#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 03, 2021; 4:06 GMT TreeBASE (cc) 1994-2008 Study reference: Woudenberg J., Groenewald J.Z., Binder M., & Crous P.W. 2013. Alternaria redefined. Studies in Mycology, 75: 171-212. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14312] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=121; TAXLABELS Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS916_96 Alternaria_anigozanthi_CBS121920 Alternaria_arborescens_CBS102605 Alternaria_argyranthemi_CBS116530 Alternaria_armoraciae_CBS118702 Alternaria_avenicola_CBS121459 Alternaria_axiaeriisporifera_CBS118715 Alternaria_brassicae_CBS116528 Alternaria_brassicicola_CBS118699 Alternaria_calycipyricola_CBS121545 Alternaria_capsici_annui_CBS504_74 Alternaria_carotiincultae_CBS109381 Alternaria_cheiranthi_CBS109384 Alternaria_chlamydospora_CBS491_72 Alternaria_cinerariae_CBS116495 Alternaria_conjuncta_CBS196_86 Alternaria_cumini_CBS121329 Alternaria_dauci_CBS117097 Alternaria_daucifolii_CBS118812 Alternaria_dianthicola_CBS116491 Alternaria_elegans_CBS109159 Alternaria_ellipsoidea_CBS119674 Alternaria_eryngii_CBS121339 Alternaria_ethzedia_CBS197_86 Alternaria_gaisen_CBS632_93 Alternaria_geniostomatis_CBS118701 Alternaria_gypsophilae_CBS107_41 Alternaria_helianthiinficiens_CBS117370 Alternaria_helianthiinficiens_CBS208_86 Alternaria_infectoria_CBS210_86 Alternaria_japonica_CBS118390 Alternaria_juxtiseptata_CBS119673 Alternaria_limaciformis_CBS481_81 Alternaria_limoniasperae_CBS102595 Alternaria_longipes_CBS540_94 Alternaria_macrospora_CBS117228 Alternaria_mimicula_CBS118696 Alternaria_molesta_CBS548_81 Alternaria_mouchaccae_CBS119671 Alternaria_nepalensis_CBS118700 Alternaria_nobilis_CBS116490 Alternaria_oregonensis_CBS542_94 Alternaria_panax_CBS482_81 Alternaria_perpunctulata_CBS115267 Alternaria_petroselini_CBS112_41 Alternaria_photistica_CBS212_86 Alternaria_porri_CBS116698 Alternaria_pseudorostrata_CBS119411 Alternaria_radicina_CBS245_67 Alternaria_resedae_CBS115_44 Alternaria_saponariae_CBS116492 Alternaria_selini_CBS109382 Alternaria_septorioides_CBS106_41 Alternaria_simsimi_CBS115265 Alternaria_smyrnii_CBS109380 Alternaria_solani_CBS116651 Alternaria_soliaridae_CBS118387 Alternaria_solidaccana_CBS118698 Alternaria_sonchi_CBS119675 Alternaria_tagetica_CBS479_81 Alternaria_tenuissima_CBS918_96 Alternaria_thalictrigenaCBS121712 Alternaria_triglochinicola_CBS119676 Alternaria_vaccariae_CBS116533 Alternaria_vaccariicola_CBS118714 Botryomyces_caespitosus_CBS177_80 Brachycladium_penicillatum_CBS116608 Chalastospora_cetera_CBS121340 Chalastospora_ellipsoidea_CBS121331 Chalastospora_obclavata_CBS124120 Chmelia_slovaca_CBS567_66 Clathrospora_heterospora_CBS175_52 Comoclathris_magna_CBS_174_52 Crivellia_homothallica_CBS116606 Crivellia_papaveracea_CBS116607 Embellisia_abundans_CBS534_83 Embellisia_allii_CBS339_71 Embellisia_annulata_CBS302_84 Embellisia_chlamydospora_CBS341_71 Embellisia_conoidea_CBS132_89 Embellisia_dennisii_CBS110533 Embellisia_dennisii_CBS476_90 Embellisia_didymospora_CBS766_79 Embellisia_eureka_CBS193_86 Embellisia_hyacinthi_CBS416_71 Embellisia_indefessa_CBS536_83 Embellisia_leptinellae_CBS477_90 Embellisia_lolii_CBS115266 Embellisia_novae_zelandiae_CBS478_90 Embellisia_phragmospora_CBS274_70 Embellisia_planifunda_CBS537_83 Embellisia_proteae_CBS475_90 Embellisia_tellustris_CBS538_83 Embellisia_tumida_CBS539_83 Nimbya_caricis_CBS480_90 Nimbya_gomphrenae_CBS108_27 Nimbya_scirpicola_CBS481_90 Pleospora_tarda_CBS714_68 Sinomyces_alternariae_CBS126989 Stemphylium_herbarum_CBS191_86 Teretispora_leucanthemi_CBS421_65 Teretispora_leucanthemi_CBS422_65 