#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on January 27, 2020; 2:43 GMT TreeBASE (cc) 1994-2008 Study reference: Bergsten J., Nilsson A.N., & Ronquist F. 2013. Bayesian Tests of Topology Hypotheses with an example from Diving Beetles. Systematic Biology, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S13927] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=38; TAXLABELS Andex_insignis Canthyporus_hottentotus Heterosternuta_pulcher Hovahydrus_minutissimus Hydrocolus_sahlbergi Hydroporus_appalachius Hydroporus_axillaris Hydroporus_carri Hydroporus_erythrocephalus Hydroporus_fortis Hydroporus_kraatzii Hydroporus_lapponum Hydroporus_longiusculus Hydroporus_mannerheimi Hydroporus_memnonius Hydroporus_neglectus Hydroporus_nigellus Hydroporus_niger Hydroporus_nigrita Hydroporus_notabilis Hydroporus_obscurus Hydroporus_pilosus Hydroporus_puberulus Hydroporus_pubescens Hydroporus_rufifrons Hydroporus_scalesianus Hydroporus_sinuatipes Hydroporus_submuticus Hydroporus_tessellatus Hydroporus_tristis Hydroporus_vagepictus Hyphydrus_ovatus Laccornellus_copelatoides Neoporus_arizonicus Neoporus_undulatus Sanfilippodytes_terminalis Suphrodytes_dorsalis Suphrodytes_figuratus ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M16067] TITLE Hydroporini; LINK TAXA = Taxa1; DIMENSIONS NCHAR=2111; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Andex_insignis GAATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGATCCTTAGGAATAATCTATGCTATACTAGCTATTGGTTTATTGGGATTTGTTGTTTGAGCTCACCATATATTTACTGTTGGTATAGATGTTGATACACGAGCCTATTTTACTTCAGCAACTATAATTATTGCAGTTCCCACAGGAATTAAGATTTTTTCTTGATTGGCAACTCTTCATGGATCCCAAATTTCTTATAGACCCTCATTACTATGGGCCTTAGGATTTGTTTTTTTATTTACAGTAGGGGGATTAACTGGAGTTGTATTAGCTAATTCATCTATTGATATTATTTTACATGATACTTATTATGTGGTAGCTCATTTTCATTATGTATTATCTATAGGGGCAGTATTTGCAATTTTAGCTGGATTTATTCAATGATTCCCCTTATTCACAGGTTTAACCCTTAATACTCAACTTTTAAAAATTCATTTTATTATTATATTTATTGGTGTTAATTTAACATTTTTCCCCCAACATTTCTTAGGATTAAGAGGTATACCCCGACGTTATTCTGATTATCCCGATGCATACACATCGTGAAATGTGGTATCTTCTATTGGATCAACTATTTCTTTTATTGGTGTATTAATATTTATTTATATTATTTGAGAGGCATTTATTTCTCAACGAACGGTAATTTTTTCTAACCAAATACCCACTTCAATTGAATGACTCCAAAATTTCCCCCCAGCTGAAAATCCACCGGCGGCAAGGCCCCGCGCAAACAGCTGGCCACGAAGGCCGCTCGCAAGAGCGCGCCCGCGACTG--GGGGTCAAGAAGCCTCATCGTTACAGGCCCGGT-CCGTCGCTCTCCGTGAGATCCGT-GTTCC--AAAGAGCACCGAACTCCTGATCCGCAAGCTTCCGTTCCAACGTCTGGTTCGTGAAATCGCGCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCGGCCGTCATGGCCCTGAAGGAAGCCAGCGAGGCGTACCTCGTCGGTCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTAGATTA--ATAATTTAAGGTCTAATCTGCCCACTGATTA-ATTGAATGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGATTGGACGAGATAAAATCTGTCTCTTAATTAATATTAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATTTATTT-TTTTATAATTTATATAATGATTATTTAATTTATTATAAAAGTGTAAATTTTATTGGGGTAATAAAAAGATTAAAATAATTCTTTTTTA-TTTAAACAATGATAATTGAGTA-TATGATCCATATATAA-GATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCATATCGATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACATTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGAAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGT------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCTGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGTTCCAATAGCGTA Canthyporus_hottentotus ---TAATTTCTCATATTATTAGCCAAGAAAGAGGGAAAAAGGAAACTTTTGGGTCCCTGGGAATAATTTATGCTATATTAGCAATTGGATTACTGGGATTTGTGGTATGAGCTCATCATATATTTACTGTGGGAATAGATGTAGATACTCGAGCATATTTTACTTCTGCAACAATAATTATTGCCGTTCCTACTGGAATTAAAATTTTTTCTTGATTAGCTACTCTTCATGGATCTCAAATTTCCTATAGACCCTCATTATTATGAGCTTTAGGGTTTGTATTTTTATTTACAGTAGGGGGATTAACTGGGGTAGTACTAGCTAACTCTTCAATTGATATTATTCTCCATGATACATATTATGTCGTTGCTCATTTTCATTATGTTTTATCTATGGGAGCAGTTTTTGCTATTCTTGCCGGATTTATTCAATGATTTCCTCTCTTTACTGGACTAACCTTAAATTCTAACATACTTAAAATTCATTTTATTGTAATATTTATTGGAGTCAATTTAACATTCTTTCCCCAACACTTTCTTGGTCTAAGAGGAATACCTCGACGATATTCTGACTACCCCGATGCTTATACCTCTTGGAATGTTATTTCTTCTATTGGATCAACAATCTCCTTTATTGGTGTTCTTATATTTATTTATATTATTTGAGAAGCATTTGTATCTCAACGTAATGTAATTTTTTCTAACCATATACCCACTTCTATTGAATGATTCCAAAAATTACCCCCTGCT---AGTCCACCGGAGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGTAAGAGCGCGCCGGCCACCGGCGGAGTCAAGAAACCCCATCGTTACAGGCCCGGAACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGTACCGAACTCCTGATCCGCAAGCTCCCGTTCCAACGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAAGCCAGCGAGGCCTACCTCGTCGGCCTGTTCGAAGACACCAACTTGTGCGCCATGTCCTTTAGATG--TAGAATTTAAGGTCTGATCTGCCCACTGAAATAATTAAATGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAAGGGTTGGACGAAATAGAATCTGTCTTTAATTAATAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATTAATAAAAGACGAGAAGACCCTATAGATCTTTATTATAATTTAAATTAATTTTATTTAAGATTAATTAATTAATTATTTTATTTATAATTTTATTGGGGTAATAAAAAGATTATAGGAATTCTTTTATTAATTTA-CAAAGATTATTGATTT-TTTGATCCATTTATAGTGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCGATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACGAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGAACAAAACTAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTCA---CGCCGCTCAGCCTGGTGACTCTGAATAACTTTTCGCTGATCGCACGGTCTCGCACCGGCGACTCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCCATTGGAGGGTAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCG-- Heterosternuta_pulcher GGATAATTTCCCATATTATCAGTCAAGAAAGAGGAAAAAAAGAAACTTTTGGTTCATTAGGTATAATCTACGCAATATTAGCTATTGGATTATTAGGATTTGTAGTATGAGCACATCATATATTTACTGTAGGAATAGATGTTGACACTCGGGCATATTTTACTTCTGCTACTATAATTATTGCTGTACCCACAGGAATTAAAATTTTTTCTTGATTAGCTACTTTACATGGCTCACAGATCTCATATAGTCCATCTCTTCTTTGAGCATTAGGATTTGTATTTTTATTTACTGTAGGAGGATTAACAGGAGTGGTACTAGCAAATTCTTCTATTGATATTATTTTACATGATACATATTATGTAGTTGCCCATTTCCATTATGTTCTTTCTATAGGAGCTGTATTTGCCATTTTAGCGGGATTTATTCAATGATTCCCTTTATTTACTGGAATTTCATTAAATAATCAATTGTTAAAAATTCATTTTATAATTATATTTATTGGTGTAAATTTAACCTTTTTCCCACAACATTTTTTAGGTTTAAGAGGTATACCTCGACGATACTCTGATTATCCTGATGCTTATACATCTTGAAATATTATTTCTTCAATTGGATCAACAATTTCTTTTATTGGAGTATTAATATTTATCTATATTATATGAGAAGCTTTTGTATCCCAACGAATAGTAATCTTTTCTAATCAAATATCAACTTCTATTGAATGATTCCAAAAATTCCCCCCAGCAGAAAATCCACCGGAGGTAAAGCCCCGAGGAAACAACTCGCCACCAAGGCCGCCCGTAAGAGCGCGCCGGCAACCGGCGGCGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGTACCGAGCTGCTGATCCGCAAACTTCCGTTCCAACGGTTGGTTCGTGAGATCGCCCAGGACTTCAAGACCGACTTGCGTTTCCAGAGCTCGGCCGTCATGGCCCTGCAGGAAGCCAGCGAGGCCTACCTCGTCGGCCTGTTCGAAGATACCAACTTGTGCGCCATGTCCTTTAGATTT--ATAATTTAAGGTTTAACCTGCCCATTGAAATTTTTGAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGCATGAATGGTTGGACGAGATAAAATCTGTCTTTTAATTAAATATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATTAGTAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTATAGTGTAAATAAGGATTAATTAATTTATTATGATAATTTATATTTTATTGGGGTAATAGAAAGATTAATATAATTCTTTTTTT-T-GAAATATTAATAAATAGTTT-TTTGATCCATTAATAGTGATAATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCATATCGATAAAAAAGATTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCCGA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGGTCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hovahydrus_minutissimus