGCAT----TTTACACTGCAAAT--AAACAAGGTTGTATTA-TATATGATAAATTTCACATTGCCTACAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTGCCTGATGAATACAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGAC-ACT--CTTT----------------TGAAGCTAGTAAA--TTGAGCTTTT-AAAATTTTGCAGATATGAAAAGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCGCAAGAACTTGTCTCCGCTGCTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTTAAATATGATATAACCACTGTAAGATAA-ATCTTT----------------------------TTGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAA-TATATATACAGGTCATGGACGCAAAGCCTTTACTAAAAGAGGCCCTTCAAGCAGCAGCTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACCCATGATATCTTTCTTGTTGTGTTTACTTGTGCCAAAATTGAAATTGAACTGTAACTCGTCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTAGAAGTATTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGCCCCTTTGGCTCACATGATCATTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCGAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGAG--GGAG-GCGCGCGGTC---GGGGCGC--CTCGG-CCC--TCG-TC--CGTGCGTCTCCC-------TCC---CGTCCCC-GGCG-CGTG--CTCGCGCGC-----ACGTC-GGGCGA----CCAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAAGGTCCGCTGCCCCCCGCG--GCCCGTCCGCGGAG-CGCGTGGG-GGGACGCGCGTGCCTCTTTCG----AAACTGAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGCGCCCGAGCGTCGGGCTGCGGCGGTGTCGCGGGG---CGGATACTGGCCTCCCCGTGCGCCTAGAGCTCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGAAA-CTCAAC----TCTC-GT-GGTGCCGTGGCTACAGCCCGTCGCGCGTCCGGCCTCCAAGA-CCCT---CACCGCGCCG--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCTAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGATCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-CCCCTCTTATTCTCATGGCCTGGTATGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACAAATTTGAATTTTAAAACCAAAA-----TGCCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGTAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATCAAA-------------TATATGAAATAGAAAATTCGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTAAAAAAAA----AAGAAGCTTTCGAGTATTC---C-ACAATGCATTTTGATGTTATGATTTTA---------------GTGGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CAAAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_thruppii GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TTTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCT{CT}T-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTTTGTCAGGTAAGTTACTTGCTGTAT-GGTT-GT-TTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAAGACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGG{CT}AATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTGTACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAG{AG}AAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGATTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CT--AACA-CCGAG--GGAG-CCGC---------CGGGCTC--TCCGG-CGC--CCGCAC--CGCGCGTCTCCC-------TCT---CGCCCCC------------------------C-TCCTT-GGGGGG----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTTCGCGGAT-CGCGCGGG-TGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGTGCCGCGGCTACAGCCCGTCGCTCGTGCGTGCTCCCCGA-CCCT---TCAGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCTTCTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCATAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATAAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_toliaraea GATGCTTGGGATACTAGTGTGGC{AC}ATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTAGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCATTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCT{CT}GACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTTGTTGTGTCAAGTAAGTTACTTGCTGTATGGTTGTCTTGACTTAATGTGGCATTTTACTTTTGTCTTTAATCCTTTTTTTAACCTTGTTTTCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTGCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGCGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATC{CT}CTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGG{CT}TCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAG{AG}AAGATCCCTTTGATTGGCTTCATCGGCAGGCTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGT--CAA-AACA-TCGGG--GGAC-TCGCGCGGCGC--GGGGCGC--TCCGG-CGC-CCCCCCC--TGTGCGCGTCCC-------TCT---CGCCCCC--------------------------TCTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAGA-CGAGAG--CCCTCCGC-TCGCG--CCCCGTCCGCGGGG-CGCGCGGG-TGGATGCG--CGCTCCTTTCG----AAACCAGAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GCCGCGGGGGG-CGGATCCTGGCCTCCC-GTGCGCCCCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGCGCCGCGGCTACGGCCCGTCGCGCGTGCGTGCTCCCCGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTTCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGCAGCGGGTATAGTTTAGTGGTAAA