Ulocladium_arborescens_CBS115269 Ulocladium_atrum_CBS195_67 Ulocladium_botrytis_CBS198_67 Ulocladium_botrytisCBS197_67 Ulocladium_brassicae_CBS121493 Ulocladium_cantlous_CBS123007 Ulocladium_capsicuma_CBS120006 Ulocladium_chartarum_CBS200_67 Ulocladium_consortiale_CBS104_31 Ulocladium_cucurbitae_CBS483_81 Ulocladium_multiforme_CBS102060 Ulocladium_obovoideum_CBS101229 Ulocladium_oudemansiiCBS114_07 Ulocladium_septosporum_CBS109_38 Ulocladium_solani_CBS123376 Ulocladium_subcucurbitae_CBS121491 Ulocladium_tuberculatum_CBS202_67 Undifilum_bornmuelleri_DAOM231361 ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=121; TAXLABELS Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS916_96 Alternaria_anigozanthi_CBS121920 Alternaria_arborescens_CBS102605 Alternaria_argyranthemi_CBS116530 Alternaria_armoraciae_CBS118702 Alternaria_avenicola_CBS121459 Alternaria_axiaeriisporifera_CBS118715 Alternaria_brassicae_CBS116528 Alternaria_brassicicola_CBS118699 Alternaria_calycipyricola_CBS121545 Alternaria_capsici_annui_CBS504_74 Alternaria_carotiincultae_CBS109381 Alternaria_cheiranthi_CBS109384 Alternaria_chlamydospora_CBS491_72 Alternaria_cinerariae_CBS116495 Alternaria_conjuncta_CBS196_86 Alternaria_cumini_CBS121329 Alternaria_dauci_CBS117097 Alternaria_daucifolii_CBS118812 Alternaria_dianthicola_CBS116491 Alternaria_elegans_CBS109159 Alternaria_ellipsoidea_CBS119674 Alternaria_eryngii_CBS121339 Alternaria_ethzedia_CBS197_86 Alternaria_gaisen_CBS632_93 Alternaria_geniostomatis_CBS118701 Alternaria_gypsophilae_CBS107_41 Alternaria_helianthiinficiens_CBS117370 Alternaria_helianthiinficiens_CBS208_86 Alternaria_infectoria_CBS210_86 Alternaria_japonica_CBS118390 Alternaria_juxtiseptata_CBS119673 Alternaria_limaciformis_CBS481_81 Alternaria_limoniasperae_CBS102595 Alternaria_longipes_CBS540_94 Alternaria_macrospora_CBS117228 Alternaria_mimicula_CBS118696 Alternaria_molesta_CBS548_81 Alternaria_mouchaccae_CBS119671 Alternaria_nepalensis_CBS118700 Alternaria_nobilis_CBS116490 Alternaria_oregonensis_CBS542_94 Alternaria_panax_CBS482_81 Alternaria_perpunctulata_CBS115267 Alternaria_petroselini_CBS112_41 Alternaria_photistica_CBS212_86 Alternaria_porri_CBS116698 Alternaria_pseudorostrata_CBS119411 Alternaria_radicina_CBS245_67 Alternaria_resedae_CBS115_44 Alternaria_saponariae_CBS116492 Alternaria_selini_CBS109382 Alternaria_septorioides_CBS106_41 Alternaria_simsimi_CBS115265 Alternaria_smyrnii_CBS109380 Alternaria_solani_CBS116651 Alternaria_soliaridae_CBS118387 Alternaria_solidaccana_CBS118698 Alternaria_sonchi_CBS119675 Alternaria_tagetica_CBS479_81 Alternaria_tenuissima_CBS918_96 Alternaria_thalictrigenaCBS121712 Alternaria_triglochinicola_CBS119676 Alternaria_vaccariae_CBS116533 Alternaria_vaccariicola_CBS118714 Botryomyces_caespitosus_CBS177_80 Brachycladium_penicillatum_CBS116608 Chalastospora_cetera_CBS121340 Chalastospora_ellipsoidea_CBS121331 Chalastospora_obclavata_CBS124120 Chmelia_slovaca_CBS567_66 Clathrospora_heterospora_CBS175_52 Comoclathris_magna_CBS174_52 Crivellia_homothallica_CBS116606 Crivellia_papaveracea_CBS116607 Embellisia_abundans_CBS534_83 Embellisia_allii_CBS339_71 Embellisia_annulata_CBS302_84 Embellisia_chlamydospora_CBS341_71 Embellisia_conoidea_CBS132_89 Embellisia_dennisii_CBS110533 Embellisia_dennisii_CBS476_90 Embellisia_didymospora_CBS766_79 Embellisia_eureka_CBS193_86 Embellisia_hyacinthi_CBS416_71 Embellisia_indefessa_CBS536_83 Embellisia_leptinellae_CBS477_90 Embellisia_lolii_CBS115266 Embellisia_novae_zelandiae_CBS478_90 Embellisia_phragmospora_CBS274_70 Embellisia_planifunda_CBS537_83 Embellisia_proteae_CBS475_90 Embellisia_tellustris_CBS538_83 