GGATAATTTCTCACATCATTAGTCAAGAAAGAGGAAAAAAGGGAACTTTTGGATCTTTGGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTGTCGTATGAGCTCATCATATATTTACAGTAGGTATAGATGTAGACACACGAGCTTACTTTACATCAGCAACTATAATTATTGCTGTTCCTACAGGAATTAAAATCTTTTCCTGATTAGCAACTTTACATGGATCTCAAATCTCTTATAGTCCTTCTCTTCTATGAGCCTTGGGATTTGTATTTTTATTTACTGTAGGGGGACTCACAGGTGTAGTATTGGCTAATTCATCTATTGATATTATTCTCCATGATACATATTATGTTGTTGCCCATTTTCATTATGTTCTTTCCATAGGAGCTGTTTTTGCAATTTTAGCCGGATTTATTCAATGATTTCCCTTATTTACAGGATTAACTTTAAATGCTAAACTATTAAAAATTCACTTTATTGTCATATTTATTGGAGTAAATTTAACTTTTTTCCCCCAACATTTCCTAGGGTTAAGAGGAATACCTCGTCGATATTCTGATTACCCAGATGCTTATACCTCATGAAATGTAATCTCTTCTATTGGATCAACTATCTCATTTATTGGTGTAATTATATTTATCTATATTATTTGAGAAGCATTTATTTCCCAACGAATTGTAATTTTTTCTAATCAAATATCCACTTCAATTGAATGATTTCAAAACTTCCCTCCAGCTGAAAATCCACCGGTGGCAAGGCCCCGCGCAAACAGCTGGCCACGAAGGCCGCTCGCAAGAGCGCGCCCGCAACCGGCGGCGTCAAGAAACCTCATCGTTACAGGCCCGGTACCGTCGCTCTGCGCGAGATCCGCCGTTACCAAAAGAGCACCGAACTCTTGATCCGCAAGCTTCCGTTCCAGCGTCTGGTCCGTGAAATCGCGCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCGGCCGTCATGGCCCTGCAGGAAGCCAGCGAAGCCTACCTCGTCGGTCTGTTCGAAGACACCAACTTGTGCGCCATGTCCTTTAGATAA--ATAATTTAAGGTCTAATCTGCCCACTGATTA-ATTAAATGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGATTGGACGAGATAAAATCTGTCTCTTAATTAGTTTTAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTTTATAAAAGACGAGAAGACCCTATAGATCTTAATTTATAAATTTTATAATTTATTTAATGATTAATTTATTTATTATAATTTTGTAAATTTTATTGGGGTAATAAAAAGATTAAATTAATTCTTTTTTA-TGTTAACAATAATAATTGGTTA-TTTGATCCATTTATAGTGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCATATCGATAAAAAAGTTTGCGA---------AGATTAAGCCATGCATGTCTCAGTACAAGCCGCG-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCAATCTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGAAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGTGCGCGCGCTTCCGCGCGCTCTCCCGTCCGCCGCTCGACCTGGTGACTCTGAATAACTTTCTGCCGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGTTCCAATAGCGTA Hydrocolus_sahlbergi GAATAATTTCCCACATTATTAGTCAAGAAAGAGGGAAAAAGGAAACCTTTGGTTCATTAGGGATAATTTATGCCATATTAGCTATTGGATTATTAGGATTCGTAGTTTGAGCTCACCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCATATTTTACATCAGCTACTATAATTATTGCTGTTCCTACAGGAATTAAAATTTTCTCTTGATTAGCTACATTACATGGTTCTCAAATTTCTTACAGACCATCATTATTATGAGCTCTTGGATTCGTATTCTTATTTACAGTAGGGGGATTAACGGGAGTAGTATTAGCTAATTCATCAATTGATATTATTTTACATGATACATATTATGTTGTTGCCCATTTTCATTATGTTTTATCAATAGGAGCCGTATTTGCTATTCTAGCAGGATTTATTCAATGATTTCCATTATTTACAGGAATTACCTTAAATTCAAATCTTTTAAAAATTCAATTTATTATTATATTTATTGGAGTAAATTTAACATTTTTTCCCCAACATTTTCTAGGATTAAGAGGAATACCTGGACGATACTCTGACTACCCTGATGCATATACTGCGTGAAATGTAATCTCTTCAATTGGTTCAACAATTTCATTTATCGGAGTATTAATACTAATTTATATTATTTGAGAAGCTATAATTTCTCAACGT-TAGTCATCTTTGCTAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTACCCCCAGCTGAA-ATCCACCGGTGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGTAAGAGCGCGCCGGCCACCGGCGGAGTCAAGAAACCTCATCGTTACAGGCCCGGCACCGTGGCTCTCCGTGAAATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTCTCGTCCGTGAGATCGCACAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAAGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAGGACACCAACTTGTGCGCGATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-ATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTAATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTTAATAAAAGACGAGAAGACCCTATAGATCTTTATAAAA-ATTTTTTTAATATTAATATAGATGATTTTATTTATTATATAGATTTTTATTTTATTGGGGTAATAAAAAGATTAAAAAAATTCTTTTTTA-T-TTGACAAAAATTATTGATTT-TATGATCCATTATTAGTGATT-TAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTTAAGAGTTCTTATCGATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGT------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTT Hydroporus_appalachius GAATAATTTCCCATATTATTAGACAAGAAAGAGGTAAAAAGGAAACTTTTGGTTCATTAGGAATAATTTATGCTATATTAGCAATTGGATTATTAGGGTTTGTAGTTTGAGCTCATCATATATTTACCGTAGGAATAGATGTTGATACTCGAGCATATTTTACTTCAGCAACAATAATTATTGCAGTTCCAACTGGAATTAAAATTTTTTCTTGATTAGCAACTTTACATGGATCTCAAATTTCCTATAGACCCTCATTATTATGAGCTTTAGGATTTGTATTTTTATTTACTGTAGGAGGTTTAACAGGAGTAGTTTTAGCTAACTCTTCTATTGATATTATTCTACATGATACATATTATGTTGTTGCTCATTTTCATTATGTTCTTTCAATAGGAGCAGTATTTGCTATTTTAGCTGGTTTTATTCAATGATTTCCTTTATTTACAGGGATTTCTTTAAATTCTAACTTATTAAAAATTCAATTTTTAATTATATTTATTGGGGTAAATTTAACATTTTTTCCCCAACATTTTTTAGGATTAAGAGGAATACCCCGACGATACTCAGATTATCCTGATGCTTATACTTCTTGAAATGTAATTTCATCAATTGGATCAACAATCTCATTTATTGGAGTATTAATATTAATTTATATTATTTGAGAAGCTTTTATTACTCAACGTTTAGTAATTTTTTCTAATCAAATGCCAACCTCTATTGAGTGATTCCAAAA----------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGT{AC}AAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAAGATTTCAAGACCGAC{CT}TGCGTTTCCAGAGTTCCGCCGTCATGGCTCTGCAGGAGGC{CT}AGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATAAAA-TTTTTTTTAATATTAATAAAGAAATTTTAATTTATTATAAAAATTTTTATTATATTGGGGTAATAAAAAGATTAATATAATTCTTTTTTT-TAATAACAATTATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAGAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_axillaris GGATAATTTCCCATATTATTAGACAAGAAAGAGGGAAAAAGGAAACTTTCGGATCATTAGGAATAATTTATGCAATATTAGCTATTGGATTATTAGGATTTGTTGTTTGAGCTCATCATATATTTACAGTAGGAATAGATGTTGATACTCGGGCATATTTTACTTCAGCAACTATAATTATTGCAGTCCCAACCGGAATTAAAATTTTCTCTTGATTAGCAACTTTACATGGATCTCAAATTTCATATAGACCTTCACTGTTATGGGCTTTAGGATTTGTATTTTTATTTACTGTTGGGGGGTTGACAGGAGTAGTATTAGCTAATTCATCAATTGATATTATCCTACATGATACTTATTATGTTGTAGCTCATTTCCATTATGTTTTATCTATAGGAGCAGTATTTGCTATTTTAGCCGGATTTATTCAGTGATTTCCCCTATTTACCGGAATTTCCTTAAATTCAAACCTTCTAAAAATCCAATTTTTAATTATATTTATTGGGGTAAATTTAACATTTTTTCCACAACATTTTTTAGGATTAAGAGGAATACCCCGACGATATTCAGATTACCCAGATGCTTATACTTCCTGAAATGTTATTTCTTCAATTGGATCAACAATTTCATTTATTGGAGTTTTATTATTAATTTATATTATTTGAGAAGCTTTTATTTCTCAACGTTTAGTTATTTTTTCAAATCAAATGCCTACTTCAATTGAATGATTCCAAAAATTTCCTCCCTGCAGAAATCCACCGGTGGCAAAGCCCCGAGGAAACAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGTACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAGGATTTCAAGACAGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACCAACTTGTGCGCCATGTCCTTTAGATAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTCTTATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGATGTTTTAATTTATTATAAAAATTTATATTTTATTGGGGTAATAAAAAGATTTAAAAAATTCTTTTTTA-T-AAAACAATAATTATTGATTT-GATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_carri GAATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTT{CT}GGTTCATTAGGTATAATTTATGCAATATTAGCAATTGGATTATTAGG{AG}TTTGTAGTTTGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACCCGGGCATACTTTACTTCAGCAACAATAATTATTGCAGTCCCAACTGGAATTAAAATTTTCTCCTGATTAGCAACTTTACATGGATCTCAAATTTCATATAGACCTTCATTATTATGAGCTTTAGGTTTTGTATTTTTATTTACTGTAGGTGGATTAACAGGAGTAGTTTTAGCTAATTCATCAATTGATATTATTCTTCATGATACATATTATGTTGTTGCTCATTTTCACTATGTTTTATCAATAGG{AG}GCAGTATTTGCTATTTTAGCTGGATTTATTCAATGATTCCCCTTATTTACAGGAATTTCATTAAATTCAAATTTATTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACCTTTTTTCCTCAACATTTTTTAGGATTAAGAGGTATACCTCGTCGATATTCAGATTATCCAGATGCTTATACATCATGAAATGTAATTTCCTCAATTGGATCAACAATTTCCTTTATCGGAGTGTTAATATTAATTTATATTATTTGAGAAGCATTT{AG}TCTCCCAACGTTTAGTTATTTTTTCTAATCAAATACCTACTTCTATTGAATGATTCCAAA-----------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAGCTCGCCACAAAAGCCGCCCGCAAGAGCGCGCC{AG}GCCACCGGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTATATAGTATTAATAAAGTTAATTTAATTTACTATAATAAATTATATTTTATTGGGGTAATAAAAAGATTAATATAATTCTTTTTTT-TTGATACAATAATTATTGATTT-TATGATCCATTATTAATGATTATATGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_erythrocephalus G{AG}ATAATCTCCCATATTATTAGACAAGAAAGAGGGAAAA{AG}GGAAACATTTGGTTCATTAGGAATAATTTATGCAATATTAGCTATTGGATTATTAGGATTTGTAGTCTGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACACGGGCATATTTTACTTCTGCAACTATAATTATTGCAGTTCCTACTGGAATTAAAATTTTTTCTTGATTAGCAACTTTACACGGATCCCAAATTTCTTATAGACCTTCATTAATATGAGCTTTGGGATTCGTATTTTTATTCACAGTAGGAGGATTAACCGGAGTAGTATTAGCAAACTCATCTATTGATATTATTCTTCATGATACATATTATGTAGTAGCCCATTTCCATTATGTTCTTTCAATAGGAGCAGTATTTGCCATTTTAGCTGGATTTATTCAGTGATTTCCCCTATTTACAGGAATCTCATTAAATTCTAATCTACTGAAAATTCAATTTTTAATTATATTTATTGGAGTGAATTTAACATTTTTCCCTCAACATTTTTTAGGACTTAGAGGAATACCCCGTCGATATTCTGATTATCCAGATGCTTACACCTCTTGAAATGTAATTTCTTCAATTGGATCAACAATTTCATTTATTGGTGTATTAATATTAATTTATATTATTTGAGAGGCTTTTATTATACAACGCTTAGTAATTTTCTCAAATCAAATACCTACTTCTATCGAATGATTCCAAAA----------------AATCCACCGGTGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGAGGAGTTAAGAAACCGCATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAGCGTTTGGTTCGTGAGATCGCGCAGGACTTCAAGACCGACCTGCGTTTCCAAAGTTCCGCCGTCATGGCCCTGCAGGAGGCTAGCGAGGCCTACCTCGTCGGCCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTAGATAAAAATTATTTAAGGTCTAACCTGCCCATTGATTA-ATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATAAATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAATATTAATAAAGAAGATTTAATTTATTAAATAATTTTATATTTTATTGGGGTAATAAAAAGATTAATTTAATTCTTTTTTA-T-TAAACAATAATTATTGGTTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_fortis -----------------------CAGGAAAGAGGGAAAAAGGAAACTTTTGGATCATTAGGGATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTGTTGTATGAGCACACCATATATTTACAGTAGGAATGGATGTTGATACTCGAGCATACTTTACCTCAGCAACTATAATTATTGCTGTCCCAACTGGAATTAAAATTTTTTCTTGATTAGCAACTTTACACGGATCTCAAATTTCTTATAGACCATCATTATTATGATCTTTAGGATTTGTCTTTTTATTCACCGTTGGAGGTTTAACAGGAGTAGTATTAGCAAATTCTTCCATTGATATTATTCTTCATGATACTTATTATGTTGTTGCTCATTTTCATTATGTCTTATCTATAGGAGCAGTATTTGCTATTTTAGCGGGATTTATTCAATGATTCCCTTTATTTACAGGACTTTCCTTAAATTCTAATTTACTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACCTTTTTTCCCCAACATTTTTTAGGGTTAAGAGGAATACCCCGACGATATTCTGATTATCCTGATGCTTATACTTCCTGAAATATTATTTCTTCAATTGGATCAACAATTTCCTTTATTGGAGTTTTAATATTAATTTATATTA--------------------------------------------------------------------------------------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGTGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAGGATTTCAAGACCGACCTGCGTTTCCAGAGTTCCGCCGTCATGGCTCTGCAGGAGGCTAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGATAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTCAAAAAGCTTAAATTATTATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGATAATTTTATTTATTAAAGGTATTTATATTTTATTGGGGTAATAAAAAGATTAAAAAAATTCTTTTTTA-T-AAAACAATAATTATTGATTT-ATTGATCCATTATTTATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_kraatzii ------------ATATTATTAGACAGGAAAGAGGAAAAAAGGAAACTTTTGGATCTTTAGGTATAATTTATGCAATATTAGCTATTGGATTATTAGGATTTGTAGTTTGAGCACATCATATATTTACAGTTGGTATAGATGTTGATACTCGAGCTTATTTTACTTCAGCAACTATAATTATTGCTGTTCCTACAGGAATTAAAATTTTTTCATGATTAGCAACTTTACATGGATCTCAAATTTCTTATAGACCATCTTTATTATGAGCCCTAGGATTTGTATTTCTTTTTACAGTAGGGGGATTAACAGGAGTTGTTTTAGCTAATTCCTCAATTGATATTATTCTTCATGATACTTATTATGTTGTTGCCCATTTTCATTATGTATTATCAATAGGAGCTGTATTTGCTATTTTAGCAGGATTTATTCAATGATTTCCATTATTTACTGGGATTACCTTAAATTCAAATTTATTAAAAATTCAATTTATTATTATATTTATTGGGGTAAATTTAACATTTTTTCCACAACATTTTCTAGGACTTAGAGGAATACCTCGCCGATATTCAGATTATCCAGATGCTTATACTTCATGAAATGTAATTTCCTCTATTGGATCAACAATTTCTTTTATTGGAATTTTAATATTAATTTATATTATTTGAGAAGCATTTATCTCTCAACGTTTAGTTATTTTTTCAAATCAAATACCAACCT-----------------------------------AGTCCACCGGTGGAAAGGCACCGAGGAAGCAGCTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCTGCCACCGGCGGAGTAAAGAAACCCCATCGTTACAGGCCCGGCACCGTCGCCCT{GT}CGTGAGATCCGTCGTTACCA{AG}AAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTGGTCCGTGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTGATGGCCCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAGGACACCAA{CT}TTGTGCGCCATGTCCTTTAGTTAAAAATAATTTAAGGTCTAACCTGCCCATTGATTAAATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATTTATAAAAGACGAGAAGACCCTATAGATCTTAATATAA-TTTTTTTTAGTATTAATAAAGAAAATTTTATTTATTATAAAAATTTATATTTTATTGGGGTAATAAAAAGATTAATAAAATTCTTTATAA-T-TAAACAAAAATTATTGGTTT-TTTGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCATATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCAAA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGT------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACC-ATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_lapponum GTATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGATCTTTAGGAATAATTTATGCCATACTAGCAATTGGATTACTAGGATTTGTAGTTTGAGCTCACCATATATTTACTGTAGGAATAGATGTTGATACCCGAGCATATTTTACTTCAGCAACAATAATTATTGCAGTTCCAACAGGAATTAAAATTTTTTCTTGATTAGCTACTTTACACGGATCTCAGATTTCATATAGACCCTCATTATTATGAGCTTTAGGGTTTGTATTTTTATTTACTGTAGGGGGATTAACAGGAGTAGTATTAGCAAATTCATCAATTGATATTATTCTTCATGATACTTACTATGTTGTTGCACATTTTCATTACGTTCTTTCTATAGGAGCGGTATTTGCTATTTTAGCTGGATTTATTCAATGATTCCCTTTATTTACAGGAATTTCATTAAATTCAAACTTATTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACATTTTTTCCCCAACATTTTCTAGGATTAAGAGGTATACCACGTCGATATTCAGATTACCCCGATGCTTATACTTCATGAAATGTAATTTCCTCAATTGGATCAACAATTTCCTTCATCGGAGTATTAATATTAATTTATATTATTTGAGAGGCTTTTATTATACAACGTTTAGTAATTTTTTCTAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTTCCCCCAGCAGAAAATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACAAAAGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAGGATTTCAAGACCGACCTGCGTTTCCAGAGTTCCGCCGTCATGGCTCTGCAGGAGGC{CT}AGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGATAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAGATTTAATTTATTATAAAAATTTATATTTTATTGGGGTAATAAAAAGATTAATTAAATTCTTTTTTA-T-TAAACAATTATTATTGGTTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_longiusculus GAATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGTTCATTAGGTATAATTTATGCAATATTAGCAATTGGATTATTAGGATTTGTAGTTTGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACCCGGGCATACTTTACTTCAGCAACAATAATTATTGCAGTCCCAACTGGAATTAAAATTTTCTCCTGATTAGCAACTTTACATGGATCTCAAATTTCATATAGACCTTCATTATTATGAGCTTTAGGTTTTGTATTTTTATTTACTGTAGGTGGATTAACAGGAGTAGTTTTAGCTAATTCATCAATTGATATTATTCTTCATGATACATATTATGTTGTTGCTCATTTTCACTATGTTTTATCAATAGGAGCAGTATTTGCTATTTTAGCTGGATTTATTCAATGATTCCCTTTATTTACAGGAATTTCATTAAATTCAAATTTATTAAAAATTCAATTTTTAATTATATTTATTGGGGTAAATTTAACCTTTTTTCCTCAACATTTTTTAGGATTAAGAGGTATACCTCGTCGATATTCAGATTATCCAGATGCTTATACATCATGAAATGTAATTTCCTCAATTGGATCAACAATTTCCTTTATCGGAGTGTTAATATTGATTTATATTATTTGAGAAGCATTTATCTCCCAACGTTTAGTTATTTTTTCTAATCAAATACCTACTTCTATTGAATGATTCCAAAATTTTCCTCCAGCA---AATCCACCGGTGGCAAAGCCCCGAGGAAGCAGCTCGCCACAAAAGCCGCCCGCAAGAGCGCGCC{AG}GCCACCGGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCTCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTATATAGTATTAATAAAGTTAATTTAATTTACTATAATAAATTATATTTTATTGGGGTAATAAAAAGATTAATATAATTCTTTTTTT-T-GATACAATAATTATTGATTT-TATGATCCATTATTAATGATTATATGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_mannerheimi GGATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAGGGAAACTTTTGGTTCATTAGGAATAATTTATGCTATATTAGCAATTGGATTATTAGGATTTGTAGTTTGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGGGCATACTTTACTTCAGCAACAATAATTATTGCAGTTCCAACTGGAATTAAAATTTTTTCTTGATTAGCAACCTTACACGGATCTCAAATTTCCTATAGACCTTCATTATTATGAGCTTTAGGATTTGTATTTTTATTTACTGTAGGAGGTTTAACAGGGGTAGTTTTAGCTAATTCCTCTATTGATATTATCCTTCATGATACATATTATGTTGTAGCCCATTTTCATTATGTTCTTTCAATAGGAGCAGTATTTGCTATTTTAGCCGGGTTTATTCAATGATTTCCTTTATTTACAGGAATTTCTTTAAATTCAAACTTATTAAAAATTCAATTTTTAATTATATTTATTGGGGTAAATTTAACATTTTTTCCCCAACATTTTTTAGGGTTAAGAGGAATACCCCGACGATACTCTGATTATCCTGATGCTTATACTTCTTGAAATGTAATTTCATCAATTGGATCAACAATCTCATTTATTGGAGTATTGATATTAATTTATATTATTTGAGAAGCTTTTATTACTCAACGTTTAGTAATTTTTTCTAATCAAATACCAACCTCTATTGAATGATTCCAAAAATTCCCACCAGCAGAAAATCCACCGGTGGCAAAGCCCCGAGAAAGCAACTCGCCACCAAGGCCGCCCG{CT}AAGAGCGCGCCAGCCAC{AC}GGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGC{GT}CAAGATTTCAAGACCGA{CT}CTGCGTTTCCAGAGTTCCGCCGTCATGGCTCTGCAGGAGGCTAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACAC{CT}AACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATAAAA-TTTTTTTTAATATTAATAAAGAAATTTTAATTTATTATAAAAATTTTTATTATATTGGGGTAATAAAAAGATTAATATAATTCTTTTTTT-TAATAACAATTATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAGAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_memnonius