#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 26, 2021; 21:02 GMT TreeBASE (cc) 1994-2008 Study reference: Chung K., Peng C., Downie S., Spalik K., & Schaal B. 2005. Molecular systematics of the trans-Pacific alpine genus Oreomyrrhis (Apiaceae)- phylogenetic affinities and biogeography implications. American Journal of Botany, null. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1418] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=51; TAXLABELS Aegopodium_podagraria Aethusa_cynapium Anethum_graveolens Angelica_archangelica Anthriscus_cerefolium Apium_graveolens Arracacia_brandegei Arracacia_nelsonii Carlesia_sinensis Chaerophyllum_temulum Coaxana_purpurea Conium_maculatum Coriandrum_sativum Coulterophytum_laxum Crithmum_maritimum Daucus_carota Enantiophylla_heydeana Endressia_castellana Erigenia_bulbosa Heracleum_lanatum Laserpitium_siler Lilaeopsis_occidentalis Lomatium_dasycarpum Myrrhidendron_donnell_smithii Myrrhis_odorata Neogoezia_minor Oreomyrrhis_andicola Oreomyrrhis_borneensis Oreomyrrhis_colensoi Oreomyrrhis_eriopoda Oreomyrrhis_hookeri Oreomyrrhis_papuana Oreomyrrhis_taiwaniana Orlaya_grandiflora Orlaya_kochii Orogenia_fusiformis Orogenia_linearifolia Pastinaca_sativa Pimpinella_peregrina Pimpinella_saxifraga Pleurospermum_foetens Prionosciadium_turneri Pseudorlaya_pumila Rhodosciadium_argutum Scandix_pecten_veneris Selinum_candollii Seseli_montanum Smyrnium_olusatrum Tetrataenium_rigens Torilis_nodosa Zizia_aurea ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=57; TAXLABELS Anthriscus_cerefolium Anthriscus_sylvestris Athamanta_cretensis Chaerophyllum_aromaticum Chaerophyllum_astrantiae Chaerophyllum_atlanticum Chaerophyllum_aureum Chaerophyllum_azoricum Chaerophyllum_bulbosum Chaerophyllum_byzantinum Chaerophyllum_crinitum Chaerophyllum_elegans Chaerophyllum_khorossanicum Chaerophyllum_libanoticum Chaerophyllum_macropodum Chaerophyllum_macrospermum Chaerophyllum_magellense Chaerophyllum_meyeri Chaerophyllum_nodosum Chaerophyllum_procumbens Chaerophyllum_tainturieri Chaerophyllum_temulentum Chaerophyllum_villarsii Conopodium_ramosum Kozlovia_paleacea Myrrhis_odorata Oreomyrrhis_andicola_1467_1 Oreomyrrhis_andicola_1479_1 Oreomyrrhis_andicola_1488_1 Oreomyrrhis_argentea Oreomyrrhis_azoreallacea Oreomyrrhis_borneensis Oreomyrrhis_brevipes Oreomyrrhis_ciliata_1555_1 Oreomyrrhis_ciliata_1588_1 Oreomyrrhis_ciliata_1602_1 Oreomyrrhis_ciliata_1614_1 Oreomyrrhis_colensoi_1641_2 Oreomyrrhis_colensoi_1643_2 Oreomyrrhis_eriopoda_1554_1 Oreomyrrhis_eriopoda_1576_1 Oreomyrrhis_eriopoda_1579_1 Oreomyrrhis_eriopoda_1612_1 Oreomyrrhis_gunnii Oreomyrrhis_involu Oreomyrrhis_linearis Oreomyrrhis_nanhu Oreomyrrhis_orizabae Oreomyrrhis_papuana Oreomyrrhis_ramosa_1621_2 Oreomyrrhis_ramosa_1624_2 Oreomyrrhis_ramosa_1630_2 Osmorhiza_aristata Osmorhiza_chilensis Osmorhiza_claytonii Scandix_pecten_veneris Sphallerocarpus_gracilis ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1537] TITLE Scandicinae; LINK TAXA = Taxa2; DIMENSIONS NCHAR=452; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Anthriscus_cerefolium TCGAATCCTGCTCTATTGGAATGACCCGTTAACTCGTTAAAA-CATCGGGCAAGCATTTGGGGGTCCAAGG-CCCCCTCTTTGCAACCCCATGG-TAGTT-GTCCCCTCAGGGG-TGTCAACCTGCCAACTAAATCAACCGGGCGCTGACTGCGCCAAGGAAATTAAAACTGAACTGATTGTTC-GCTTCTCGTTCTCGGGCAGCGGCGTCACTCTGAATTATCTCTCGTTGCCCCCTGTCCAAACTAATCTTC-TATGAGATTTTGTTGGTTTGGGGG-CGGAAATTAGCCTCCTGTGCCCTGTTGTGCGGCTGGCGTAAAAGTGAGTATATGGTGACGAATGTCGCGACATCGGTGGTTGTAAGAAAACCTTCTAGTCTTGTCGTGTGAATGTTTGTCATTTTATAAC-GCTCAATGACCCTTAGGTGCCAAAACCTTTTGGCCCTTCGA Anthriscus_sylvestris TCGAATCCTGCTCAAGCGGAATGACCCGTTAACTCGTTAAAA-CATCGGGCAAGCGTTAGGGGGCCCAAGG-TCCCCTCTTTGCGATCCCGTGG-TGGTT-GTCCCCTCACGGG-TGTCAACCAACCAAATAAATCAACCGGGCGCTGACGGCGCCAAGGAAATTAATATTGAATTGATTGTTA-GCTTCTCGTTCGCGGGAAGCGGCGTCAATCTGAAACACATCTAGTTGCCCCCTGACCAAACTAATCTTT-CAAGAGATTTCGTCGGTTTGGGGG-CGGAAATTAGCCTCCTGTGCCATGTTGTGCGGCTGGCGTAAAACTGAGTCTATGGTGACGAATGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGTCCGTCATCTTATACG-GCTCAATGACCCTTAGGCGCCAAAAACTTT-GGCACTTCGA Athamanta_cretensis TCGAATCCTGC-ATACCGGAATGACCCGTTAACATGTAAAAA-CATCGGGCGAGCGTCAGGGGGCAT-ATGGTCTCCTGTTTGCGATCCCAAGG-TAGGT-GTCCCCTCACGGG-TGTCAACCAACCAATGAAATAAACCGGGCGCTGACTGCGCCAAGGAAATTGAAAATGAATTGTTCGTCC-GCTTCTCGTTCACGGGCAGCGGCGTCAGTCCAAAACACATCCTGTTGCCCCCCGATCAAAC---------------ATTT----GGTTTGGGGG-CGGATACTGGCCTCCCGTTCCTTGTCGTGCGGTTGGCGCAAAAATGAGTCTATGGCGATGGAT--CACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGCCCGTCACCTTAGTTA-GCTCAATGACCCTTAGGTGCCACAAACTTTGTGCGCTTCGA Chaerophyllum_aromaticum TCGAATCCTGCGGTAGCGGAATGACCAGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGATCCCTGGG-TTGTT-GTCCCCTCACGGG-TGCCAACCAACCACCAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCCCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAGCCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGAGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTAAGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_astrantiae TCGAATCCTGCGCTAGCGGAATGACCAGTTAACATGTTCAAA-CATCGGGCAAGCGTCAGGGGCCCTTATGATCCCCTGTTTGCGATCCCCGGG-TAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGGGG-CGGAAATTGGCCTCCTGTGCCTTGTGGTGCGGCTGGCGCAAAAATGAGTCTGTGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACGAACATTGTGCGCTTCGA Chaerophyllum_atlanticum TCGAATCCTGCGCTAGCGGAATGACCAGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGATCCCTGGG-TTGTT-GTCCCCTCACGGG-TGCCAACCAACCACCAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCCCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTC-TTTGAGATTTTGTTGGTTTTGAGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTAAGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGTGCCACAAACATTGTGCGCTTCGA Chaerophyllum_aureum TCGAATCCTGCGCTAGCGGAATGACCAGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTGTGCGATCCCCGGT-TAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATGTTC-TTTGAGATTTTGTTGGTTTTGGGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTATGGCGACGGCTGTCGCGACATCGGTGGTTGTAATAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_azoricum TCGAATCCTGCGCTAGCGGAATGACCAGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCTCTGTTTGCGATCCCTGGG-TTGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTCCACGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGAGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTAAGGCGACCGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_bulbosum