Solanum_tomentosum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCGA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCGAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCGAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGAATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAACTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGAAAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATTGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGTGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCCCC-----T-----CGCCCCC--------------------------TCTTC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAACCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-TGGATGCG--TGCTTCTTTCT----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTCTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCACGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCGCTTTTCTTCTTTCTATATTAT----CTTTTCTTCTTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTTCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-TTAAAA------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTACTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_torvum ?ATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACCT---GATCCCTACTTTATCTGCAGGTCAGAGTTGGAGACAACATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA------------------------CAATATGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GCTGTAC-TGTT-GTCTTGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTTTTA--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTTAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTACTAATATATGATAAATTTCTCATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCGGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGTGTTTTT-AATATTTTGCAGATATGAAAAGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATATACTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGACATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCCCTCGTGCAAAAATTGAAATTGACCTGCAAATCATCC--TATGCATCAGGGAACTGGGAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCTGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCG-CTCCC-------TCC---CGCCCCCTT------------------------TCC---GGGGGG----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCGAA-CGAGAG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTAG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGCCGACGGACGTCGCGGCAATTGGTGGTTGTGA-GTCAAC----TCTC-TT-GGTGCCGCGGCTACGGCCCGTCGTGCGTGCGTGCTACCCGA-CCCT---TCAGGCGCCA--------TTGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CTAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTCGATTGTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGCAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATG------TTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_tridynamum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTT-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTATTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACCATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCTTTTTTT--AACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCTTGTTCTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGGCTTAATGTGGCATTTTACTT---GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCTTTGTAGGTTATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAATTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTACAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGATATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGCTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATTCATCAGGGAACTGGAAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACGTGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAATACCTGCACA-GCAGAACGACCCGCGAACACGTT-CAC-AACA-CCGGG--GGAG-CCGCGCGGCG---GGGGCGC--TTCGG-CGT---CGCCC--CGCGCGT-TCCC-------TCC---CGCCCCC-------------------------GATTTT-GGGTGG----CAAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGGG--CCCTCCGC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGAGATTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TC-GGTGCCGCGGCTACAGACCGTCGTGCGTGCGCGCTCCCCGA-CCCT---TCCGGCGCTC--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTCCTACATGAGATAACACA-----GAAAATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTG----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTTAGATTTTTT---------------------------ATAAAAGGAAAATCAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTTATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CAAAACTCCCC-TGTTCGACAAAAATTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_trisectum