GAATGATTTCCCATATTATTAGACAAGAAAGAGGTAAAAAGGAAACTTTTGGATCTTTGGGAATAATTTATGCAATATTAGCTATTGGACTATTAGGGTTTGTTGTATGAGCTCATCATATATTTACAGTTGGAATAGATGTTGATACTCGGGCTTATTTTACTTCAGCAACTATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTTCATGATTGGCAACCCTACATGGATCTCAGATTTCTTATAGACCATCTTTATTATGAGCCCTGGGATTTGTATTTCTTTTCACGGTGGGGGGATTAACAGGAGTTGTTCTTGCTAATTCTTCAATTGATATTATTCTTCATGATACATATTATGTAGTTGCCCATTTTCATTATGTTTTATCTATAGGAGCTGTATTTGCTATTTTAGCCGGGTTTATTCAATGATTTCCCCTATTTACTGGAATTACTTTAAATTCAAATTTATTAAAAATTCAATTTATTATTATATTTATTGGAGTAAATTTAACATTCTTTCCCCAACATTTTCTGGGACTTAGAGGAATACCTCGACGATACTCGGATTATCCTGATGCTTATACTTCATGAAATGTAATTTCTTCAATTGGATCAACTATTTCTTTTATTGGAATTTTAATATTAATTTATATTATTTGGGAGGCATTTGTATCTCAACGTTTAGTAATTTTTTCAAATCAAATACCAACCTCTATTGAATGATTCCAAAAATTTCCCCCAGCAGAAAGTCCACCGGTGGCAAGGCACCGAGGAAGCAGCTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCGGCAACCGGAGGAGTAAAGAAACCCCATCGTTACAGGCCCGGCACCGTCGCCCTGCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTGGTACGTGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTGATGGCCCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTAGTTAAAAATAATTTAAGGTCTAACCTGCCCATTGATTAAATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAATAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATGTTTATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAAAATTTATTTATTAGGAAAATTTTTATTTTATTGGGGTAATAAAAAGATTAATAAAATTCTTTATAA-T-TAAACAAAAATTATTGGTTT-TTTGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCATATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGG-TCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_neglectus GAATAATTTCCCATATTATTAGTCAAGAAAGAGGAAAGAAAGAAACTTTTGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGGTTACTAGGATTTGTAGTTTGAGCCCATCATATATTTACAGTTGGAATAGATGTTGATACTCGAGCATATTTTACTTCAGCTACTATAATTATTGCTGTACCTACTGGAATTAAAATTTTTTCATGATTAGCTACCCTTCATGGATCTCAAATTTCATATAGCCCTTCCCTTTTATGAGCATTAGGATTTGTATTTTTATTTACTGTAGGTGGTTTAACTGGTGTAGTATTAGCTAATTCATCTATTGATATTATTCTCCATGATACCTACTATGTTGTTGCCCATTTTCATTATGTTTTATCTATGGGAGCAGTATTTGCTATTTTAGCTGGCTTTATTCAATGATTTCCCCTATTTACAGGAATTTCTCTTAACTCTAATCTATTAAAAATTCAATTTATAATTATATTTATTGGAGTAAATTTAACATTTTTTCCTCAACATTTTTTAGGATTAAGAGGAATACCTCGACGATATTCAGATTATCCAGATGCCTATACTTCTTGAAATATCATTTCTTCTATTGGTTCTACAATTTCCTTTATTGGAATTTT-------------------------------------------------------------------------------------------------------------AGTCCACCGGAGGCAAAGCCCCGAGGAAACAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCGGCCACCGGCGGTGTAAAGAAACCACATCGTTACAGGCCCGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAACTTCCGTTCCAACGTTTGGTCCGTGAGATCGCACAGGACTTCAAAACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACCAACTTGTGCGCGATGTCCTTTTGTTT--TATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTAATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAAATTTTATTTATTAAAATTAATTTTATTTTATTGGGGTAATAAAAAGATTTAAAAAATTCTTTAATA-A-TAAACAATAATTATTGATTA-TATGATCCATTATTAATGATTAAAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_nigellus ---------------------------------------AGGAAACCTTTGGATCATTAGGTATAATTTACGCAATATTAGCAATTGGGTTACTAGGATTTGTAGTCTGAGCTCATCATATATTTACTGTAGGAATAGATGTTGATACTCGAGCATATTTTACTTCAGCAACAATAATTATTGCTGTTCCAACTGGAATTAAAATTTTCTCATGATTAGCAACTTTACACGGATCTCAAATTTCTTACAGACCCTCATTATTATGAGCTTTAGGATTTGTATTTTTATTTACTGTTGGGGGATTAACTGGGGTAGTATTAGCTAATTCATCAATTGATATTATTCTTCATGATACTTACTATGTTGTTGCACATTTTCATTATGTTCTTTCAATGGGAGCAGTATTTGCTATTTTAGCTGGATTTATCCAATGATTTCCTTTATTTACAGGAATTTCATTAAATTCAAACTTATTGAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACCTTTTTTCCCCAACATTTTTTAGGATTAAGAGGAATACCCCGTCGATACTCAGATTATCCTGATGCCTATACATCGTGAAATGTAATTTCCTCAATCGGATCAACAATTTCCTTTATTGGTGTATTAATACTAATTTATATTATTTGAGAAGCATTTATTTCCCAACGTTTAGTAATTTTTTCAAATCAAATACCTACTTCT---------------------------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACAAAAGCCGCC-GCAAGAGCGCGCCAGCCACCGGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTCCGTGAGATCGCTCAGGACTTCAAAACCGACCTGCGTTTCCAGAGTTCCGCCGTCATGGCTCTGCAGGAGGCTAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAATATTAATAAAGAAAATTTAATTTTTTATAAAAAATTATATTTTATTGGGGTAATAAAAAGATTAATATAATTCTTTTTTT-T-TATACAATAATTATTGATTT-TATGATCCATTATTAATGATTATATGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_niger -----------------------------------------------TTTGGATCATTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTGTAGTATGAGCTCATCATATATTTACAGTAGGAATAGATGTAGATACTCGGGCATATTTTACATCAGCAACTATAATTATTGCTGTACCCACTGGAATTAAAATTTTTTCTTGATTAGCAACCTTACATGGATCTCAAATTTCTTATAGCCCATCATTATTATGAGCTTTAGGATTTGTTTTCTTATTTACTGTAGGAGGATTAACGGGAGTAGTTTTAGCTAACTCATCTATTGATATTATTCTTCATGATACTTATTATGTAGTTGCACATTTTCATTATGTTCTTTCTATAGGAGCAGTATTTGCTATCTTAGCTGGATTTATTCAATGATTTCCTTTATTTACAGGAATTTCATTAAATTCTAATTTATTAAAAATTCAATTTTTAATTATATTTATTGGGGTTAATTTAACATTTTTCCCCCAACACTTTTTAGGGTTAAGAGGTATACCCCGCCGATATTCAGATTACCCAGATGCATATACATCCTGAAATGTAATTTCTTCAATCGGATCAACAATTTCATTTATTGGAGTATTAATATTAATTTA-------------------------------------------------------------------------------------------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTTAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTGCGCGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCTAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTTGTATTAATAAAGAAAATTTAATTTATTAAAAAAATTTATATTTTATTGGGGTAATAAAAAGATTAATTAAATTCTTTTATA-A-AAAACAATAATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_nigrita GGATAATCTCCCATATTATTAGACAAGAAAGAGGAAAAAGGGAAACTTTTGGATCTTTAGGTATAATTTATGCTATATTAGCTATTGGATTACTTGGATTTGTAGTATGGGCCCATCATATATTTACTGTTGGAATAGATGTTGATACTCGTGCATATTTTACTTCCGCAACTATAATTATTGCAGTACCCACAGGAATTAAAATTTTTTCCTGATTAGCAACTCTTCATGGCTCTCAAATTTCATATAGACCCTCTTTATTATGAGCCCTGGGTTTCGTATTTTTATTTACAGTAGGGGGATTAACAGGTGTTGTTCTTGCTAATTCATCAATTGATATTATTCTTCATGATACTTATTATGTAGTCGCTCATTTTCATTATGTTTTATCTATAGGGGCCGTATTTGCTATTTTAGCCGGATTTATTCAATGATTTCCCCTTTTTACAGGAATTTCCTTAAATTCTAATTTATTAAAAATTCAATTTATTATTATATTTATTGGGGTAAATTTAACATTTTTTCCCCAACATTTTCTTGGACTAAGAGGTATACCTCGACGATATTCTGATTATCCGGATGCATATACATCATGAAATGTAATTTCTTCTATTGGATCAACAATTTCATTTATTGGAATTTTAATGTTAATTTATATTATTTGAGAAGCATTTATTTCCCAACGTATAGTAATTTTCTCAAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTTCCCCCAGCAGAAAGTCCACCGGGGGCAAGGCCCCGAGGAAGCAGCTCGCCACCAAGGCGGCCCGCAAGAGCGCGCCGGCCACCGGCGGCGTGAAGAAGCCCCATCGTTACAGGCCCGGCACCGTCGCCCTCCG{CT}GAGATCCG{CT}CGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTCGTCCGTGAGATCGCTCAGGACTTCAAGACGGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCTTACCTGGTCGGTCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTTGTTAAAAATAATTTAAGGTCTAACCTGCCCATTGATTAAATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGCAAAAAAGCTTAAATTTAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-CTTTTTTTAGTATTAATAAAGAAAATTTTATTTATTAATTGATTTTATATTTTATTGGGGTAATAAAAAGATTAAATAAATTCTTTAAAA-T-TTAACAAAAATTATTGATTA-TATGATCCATTATTAGTGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_notabilis -----------------------------------AAAAAGGAAACTTTTGGATCATTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTGTAGTTTGAGCTCATCATATGTTTACAGTAGGAATAGATGTAGATACCCGAGCATATTTCACCTCAGCAACTATAATTATTGCTGTGCCTACAGGAATTAAAATTTTTTCTTGACTAGCAACTTTACACGGATCTCAAATCTCATATAGACCATCATTATTATGGGCTTTAGGATTTGTTTTTTTATTCACTGTTGGGGGACTAACGGGAGTAGTTTTAGCTAATTCATCTATTGATATTATTCTTCATGATACTTACTATGTAGTTGCACATTTTCATTATGTTCTTTCTATGGGAGCGGTATTTGCTATTTTAGCTGGATTTATTCAATGATTTCCTTTATTTACGGGAATTTCATTAAATTCAAATTTATTGAAAATTCAATTTTTAATTATATTCATCGGGGTTAATCTAACATTTTTTCCCCAACATTTTTTAGGGTTAAGAGGTATACCCCGCCGATACTCTGATTATCCGGATGCATATACATCTTGAAATGTAATTTCTTCAATTGGATCTACAATTTCATTTATTGGGGTATTAATACTAATTTATATTATTTGAGAAGCTTTCATCATACAACGTTTAGTAATTTTTTCAAACCAAATACCTACTTCAATTGAATGATTCCAAA-----------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTTAAGAAACC{AG}CATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTACGTGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGA{AG}GCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTACATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTTGTATTAATAAAGAAATTTTAATTTATTAAAAAAAATTATATTTTATTGGGGTAATAAAAAGATTAATTAAATTCTTTTATA-A-AAAACAATAATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_obscurus