TCGAATCCTGCGCTAGCGGAATGACCAGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGATCCCCGGG-TTGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGGGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTAAGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_byzantinum TCGAATCCTGCACTAGCGGAATGACCAGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGGTCCCCGGG-AAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAATTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTACGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCC-TAACCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGTGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTATGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTT---GTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTAAAGCGCGACAAACATTGTGCGCTTCGT Chaerophyllum_crinitum TCGAATCCTGCACTAGCGGAATGACCAGTTAACACGTTTAAA-CATCGGGCAAGCATCAGGGGGCCTTATGATCCCCTGTTTGCGATCCCCGGG-TAGTT-GTCCCCTCACGGG-TGCCA--------ACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCC-TAACCAAACTAATCTTC-TTAGAGATTTTGGTGGTTTTGGGC-CGGAAATTGGCCTCCTGTGCCTTGTGGTGCGGCTGGCGCAAAAATGAGTCTATGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_elegans TCGAATCCTGCTCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCTTGTTTGCGATCCCCAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCTTGTTGCCCCCTGACCAAACAAATCTTC-TAAGAGATTTTGTCGGTTTGGGGG-CGGACATTGGCCTCCCATGCCGTGTTGTGTGGCTGGCGCAAATATGAGTCTATGGTGACAGTTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTTAATTCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_khorossanicum TCGAATCCTGCACTAGCGGAATGACCAGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGATCCCCGGG-TAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTCCTTAAAAATTTTTTTGGTTTGGGGC-CGAACATTGGCCTCCTGTCCCCTGTGGTGCGGCTGGCGCAAAAATGTGTATATGGCGACGGCTGTCGAGACATCGGTGGTTGTGAGGAGACTTTCTTGTATTGTCGTGTTAATGCTTGTCACCT-AGTAA-GCTCAATGACCCTAAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_libanoticum TCGAATCCTGCACTAGCGGAATGACCAGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGGTCCCCGGG-AAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTACGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCC-TAACCAAACTAAGCTTC-TTAGAGATTTTGTTGGTTTTGTGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTATGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTT---GTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTAAAGCGCGACAAACATTGTGCGCTTCGT Chaerophyllum_macropodum TCGAATCCTGCACTAGCGGAATGACCAGTTAACATGTTCAAA-CATCGGGCAAGCGTCAGGGGCCCTTATGATCCCCTGTTCGTGATCCCCGGG-TAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTC-TTAGAGATTCCGTTGGTTTTGGGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTATGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAGTGACCCTTAGGCGCTACAAACATTGTGCGCTTCGA Chaerophyllum_macrospermum TCGAATCCTGCGCTAGCGGAATGACCAGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGCCCTTATGATCCCCTGTTTGCGATCCCCGGG-TAGTT-GTCCCCTCGCGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTG-ACGTTC-GCTTCTCGTTCGCGGGCAGCGATGTCAGTCTGAAACACATCTTGTTGCCCCCTAACCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGGGG-CGGAAATTGGCCTCCTGTGCCTTGTGGTGCGGCTGGCGCAAAAATGAGTCTGTGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_magellense TCGAATCCTGCTCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCCAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCGGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTT-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCTTGTTGCCCC-TGACCAAACAAATGTTC-TAAGAGATTTTGTCGGTTTGGGGG-CGGACATTGGCCTCCCATGCCGTGTTGTGTGGCTGGTGCAAATATGAGTCTATGGTGACAGTTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTTAATTCTTGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Chaerophyllum_meyeri TCGAATCCTGCACTAGCGGAATGACCAGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCCTTATGATCCCCTGTTTGCGATCCCCGGG-TAGTT-GTCCCCTCACGGG-TGCCAACCAACCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGACGTCAGTCTGAAACACATCTTGGTGCCCCCTAACCAAACTAATCTTC-TTAGAGATTTTGTTGGTTTTGGGG-CGGACATTGGCCTCCTGTGCCCTGTGGTGCGGCTGGCGCAAAAATGAGTCTATGGCGACGGCTGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTATTGTCGTCTTAATGCTCGTCTCCTTAGTAA-GCTCAATGACCCT???????????????????????????? Chaerophyllum_nodosum TCGAATCCTGCTCTAGCGGAATGACCCGTTAACATGTTTAAAACATTGGGCAAGCGTCAGGGGTCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGAATGCGCCAAGGAAATTAATACTGAATTGTGCGTTT-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAAAACATCTTGTTGCCCC-TGACCAAAATAATCTTC-TAAGAGATTTTGTTTGTTTTGGGG-TGGACATTGGCCTCCTGTACCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCGCGACATCGGTGGTTGTAAGAAGACCTT---GTCTTGTCGTGTTAATGCTTGTCACCTTAGTAA-GCTCAATGACCCTTAGGCGCTACAAACATTGTGCGCTTCGA Chaerophyllum_procumbens TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACCGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCTAACCAAATCTCCTACGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCCGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTGA-GCTCGATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Chaerophyllum_tainturieri TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCTTGTTGCCCC-TGACCTAACCAAACCTCCTACGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCCGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTGA-GCTCGATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Chaerophyllum_temulentum TCGAATCCTGCACTAGCGGAATGACCCGTTAACATGTTTCAA-CGTCGGGAAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGTGATCCCTAGT-TGGTT-GTCCCCTCACGGG-TGTCAACTTGCCAACAAAATCAACCGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTT-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCTTGTTGCCCCCTGACCAAACCAATCTTCCTAGGATATTTCGTCGGTTTTGGGG-CGGACAATGGCCTCCCGTACCCTGTTGTGCGGCTGGCGTAAAAATGAGTC--TGGTGACGGTTGTCGCGACATTGGTGGTTGTAAGAAGACCTTCATGTCTCGTCGTGTTAATGCTCGTCACCTTAGT-A-GCTCAATGACCCTTAAGCGCCACAAACACTGTGTGCTTCGA Chaerophyllum_villarsii TCGAATCCTGCTCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGGAT-ATGATCCCCTGTTTGCGATCCCCTGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCTTGTTGCCCC-TGACCAAACAAATCTTC-TAAGAGATTTTGTCGGTTTGGGGG-CGGACATTGGCCTCCCATGCCGTGTTGTGTGGCTGGCACAAATATGAGTCTATGGTGACAGTTGTCACGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTTTTAATTCTCGTCACCTTAGTAAAGCTCAATGACCCTTAGGCGCCACAAACATTGTGCGCTTCGA Conopodium_ramosum