GATGCTTGGGATACTAGCTTGGC{GT}GTGGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTTCCATTCCCTGATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATAGTCTGAACCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAAT{AG}CG{CT}AGAACACGT-CATTTT--GAA-TTTCTTTT----GACTCTACTGGTGCTTTT-ACCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTT----GTTGTAC-TGTT-GTCTTGACTTTATGTGGCATTTTACTTTT-GTCTTTAATCGTTTATT----ACCTTGTTT-----------------------------------------------------------------------------------------TCTT-GTCACTCTCAGGCAGCCCTAGAGGCACCTAGAGTTCTGAATTTGAACTGCAACAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAGA-ACTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-{CT}CTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCAAAT--CAACAAGGTTGTATTAATA{GT}ATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCACAACATTGCCTACCAAGGTCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAAT????????????????????????????????????-??????????????????????????????-----????????????????????????--??????????-?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????ATGTCAAATACGATATAACCACTGTAATATAAGATTTTT--CTGACTTCAGTATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACA{AG}GTCATGGA{CT}GCAAAGCCTTTACTAAAGGAGGCTCTTCAAGC{AT}GCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGA{CT}GTTCAAATAGT{AT}GTCCTTGTAAGTACC-AAATGGACTCATGGT{AG}TCTTTCTTGTTGTGTTTACT{AT}GTG{AC}CAAAA{AC}TGAAATTGACTTGCTA{AC}TCG{AT}CC--TATGCATCAGGGAACTGGCAAAAAGAAGTTTGAGCAGGAGATTGAACAGCTCGAAGTGTTGTACCCTAACAAAGCTAAAGG{AT}GTGGCAAAA{CT}TCAATGTCCCTTTGGCTCA{CT}ATGATCACTGCTGGTGCTGATTTTAT{CG}TTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGGACTCGTT-TA--AACA-CAAGG--GGGG-CCGCACGGCG---GGGGTGC--TTCGG-CGC--CCGCC---CGTGCGTCTCCCC------TCC---CGCCCCT-GACG---TT--CGCTCGCGCGCTCGTTC---GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACGAAAT-AGACGG--CCCTCCCC-CT-CG--CCCCGTCCGCGGAG-TGCGTGGG-GGGATGCG--TGCTTCTTTTT----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------AAGGC---GTCGTGGGG---CGGATACTGGCCTCCC-GTGCGCCTCGAGCGCGCGGCTGGCCTAAATGTGAGCCCGCGTCGACGGACGTCACGGCATGTGGTGGTTGAAA-CTCAAC----TCTC-GT-GGTGTCGTGGCTACAGCCCGTCGCGCGCGCGGCCTCTTTGA-CCCT---CACAGCGCCG----GCTAAGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAGCACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTTTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGCATTTGAAAACAAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAA------------------TATATGAAATAGAAAATTCGATC-AAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTTCTTTCCCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACGACCCTAT-CTTATCCTATCTTAATTAC-----------CACAATTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_vespertilio ???GCTTGGGATACTAGTGTTGCCATTGAGGTACTCCGA-----TCTTAACTGC-AGATGAT---ACAAT-ATC---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCGAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTT--AACTTTGCTGGTGCTTTC-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTGAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTTTGTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCCTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTTACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTGAATGCTTCAAATCAGACCATCAACTTT-----AATAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAAGTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AACTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGAC{CG}CGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGTGCGGCGC--GGGGCGC--TACGG-CGC---CGCCC--CGCGCGTCTCACCC-----T-----CGCCCCC--------------------------TCTTC-GGGGGG----CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCGC-CCGTG--CCCCGTCCGCGGGG-CGTGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGCCGCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGCAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGTGCTCCACGA-CCCT---TCCGGCGCTA--------GCGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCT-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTC---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_vestissimum