GAATAATCTCCCATATTATTAGACAAGAAAGAGGGAAAAAAGAAACATTTGGTTCATTAGGAATAATTTATGCTATATTAGCTATTGGATTATTAGGATTTGTAGTTTGAGCACATCATATATTTACAGTAGGAATAGATGTTGATACACGAGCATATTTTACTTCAGCAACTATAATTATTGCAGTTCCAACTGGAATTAAAATTTTTTCTTGATTAGCAACTTTACATGGATCTCAAATTTCTTATAGACCCTCTTTATTATGAGCTTTAGGATTTGTATTTTTATTTACAGTAGGAGGTTTAACAGGAGTAGTTTTAGCTAATTCTTCAATTGATATTATTCTTCATGATACTTATTATGTAGTAGCACATTTTCATTATGTTCTTTCTATAGGAGCTGTATTTGCTATTTTAGCCGGATTTATTCAATGATTTCCTTTATTTACAGGAATTTCATTAAACTATAATTTATTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACATTTTTTCCTCAACATTTTCTTGGACTTAGAGGAATACCCCGTCGATATTCAGATTATCCAGATGCATATACCTCTTGAAATGTAATTTCTTCTATTGGATCAACAATTTCTTTTATTGGAGTATTAATATTAATTTATATTATTTGAGAAGCTTTTATTATACAACGTTTAGTAATCTTTTCAAATCAAATACCAACTTCTATTGAATGATTCCAAAAATTCCCTCCTGCAGAAAATCCACCGGCGGCAAGGCCCCGAGGAAACAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCGGCCACCGGCGGAGTTAAGAAACCACATCGTTACAGGCCCGGTACCGTAGC{CT}CTCCG{CT}GAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAGGACTTCAAGACCGACCTGCGTTTCCAAAGTTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGATAATAATTATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTTTGTAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAATATTAATAAAGAAAATTTTATTTATTAAAATTATTTTTATTTTATTGGGGTAATAAATAGATTAATTTAATTCTTTTTTT-T-AATACAATAATTATTGACTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_pilosus GTATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAGGGAAACCTTTGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTGTAGTCTGAGCTCACCATATATTTACTGTTGGAATAGATGTGGATACTCGAGCATATTTTACTTCAGCAACCATAATTATTGCAGTTCCCACAGGAATTAAAATTTTTTCTTGATTAGCAACTCTTCATGGATCTCAAATTTCATATAGCCCCTCTCTACTATGAGCCCTGGGGTTTGTATTTTTATTTACAGTAGGGGGATTAACAGGAGTTGTTCTTGCTAATTCTTCAATCGATATTATTCTTCATGATACTTATTATGTAGTAGCCCATTTTCACTATGTTTTATCTATAGGAGCAGTATTTGCTATTTTAGCGGGATTTATTCAATGATTTCCCCTTTTTACGGGAATTTCTTTAAATTCAAATTTACTAAAAATTCAATTTATTATTATATTCATTGGAGTAAATTTAACATTTTTTCCACAACATTTCCTTGGATTAAGAGGTATACCCCGCCGATATTCTGATTATCCAGATGCTTATACTTCATGAAATGTAATCTCTTCTATTGGTTCTACAATTTCATTTATTGGAATCTTAATATTAATTTATATTATTTGAGAGGCATTTATCTCCCAACGTATAGTAATTTTTTCTAATCAAATACCAACTTCTATTGAATGATTTCAAAAATTCCCACCAGCTGAAAGTCCACCGGTGGCAAGGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCTCGCAAGAGCGCGCCGGCCACCGGCGGCGTGAAGAAGCCCCATCGTTACAGGCCCGGTACCGTCGCTCTCCGCGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTGGTCCGTGAGATCGCTCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCGGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCTTACCTTGTCGGTCTGTTCGAGGACACGAACTTGTGCGCCATGTCCTTTAGTTAAAAATAATTTAAGGTTTAACCTGCCCATTGATAGAATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATGAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAAATTTTATTTATTAATTAATATTATATTTTATTGGGGTAATAAAAAGATTAAAAAAATTCTTTTAAA-T-TTTACAAAAATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_puberulus GGATAATTTCTCATATTATTAGACAAGAAAGAGGAAAAAAAGAAACATTTGGATCTTTAGGAATAATTTATGCTATATTAGCAATTGGACTTTTAGGATTTGTTGTATGAGCACACCATATATTTACTGTAGGAATAGATGTAGATACACGAGCATATTTTACTTCAGCTACTATAATTATTGCTGTACCTACAGGAATTAAAATTTTCTCTTGACTAGCAACTTTACATGGATCTCAAATTTCTTATAGACCCTCCTTATTATGAGCATTAGGATTTGTATTTTTATTTACTGTAGGAGGATTAACAGGAGTAGTCTTAGCTAACTCTTCAATTGATATTATTTTACATGATACATATTATGTTGTTGCCCATTTTCATTATGTTCTTTCTATAGGAGCAGTATTTGCTATTTTAGCTGGATTTATCCAATGATTTCCTTTATTCACTGGAATCTCCTTAAATTCAAATTTATTAAAAATTCAATTTGTTATTATATTTATTGGAGTAAATTTAACATTTTTTCCCCAACATTTTCTTGGATTAAGAGGAATACCACGTCGTTACTCTGATTATCCAGATGCTTATACTTCCTGAAATGTAATTTCCTCTATTGGCTCAACAATTTCATTTATTGGAATTTTAATATTAATTTATATCATTTGAGAAGCATTTATCTCCCAACGTATAGTAATTTTCTCTAATCAAATATCTACATCTATTGAATGATTCCAAAA----------------AGTCAACCGGTGGCAAGGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGCAAGAGCGCCCCGGCCACCGGCGGCGTAAAGAAACCCCATCGTTACAGGCCCGGCACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCAC{AC}GAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTGGTCCGTGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCGGCCGTCATGGCCCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTAGTTAAATATAATTTAAGGTCTAACCTGCCCATTGATAAATTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTAATAAAAATTAGAATTTAATTTTTAAGTTAAAAAGCTTAAATAAAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATTTAGAAAATTTTATTTATTAGAAAAAATTTTATTTTATTGGGGTAATAAAAAGATTAAAAAAATTCTTTTTAA-T-TTAACAGTAATTATTGATTA-ATTGATCCATTATTAATGATTAAAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_pubescens GTATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGATCTTTAGGAATAATTTATGCTATATTAGCTATTGGTCTATTAGGATTTGTAGTTTGAGCTCACCATATATTTACTGTTGGAATAGATGTTGATACTCGAGCATATTTTACCTCAGCAACTATAATTATTGCCGTCCCTACAGGAATTAAAATTTTTTCCTGATTAGCAACTCTTCATGGATCTCAAATTTCTTATAGACCATCCTTATTATGAGCTCTTGGTTTTGTATTTTTATTTACCGTAGGAGGATTAACAGGTGTTGTACTTGCTAATTCATCAATTGATATTATTCTTCATGATACTTATTATGTAGTAGCACATTTCCATTATGTTTTATCTATAGGAGCTGTATTTGCTATTTTAGCGGGATTTATTCAATGATTTCCACTTTTTACTGGAATTTCCCTAAATTCAAATTTATTAAAAATTCAATTTATTATTATATTTATTGGGGTAAATTTAACCTTTTTTCCCCAACATTTTCTAGGATTAAGAGGTATACCGCGACGATATTCTGATTATCCAGATGCATATACTTCATGAAATGTTATTTCTTCTATTGGTTCAACAATTTCATTTATTGGAATTTTAATATTAATTTATATTATTTGAGAAGCATTTATTTCTCAACGAATAGTAATTTTTTCTAATCAAATGCCTACTTCTATTGAATGATTCCAAAAATTTCCCCCGGCAGAAAGTCCACCGGAGGCAAGGCCCCGAGGAAGCAGCTCGCCACCAAGGCTGCCCGCAAGAGCGCGCCGGCCACCGGCGGCGTGAAGAAGCCCCATCGTTACAGGCCCGGCACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTCGTCCGTGAGATCGCTCAGGACTTCAAGACGGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCTTACCTGGTCGGTCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTAGTTAAGAATAATTTAAGGTCTAACCTGCCCATTGATTAAATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAGATTTTATTTATTAATTAATTTTATATTTTATTGGGGTAATAAAAAGATTAAATAAATTCTTTAAAA-T-TTAACAAAAATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_rufifrons ------------------------------------------------------------GTATAATTTATGCAATATTAGCTATTGGATTATTAGGATTTGTAGTTTGAGCTCATCATATATTTACAGTTGGAATAGATGTTGATACTCGAGCATATTTTACTTCAGCAACTATAATTATTGCAGTTCCAACTGGAATTAAAATTTTTTCTTGATTAGCAACTTTACATGGATCCCAAATTTCTTACAGACCTTCTTTATTATGAGCCTTAGGATTTGTATTTTTATTTACTGTAGGGGGTTTAACCGGAGTAGTTCTAGCTAATTCATCAATTGATATTATTCTTCATGATACTTATTATGTAGTTGCCCATTTTCATTATGTTCTTTCAATAGGGGCAGTATTTGCAATTTTAGCTGGATTTATTCAATGATTTCCCTTATTTACAGGAATTTCATTAAATTCAAATTTATTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACATTTTTTCCCCAACATTTCTTAGGATTAAGAGGAATACCTCGTCGATATTCTGATTATCCTGATGCATATACTTCTTGAAATGTAATTTCCTCTATTGGATCAACAATCTCATTTATTGGAGTATTAATATTAATTTATATTATTTGAGAAGCTTTTATTATACAACGTTTAGTAATTTTTTCTAATCAAATACCTACTTCAATTGAATGATTCCAAAAATTCCCCCCTGCAGAAAATCCACCGGTGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTTAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTTCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAGGACTTCAAGACCGACTTGCGTTTCCAAAGTTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCTTACCTCGTCGGTCTGTTCGAAGACACCAACTTGTGCGCCATGTCCTTTAGATAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAAGCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAATATTAATAAAGAAATTTTAATTTATTAAATAATTTTATATTTTATTGGGGTAATAAAAAGATTAATTTAATTCTTTTTAA-T-TCAACAATAATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_scalesianus GAATAATTTCTCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGATCACTAGGAATAATTTATGCTATACTAGCTATTGGATTACTAGGGTTTGTTGTATGAGCTCATCATATATTTACAGTTGGTATAGATGTTGATACTCGAGCATACTTTACTTCAGCTACAATAATTATTGCTGTTCCTACTGGAATTAAAATTTTTTCATGATTAGCAACCCTTCATGGATCTCAAATTTCATATAGTCCATCTCTTTTATGAGCTTTAGGGTTTGTATTTCTATTTACAGTTGGGGGTTTAACTGGAGTAGTTTTAGCTAATTCATCAATTGATATTATTCTTCATGATACTTATTATGTTGTAGCTCATTTTCATTATGTTTTATCAATAGGTGCAGTTTTTGCTATTTTAGCTGGATTTATTCAATGATTTCCCCTATTTACAGGAATTTCATTAAATTCTAATTTATTAAAAATTCAATTTATAATTATATTTATTGGAGTAAATTTAACATTTTTTCCTCAACATTTCCTAGGATTAAGAGGTATGCCTCGACGATATTCAGATTACCCTGATGCATACACATCTTGAAATATTATTTCCTCAATTGGCTCTACAATTTCATTTATTGGAATTTTAATATTAATTTATATTATTTGAGAAGCTTTTATTACTCAACGCTTAGTAATTTTTTCTAATCAAATACCAACATCTATCGAATGATTCCAAAAATTTCCCCCGGCCGAAAGTCCACCGGAGGCAAAGCCCCGAGGAAACAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCCGCCACCGGAGGCGTAAAGAAACCACATCGTTACAGGCCCGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAACTTCCGTTCCAACGTTTGGTCCGTGAGATCGCACAGGACTTCAAAACCGACTTGCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACCAACTTGTGCGCGATGTCCTTTTGTTT-ATATAATTTAAGGTCTAACCTGCCCATTGATAAAGTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTTTTAATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATAAAAATAAAAGACGAGAAGACCCTATAGATCTTAATATAA-TTAATTTTAGTATTAATAAAGAAAATTTTATTTATTAAAATAGATTATATTTTATTGGGGTAATAAAAAGATTAGATAAATTCTTTTAAA-T-TAAACAAAAATTATTGGTTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAGAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGAAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGT------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_sinuatipes