TCGAATCCTGCTATACCAGAATGACCCGTTAACATGTAAAAA-CATCGGGCAAGCGTCAGGGGGCAT-ATTGTCTCCTGTTTGCGAACCCAAGG-TAGGTTGGCCCCTCACGGG-CGTCAGCCAACCAATGAACTAAACCGGGCGCCGACTGCGCCAAGGAAAATAAAACTGAATTGTTCGTCC-GCTTCTCGTTCACGGGCAGCGGCGTCAGTCCAAAACACATCTTGTTGCCCCCCGACCAAAC---------------ATTT----GGTTTGGGGG-CGGATACTGGCCTCCCGTTCCTTGTTGTGCGGTTGGCGCAAAAATGAGTCTATGGCGATGGAT--CGCGACATCGGTGGTTGTAAGAAGACCTT---GTCTTGTCGTGTGAACGACCGTCACCTTAGTTA-GCTCAATGACCCTTACAGGCCACAAACTTTGTGCGCTTCGA Kozlovia_paleacea TCGAATCCTGCTCTAGCGGAATGACCCGTTAACTCGTTAAAA-CATCGGGCAAGCTTCAGGG-----------CTCCTGTTTGCGACCCC--GG-TTTGTTGTCCCCTCACGGG-TGTCAACAAGCCAACTAAATCAACCGGGCGCTGACTGCGCCAAGGAAATTAATACTAAATTGATTGTTT-GCTACTCGTTCGCGGGCAGCAGCGTCAATCTGAAACACATCTCGTTGCCCT-TGGCCAAAATAATCTAC-AAAGAGATTTTTTCGGTTTGAGGG-CGGACATTAGCCTCCTGTGCCTTGTTGTGTGGCTGGCGCAAAAATGAGTCTATGGTGACGAATGTCGCGACATCGGTGGTTGTAACAAGACCTT---GTCTTGTCGTGTGAATGTCCGTCATCTTAGAAT-GCTCAATGACCCTTAGGCGCCAAAAAATTTTGGCACTTCGA Myrrhis_odorata TCGAATCCTGCTCTAGCGGAATGACCCGTTAACGCGTTAAAA-CACCGGGCAAGCATCAGGAGGCCCAAGG-TCCCCTCTTTGCGACCCCAGGG-CAGTT-GTCCCCTCACGGG-TGTCAACATGCCAACTAAATCAACCGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGATTGTTT-GCTTCTCGTTCGCGGGCAGCGGCGTCAATCTGAAACACATCTTGTTGCCCC-TGTCCAAACTAATCTTC-TAGGAGATTTTGTCGGTTTGGGGG-CGGACATTAGCCTCCTGTGCCCTGTTGTGCGGCTGGCGTAAAAATGAGTCTATGGTGACGAATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGTCCGTCATCTTAGAAC-GCTCAGTGACCCTTAGCCGCCAAAAACTTTTGGCGCTTCGA Oreomyrrhis_andicola_1467_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-GGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_andicola_1479_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-AGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_andicola_1488_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCGGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTACCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_argentea TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAGCCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_azoreallacea TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCGT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGG-GGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_borneensis TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAAACAATCTCC-TAAGAGATTTTGTCGGTTTTGGGGGCGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTGA-GCTCATTGACCCTAAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_brevipes TCGATTCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTTTGTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCGCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_ciliata_1555_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGGGTGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_ciliata_1588_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTTTGTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAAAGCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_ciliata_1602_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTTTGTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_ciliata_1614_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTTTGTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAA----TCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_colensoi_1641_2 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTATGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGAAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_colensoi_1643_2 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCATCAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTATGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGAAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_eriopoda_1554_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCGATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_eriopoda_1576_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCGGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_eriopoda_1579_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGAGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_eriopoda_1612_1 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGCCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGCTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_gunnii TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAAACAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGCTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_involu TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAAACAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTGA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_linearis TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGAAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTTATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_nanhu TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAAACAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTATTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTGA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_orizabae TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_papuana TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTCAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCAACTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGCAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_ramosa_1621_2 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGGTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTATGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGAAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Oreomyrrhis_ramosa_1624_2 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TGACCAAACCAATCTCC-TAAGAGATTATGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGAAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACGCTGTGCGCTTCGA Oreomyrrhis_ramosa_1630_2 TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGGATCCCCTGTTTGCGATCCCTAGG-TAGTT-GTCCCCTCACGGG-TGTCAACCAGCCAACAAAATCAACTGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTTTGAAACACATCTTGTTGCCCC-TAACCAAACCAATCTCC-TAAGAGATTATGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGTTGTGCGGCTGGCGAAAAAATGAGTCTATGGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAGACCTTCATGTCTTGTCGTGTTAATGCTCGTCACCTTAGTAA-GCTCAATGACCCTTAAGTGCCACAAACACTGTGCGCTTCGA Osmorhiza_aristata