GATGCTTGGGATACCAGTGTTGCCATTGAGGTACTCCTA-----TCTTAATTGC-CTATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCCAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGCGGGGTTGATCGTGTTTTTGTTGACCACCCTATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGTGGT-CCTGA-GGGATACTACAATGTGAATGCGCAGAACACAC-AATTTTT-GAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTGT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTACTTGCTGTAA-TGTT-GTCTTGATTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTGTTTTT--AAGCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATTTTTCTCAGGACCCTATGGTAACACATCCCAGTTTCAGAAA-TATCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTGTTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGAAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTCTATTCACTTGA-TTGCA--A--TTTACCCTGCAAAT--CAACAGGGTTGTACTAATATAAGATAAATTTTACATTGCCTCCAGGTTGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCT-GAAATCAGACCACCAACTTT------AAAGCTCTTTTGATGCTAGTAAA--TATAGTTTTT-AATATTT-GCAGACATGAAGCGCCTGTGAAGGGTAGGAAAATCAACTGGATGAAGGCCGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACATCAGCATATACTAAAATATTGTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATGCAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATTGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCATGGTATCTTTCTTGTTATGTTCACTCGTGC-AAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTTGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAGTTCAATGTCCCTTTGGCTCACATGATCACTGCCGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAGA-GCAGCACGACCCGCGAACACGTT-CG--AACA-CCGGG--GGGG-{CG}C{CG}CGCCGCG---GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTCTCCCCC-TCCCTCCCTCCGCCCCCCGACG-CGCGCGCGCTCGCGCGCTCGTCCC--GGGGGG----CGAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAC-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGCGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC--GCACGCCGC----------------ACGGC---GTGGCGGGG---CGGATACTGGCCTCCC-GTGCGCCCCGAGCCCGCGGCCGGCCCAAATGCGAGCCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGGAA-CTCGACCGACTCTC-TC-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCCCGA-CCCT---CCCAGCGCCT--------CGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTTTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCCTTATCTCC--TTTATCT-CTTTATCT---------------------------AAAGTAATCT----------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTTAGATTTTTT---------------------------AGAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGGTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_viarum GATGCTTGGGATACCAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAATTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCACAT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTATTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGATCCCTTA-GAGAGGT-CCTGA-GGGATACTACAATGTGAATGTGCAGAACACAC-CATTTTT-TAA-TTCCTTTTTT--GACTCTGCTGGTGCTTTT-ATCCTTT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGTAAGTTAGTTGTTGTAC-TGTT-GTCTCGACTTAATGTGGCATTTTACCTTT-GTCTTTAATCCTTTGTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAGCACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TATCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGTAAAT--CAACAAGGTTGTACTAATGTATGATAAATTTAACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----AAAAGCTCTTTTGATGCTAGTAAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACGGTGAGCCCATACTATGCCCAAGAACTTGTATCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACCGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGAAAAGATTTTT--CTGACCTCGACATATACTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGATAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAATTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGATTCATGGTATCTTTCTTGTTATGTTCACTCGAGCAAAAATTGAAATTGACCTACAACTCATCC--CATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTAGCAAAATTCAATGTCCCTTTGGCTCACATGATCACAGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CTGGG--GGGG-CCGCGCGGCG---GGGGTGC--TTCGG-CGC---TGCCC--CGCGCGTCTCCCC------TC----CGCCCCC-GATG-CGT----GCCTCTGTGCTCGTTCTT-GGGGG-----CCAAAA-CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAAT-TGAGAG--CCCTCCCC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGGGTGGATGTG--TGCTTCTTTCT----GAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCT-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGTCTCCC-GTGCGCCTCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAA-CTCAAC----TCTC-TT-GGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGA-CCCT---CCCAGCGCTC--------AGGCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT----CTTTTCTTCTTTCTATATTATATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AACGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCC-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCAGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCTATTTTTTAGATTTTTT---------------------------ATAAAAGTAAAATAACA-------------TATATGAAATTGAAAATTCGAG-AAAAATAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCATCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_violaceum GATGCTTGGGATACTAGTGTTGCCATTGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTT--AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCAAGTAAGTTACTTGCTGTAT-GGTT-GT-TCGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACCATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCGTTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGCATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTACTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCTCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAGCTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTT---CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAACAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCAAG-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG----------------------------------CCGCCC--CGCGCGTCTCCCCC-----T-----CGCCCC---------------------------TCTTC-GGGGGGG---CCAAA--CGAACCCCGGCGCGAAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCGTCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGGG--GGACGCG--TGCTCCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GCCGCGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGCCCACGTCGACGGACGT{AC}ACGGCAAGTGGTGGTTGTAA-CCCAAC----TCTC-TT-GGCGCCGCGGCCACAGCCCGTCGCGCGTGCGCGCTCCACGA-CCCT---GCCGGCGCTG--------CCG{CT}GCTCCGACC{GT}CGACCCCAGGTCATCAGCCATCTCTCCTAATTTAATTGAAAAAG-ATAATTACTACATGAGATAACACA-----GAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCTCCTTTATCTCTTTATCT---------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTAATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGATATTTTTTATATTTT--------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTATGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_virginianum GATGCTTGGGATACTAGTGTTGCCATCGAGGTACTCCTA-----TCTTAACTGC-AGATGAT---ACAAT-ATG---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATTGGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTAAGCATATTCTGAACCCTTA-GAGAGGT-CCTAA-GGGATACTACAATGTGAATGCACAGAACACGC-CATTTTT-GAA-TTCCTTTTTTT-AACTTTGCTGGTGCTTTT-ATCCTCT-AAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGATTATTTGGACAATGAACTTAGATTCAGCCTGTTGTGTCGAGTAAGTTACTTGCTGTAT-GGTT-GTCTTGACTTAATGTGGCATTTTACTTTT-GTCTTTAATCCTTTTTTT--AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACTCTCAGGCAGCCCTAGAGGCACCCAGAGTTCTGAATTTGAACTGCAGCAAATACTTCTCAGGACTATATGGTAACACATCCCAGTTTCAGAAA-TCTCCTTAGCGATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCTTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTAGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTACTAATATATGATAAATTTCATATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAAA-TTTAATGCTTCAAATCAGACCATCAACTTT-----AAAAGCTCTTTTGATGCTAGTGAA--TTGAGTTTTT-AATATTTTGCAGACATGAAAAGCCTGTGAAAGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGTATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAGGATAAGATTTTT--CTGACCTCAGCATCTGCTAAAATATTATGTATGTTTATGAAATTAAAGAGTTCTTCCTAA-TCAAAATCTCTATACAGGTCATGGATGCAAAGCCTTTACTAAAGGAGGCTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTATC-AAGTGGACTCGTGGCATCTTTCTTGTTATGTTCACTCGTGCAAAAAATGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGAAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAATAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCAGAGGATCATTGTCGAAA-CCTGCACA-GCAGAACGACCCGCGAACACGTT-CA--AACA-CCGGG--GGAG-CCGCGCGGCGC--GGGGCGC--TCCGG-CGC---CGCCC--CGCGCGTATCCC-------TCT---CCCCCCC--------------------------TTTTC-GGGGG-----CCAAA--CGAACCCCGGCGCGGAAAGCGCCAAGGAATACTCAAA-CGAGAG--CCCTCCAC-CCGCG--CCCCGTCCGCGGAG-CGTGCGGG-TGGATGCG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------TCGGC---GTCGTGGGGG--CGGATACTGGCCTCCC-GTGCGCCTCGCGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCG?CAAGTGGTGGTTGTAA-CTCAAC----TCT?