GAATAATTTCCCATATTATTAGACAGGAAAGAGGAAAAAGGGAAACTTTTGGATCCTTAGGAATAATTTATGCTATACTAGCTATTGGATTATTGGGATTTGTTGTTTGAGCTCATCATATATTTACAGTTGGAATAGACGTTGATACCCGGGCATATTTTACTTCTGCGACTATAATTATTGCAGTACCAACTGGAATTAAAATTTTCTCTTGATTAGCGACTTTACATGGATCTCAAATTTCCTATAGACCCTCTTTACTATGAGCTTTAGGATTTGTTTTTTTATTTACAGTGGGGGGATTAACTGGTGTAGTTCTAGCTAATTCTTCTATTGATATTATTTTACATGATACTTACTATGTTGTGGCCCATTTTCATTATGTTTTATCAATAGGGGCAGTATTTGCTATTTTAGCTGGTTTTATTCAATGATTTCCTTTATTTACCGGAATTTCTTTAAACTCTAATTTATTAAAAATTCAATTTATTATTATATTTATTGGTGTAAATTTAACCTTTTTCCCCCAACATTTTTTAGGTCTAAGAGGTATACCCCGACGATACTCCGATTACCC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACCAAGGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTTAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTGCC{GT}TTCCAACGTTTGGTACGTGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGTAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTTGTATTAATAAAGAAATTTTAATTTATTAAAAAAAATTATATTTTATTGGGGTAATAAAAAGATTAATTAAATTCTTTTATA-A-AAAACAATAATTATTGATTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_submuticus GTATAATTTCCCATATTATTAGACAAGAAAGAGGGAAAAAGGAAACTTTTGGATCTTTAGGAATAATTTATGCTATACTAGCAATTGGATTACTAGGATTTGTAGTTTGAGCTCACCATATATTTACTGTAGGAATAGATGTTGATACCCGAGCATATTTTACTTCAGCAACAATAATTATTGCAGTTCCAACAGGAATTAAAATTTTCTCTTGATTAGCTACTTTACATGGATCTCAAATTTCCTATAGACCCTCATTATTATGAGCTTTAGGATTTGTATTTTTATTTACTGTAGGGGGATTAACAGGAGTTGTATTAGCAAATTCATCAATTGATATTATTCTTCATGATACTTACTATGTTGTTGCACATTTTCATTACGTTCTTTCTATAGGAGCAGTATTTGCTATTTTAGCTGGATTTATTCAATGATTCCCTTTATTTACAGGAATTTCATTAAATTCAAATTTATTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACATTTTTTCCCCAACATTTTTTAGGATTAAGAGGAATACCACGTCGATATTCAGATTACCCTGATGCTTATACTTCATGAAATGTAATTTCTTCAATTGGATCAACAATTTCTTTTATTGGGGTATTAATATTAATTTATATTATTTGAGAAGCTTTTATTATACAACGTTTAGTAATTTTTTCTAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTTCCCCCAGCAGAAAATCCACCGGTGGCAAAGCCCCGAGGAAGCAACTCGCCACAAAAGCCGCCCGCAAGAGCGCGCCAGCCACCGGCGGAGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTGCCTTTCCAACGTTTGGTTCGTGAGATCGCGCAGGATTTCAAGACCGACCTGCGTTTCCAGAGTTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGATAATTATAATTTAAGGTCTAACCTGCCCATTGATAA-GTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAATAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTATAGTATTAATAAAGAAAATTTAATTTATTATAAAAATTTATATTTTATTGGGGTAATAAAAAGATTAATTAAATTCTTTTTTA-T-TAAACAATTATTATTGGTTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAACCCTTTAACAAGTACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_tessellatus GAATAATTTCCCATATTATTAGACAAGAAAGAGGGAAAAGGGAAACTTTCGGATCTTTGGGGATAATTTATGCTATATTAGCTATTGGTTTACTAGGGTTTGTAGTATGAGCTCATCATATATTTACTGTAGGAATAGACGTGGATACTCGAGCATATTTTACCTCAGCAACTATAATTATTGCTGTACCAACGGGAATTAAGATTTTTTCTTGATTGGCTACTCTTCATGGCTCCCAAATTTCATATAGACCCTCCTTATTATGAGCTTTAGGGTTTGTATTTTTATTTACAGTAGGGGGATTAACAGGAGTTGTTCTTGCTAATTCTTCGATTGATATTATTCTTCATGATACTTATTACGTAGTTGCACATTTCCACTATGTTCTGTCTATAGGAGCTGTATTTGCTATTTTAGCTGGATTTATCCAATGATTTCCACTTTTTACAGGAATCTCTTTAAACTCTAATTTATTAAAAATTCAATTTATTATTATATTTATTGGGGTAAATTTAACATTTTTTCCTCAACATTTTCTAGGATTAAGAGGAATACCCCGCCGATATTCTGATTATCCAGATGCATATACATCATGAAATGTAATTTCTTCTATTGGATCAACAATTTCATTTATTGGAATTTTAATATTAATTTATATTATTTGAGAGGCATTTATTTCGCAACGAATAGTAATTTTTTCCAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTCCCTCCGGCA---AGTCCACCGG{AG}GGCAAGGCCCCGAGGAA{AG}CAGCTCGCCACCAAGGCGGCCCGCAAGAGCGCGCCGGCCACCGGCGGCGTGAAGAAGCCCCATCGTTACAGGCCCGG{CT}ACCGTCGCCCTCCGCGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCT{CG}ATCCGCAAGCTTCCGTTCCA{AG}CGTCTCGTCCG{CT}GAGATCGC{CT}CAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCTTAC{CT}TGGT{AC}GGTCTGTTCGAGGACACCAAC{CT}TGTGCGCCATGTCCTTTTGTTAAAAATAATTTAAGGTCTAACCTGCCCATTGATTAAATTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTTATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAATATTAATAAAGTAAATTTTATTTATTAATAAATTTTATATTTTATTGGGGTAATATAAAGATTAAATTAATTCTTTAAAA-T-TTAACAAAAATTATTGGTTA-TATGATCCATTATTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_tristis --------------------------------------------------------------------TATGCTATACTAGCTATTGGATTATTAGGATTCGTTGTTTGAGCCCATCATATATTTACAGTTGGAATAGATGTAGATACCCGGGCATATTTTACTTCAGCAACTATAATTATTGCTGTTCCAACTGGAATTAAAATTTTTTCTTGATTAGCAACTTTACACGGATCTCAAATTTCATATAGCCCCTCTTTATTATGAGCTTTAGGATTTGTTTTTTTATTTACAGTAGGGGGATTAACTGGAGTAGTTCTAGCTAATTCTTCTATTGATATTATCTTGCATGATACTTATTATGTTGTAGCTCATTTTCATTATGTTTTATCAATAGGAGCGGTATTTGCTATTTTAGCCGGTTTTATTCAATGATTTCCTTTATTTACTGGAATTTCTTTAAACTCTAATTTATTAAAAATTCAATTTATTATTATATTTATTGGTGTAAATTTAACTTTTTTCCCACAACATTTTTTAGGTCTTAGAGGTATACCCCGACGATACTCTGATTACCCTGATGCCTATACATCTTGAAATGTAATCTCCTCAATTGGATCAACAATCTCATTCATTGGGGTTTTAATATTAATTTATATTATTTGAGAAGCTTTTATTTCTCAACGTATAGTAATTTTTTCTAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTTCCACCAGCTGAAAGTCCACCGGAGGCAAGGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCTCGCAAGAGCGCGCCCGCCACCGGCGGCGTGAAGAAACCCCATCGTTACAGGCCCGGCACCGTGGCCCTCCGCGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGTCTGGTCCGCGAGATCGCTCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAGGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAGGACACCAACTTGTGCGCCATGTCCTTTAGTAA-ATATAATTTAAGGTCTAACCTGCCCATTGATAAAGTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTAATGAGAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAAATTTTATTTATTAATTTAATTTATATTTTATTGGGGTAATAAAAAGATTTAATAAATTCTTTTAAA-T-AAAACAAAGATTATTGATTA-TATGATCCATTATTAATGATTAAAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCTAA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGGGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hydroporus_vagepictus GTATAATTTCCCATATTATTAGTCAAGAAAGAGGGAAAAGGGAAACTTTTGGGTCTTTAGGAATAATTTATGCTATACTAGCTATCGGCCTATTAGGATTTGTTGTCTGAGCACATCATATATTTACAGTCGGGATAGACGTTGATACCCGGGCATATTTTACCTCAGCAACTATAATTATTGCTGTACCAACTGGAATTAAAATTTTCTCTTGATTAGCAACTTTACATGGGTCCCAAATCTCTTATAGACCTTCTTTATTATGAGCTTTAGGGTTTGTATTCCTATTTACAGTTGGGGGTTTAACGGGAGTAGTTTTAGCTAATTCTTCTATTGATATTATTTTACATGATACTTATTATGTTGTTGCCCATTTTCATTATGTTTTATCTATAGGGGCCGTATTCGCTATTTTAGCCGGCTTTATTCAATGATTTCCTTTATTTACCGGAATTTCCTTAAATTCTAATTTACTAAAAATTCAATTTATTATTATATTTATTGGTGTAAATTTAACATTTTTTCCCCAACATTTTTTAGGACTAAGAGGTATACCCCGACGATATTCTGATTACCCAGATGCTTATACTTCATGAAATGTAATCTCCTCAATTGGGTCAACAATTTCATTTATTGGAGTTTTAATATTAATTTACATTATTTGAGAAGCTTTTATTTCTCAACGTATAGTAATTTTTTCTAACCAAATACCCACCTCTATTGAATGATTCCAAAAATTTCCTCCTGCAGAAAGTCTACCGGAGGCAAGGCCCCGAGAAAACAGCTCGCCACTAAGGCCGCCCGCAAGAGCGCGCCCGCCACCGGCGGTGTCAAGAAGCCCCATCGTTACAGGCCGGGAACGGTCGCTCTTCGCGAGATCCGTCGCTACCAGAAGAGCACGGAACTGCTGATCCGCAAGCTGCCGTTCCAGCGCCTCGTGCGCGAGATCGCACAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCTCTGCAGGAGGCCAGCGAGGCATATCTCGTCGGTCTTTTCGAGGACACCAATCTGTGCGCCATGTCCTTTAGTAATATATAATTTGAGGTCTAACCTGCCCATTGATAAAGTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTTAATAAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATAAATAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTTTAGTATTAATAAAGAAAATTTTATTTATTAATTTAGTTTATATTTTATTGGGGTAATAAAAAGATTAAATAAATTCTTTTATA-T-AAAACAAAGATTATTGATTA-TATGATCCATTATTAATGATTAAAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGGGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Hyphydrus_ovatus