TCGAATCCTGCTTTAGCGGAATGACCTGTTAACTCGTTAAAA-CATCGGGCAAGCATCAAGGGGCCCAAGG-TCCCCTCTTTGCGACCCCAGGGGTAGTT-GTCCCCTCGCGGG-CGTCAACAAACCAACTAAATCAATCGGGCGCTG-ATGCGCCAAGGAAATTAATATTGAATTGATTGTTT-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCCTATTGCCCC-TGACCAAACTAATCTTT-TAAGAGATTTTGTCGGTTTGGGGG-CGGACATTGGCCTCCTGTGCCCTGTTGTGCGGCTGGCGCAAAAATAATTCTATGGTGACGAATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGTTCGTCATCTTAGAAC-GATCAATGACCCTTAGGCGCCAAAAAAAATTGGCGCTTCGA Osmorhiza_chilensis TCGAATCCTGCTCTAGCGGAATGACCCGTTAACTCGTTAAAA-CATCGGGCAAGCATCAAGGGGCCCAAGG-TCCCCTCTTTGCGACCCCAGGG-TAGTT-GTCCCCTCACGGG-CGTCAACAAGCCAACTAAATCAATCGGGCGCTGGATGCGCCAAGGAAATTAATATTGAATTGATTGTTT-GCTTCTCGTTCGCGGGAAGCGGCGTCAGTCTGAAACACATCCTGTTGCCCC-TGACCAAACTAATCTTT-TAAGAGATTTTGTCGGTTTGGGGG-CGGACATTGGCCTCCTGTGCCCTGTTGTGCGGCTGGCGCAAAAATAATTCTATGGTGACGAATGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGTTCGTCATCTTAGAAC-GATCAGCAACCCTTAGGCGCCAAAAAAATTTGGCGCTTCGA Osmorhiza_claytonii TCGAATCCTGCTCTAGCGGAATGACCCGTTAACTCGTTAAAA-CATCGGGCAAGCATCAAGGGGACCAAGG-TCCCCTCTTTGCGACCCCAGGG-TAGTT-GTCCCCTCACGGG-CGTCAACAAGCCAACTAAATCAATCGGGCGCTGGATGCGCCAAGGAAATTAATATTGAATTGATTGTTT-GCTTCTCGTTCGCGGGCAGCGGCGTCAGTCTGAAACACATCCTGTTGCCCC-TGACCAAACTAATCTTT-TAAGAGATTTTGTCGGTTTGGGGG-CGGACATTGGCCTCCTGTGCCCTGTTGTGCGGCTGGCGCAAAAATAATTCTATGGTGACGAATGTCGCGACATTGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTGAATGTTCGTCATCTTAGAAC-GATCAATAACCCTTAGGCGCCAAAAAAATTTGGCGCTTCGA Scandix_pecten_veneris TCAAATCCTGCTTTAGCGGAATGACCCGTTAACTTGTTAAAA-TATTGGGGAAGCTTCAGGGTGCCTCAGG-TCCCTTGTTTGCGATCCCAGGG-TAGCT-GTCCCCTCACGGG--GTCGGCCAGCCAAAAAAATCAACTGGGCGCTAACTGCGCCAAGGAATTTTACATTGAATTGATCGTTTTGCTTCTCGTTCGCGGGCGGCAGCGTCATTCTAAAACCCATCTTGTTGCCTC-TGACCAAACTAATCTTT-TAAATGATTTTGTTGGTTCGGGGG-CGGACATTGGCCTCCTGTGCACTTTTGTGCGGCTGGCATAAAAATGAGTCTATGGTGACGGATGTCACGACATTGGTGGTTGTAAT-ATACCTTCTTGAATTGTCGTGTCTAAGTCTGTCACTTTAGTAAAGCTCAATGACCCTTAGGTGCCAAAAACTTTTGGTGCATCTA Sphallerocarpus_gracilis TCGAATCCTGCTCTAGCGGAATGACCTGTTAACATGTTAAAA-CATCGGGCAAGCGTCAGGGGGCAT-AGG-TCCTCTGTTTGCGATCCCAAGG-TAGTT-GTCCCCTCATGGG-TTTCAACCAGCCAACTAAATCAACCGGGCGCTGATTGCGCCAAGGAAATTAATACGGAATTGTTCGTTA-GCTTCTCGTTCGCGGGAAGCAACGTCAGTCTGAAACACATCTTGTTGCCCT-TGACCAAATGAATCTTC-AAAGAGATTTTGTAGGTTTTGGGG-CGTAAACTGGCCTCCCGTGCCCTGTTGTGCGGTTGGCGTAAAAATGAGTCTATGGTGATGGATGTCGCGACATCGGTGGTTGTATGAAGACCTCTTTGTCTTGTCGTGTGAATGCCCGTCACCTTAGTCA-GCTCGATGACCCTTGGGCGCCACAAACTTTGTGCGCTTTGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Scandicinae) = N: 1-452; CODONPOSSET CodonPositions (CHARACTERS = Scandicinae) = N: 1-452; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1536] TITLE Apioideae_ITS; LINK TAXA = Taxa1; DIMENSIONS NCHAR=475; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Aegopodium_podagraria TCGAATCCTGTGATAGCAGAACGACCCGCTAACTGGTAAATA---TATTGGGCAAGC-TCATGGGGATTTTA--TCCCCTGTTGGTGAACCC--TTGGTAG---GTGGTCA---CTCCCCGGTTGCCACTGGCCTACGAAA-TCACCCGGGCGCGGAATGCGCCAAGGA-AATTAAAACTGAATTG-ATGTGT-GTTTCCCGTTAGCCGGGTTGCAC-CGTCATTCTAAAAACATATCGTGTTGCCAC-CGA-TCA--CTCACTCCT--AGAGGAGATGT-GCTGGTTT-GGGGGCGGAAATTGGCCTCCCGTGCCTTGT--TGTGCGGCTGGCACAAAAGCGAGTCTCT-GACAATGGTCGTCGCGACATCGGTGGTTGTAAAAAG-ACCT---TATCTTGTCGCGCGAA-TCCCTGTCACCTTAGAG-AGCTCTAGGATCCT-TAGGCGCCACCCAT--TGTGTGCGCTTTGA Aethusa_cynapium TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTAAACA---ATTTGGGCAAGCGTCGGGGGGCCTTGG--TCCCCTGTCTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTGGCCACTGGCCTGCAAAAATCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCAACGG-CGTCGTTCCAAAA-CACATCGTCTTGCCCCACAAAAACCACTCACTCCT---GAGAAGTTGTGCC-GGTTT-GGGGGCGGAAACTGGCCTCCCGTGCCTTGT--CGTGCGGTTGGCGGAAAGGCGAGTCTCC-GGCGATGGACGTCGCGACATCGGTGGTTGTAAAA-G-GCCCTCTTGTCTTGTCGCGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCGGCACACAC--TCTGTGCGCTTCGA Anethum_graveolens TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAACA---CATTGGGCAAGCTTCAGAGGGCTTCGG--TCCCCTGTTTGCAAACCCT--TGGTAG---GTGTCCCC--CTCTATGGTGGTCACCGGCCTACGAAA-TCATCCGGGCGCGGAATGCGCCAAGGA-ACTTAAAATTGAATTGTACGTTC-GCATCCCGTTAGC-GGGCATCGAACGTCATTCCAAAA-CACATTTGCTTGCCC--CAA-CCA--CTCACTCCT--TGATGAGATGTGCT-GGTTT-TTGGGCGGAAATTGGCCTCCCGTGCCTTGT--TGTGCGGTTGGTGCAAAAGCGAGTCTCC-GGCGTTGGACGTCGTGACATCGGTGGTTGTAAAA-G-ACCCTCTTGACTTGTCGCACGAA-TCCTCGTCATCTAAGTG-AGCTCTAGGACCCT-TGGGCGCTACACAA--TCTGTTTGCCCTAA Angelica_archangelica TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACA---ATTTGGGCGAGCGTCGGGGGGCCTCGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTGGCCACTGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTGCGTCC-GTATCCCGTTAGC-GGGCAACGG-CGTCATTCCAAAA-CACATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGCT-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCC-GCGGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGCGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Anthriscus_cerefolium TCGAATCCTGCTCTATTGGAATGACCCGTTAACTCGTTAAAA---CATCGGGCAAGCATTTGGGGGTCCAAGG-CCCCCTCTTTGCAACCCCA--TGGTAG---TTGTCCC---CTCAGGGGTGTCAACCTGCCAACTAAA-TCAACCGGGCGCTGACTGCGCCAAGGA-AATTAAAACTGAACTGATTGTTC-GCTTCTCGTTCTC-GGGCAGCGG-CGTCACTCTGAAT-TATCTCTCGTTGCCCCCTGT-CCA--AACTAATCT-TCTATGAGATTTTGTTGGTTT-GGGGGCGGAAATTAGCCTCCTGTGCCCTGT--TGTGCGGCTGGCGTAAAAGTGAGTATAT-GGTGACGAATGTCGCGACATCGGTGGTTGTAAGAAA-ACCTTCTAGTCTTGTCGTGTGAA-TGTTTGTCATTTTATAA-CGCTCAATGACCCT-TAGGTGCCAAAACC--TTTTGGCCCTTCGA Apium_graveolens TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAACA---CATTGGGCAAGCGTCGGTGGGCTTTGG--TCCGCCGTTTGCAAACCTT--TGGTAG---GTGGCCC---CTCTTTGGTGGCCACCGGCCTACGAA--TCATCCGGGCGCGGAATGCGCCAAGGA-ACTTAAAATTGAATTGTACGTTC-GCAACCCGTTAG--GGGCGGCGG-CGTCATTCCAAAA-CACATTTGCTTGCCCT-CAAACAC---TCACTCCT--TGATGAGGGGTGTT-GGTTT-TTGGGCGGAAATTGGCCTCCCGTGCCGTGT--TGTGCGGTTGGCGCAAAAGCGAGTCTCC-GGCGACGGACGTCGTGACATCGGTGGTTGTAAAA-G-GCCCTCTTGTTTTGTCGCACGTA-ATTGTGTCATCTAAG-G-AGCTCGAGGACCCT-GAGGCGCTACACAA--TTTGTTCGCTTTAA Arracacia_brandegei TCGAATCCTGCAATAGCAGAACGACCCGCTAACACGTCAACA---ATTTAGGCAAGCGTCGGGGGGCCTCGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCC---CTCCCGGGGGC-CACTGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACTTAAAACTGAATTGTGCGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCATTCCAAAA-CACATCGTATTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACGCTGT--CGTGCGGTTGGCGAAAAAACGAGTCTCC-GGCGACGGACATCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGCAAA-TCCTCGTCATTTTAGAG-AGCTCCAGGACCCT-TCGGCAGCACACTC--TCTGTGCGCTTTGA Arracacia_nelsonii TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGGCAAGCGTCGGGGGGCCTCGG--TCTCCTGTATGCGAATCCCCCTGGTAG---GTGGCCA---CTCCCGGGCGGCCACTGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACCTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCACCGG-TGTCATTCCAAAA-CACATCGTCTTGCCCG-CAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACGTTGT--CGTGCGGTTGGCGGAAAAATGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAACA-G-ACCCTCTTGTCTTGTCGCGCAAA-TCCTCGTCATTTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TGTGTGCGCTTCGA Carlesia_sinensis TCGAATCCTGCAACAGCAGAATGACCCGCTAACACGTCAACA---TTTTGGGCAAGCATCGGGGGGCCTCGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTG-CCACCGGCCTTCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCAGCGG-CGTCATTCTAAAA-CACATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGGGCGGAAACTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGCGCGAA-TCCTCGTCATCTTAGAG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Chaerophyllum_temulum TCGAATCCTGCACTAGCGGAATGACCCGTTAACATGTTTCAA---CGTCGGGAAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGTGATCCCT--AGTTGG---TTGTCCC---CTCACGGGTGTCAACTTGCCAACAAAA-TCAACCGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTT-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTCTGAAA-CACATCTTGTTGCCCCCTGA-CCA--AACCAATCTTCCTAGGATATTTCGTCGGTTTTGGGG-CGGACAATGGCCTCCCGTACCCTGT--TGTGCGGCTGGCGTAAAAATGAGTCT---GGTGACGGTTGTCGCGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTCGTCGTGTTAA-TGCTCGTCACCTTAGT--AGCTCAATGACCCT-TAAGCGCCACAAAC--ACTGTGTGCTTCGA Coaxana_purpurea TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGGCAAGCATTTTGGGGCCCTGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTGC-CACTGGCCTGCAAAA-TCATTTGGGCGCGGAATGCGCCAAGGA-ACTTAAAAATGAATTGTACGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCATTCCAAAA-CACATCTTCTTGCCCC-CAAACCA--CTCGCACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACATTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCG-GGCGACGGACGTCGCGACATTGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGTAAA-TCCTCGTCATTTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Conium_maculatum TCGAATCCTGCGATGGCAGAATGACCCGCTAACACGTATACA---CATCGGACAAGCGTCAGGGGGCTTTTG--TCCCCTGTTAGCGAATCCC--TGGTAG---GTGGCC----CTCTTGGGTGGCCACTGGCCTGCAAAA-TCATTTGGGCGCGGAATGTGCCAAGGA-ACATAAAACTGAATTGTACGCCC-GCTTCCCGTTAAC-GGGCAGCGG-CGTCATTCCAAAA-CACATTGTCTTGCCCA-CAAACAC-AGACACTCCT--CAAGGATTTGTGCCTGGTTT-GGGGGCGGAAATTGGCCTCCCGTGACTTGT--TGCGCGGTTGGCAAAAAAATGAGTCTCC-GGCGACGGACGTCGTGACAACGGTGGTTGTAAAA-G-ACCCTCTTGAATTGTTGCGCGAA-TCCGCGTCATCTTAGCG-AGCTCTAGGACCCT-TAGGCGACACACAC--TCTGTGCGCTTCAA Coriandrum_sativum TCGAAACCTGCAGAAGCAGAACGACCTGCTAACTCGTAAACA---CATTGGGCAAGCGTCGGGGGGCTTTTG--TCCCTTGTTCGCGAATCCC--TGGTAG---GTGGCCC---CTCCTGGGTGGCCGCTGGCCT-CAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACTTGAAATTGAATTGTACGTCC-GCATCCCGTTAGC-GGGCAGCGG-CGTCATTCCAAAA-AACATTGTCTTGCCCA-CAA-CCA--CCCACTCCT--TGAGGAGTTGTGTT-GGTTT-GGGGGCGGAAACTGGCCTCCCGTGCCTTGT--CGCGCGGTTGGCGGAAAATCGAGTCTCC-GACGACGGATGTCGTGACATCGGTGGTTGTAAAA-G-GCCCTCTTGTCTTGTCACGCGAA-TCCTAGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCGC-ACACAC--TCTGTGCGCTTTGA Coulterophytum_laxum TCGAATCCTGCAATAGCAGAACGACCCGCTAACACGTCAACA---ATTTCGGCAAGCGTCGGGGGGCCTCGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCC---CTCCCGGGGGGTCACTGGCCTGCAAAA-TCATTCGGGCGCGGCATGCGCCAAGGA-ACATAAAACCGAATTGTATGTCC-GTATCCCGTTAGC-GGGCATCGG-CATCATTCCAAAA-CACATCGTATTGCCCA-CAAACCA--GTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACGCTGT--CGTGCGGTTGGCGAAAAAAAGAGTCTTT-GGCGACGGACATCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGCAAA-TCCTCGTCATTTTAGAG-AGCTCCGGGACCCT-TAGGCAGCACACTC--TCTGTGCGCTTCGA Crithmum_maritimum TCGAAGCCTGCAACAGCAGTACAACCCGCTAACTCGTAAACA---CATTGGGCAAGC-TAATGGGGATTTGG--TTCCTCGTTTGCGAACCCC-TTGGCAG---GTGGCCC---CTTTCCAGTGGCCACCGGCCTATGAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ATATAAAACTGAATTG-ACGTTC-GCTTCCCGTAAGC-GGGCAGTGG-CGTCATTCCGAAA-CACATCGTGTTGCCCC-CGA-CCA--CTCACTCCT--AGAGGAGAT---CC-GGTTT-GGGGGCGGAAATTGGCCTCCCGTGCATATTATCGCGCGGTTGGCGCAAAAGCGAGTCTCC-GGCGACGGACGTCGTGACATCGGTGGTTGTAAAAAG-ACCT---TGTCTTGTCGCGCGAA-TCCGGGTCAGGTTGGTG-AGCTCGAGGACCCT-TAGG---CACACAT--TGTGTGCGCTTCGA Daucus_carota TCGAATCCTGTGATACCAGAATGACTTGTTAACATGTAACAA---CAACGGGCAAGCAACTGTGGGCCTTTGG-TCCCCTGTCTGTGAACCCA--AGGCAG---GTGTCAC---CTTATGGTTCCCCTC-GCCTAATAAAA-TCAACTGGGCGCTAGATGCGCCAAGGA-AGTAAATAATGAATTGTTCGTTC-GCTTCTCGTTCGC-GGGAAGTGG-CGGCGGTCCAAAA-CACATCGTGTTGCCCC-TGA-CCA--AACATCTCC--TCGAGAGATTTA-TTTGTTC-AGGGGCGGAAATTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCT-GGTGACGGGCATCACGACATCGGTGGTTGTAAGAAG-ACCTTCTTGTGTCGTTGTGTA---TACCCGCCGCAGTAGGG-AACTCGAGGGCCCT-TGGGCACAGCAAAAATTGTGTGCACTTCGA Enantiophylla_heydeana TCGAATCCTGCAATAGCAGAACGACCCGCTAACACGTCAACA---ATTTCGGCAAGCGTCGGGGGACCTCGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCC---CTCCCGGGGGGTCACTGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACTTAAAACTGAATTGTATGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCATTCTAAAA-CACATCGTATTGCCCA-CAAACCA--CTCGCACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACGCTGT--CGTGCGGTTGGCGAAAAAACGAGTCTCC-GGCGACGGAAATCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGCAAA-TCCTCGTAATTTTAGAG-AGCTCCGGGACCCT-TAGGCAGCACACTC--TTTGTGCGCTTCGA Endressia_castellana TCGAATCCTGCAGTAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGACAAGTGTTCGGGGGCCTCGG--TCTCCTGTATGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTGTCCACTGGCCTCCAAAA-TCATTTGGGCGCGGAATGCGCCAAGGA-CAGTAAAACTGAATTGTACGTTC-GTATCCCGTTAGC-GGGCTGCGG-CGTCATTCCAAAA-CACATCGTCTTGCCCC-CAAACCA--CTCACGTCT---GAGAAGTTGTGCC-GGTTT-GGGG-TGGAAATTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCC-GGCGATGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTTTTGTCTTGTCGTGCGAA-TCCTCGTCATCTTAGCG-AGCTCTAGGACCCA-TAGGCAGCACACAC--TGTGTGCGCTTTGA Erigenia_bulbosa TCGAATCCTACAACAGCAGAATGACCAGCTAACACGTAAACA---CATCGGGTCAGTGTAAGGGGCCTT-GAG-TCCCTCGTATGCGAACCCT--AGGAAG---GTGGCCC---CTCCCGGGTGCCCACCGGCCA-CGAAA-TCAATTGGGCGCGGAATGCGCCAAGGA-CATCAAAACTGAATTGTACGTCT-TCTTCTCGTTCGC-GGGAGGCGG-CGTCTTTCTAAAA-CACATCGTGTTGCCCC-ATGACCG--CTCACCCCT-TGGGGCATTTGGGTC-GGTCT-GGGA-CGGATACTGGCCTCCCGTGCCTCGT--TGCGCGGCTGGCGCAAAATCGAGTTCGT-GGGGACGGACGTCGCGACAATGGTGGTTGTAAAAAGAACCTTCTC-TCTTGTCGTGCGAA-TACCCGTCACCCTAGCG-AGCTTGAGGACCCT-TTGGCGCCACAAAC--CGTGTGCGCTTCAA Heracleum_lanatum