-TT-GGTGC?GCGGCTACAGGCCGTCGCGCGTGCGTGCTCCCCCA-CCCT---TCCGGCGCTC--------GCGCGCTC?GACA?CGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAGATAACACA-----TAAGATAAA--------GGAAAGAA----TCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTCC--TTTATCT-CTTTATCT-----------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCCCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGG-ACCCTCTTATTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT----------------CATTTTAATTGA---------------------TTTTAATTGAATAGTTAATATTC---------AAGCAACAAGAAAAA-TTCCCATTTTTGAGATTGTTT---------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT---AAAAAAAAGTCTCATTTCTCTTTCTGCTTTTTGATTTTATGTTT----ACCACCTTGCTGGACTACAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGCATTTTTATGTTCTGATTTTA---------------GTCGTTTTGACAACCCTAG-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA Solanum_wendlandii GATGCTTGGGATACTAGTGTTGCCGTTGAGGTACTCCTA-----TCTTAACTGC-ATATGAT---ACAAT-ATA---TCT-CTT---------GATTCAAGCATGT---GATCCCTACTTTATCTGCAGGTCAAAGTTGGAGACAGCATTGAAATTGTTCGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCCTGGAGAAAGTAAGCGTATTCTGAACTCTTA-GAGAGGT-CCTGA-GGGGTACTATAATGTGAAT---------ACGC-CATTTTT-TAA-TTTCATTC----GACTCTGCTGGTGCTTTT-ATCCTTTTAAGGTTTGGGGCAAAACTGGTTCAAAAATCTATGGCCCCAAAGCTGGACAAGACTATTTGGACAATGAACTTAGGTTCAGCTTGTTCTGTCAAGTAAGTTACTTG-TG--C-TGTT-GTCTTGACTTTATGTGGCATTTTACC----G-CTTT-----TTTTTT---AACCTTGTTT-----------------------------------------------------------------------------------------TCTTTGTCACACTCAGGCAGCCCTAGAGGCACCAAGAGTTCTGAATTTGAACTGCTGCAAATTCTTCTCAGGACCATATGGTAACACATCCCAGTTTCGGAAA-TCTCCTTAGCAATCATA--GTATATCCTTGTAGGTAATCA----TCTTTA----TTTTGCCTATTT-CTGCAGGAGAAGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATTCCCTGCTACTTGAAGTCAATGTACCAGTCAAGAGGAATCTATTTGAATGCCAAGGTAAAA-TCTCTTTGTATTCACTTGA-TTGCA--C--TTTACCCTGCTAAT--CAACAAGGTTGTATTAATATATGATAAATTTCACATTGCCTCCAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGCCGATTTGCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGGTATGAA--TTTAATGCTTGAAATCAGACCACCAACTTT-----ATAAGCTCTTTTGATGCAAGTAAA--TTGAGTTTTT-AATATTTTACAGACATGAAACGCCTGTTAAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCAGATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTCTCAGCTGTTGACAAGGGTGTTGAATTGGATAATGTCCTTCGTAAGACTAGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGGAACCCAGCAACTGACAAATACACAGATGTCAAATATGATATAACCACTGTAAGATAAGATTTTT--CTGACTTCAGCATATATTAAAATATTTTGTATGTTTATGAAATTAAAGAGTTCTTGCTAA-TCAAAATCTCTATACAGGTCATGGACGCAAAGCCTTTACTAAAGGAGACTCTTCAAGCAGCAGTTGGCTTGCCTGTTGACAGGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCTGCAATTCACAAGTTCATCGGATTGGATGTTCAAATAGTAGTCCTTGTAAGTACC-AAATGGACTCATGATATCTTTCTTGTTATGTTCACTTGTGCAAAAATTGAAATTGACCTGCAACTCATCC--TATGCATCAGGGAACTGGCAAAAAGAAGTTCGAGCAGGAGATTGAACAGCTCGAGGTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTTCCAAGCCGAGGATCATTGTCGAAA-CCTGCAGA-GCAGAACGACCCGCGAACGCGTT-CA--AACA-CCGGG--GG-C-ACGCGCGGCG---GGGGCGC--TTCGG-CGC---CCCTC--CGCGAGTCCCCC-------TCC---CGCCCGC-GACG-CG----CGCTCGCGCGCTCGTTTTC-GGGCGG----CTAA---CGAACCCCGGCGCGGAAAGCGCCAAGGAATACT{CT}AAATCGGCAG--CCCGCCCC-TCGCG--CCCCGTCCGCGGAG-CGCGCGGG-GGGACGTG--TGCTTCTTTCG----AAACCAAAA-CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCC-GCACGCCGC----------------ACGGC---GTCGCGGGGG--CGGATACTGGCCCCCC-GTGCGCCTCGAGCTCGCGGCCGGCCCAAATGCGAGTCCACGTCGACGGATGTCGCGGCAAGTGGTGGTTGGAA-CTCAAC----TCTC-TT-GGTGCCGCGGCTGCCGCCCGTCGCGCGTCCGGACTCCCGGA-CCCC---CTCAGCGCTC--------AGTCGCTCCGACCGCGACCCCAGGTCATCAGCCATCTCTCCC-----AATTGAAAAAG-ATAATTACTACATGAAATAGCACA-----TAAGATAAA--------GGAAAGAATCTTTCTTTCTCTCTTTTCTTCTTTCTATATTAT-------------------------ATAGATATGTAC--------------------AACTTTTATCATCAATTTCCTTTATCTC---TTTATCT--------------------------------------------------------------AAAGTAAAGGAAGGGCTCAGAAGAGCCAAGAATATCAAGAAAAATAAAG---------------------------------------------AAGACCTCT-------------TTTCTTTGTCTTGATTTTGTTCGAAAGGGACCCTCTTAGTCTCATGGCCTGGTCTGGTCAGTACCCAGCCGGGCCTCTTTTGTT----------CCAACGAATTTGAATTTGAAAACCAAAA-----TGTCTGTT-ATAGTT-------GTAATATTTCATTTTAATT-------------------------------GAATAGTTAATATTC---------AAGCAACAAGAAAAAATTCCCATTTTTT------------------------------------ATAAAAGTAAAATAAAA-------------TATATGAAATAGAAAATTCGAT-AAAAATAAAAGTGTCATTTCTCTTTCTGCTTTTTAATTTTATGTTT----ACCACCTTGCTGGACTAAAAAAAA------GAAGCTTTCGAGTATTC---C-ACAATGC----TTATGTTATGATTGTA---------------GTCGTTTTGACAACCCTAT-CTTATCCTATCTTAATTAC-----------CACAACTCCCC-TGTTCGACAAAAGTTGCATTTGTATAC-AATAATCGGATTGTAGCGGGTATAGTTTAGTGGTAAA ; END; BEGIN SETS; CHARSET ITS (CHARACTERS = 'waxy + ITS + trnS-trnG') = 1948-2684; CHARSET trnSG (CHARACTERS = 'waxy + ITS + trnS-trnG') = 2685-3688; CHARSET waxy (CHARACTERS = 'waxy + ITS + trnS-trnG') = 1-1947; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = 'waxy + ITS + trnS-trnG') = N: 1-3688; CODONPOSSET CodonPositions (CHARACTERS = 'waxy + ITS + trnS-trnG') = N: 1-3688; END; BEGIN TREES; TITLE Tb7393; LINK TAXA = Taxa1; TRANSLATE 1 Solanum_wendlandii, 2 Solanum_virginianum, 3 Solanum_violaceum, 4 Solanum_viarum, 5 Solanum_vestissimum, 6 Solanum_vespertilio, 7 Solanum_trisectum, 8 Solanum_tridynamum, 9 Solanum_torvum, 10 Solanum_tomentosum, 11 Solanum_toliaraea, 12 Solanum_thelopodium, 13 Solanum_tenuispinum, 14 Solanum_stramonifolium, 15 Solanum_stenandrum, 16 Solanum_stelligerum, 17 Solanum_stagnale, 18 Solanum_sisymbriifolium, 19 Solanum_sessilistellatum, 20 Solanum_sessiliflorum, 21 Solanum_sp._nov., 22 Solanum_schimperianum, 23 Solanum_sandwicense, 24 Solanum_rostratum, 25 Solanum_robustum, 26 Solanum_richardii, 27 Solanum_reptans, 28 Solanum_repandum, 29 Solanum_refractum, 30 Solanum_quitoense, 31 Solanum_pyracanthos, 32 Solanum_pugiunculiferum, 33 Solanum_ptychanthum, 34 Solanum_pseudolulo, 35 Solanum_pseudocapsicum, 36 Solanum_prinophyllum, 37 Solanum_polygamum, 38 Solanum_platense, 39 Solanum_petrophilum, 40 Solanum_pectinatum, 41 Solanum_paniculatum, 42 Solanum_panduriforme, 43 Solanum_pancheri, 44 Solanum_palitans, 45 Solanum_palinacanthum, 46 Solanum_nummularium, 47 Solanum_nemorense, 48 Solanum_nemophilum, 49 Solanum_myriacanthum, 50 Solanum_myoxotrichum, 51 Solanum_multispinum, 52 Solanum_morellifolium, 53 Solanum_montanum, 54 Solanum_mitlense, 55 Solanum_microphyllum, 56 Solanum_melongena, 57 Solanum_marginatum, 58 Solanum_mapiriense, 59 Solanum_mammosum, 60 Solanum_mahoriensis, 61 Solanum_macrocarpon, 62 Solanum_lycocarpum, 63 Solanum_luteoalbum, 64 Solanum_lidii, 65 Solanum_lasiocarpum, 66 Solanum_lanceolatum, 67 Solanum_laciniatum, 68 Solanum_kwebense, 69 Solanum_jamaicense, 70 Solanum_incompletum, 71 Solanum_incarceratum, 72 Solanum_incanum, 73 Solanum_hyporhodium, 74 Solanum_hoehnei, 75 Solanum_hirtum, 76 Solanum_hindsianum, 77 Solanum_hieronymi, 78 Solanum_linnaeanum, 79 Solanum_heinianum, 80 Solanum_hastifolium, 81 Solanum_glutinosum, 82 Solanum_glaucophyllum, 83 Solanum_furfuraceum, 84 Solanum_fraxinifolium, 85 Solanum_ferocissimum, 86 Solanum_felinum, 87 Solanum_elaeagnifolium_TX, 88 Solanum_elaeagnifolium_SA, 89 Solanum_echinatum, 90 Solanum_dulcamara, 91 Solanum_drymophilum, 92 Solanum_diversiflorum, 93 Solanum_diploconos, 94 Solanum_dasyphyllum, 95 'Solanum cyaneo-purpureum', 96 Solanum_crotonoides, 97 Solanum_crinitum, 98 Solanum_crinitipes, 99 Solanum_cordovense, 100 Solanum_conditum, 101 Solanum_comptum, 102 Solanum_thruppii, 103 Solanum_cleistogamum, 104 Solanum_clarkiae, 105 Solanum_citrullifolium, 106 Solanum_cinereum, 107 Solanum_chenopodinum, 108 Solanum_carolinense, 109 Solanum_capsicoides, 110 Solanum_capense, 111 Solanum_candidum, 112 Solanum_campylacanthum, 113 Solanum_campechiense, 114 Solanum_campanulatum, 115 Solanum_betaceum, 116 Solanum_bahamense, 117 Solanum_aviculare, 118 Solanum_aturense, 119 Solanum_atropurpureum, 120 Solanum_asymmetriphyllum, 121 Solanum_arundo, 122 Solanum_argentinum, 123 Solanum_arboreum, 124 Solanum_anguivi, 125 Solanum_allophyllum, 126 Solanum_agrarium, 127 Solanum_aethiopicum, 128 Solanum_adhaerens, 129 Solanum_aculeatissimum, 130 Solanum_aculeastrum, 131 Solanum_acerifolium, 132 Solanum_accrescens, 133 Solanum_abutiloides, 134 Jaltomata_procumbens; TREE 'Figs. 1-2' = [&R] (134,((((((133,99),(123,(122,35))),(((132,(25,17)),((126,15),55)),((((((131,(119,13)),109),(((129,4),49),71)),38),(59,45)),((((111,(65,28)),86),(75,73,40,34,5),30,14),20)),((((130,102),(((((127,124),80),95),(110,10),(64,6)),(94,61)),121,(120,21),(114,((107,85),16),83,((70,23),43),106,36,39),(112,42),(104,92),(103,89),((79,11),60,50,31),(78,19),72,(68,22),57,56,(48,46),32,26,3,2),((88,87),(76,8)),77),((128,118),69),(116,91),113,(108,(101,100)),(((98,81,41),(66,9)),96),51),((105,24),97,62,54),37,18),(((115,63),82),93),((74,27),47),(29,1),125),(58,52)),(((117,67),7),(90,(44,33))),(84,53)),12)); END;