GGATAATTTCCCATATTATTAGACAGGAAAGAGGAAAAAAGGAAACTTTTGGTTCATTGGGAATAATTTATGCTATACTAGCAATTGGATTATTAGGGTTTGTTGTATGAGCTCATCATATATTTACAGTAGGAATAGACGTTGATACTCGAGCATATTTTACCTCAGCAACTATAATTATCGCAGTTCCAACAGGAATTAAAATTTTCTCTTGATTAGCTACCCTTCACGGATCTCAAATTTCTTATAGACCTTCTCTTTTATGGGCATTAGGGTTTGTATTTTTATTTACAGTAGGAGGATTAACCGGAGTAGTCCTTGCAAATTCATCTATTGATATTATTCTCCATGATACATATTATGTAGTGGCTCATTTTCATTATGTTCTGTCAATAGGGGCAGTATTTGCCATTTTAGCAGGATTTATTCAATGATTCCCATTATTTACGGGCCTATCTTTAAATTCTAAATTATTAAAAATTCATTTTATTATTATATTTTTAGGAGTAAATTTAACATTTTTTCCTCAACATTTTCTAGGATTAAGAGGAATACCTCGACGTTACTCAGACTATCCTGATGCTTATACATCATGAAATGTAATTTCCTCAATAGGATCTACTATATCATTTATTGGAGTATTAATATTTATTTATATTATTTGAGAAGCCTTTATATCCCAACGGACTGTTTTATTTTCCAATCAAATACCTACTTCAATTGAATGACTTCAAAATTTCCCCCCGGCTGAAAATCCACCGGTGGCAAGGCCCCGCGCAAACAACTCGCCACCAAGGCCGCCCGCAAGAGTGCGCCCGCCACCGGCGGAGTCAAGAAGCCGCATCGTTACAGGCCGGGCACGGTCGCTCTCCGCGAGATCCGTCGCTACCAGAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCGTTCCAACGGTTGGTGCGCGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCGGCCGTCATGGCCCTGCAGGAAGCCAGCGAGGCTTACCTCGTCGGTCTGTTCGAAGACACTAACTTGTGCGCCATGTCCTTTAGGATA--ATAATTTAAGGTCTAATCTGCCCACTGATTA-ATTAAATGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTGAAAGCTTGTATGAATGATTGGACGAGATAAAATCTGTCTCTTAATTAAAATTAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTTTATGAAAGACGAGAAGACCCTATAGATCTTAATTTATATATGTTATAATTTTTATAAAGATTATTTTATTATTTATAATTTTATAAATTTTATTGGGGTAATAAAAAGATTAGAGTAATTCTTTTTTAATTTTTACAATTATTATTGATTA-TAAGATCCTCTATTAGTGATTAAAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCATATCGATAAAAAAGATTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCAATTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACATTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACACAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGT------CCGCGCGCTCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTACAGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGTTCCAATAGCGTA Laccornellus_copelatoides GGATAATCTCTCACATTATTAGCCAAGAAAGAGGAAAAAAAGAAACTTTTGGATCTTTAGGTATAATTTATGCTATACTAGCTATTGGTCTATTAGGATTTGTTGTATGAGCACACCATATATTCACTGTTGGTATGGATGTTGATACTCGGGCATATTTCACCTCAGCAACTATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTTCCTGGTTAGCAACTCTTCATGGATCACAAATTTCTTATAGACCATCTCTTTTATGAGCCTTAGGGTTTGTCTTTTTATTTACTGTCGGGGGATTAACCGGAGTTGTTCTAGCTAATTCTTCTATTGATATTATTCTTCATGATACTTACTATGTAGTTGCCCATTTTCACTACGTATTATCTATAGGGGCAGTATTCGCAATTTTAGCTGGGTTTATTCAATGATTCCCTCTTTTTACAGGATTAACGTTAAATTCTAACTTACTAAAAATACAATTCATTGTTATATTTATAGGAGTAAATTTAACCTTTTTCCCTCAACATTTTCTAGGGTTAAGAGGAATACCCCGACGTTATTCTGATTATCCAGATGCCTATACCTCATGAAACGTCATCTCCTCTATTGGTTCAACAATCTCCTTTATTGGAGTCTTAATACTTATTTATATTATCTGAGAAGCATTTATCTCCCAACGTATTGTAATTTTTTCTAACCAAATACCCACTTCTATTGAATGATTCCAAAAATTCCCCCCAGCGGAAAGTCCACCGGAGGCAAGGCCCCGAGGAAACAGCTCGCGACCAAGGCCGCCCGCAAGAGCGCGCCCGCCACCGGCGGCGTAAAGAAACCCCATCGTTACAGGCCCGGCACGGTCGCCCTCCGCGAGATCCGTCGTTACCAGAAGAGCACCGAGCTCCTCATCCGCAAGCTCCCGTTCCAACGTCTCGTCCGCGAGATCGCGCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTAATGGCCCTGCAGGAAGCCAGCGAGGCTTACCTGGTCGGTCTGTTCGAGGACACGAACTTGTGCGCCATGTCCTTTAGA-A--TAGAATTTAAGGTCTGACCTGCCCACTGAAAATTTTTAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAAGGGTTGGACGAGATAAAGACTGTCTCTGAATAAATAGTAGAATTTAATTTTTAAGTTAAAAAGCTTAAATATTATTAAAAGACGAGAAGACCCTATAGATCTTTATAGTTAAT--AATTAATTTTATTTATGATTTTTTTATTTATTAGTAGTTAAACTATTTTATTGGGGTAATAGAAAGATTTAAATAATTCTTTTTTAAGGAAAACAATAATAATTGAAAA-TTTGATCCATTATTAGTGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCATATCGATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACGAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Neoporus_arizonicus GGATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAAGAAACTTTTGGATCACTAGGTATAATTTATGCTATACTAGCTATTGGTCTTCTTGGATTTGTTGTATGAGCCCATCATATGTTTACAGTTGGAATAGATGTGGATACACGAGCATATTTCACTTCTGCTACTATAATTATTGCTGTTCCAACAGGAATTAAAATTTTTTCTTGACTTGCAACCCTTCACGGATCCCAAATCTCATATAGTCCCTCCTTACTTTGAGCTTTAGGATTTGTATTCTTATTTACTGTAGGGGGACTAACAGGAGTGGTCCTAGCTAATTCCTCAATTGATATTATTTTACATGATACCTATTATGTTGTTGCCCATTTCCACTATGTTTTATCAATAGGAGCTGTCTTCGCTATTTTAGCGGGATTCATTCAATGATTCCCATTATTTACAGGTATTTCTTTAAATAATCAATTATTAAAAACTCAATTTGTAATTATATTTATTGGTGTAAATTTAACATTTTTCCCTCAACATTTTCTTGGATTAAGAGGAATACCACGACGTTATTCAGATTATCCTGATGCATACACTTCATGAAATATTATTTCTTCTATTGGATCCACAATTTCTTTTATTGGAGTGTTAATATTTATTTATATTATTTGAGAAGCTTTTGTATCACAACGAATAGTAATTTTTTCAAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTCCCACCAGCTGAAAATCCACCGGAGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGTAAGAGCGCGCCGGCAACCGGAGGCGTCAAGAAGCCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAACTCCTGATCCGCAAACTTCCGTTCCAACGGTTGGTTCGCGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCGGCCGTCATGGCCCTGCAGGAAGCCAGCGAGGCCTACCTCGTCGGTCTGTTCGAAGATACCAACTTGTGCGCCATGTCCTTTAGGTTT--ATTATTTAAGGTTTAACCTGCCCATTGAAAATTTTAAAAGGCCGCAGTATTTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTTTTGGTTAAAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTAAGGTAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTTTTTAAAATATTAATTAGGATTAATTAATTTATTATAAGAATTTATATTTTATTGGGGTAATAGAAAGATTAAAAAAATTCTTTTTTT-T-AATATATTGATAATTAGTTT-TTTGATCCATTATTAATGATAATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCATATCGATAAAAAAGATTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCCGA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGAACAAAACCAATCGGCGGCGGGCGCGT------CCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Neoporus_undulatus GAATAATTTCCCATATTATTAGTCAAGAAAGAGGAAAAAAGGAAACTTTTGGATCATTGGGAATAATCTACGCTATACTTGCTATTGGACTTTTAGGATTTGTAGTATGGGCTCATCATATATTCACAGTAGGAATAGATGTTGATACACGAGCATATTTCACTTCAGCAACAATAATTATTGCTGTTCCTACAGGAATCAAAATTTTTTCATGACTTGCAACCCTTCATGGATCTCAAATTTCTTATAGACCATCTCTAATATGAGCTTTAGGATTTGTATTTTTATTTACCGTTGGAGGTTTAACTGGAGTAGTTTTAGCTAACTCCTCTATTGATATTATTCTTCATGATACATATTATGTTGTTGCCCATTTTCACTATGTTCTTTCAATAGGGGCAGTATTTGCTATTCTAGCAGGTTTTATTCAATGATTTCCATTATTTACAGGAATTTCACTAAACAATCAATTATTAAAAATTCAATTTGGAATTATATTCATTGGAGTAAATTTAACATTCTTTCCTCAACATTTTCTAGGTTTAAGAGGAATGCCTCGACGATACTCAGATTACCCAGATGCATATACTTCTTGAAATATTATATCCTCTATTGGATCAACAATTTCCTTTATCGGAGTACTAATATTTATTTATATTATTTGAGAAGCTTTTGTATCTCAACGAATAGTAATTTTCTCAAATCAAATACCTACTTCTATTGAA---------------------------AATCCACCGGAGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGTAAGAGCGCGCCGGCAACCGGCGGCGTCAAGAAGCCGCATCGTTACAGGCCCGGTACCGTGGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGCACCGAACTTCTGATCCGCAAACTTCCCTTCCAACGGTTGGTTCGCGAGATCGCCCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCGGCCGTCATGGCCCTGCAGGAAGCCAGCGAGGCCTACCTCGTCGGCCTGTTCGAAGATACCAACTTGTGCGCCATGTCCTTTAGATTTC-ATAATTTAAGGTCTAACCTGCCCATTGAAAATTTTAAAAGGCCGCAGTATTTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTTTTATTAAAAATTAGAATTTAATTTTTAAGTTAAAAAGCTTACATTTAAGTAAAAGACGAGAAGACCCTATAGATCTTTATAAAA-TTTTTTAGGATATTAATTAAGATTAGTTAATTTATTATAAAAAATTTTATTTTATTGGGGTAATAAAAAGATTAAAAAAATTCTTTTTTA-T-GAAATATAAATAAATAGATT-TTTGATCCATTATTAATGATAATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCATATCGATAAAAAAGATTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCCGA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGAACAAAACCAATCGGCGGCGGGCGCGT------TCGCGCGTCCGTT----CGCCGCTCGACCTGGTGACTCTGAATAACTTTCCGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Sanfilippodytes_terminalis