TCGAATCCTGCAATAGCAGAATGACCCGCTAACATGTAATTA---CATCGGGCAAGCGTATGGGGGCTTTGG--TCCCCTGTTAGCAAAACCC--TGGTAG---GTGGCCCCC-TTTTTTGGGGGCCACTGGCCTGCAAAA-TCACTCGAGCGCGGAATGCGCCAAGGA-ACTTAAAACTGAATTGTACGTTT-GCATCCCGTTAGC-GGGCAGCGG-CGTCTTTCCAAAA-CACATTCACTTGCCCA-AAA-CCA--CACACTCCT--TGAGGAGCTGTGTT-GGTTT-GAGGGCGGAAATTGGCCTCCCATGCCTTCT--CGCATGGTTGGCAAAAAAATGAGTCTCT-GGCTATGGACGTCGTGACATTGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGGGCGAA-TCCGGGTCATCTTAACG-AGCTCCAGGACCCT-TAGGCGGCACACAT--TGTGTGCGCTTCGA Laserpitium_siler TCGAATCCTGCGATAGCAGAATGACCCGTTAACACGTAAAAA---CATCGGGCAAGCGTCGGGGGGCCTTGTG-TCCCCTGTTTGCAAACCCA--AGGTAG---GTGTCCC---CTAACGGGTGTCTACCGGCCAATGAAA-TCAACCGGGCGCTGACTGCGCCAAGGA-AGTTAATAACGAATTGTTCGTTT-GCTTCTCGTTCGC-GGGAAGTGG-CGTCAGTCCGAAA-CATATCGTGTTGCCCC-TGA-CCA--AACATCTCT--CTAGGAGATTTT-TCGGTTT-AGGGGCGGATATTGGCCTCCTGTGCCTTGTG-TGTGCGGCTGGCTCAAAAATGAGTCTCT-GGTGATGGACGTTGCGACATCGGTGGTTGTAAGAAG-ACCTTCTTGTGTTGTCGTGTA---TGCCCGTCACCTCAGTC-AGCTTAAGGGCCCT-TAGGCGCAACAAAA--TGTGTGCGCTTCGA Lilaeopsis_occidentalis TCGAATCCCGCGATAGCGAAATGACCCGTTAACATGTAAAACCATCATCGGGTGAGAGTCGGGGG-ATTAGGT-TCTCCCGACCTTGTACCTG--AGGCAG---GTGGCCC-----TTCGGGTGCCCACCGGCCCACGAAA-----TTGGGCGCGGAAGGCGCCAAGGA-AAATGAAATTGAATTATATGCGC-GCTTCTTGAACGC-ATGAAGCGT-CGTCATTCTAAAA-ATCATCTTATTGCCCC-TTGATCAT-TCACCCTCC-GGGAGGAGGTAGTTT--GTTTCGGGGGCGGAAAATGGCCTCCCGTTCCCTCTACGGCGCGGTTGGTGATAAAACGAGACTCTTGGCGACGGATGTCGCGGCATCGGTGGTTGTAAAAAG-ACCGTCTTATCTTGTCGGACCAAATATCAGTCACCTAAGAG-GGATCAAGGACCCT-AAGTTGTCATGCAATGTGCGTGCGCTTTGA Lomatium_dasycarpum TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACA---ATCTGGGCAAGCGTCGGGGGGCTTCGG--TCTCCTGTATGCAAATCCC--TGGTAG---GTGACCG---CTCTCGGGTGGCCACTGGCCTTCAAAA-CCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCATTCCAAAA-CACATCGTCTTGCCCA-TAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GTTGGCGGAAACTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTTTCTTGTCGCGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--CCTGTGCGCTTGGA Myrrhidendron_donnell_smithii TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGGCAAGCGTCGGGGGGCCTCGG--TCTCCTGTCTGCGAATCCCCCTGGTAG---GTGGCCA---CT--------------GGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACTTAAAACTGAATTGTACGTCC-GTATCCCGTTTGC-GGGCACCGG-CGTCATTCCAAAA-CACATCGTCTTGCCCG-CAA-CCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGTCCTCCCGTACGTTGT--CGTGCGGTTGGCGGAAAAACGGGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTTTAAAA-G-ACCCTCTTGTCTTGTCGCGCAAA-TCCTCGTCATTTTAGCG-AGCTCCAGGGCCCT-TAGGCGGCACACAC--TCTATGCGCTTCGA Myrrhis_odorata TCGAATCCTGCTCTAGCGGAATGACCCGTTAACGCGTTAAAA---CACCGGGCAAGCATCAGGAGGCCCAAGG-TCCCCTCTTTGCGACCCCA--GGGCAG---TTGTCCC---CTCACGGGTGTCAACATGCCAACTAAA-TCAACCGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGATTGTTT-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAATCTGAAA-CACATCTTGTTGCCCC-TGT-CCA--AACTAATCT-TCTAGGAGATTTTGTCGGTTT-GGGGGCGGACATTAGCCTCCTGTGCCCTGT--TGTGCGGCTGGCGTAAAAATGAGTCTAT-GGTGACGAATGTCGCGACATCGGTGGTTGTAAGAAG-ACCTTCTTGTCTTGTCGTGTGAA-TGTCCGTCATCTTAGAA-CGCTCAGTGACCCT-TAGCCGCCAAAAAC--TTTTGGCGCTTCGA Neogoezia_minor TCGAATCCTAGAATAACAAAATAACTTGCTAACGTGTACACA---CATTGGGTGAGCATCGGGTTGCTTCGGT-T-TCTCGTTTGCCTACCCA--AGGCAG---GTGGCCC-----TTTGGGTTCCCACCGGCCTATGAAA-----TTGGGCGCGGAAAGTGCCAAGTA-AAGTAAAATTGAATTGCACGTAC-GCTTCTTGTACGC-TGGAAGTGT-CGTCATTCTGAAA-CATATCTTGCTGCCCC---GACCA--CCACTCCCA-GAGGGGAGCTTGGCT-GGTTT-GTGGGCGGATAATGGCCTCCTGTGCCTTGC--GGTGCGGTTGGTATTAAAATGAGACATT-GTTGATGCATGTTACGACATTGGTGGTTTTAAAAAG-GCCGTCTTGTCTTGTCGTGCCAT-TGCCCGTCACCTAAGCT-AGCTCAAGGACTCT-TAGGTGCCATGTAT--TTTGTGCACTTCGA Oreomyrrhis_andicola TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA---CATCGGGCAAGCGTCAGGGGGCATGGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCAACAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AACCAATCT-CCTAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGCAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTA-AGCTCAATGACCCT-TAAGTGCCACAAAC--ACTGTGCGCTTCGA Oreomyrrhis_borneensis TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA---CATCGGGCAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCAACAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AAACAATCT-CCTAAGAGATTTTGTCGGTTTTGGGGGCGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGCAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTG-AGCTCATTGACCCT-AAAGTGCCACAAAC--ACTGTGCGCTTCGA Oreomyrrhis_colensoi TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA---CATCGGGCAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCATCAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AACCAATCT-CCTAAGAGATTATGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGAAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTA-AGCTCAATGACCCT-TAAGTGCCACAAAC--ACTGTGCGCTTCGA Oreomyrrhis_eriopoda TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA---CATCGGGCAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCAACAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AACCGATCT-CCTAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGCAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTA-AGCTCAATGACCCT-TAAGTGCCACAAAC--ACTGTGCGCTTCGA Oreomyrrhis_hookeri TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA---CATCGGGCAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCAACAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AACCAATCT-CCTAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGCAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTA-AGCTCAATGACCCT-TAAGTGCCACAAAC--ACTGTGCGCTTCGA Oreomyrrhis_papuana TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTCAAA---CATCGGGCAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCAACAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCAACTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AACCAATCT-CCTAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGCAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTA-AGCTCAATGACCCT-TAAGTGCCACAAAC--ACTGTGCGCTTCGA Oreomyrrhis_taiwaniana TCGAATCCTGCGCTAGCGGAATGACCCGTTAACACGTTTAAA---CATCGGGCAAGCGTCAGGGGGCATAGGA-TCCCCTGTTTGCGATCCCT--AGGTAG---TTGTCCC---CTCACGGGTGTCAACCAGCCAACAAAA-TCAACTGGGCGCTGACTGCGCCAAGGA-AATTAATACTGAATTGTGCGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTTTGAAA-CACATCTTGTTGCCCC-TGA-CCA--AAACAATCT-CCTAAGAGATTTTGTCGGTTTTGGGG-CGGACATTGGCCTCCCGTGCCCTGT--TGTGCGGCTGGCGCAAAAATGAGTCTAT-GGTGACGGTTGTCACGACATTGGTGGTTGTAAGAAG-ACCTTCATGTCTTGTCGTGTTAA-TGCTCGTCACCTTAGTG-AGCTCAATGACCCT-TAAGTGCCACAAAC--ACTGTGCGCTTCGA Orlaya_grandiflora TCGAATCCTGCGAGAGCAGAATGACCCGTAAACATGTAAAAA---CATCGGGGAAGTAACAGGGGGCCTT-GG-TCCCTTGTATGCAAACCCA--AGGCAG---GTGTCCC---CTTATTGGTGTCCACCAGCCAATGAAA-TCAACCGGGCGCTAACTGCGCCAAGGA-AGTTAAAAATGAATTGTTCGTTC-GCTTCTCGTTTGT-GGGAAGCGG-CGTCAGTTGGAAA-CACATTGTGTTGCCCC-AGT-CCA--AGCATCCCT--CTAGGAGATTTT-TTGGATT-GGGGGCGTAAATTGGCCTCCCGTGCCTTGTG-CGTGCGGCTGGCTCAAATGCGAGCCTCT-AGAGATGGAGATCGCGACATCGGTGGTTGTAAGAAG-ACCTTCTTGTTTTGTCGTGTA---TGGCCGTCACCTTAGTT-TGCTCGAGGGCCCT-ATGGCACCACAAAA--TGTGTGCGCTTCAA Orlaya_kochii TCGAATCCTGCGAGAGCAGAGTGACCCGTAAACATGTAAAAA---CATCGGGCAAGCAACTGGGGGCCTT-GG-TCCCTTGTTTGCAAACCCA--AGGCAG---GTGGCCC---CTGATGGGCGTCCGCCAGCCACTGAAA-TCAACCGGGCGCTAACTGCGCCAAGGA-AGTTAAAAATGAATTGTTCGTTC-GCTTCTCATTCGT-GGGAAGTGG-CGTCAGTTGGAAA-CACATTGTGTTGCCCC-AGT-CCA--AGCATCCCT--CTATGAGATTTT-TTGGATT-GGGGGCGTATGTTGGCCTCCCGTGCCTTGTG-TGCGCGGCTGGCTCAAATGGGAGCCTAT-GGTGACGGACATCGTGACATCGGTGGTTGTAAGAAG-ACCTTCTTGTTTTGTCGTGCG---TGGCCGTCACCTTAGTT-TGCTCGAGGGCCCT-TTGGCACCATAAAA--TGTGTGTGCTTCAA Orogenia_fusiformis TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAACA---ATTTGGGCAAGCGTCGGGGGGCTTCGG--TCTCCTGTATGCGAATCCC--TGGTAG---GTGGCCG---CTCCCGGGTGGCCACTGGCCTGCGAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCATTCCAAAA-CACATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGTC-GGTTT-GTTGGCGGAAACTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCCGAAAAACGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGCGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--CGTGTGCGCTTCGA Orogenia_linearifolia TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTTAAAA---ATTTGGGCAAGCGTCGGGGGGCTTCGG--TCTGCTGTATGCGAATCCC--TGGTAG---GTGGTCG---CTCTCGGGTGGACACTGGCCTGCGAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCACCGG-CGTCATTCCAAAA-CACATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GTTGGCGGAAACTGGCCTCCCGTACCTTGT--TGTACGGTTGGCGGAAAAACGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGCGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--CCTGTGCGCTTCGA Pastinaca_sativa TCGAATCCTGCAATAGCAGAATGACCTGCTAACATGTAAGCA---CATTGGGCAAGCGTATGGGGGCTTTGG--TCCCTTGTTAGCGAAACCC--TGGTAGTAGGTGGCCCCC-TTCTTTGGGAGCCACTAGCTTGCCAAA-TCACCCGAGCGCGGTATGCGCCAAGGA-ACTTAAAACTGAATTGTACGTCT-GCATCCCGGTAGC-GGGCAGCGG-CGTCTTTCCAAAA-CACATTCACTTGCCCA-TAA-CCT--CACACTCCT--TGAGGAGCTGTGTT-GGTTT-GGGGGCGGAAATTGGCCTCCCATGCCTTCT--AGCGTGGTTGGCAAAAAAGCGAGTCTCC-GGCTACGGACGTCGTGACATTGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGGGCGAA-TCCGGGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCGGCGCACAC--AATGTGCGCTTCGA Pimpinella_peregrina TCGAATCCTGCGATAGCAGAACCACCCGGTAACACGTAAACA---CATCGGGCTAGCGTCATTGGGCTTCGG--TCCCTTGTCCGCGAACCCC--AGGTAGTT-GTCCCCTTAGATTCTAAGGGGCCACCGGCCGACGAAA-TCATCCGGGCGCGGAATGCGCCAAGGA-ACTTAAAATCGAATTGTATGCTC-GCTTCCCGTTAGC-GGGCAGCGG-CTTCAATCCAAAA-CACATCGACATGCCCC-CAA-CCA--CGCACCCCT--AGAGGAGC-GTGAT-GACTT-GGGGGCGGAAGTTGGCCTCCCGTGCCTTAC--GGCGCGGCTGGCGCAAATGAGAGTCTCT-GGCGACGAACGTCGTGACATTGGTGGTTGTAAAA-G-AACCTATTTCCTTTTCGCGCGTA-TCC--GTCATCTCTTAG-AGCTCTAGGACCCTCTTGGCGGCACACAT--TCTGTGCGCTCCGA Pimpinella_saxifraga TCGAATCCTGCGATAGCAGAACGACCCGGTAACACGTAAACA---CATCGGGCTAGCGTCATTGGGCTTCGG--TCCCTTGTCCGCGAACCCC--AGGTAGGT-GTCCCCGTAGATTCTAAGGGGCCACCGGCCGACGAAA-TCATCCGGGCGCGGAATGCGCCAAGGA-ACTTAAAATCGAATTGTATGCTC-GCTTCCCGTTAGC-GGGCAGCGG-CTTCAATCCAAAA-CACATCGACATGCCCC-CAA-CCG--CGCACCCCT--AGAGGAGC-GTGAT-GACTT-GGGGGCGGAAGTTGGCCTCCCGTGCCTTAC--GGCGCGGCTGGCGCAAATGAGAGTCTCT-GGCGACGAACGTCGTGACATTGGTGGTTGTAAAA-G-AACCTATTTCCTTGTCGCGCGTA-TCC--GTCATCTCTTAG-AGCTCTAGGACCCTCTTGGCGGCACACAT--TCTGTGCGCTCCGA Pleurospermum_foetens TCGATTCCTGCAATAGCAGAACGACCCGCTAACATGTCAAAA---TACTGGGTGAGCAGCGGGGGGCTTTGAG-TGCGCTGTCTGTGAACCCC--TGGACG---ACGGGCA---CTTTTTTGTGCAAATCGGCCAACAAAA-TTAATTGGGCGTGGAATGCGCCAAGGA-AAATAAATA-GAATTGTACGTTA-GCTTCCCGTTTGC-GGGCAGTGG-CGTCTTTCCGAAA-CACATTGTCCCGCCCC---TACCG--CGCGCTCAT-TGA-GC---TGCGCT-GGTTC-GGGG-CGGATACTGGCCTCCCGTGCCAATT--TGCGCGGCTGGCACAAAAATGAGTCTCT-GGCGACAGATGTCGTGACATTGGTGGTTGTAAAAAG-ACCTTTTCATGTT---GCGCGAA-TATTTGTAACCTTAGGG-AGATTGAGGACCCT-TTAGCGCCACCCTC--TCGGAGCGCTCCAA Prionosciadium_turneri TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGGCAAGCGTCGGGGGGCCTTGG--TCTCCTGTCTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTGC-CACTGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACTAAAAATTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCTTTCTAAAA-CATATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGTC-GGTTT-GGGA-CGGAAACTGGCCTCCCGTACGCTGT--CGTGCGGTTGGCGAAAAAATGAGTCTCC-GGCGATGGACATCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGCAAA-TCCTCGTCATTTTAGAG-AGCTACGGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Pseudorlaya_pumila TCGAATCCTGCGATACTAGAATGACCCGTTAACATGTAAAAA---CACTGGGCAAGCAACTTCGGACCTGTGG-TCCCCTGTCTGCAAACCCA--AGGCAG---GTGTCCC---CTTATGGGTGTCCCCTGCCTAATAAAA-TCAACTGGGCGCTAGATGCGCCAAGGA-AGTAAATAATGAATTGTTCGTCC-GCATCTCGTTCGC-GGGAAGTGG-CGGCAGTCCAAAA-CACATCGTGTTGCCCC-TGA-CCA--AACATCTCC--TCCGGAGATTTA-TTTGTTT-AGGGGCGGAAACTGGCCTCCCGTGCCTTTTG-TGTGCGGTTGGCTCAAAAATGAGTCTCT-GGTGACGGGCATCACGACATCGGTGGTTGTAAGAAG-ACCTTCTTGTGTTGTTGTGTA---TGCCCGCCACAGTAGGG-AACTCGAGGGCCCT-TGGGCACTACAAGAATTGTGTGCACTTCGA Rhodosciadium_argutum TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGGCAAGCGTCGGGGGGCCTCGG--TCTCCTGTCTGCCAATCCC--TGGTAG---GTGGCCA---CTCCCGGGGGC-CACTGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-ACTAAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCTTTCCAAAA-CACATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACGCTGT--CGTGCGGTTGGCGAAAAAATGAGTCTCC-GGCGACGGACATCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGCAAA-TCCTCGTCATTTTAGAG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Scandix_pecten_veneris TCAAATCCTGCTTTAGCGGAATGACCCGTTAACTTGTTAAAA---TATTGGGGAAGCTTCAGGGTGCCTCAGG-TCCCTTGTTTGCGATCCCA--GGGTAG---CTGTCCC---CTCACGGG-GTCGGCCAGCCAAAAAAA-TCAACTGGGCGCTAACTGCGCCAAGGA-ATTTTACATTGAATTGATCGTTTTGCTTCTCGTTCGC-GGGCGGCAG-CGTCATTCTAAAA-CCCATCTTGTTGCCTC-TGA-CCA--AACTAATCT-TTTAAATGATTTTGTTGGTTC-GGGGGCGGACATTGGCCTCCTGTGCACTTT--TGTGCGGCTGGCATAAAAATGAGTCTAT-GGTGACGGATGTCACGACATTGGTGGTTGTAATAT--ACCTTCTTGAATTGTCGTGTCTA-AGTCTGTCACTTTAGTAAAGCTCAATGACCCT-TAGGTGCCAAAAAC--TTTTGGTGCATCTA Selinum_candollii TCGAATCCTGCAACAGCAGAATGACCCGCTAACTCGTCAACA---ATTTGGGCAAGCGTCGGGGGGCCTCGG--TCTCCTGTTTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTG-CCACTGGCCTTCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCAGCGG-CGTCATTCTAAAA-CACATTGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGAGCC-GTTTT-GGGGGCGGAAACTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-GCCCTCTTGTCTTGTCGTGCGAA-TCCTCGTCATCTTAGAG-AGCTCCTGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Seseli_montanum TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACA---ATTTGGGCAAGCATCGGGGGGCCTCGG--TCTCCTGTATGCGAGTCCT--TGGTAG---GTGCCCA---CTCCCGGGTGGCCACTGGCCTTCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGAATTGTACGTCC-GTATCCCGTTAGC-GGGCAGCGG-CATCATTCCAAAA-CACATTGTCTTGCCCC-CAAACCA--CTCACACCT---GAGAAGTTGTGCT-GGTTT-GGGG-CGGAAACTGGCCTCCCGTACCTTGT--TGTGCGGTTGGTGGAAAAACGAGTCTCC-GGCGATGGAAGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGTGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA Smyrnium_olusatrum TCGAATCCTGCAATAGCAGAATGACTTGCTAACATGTAAAAA---CACAGGCCTAGCGTTGGGGGCCTTATT--TCCCCCATTTGCGAACCCA--AGGCAG---GTGGCCC---CTTTTGGGTGCCCACTTGCCTAAGTAA-CAATCCCGGCGCGGAATGCGCCAAGGA-AATTAATATTGAATTGTACGTTT-GCTTCTCGTTCAC-GGGAAGTGA-CGACATTCCAAAA-CACATCTTTTTGCCCC---TATCA--CACAATTCT--TTTGGAGATGTGC--GGATT-TGGGGCGGATACTGGCCTCCTGTGCCCTGT--GGTGCAGCTGGCGGAAAACTGAGTCTCT-GGCGATGGACGTCATGACATCGGTGGTTCTAATATTTACCCTCTCGTATTGTCGTGTAAA-TGTTTGTCGCCTTAGTC-AGCTCAAGGACCCT-TAGGTGCCACAAAT--TGTGTGCGCTTTGA Tetrataenium_rigens TCGAATCCTGCAATAGCAGAATGACCCGCTAACATGTAAGCA---CATTGGGCAAGCGTATGGGGGCTTTGC--TCCCCTGTCAGCGAAACCC--TGGTAG---GTGGCCC---TTCTCGGGGGGCCATTGGCCTGCAAAA-TCACTCGGGTGCGGAATGCGCCAAGAA-ACTTAAAACTGAATTGCACGTCT-ACATCCCTTTAGC-GGGCAGTGG-CGTCTTTCCAAAA-CACATTGACTTGCCCA-CAA-CCA--CACACTCCT--TTAGGAGCTGTGCC-GGTTT-AGGG-CGGAAACTGGCCTCCCATGCCTTCT--CGCGTGGTTGGCAGAAAAGCGAGTCTTG-GGCTACGGACGTCGTGACATTGGTGGTTGTAAAA-G-ACCCTCTTGTCTTGTCGGGCGTA-TTCGGATCATCTTATCG-AGCTCCAGGACCCT-TAGGCGGCACACAT--TGTGTGCGCTTCGA Torilis_nodosa TCGAAACCTGCAATAGCAGAACGACCCGTTAACACGTCAAAAAA-CATTGGGCGAGCATCAGGTGGCCCCTAGGGCCCTTGTCTGCAAACCCA--AGGTAG---GTGGCCT---CGCATGGGTGTCCACTAGCCAATTAAA-TAAACCGGGCGCTGACTGCGCCAAGGACAACTAATACAGAATTGTACGTTC-GCTTCTCGTTCGC-GGGCAGCGG-CGTCAGTCTGAAA-CACATCGTGTTGCCCC-T-A-CCA--GACACATCT--CTTTGAGATTT-GCTGGTTTTGGGG-CGGATATTGGCCTCCCGTGCCACGT--TGTGCGGCTGGTGAAAAAATGAGTCTCT-GGCGATGGACGTCACGACATCGGTGGTTGTAATAAG-ACCT---TGTATTGTCGTGTGGA-AGCCCATCCCCTCAGTT-AGCTCAAGGACCCT-TAGGCGCCACGAAT--CGTGTGCGCTTCGA Zizia_aurea TCGAACCCTGCAATAGCAGAATGACCCGCTAACATGTCAACA---ATTCGGGCAAGCGTCGGGGGGCCTCGG--TCTTCTGTCTGCGAATCCC--TGGTAG---GTGGCCA---CTCCCGGGTGGGCACCGGCCTGCAAAA-TCATTCGGGCGCGGAATGCGCCAAGGA-CCTTAAAACTGTATTGTACGTCC-GTATCCCGTTAGC-GGGCATCGG-CGTCATTCCAAAA-CACATCGTCTTGCCCA-CAAACCA--CTCACACCT---GAGAAGTTGTGCC-GGTTT-GGGG-CGGAAATTGGCCTCCCGTACCTTGT--CGTGCGGTTGGCGGAAAAACGAGTCTCC-GGCGACGGACGTCGCGACATCGGTGGTTGTAAAA-G-ACCCTCTTCTCTTGTCGCGCGAA-TCCTCGTCATCTTAGCG-AGCTCCAGGACCCT-TAGGCAGCACACAC--TCTGTGCGCTTCGA ; END; BEGIN CODONS; CODONPOSSET * CodonPositions (CHARACTERS = Apioideae_ITS) = N: 1-475; CODONPOSSET CodonPositions (CHARACTERS = Apioideae_ITS) = N: 1-475; END; BEGIN TREES; TITLE Tb7470; LINK TAXA = Taxa1; TRANSLATE 1 Zizia_aurea, 2 Torilis_nodosa, 3 Tetrataenium_rigens, 4 Smyrnium_olusatrum, 5 Seseli_montanum, 6 Selinum_candollii, 7 Scandix_pecten_veneris, 8 Rhodosciadium_argutum, 9 Pseudorlaya_pumila, 10 Prionosciadium_turneri, 11 Pleurospermum_foetens, 12 Pimpinella_saxifraga, 13 Pimpinella_peregrina, 14 Pastinaca_sativa, 15 Orogenia_linearifolia, 16 Orogenia_fusiformis, 17 Orlaya_kochii, 18 Orlaya_grandiflora, 19 Oreomyrrhis_taiwaniana, 20 Oreomyrrhis_papuana, 21 Oreomyrrhis_hookeri, 22 Oreomyrrhis_eriopoda, 23 Oreomyrrhis_colensoi, 24 Oreomyrrhis_borneensis, 25 Oreomyrrhis_andicola, 26 Neogoezia_minor, 27 Myrrhis_odorata, 28 Myrrhidendron_donnell_smithii, 29 Lomatium_dasycarpum, 30 Lilaeopsis_occidentalis, 31 Laserpitium_siler, 32 Heracleum_lanatum, 33 Erigenia_bulbosa, 34 Endressia_castellana, 35 Enantiophylla_heydeana, 36 Daucus_carota, 37 Crithmum_maritimum, 38 Coulterophytum_laxum, 39 Coriandrum_sativum, 40 Conium_maculatum, 41 Coaxana_purpurea, 42 Chaerophyllum_temulum, 43 Carlesia_sinensis, 44 Arracacia_nelsonii, 45 Arracacia_brandegei, 46 Apium_graveolens, 47 Anthriscus_cerefolium, 48 Angelica_archangelica, 49 Anethum_graveolens, 50 Aethusa_cynapium, 51 Aegopodium_podagraria; TREE Fig._2 = [&R] (11,((((((36,9),(18,17)),31)Daucinae,(((27,47),7),((22,(24,19),21,25,20,23),42))Scandicinae),2)Scandiceae,(51,(((37,(12,13)Pimpinella),(((32,14),3)Heracleum_clade,(((((28,44),((((35,38),45),(8,10)),41)),((43,6),(5,34)),1,48,(29,15,16)),50)Selineae,39),40)),(49,46)Apium_clade))Apioid_superclade,(4,(26,30)Oenantheae)),33); END; BEGIN TREES; TITLE Tb7471; LINK TAXA = Taxa2; TRANSLATE 1 Sphallerocarpus_gracilis, 2 Scandix_pecten_veneris, 3 Osmorhiza_claytonii, 4 Osmorhiza_chilensis, 5 Osmorhiza_aristata, 6 Oreomyrrhis_ramosa_1630_2, 7 Oreomyrrhis_ramosa_1624_2, 8 Oreomyrrhis_ramosa_1621_2, 9 Oreomyrrhis_papuana, 10 Oreomyrrhis_orizabae, 11 Oreomyrrhis_nanhu, 12 Oreomyrrhis_linearis, 13 Oreomyrrhis_involu, 14 Oreomyrrhis_gunnii, 15 Oreomyrrhis_eriopoda_1612_1, 16 Oreomyrrhis_eriopoda_1579_1, 17 Oreomyrrhis_eriopoda_1576_1, 18 Oreomyrrhis_eriopoda_1554_1, 19 Oreomyrrhis_colensoi_1643_2, 20 Oreomyrrhis_colensoi_1641_2, 21 Oreomyrrhis_ciliata_1588_1, 22 Oreomyrrhis_ciliata_1555_1, 23 Oreomyrrhis_ciliata_1614_1, 24 Oreomyrrhis_ciliata_1602_1, 25 Oreomyrrhis_brevipes, 26 Oreomyrrhis_borneensis, 27 Oreomyrrhis_azoreallacea, 28 Oreomyrrhis_argentea, 29 Oreomyrrhis_andicola_1488_1, 30 Oreomyrrhis_andicola_1467_1, 31 Oreomyrrhis_andicola_1479_1, 32 Myrrhis_odorata, 33 Kozlovia_paleacea, 34 Conopodium_ramosum, 35 Chaerophyllum_villarsii, 36 Chaerophyllum_temulentum, 37 Chaerophyllum_tainturieri, 38 Chaerophyllum_procumbens, 39 Chaerophyllum_nodosum, 40 Chaerophyllum_meyeri, 41 Chaerophyllum_magellense, 42 Chaerophyllum_macrospermum, 43 Chaerophyllum_macropodum, 44 Chaerophyllum_libanoticum, 45 Chaerophyllum_khorossanicum, 46 Chaerophyllum_elegans, 47 Chaerophyllum_crinitum, 48 Chaerophyllum_byzantinum, 49 Chaerophyllum_bulbosum, 50 Chaerophyllum_azoricum, 51 Chaerophyllum_aureum, 52 Chaerophyllum_atlanticum, 53 Chaerophyllum_astrantiae, 54 Chaerophyllum_aromaticum, 55 Athamanta_cretensis, 56 Anthriscus_sylvestris, 57 Anthriscus_cerefolium; TREE Fig._4A = [&R] (55,(((((((30,31,29,(28,25,22,21,24,23,16,15),27,(26,13,11),(19,20,8,7,6),18,17,14,12,10,9)Oreomyrrhis,(38,37)),36)Chaerophyllum,((((((54,52),50),49),((53,42),43),51),(48,44),(47,45),40)Chrysocarpum,39)),(46,41,35)Dasypetalon),((((33,(5,(3,4))),32),(57,56)),2)),1),34); END;