GGATAATTTCCCATATTATTAGCCAAGAAAGAGGGAAAAGGGAAACATTTGGGTCATTAGGAATAATTTACGCAATATTAGCAATTGGATTATTAGGATTCGTAGTGTGAGCTCATCATATATTTACCGTAGGAATAGATGTAGATACTCGAGCTTATTTTACTTCAGCTACTATAATTATTGCAGTACCCACAGGAATTAAAATTTTTTCTTGATTAGCAACCTTACATGGATCTCAAATTTCATATAGACCCTCACTATTATGGGCTTTAGGGTTTGTATTCTTATTTACTGTAGGAGGATTGACAGGGGTAGTTTTAGCTAACTCTTCTATTGATATTATTCTTCATGATACATATTATGTTGTTGCTCATTTTCATTATGTATTATCTATAGGGGCAGTATTTGCAATTTTAGCGGGCTTTATCCAATGATTTCCATTATTTACGGGAATTTCTCTAAATTCTCAATTATTAAAAATTCAATTTATTATTATATTTATCGGGGTAAACTTAACATTTTTCCCCCAACATTTTTTGGGATTAAGAGGGATGCCCCGACGATATTCAGACTACCCTGATGCTTATACATCTTGAAATGTAATTTCATCTATTGGCTCGACAATTTCTTTTATTGGAGTATTAATATTAATTTATATTATTTGAGAGGCTCTTATTTCACAACGATTAGTAATCTTCTCTAATCAAATACCAACCTCTATTGAATGATTCCAAAAATTCCCTCCGGCAGAAAGTCCACCGGAGGCAAGGCCCCGAGGAAACAACTCGCCACCAAGGCCGCACGTAAGAGCGCGCCTGCTACCGGCGGAGTCAAGAAGCCCCATAGGTACAGGCCCGGTACCGTCGCTCTCCGTGAGATCCGTCGTTACCAGAAGAGTACCGAGCTCCTGATCCGCAAGCTGCCGTTCCAACGGTTGGTGCGTGAGATCGCCCAGGACTTCAAGACCGACCTTCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAAGAAGCCAGCGAGGCCTACCTCGTCGGTCTCTTCGAAGACACCAACTTGTGCGCCATGTCCTTTAGATAA--ATAATTTAAGGTCTAACCTGCCCATTGAAATTTTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAATAACTGTCTCATTATAATTTATAGAATTTAATTTTTGAGTTAAAAAGCTTAAATATTAGTAAAAGACGAGAAGACCCTATAGATCTTTATAAAA-ATTTTTTTAATATTAATAATGATTTTTTAATTTATTATTATTATTTTTATTTTATTGGGGTAATAAAGAGATTTAATTAATTCTTTTTTT-ATAAAACAAAAATTTTTGATTAGTATGATCCATAATTTATGATTAAAAGTTTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCATATTGATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCACA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Suphrodytes_dorsalis GTATAATTTCCCATATTATTAGTCAAGAAAGAGGTAAAAAGGAAACTTTTGGGTCATTAGGGATAATTTATGCCATATTAGCTATTGGTCTTTTAGGATTTGTTGTTTGAGCCCATCATATATTTACAGTTGGAATAGATGTTGATACTCGAGCATACTTTACTTCAGCTACAATAATTATTGCTGTCCCAACTGGAATTAAAATTTTTTCATGGTTAGCAACTCTTCATGGATCTCAAATTTCTTATAGTCCTTCATTATTATGAGCTTTAGGATTTGTATTTTTATTTACTGTAGGAGGACTTACCGGAGTAGTTCTTGCTAATTCATCTATTGATATTATTCTACATGATACTTATTATGTTGTAGCCCATTTTCACTACGTTTTATCTATAGGAGCTGTATTTGCTATTTTAGCAGGATTTATTCAATGATTTCCTTTATTTACTGGAATTTCTCTAAACTCTAATTTATTAAAAATTCAATTTGTAATTATATTTATTGGAGTAAATTTAACATTCTTCCCTCAACATTTTTTAGGATTAAGAGGAATACCACGTCGTTATTCAGATTATCCAGATGCATATACTTCATGAAATGTAATTTCATCAATTGGTTCAACAATTTCATTTATTGGAGTATTAATATTAATTTATATTATTTGAGAAGCATTTATTTCTCAACGTTTAGTAATTTTTTCTAATCAAATACCTACTTCTATTGAATGATTCCAAAAATTCCCACCAGCAGAAAATCTACCGGTGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGTAAGAGCGCCCCGGCCACCGGCGGCGTCAAGAAACCACATCGTTACAGGCCCGGCACCGTAGCTCTCCGTGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTACCTTTCCAACGTCTGGTCCGTGAGATCGCTCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAAGCCAGCGAGGCATACCTCGTCGGTCTGTTCGAAGACACAAACTTGTGCGCCATGTCCTTTAGATAAATATAATTTAAGGTCTAACCTGCCCATTGACTAAGTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTAAATAATAAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATTTAAAAGACGAGAAGACCCTATAGATCTTTATATAAATTTTTTTTAGTATTAATTAAGAAAATTTTATTTATTATTAATATTTATATTTTATTGGGGTAATAAAAAGATTAAAAAAATTCTTTTTAA-T-TAAACAATAATTATTGATTA-TATGATCCATTTTTAATGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAGAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA Suphrodytes_figuratus GAATAATTTCCCATATTATTAGACAAGAAAGAGGAAAAAAGGAAACTTTTGGTTCATTAGGAATAATTTATGCTATATTAGCTATTGGTCTTTTAGGATTTGTAGTATGAGCTCATCATATATTTACAGTAGGGATAGATGTTGATACCCGAGCATATTTCACTTCAGCTACAATAATTATTGCTGTTCCAACGGGAATTAAAATTTTTTCATGATTAGCAACTCTTCATGGATCTCAAATTTCATATAGACCTTCTCTATTATGAGCTTTAGGATTTGTATTTTTATTTACTGTTGGGGGATTAACTGGAGTAGTTCTTGCTAACTCATCTATTGATATCATTTTACATGATACTTATTATGTTGTTGCCCATTTTCACTATGTTTTATCTATAGGAGCTGTTTTTGCTATTTTAGCAGGATTTATTCAATGGTTTCCTTTATTTACTGGAATTTCTCTAAATTCTAACTTATTAAAAATTCAATTTTTAATTATATTTATTGGAGTAAATTTAACATTCTTCCCTCAACATTTTTTAGGATTAAGAGGAATACCCCGTCGTTATTCAGACTATCCAGATGCATATACTTCTTGAAATATTATCTCATCAATTGGTTCAACTATTTCATTTATTGGAGTATTAATATTAATTTATATTATTTGAGAAGCATTTATTTCTCAACGTTTAGTAATTTTTTCTAATCAAATACCCACCTCTATTGAATGATTCCAAAAATTCCCACCAGCAGAAAATCTACCGGTGGCAAAGCCCCGAGGAAACAGCTCGCCACCAAGGCCGCCCGTAAGAGCGCGCCGGCCACCGGCGGTGTCAAGAAACCACATCGTTACAGGCCCGGTACCGTAGCTCTCCGCGAGATCCGTCGTTACCAAAAGAGCACCGAGCTCCTGATCCGCAAGCTTCCTTTCCAACGTTTGGTCCGCGAGATCGCGCAGGACTTCAAGACCGACCTGCGTTTCCAGAGCTCCGCCGTCATGGCCCTGCAGGAGGCCAGCGAGGCTTACCTCGTCGGTCTGTTCGAAGACACAAACTTGTGCGCCATGTCCTTTAGATAAATATAATTTAAGGTCTAACCTGCCCATTGACTTAGTTAAAAGGCCGCAGTAATTTGACTGTGCAAAGGTAGCATAATCATTAGTTTTTTAATTAAAAGCTTGTATGAATGGTTGGACGAGATAAAATCTGTCTCTAAATAATTAATAGAATTTAATTTTTAAGTTAAAAAGCTTAAATTTATTTAAAAGACGAGAAGACCCTATAGATCTTTATATAA-TTATTTTTAGTATTAATTAAGAAAATTTTATTTATTAATAATATTTATATTTTATTGGGGTAATAAGAAGATTAAAAAAATTCTTTTTAA-T-TAAACAATAATTATTGATTA-TATGATCCATTTTTAGTGATTATAAGATTAAGTTACCTTAGGGATAACAGCGTAATTTTTTTAAAGAGTTCTTATCAATAAAAAAGTTTGCGATTGTCTCAAAGATTAAGCCATGCATGTCTCAGTACAAGCCGCA-TTAAGGTGAAACCGCGAAAGGCTCATTAAATCAGTTATGGTTCCTTAGATCGTACCCACACTTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCAAACAGAGCTCCGACCGGAGACGGGAGGAGTGCTTTTATTAGATCAAAACCAATCGGCGGCGGGCGCGC------TCGCGCGTCCGTT----CGCCGCTCAACCTGGTGACTCTGAATAACTTTCGGCTGATCGCACGGTCTCGCACCGGCGACGCATCTTTCAAATGTCTGCCTTATCAACTGTCGATGGTAGGTTCTGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA ; END; BEGIN TREES; TITLE Bergsten_et_al; LINK TAXA = Taxa1; TRANSLATE 1 Hovahydrus_minutissimus, 2 Sanfilippodytes_terminalis, 3 Canthyporus_hottentotus, 4 Laccornellus_copelatoides, 5 Andex_insignis, 6 Hyphydrus_ovatus, 7 Heterosternuta_pulcher, 8 Neoporus_arizonicus, 9 Neoporus_undulatus, 10 Hydrocolus_sahlbergi, 11 Suphrodytes_figuratus, 12 Suphrodytes_dorsalis, 13 Hydroporus_scalesianus, 14 Hydroporus_vagepictus, 15 Hydroporus_longiusculus, 16 Hydroporus_carri, 17 Hydroporus_nigellus, 18 Hydroporus_niger, 19 Hydroporus_notabilis, 20 Hydroporus_appalachius, 21 Hydroporus_mannerheimi, 22 Hydroporus_neglectus, 23 Hydroporus_sinuatipes, 24 Hydroporus_obscurus, 25 Hydroporus_erythrocephalus, 26 Hydroporus_puberulus, 27 Hydroporus_axillaris, 28 Hydroporus_fortis, 29 Hydroporus_kraatzii, 30 Hydroporus_memnonius, 31 Hydroporus_rufifrons, 32 Hydroporus_tristis, 33 Hydroporus_nigrita, 34 Hydroporus_lapponum, 35 Hydroporus_submuticus, 36 Hydroporus_pilosus, 37 Hydroporus_pubescens, 38 Hydroporus_tessellatus; TREE con_50_majrule = [&R] (1:0.2920044492297025,5:0.1929437626521394,(((((2:0.3068774289164066,(7:0.2119240673926005,(8:0.1630722817104326,9:0.1786124355969183):0.08537070375777354):0.2075952695646153):0.06311522162856982,(((11:0.06715135998282754,12:0.0683712157163489):0.1280016524512169,((((((15:0.001361292232392445,16:0.00155958994011875):0.07373334226486773,17:0.05195425254806695):0.0404603524612786,(34:0.01696839843165186,35:0.01087850771416529):0.04971378088563011):0.02907108220405452,(20:0.02007977788518522,21:0.01605713555812074):0.06424000462955425):0.01526348491280463,(((18:0.03680358018164587,19:0.05508200561254508):0.01880212733864834,23:0.1027762234581039):0.0434269709599578,((24:0.09405469055366923,25:0.124665544293042):0.027376526377901,31:0.07895119500030166):0.02641211430507596):0.02361188919753865):0.02062765234915813,(27:0.09681859432713669,28:0.09901032066068585):0.03306697688833357):0.06282870796148671):0.02831458528381389,((13:0.1388416328058852,22:0.08738572375442441):0.1007229129702948,((14:0.1589689473615667,32:0.08273890171154304):0.09558401346918691,(26:0.1929386517439422,((29:0.05915837590397181,30:0.08149596698555038):0.1184560191127728,(((33:0.0663284753582607,38:0.07421394200776782):0.03118636859478836,37:0.06377053726912615):0.03334308268822784,36:0.09073087807635442):0.06563803828113376):0.02780552155872584):0.02185829632360996):0.04721418910865668):0.04280913880234331):0.04779203918765548):0.02249078575156959,10:0.2228822243173006):0.05307610588321862,(3:0.376904192954566,4:0.4039452715911125):0.147767389231616):0.1984953137530988,6:0.330870420600962):0.1082190957937197); END;