Embellisia_tumida_CBS539_83 Nimbya_caricis_CBS480_90 Nimbya_gomphrenae_CBS108_27 Nimbya_scirpicola_CBS481_90 Pleospora_tarda_CBS714_68 Sinomyces_alternariae_CBS126989 Stemphylium_herbarum_CBS191_86 Teretispora_leucanthemi_CBS421_65 Teretispora_leucanthemi_CBS422_65 Ulocladium_arborescens_CBS115269 Ulocladium_atrum_CBS195_67 Ulocladium_botrytis_CBS198_67 Ulocladium_botrytisCBS197_67 Ulocladium_brassicae_CBS121493 Ulocladium_cantlous_CBS123007 Ulocladium_capsicuma_CBS120006 Ulocladium_chartarum_CBS200_67 Ulocladium_consortiale_CBS104_31 Ulocladium_cucurbitae_CBS483_81 Ulocladium_multiforme_CBS102060 Ulocladium_obovoideum_CBS101229 Ulocladium_oudemansiiCBS114_07 Ulocladium_septosporum_CBS109_38 Ulocladium_solani_CBS123376 Ulocladium_subcucurbitae_CBS121491 Ulocladium_tuberculatum_CBS202_67 Undifilum_bornmuelleri_DAOM231361 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=121; TAXLABELS Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS916_96 Alternaria_anigozanthi_CBS121920 Alternaria_arborescens_CBS102605 Alternaria_argyranthemi_CBS116530 Alternaria_armoraciae_CBS118702 Alternaria_avenicola_CBS121459 Alternaria_axiaeriisporifera_CBS118715 Alternaria_brassicae_CBS116528 Alternaria_brassicicola_CBS118699 Alternaria_calycipyricola_CBS121545 Alternaria_capsici_annui_CBS504_74 Alternaria_carotiincultae_CBS109381 Alternaria_cheiranthi_CBS109384 Alternaria_chlamydospora_CBS491_72 Alternaria_cinerariae_CBS116495 Alternaria_conjuncta_CBS196_86 Alternaria_cumini_CBS121329 Alternaria_dauci_CBS117097 Alternaria_daucifolii_CBS118812 Alternaria_dianthicola_CBS116491 Alternaria_elegans_CBS109159 Alternaria_ellipsoidea_CBS119674 Alternaria_eryngii_CBS121339 Alternaria_ethzedia_CBS197_86 Alternaria_gaisen_CBS632_93 Alternaria_geniostomatis_CBS118701 Alternaria_gypsophilae_CBS107_41 Alternaria_helianthiinficiens_CBS117370 Alternaria_helianthiinficiens_CBS208_86 Alternaria_infectoria_CBS210_86 Alternaria_japonica_CBS118390 Alternaria_juxtiseptata_CBS119673 Alternaria_limaciformis_CBS481_81 Alternaria_limoniasperae_CBS102595 Alternaria_longipes_CBS540_94 Alternaria_macrospora_CBS117228 Alternaria_mimicula_CBS118696 Alternaria_molesta_CBS548_81 Alternaria_mouchaccae_CBS119671 Alternaria_nepalensis_CBS118700 Alternaria_nobilis_CBS116490 Alternaria_oregonensis_CBS542_94 Alternaria_panax_CBS482_81 Alternaria_perpunctulata_CBS115267 Alternaria_petroselini_CBS112_41 Alternaria_photistica_CBS212_86 Alternaria_porri_CBS116698 Alternaria_pseudorostrata_CBS119411 Alternaria_radicina_CBS245_67 Alternaria_resedae_CBS115_44 Alternaria_saponariae_CBS116492 Alternaria_selini_CBS109382 Alternaria_septorioides_CBS106_41 Alternaria_simsimi_CBS115265 Alternaria_smyrnii_CBS109380 Alternaria_solani_CBS116651 Alternaria_soliaridae_CBS118387 Alternaria_solidaccana_CBS118698 Alternaria_sonchi_CBS119675 Alternaria_tagetica_CBS479_81 Alternaria_tenuissima_CBS918_96 Alternaria_thalictrigena_CBS121712 Alternaria_triglochinicola_CBS119676 Alternaria_vaccariae_CBS116533 Alternaria_vaccariicola_CBS118714 Botryomyces_caespitosus_CBS177_80 Brachycladium_penicillatum_CBS116608 Chalastospora_cetera_CBS121340 Chalastospora_ellipsoidea_CBS121331 Chalastospora_obclavata_CBS124120 Chmelia_slovaca_CBS567_66 Clathrospora_heterospora_CBS175_52 Comoclathris_magna_CBS174_52 Crivellia_homothallica_CBS116606 Crivellia_papaveracea_CBS116607 Embellisia_abundans_CBS534_83 Embellisia_allii_CBS339_71 Embellisia_annulata_CBS302_84 Embellisia_chlamydospora_CBS341_71 Embellisia_conoidea_CBS132_89 Embellisia_dennisii_CBS110533 Embellisia_dennisii_CBS476_90 Embellisia_didymospora_CBS766_79 Embellisia_eureka_CBS193_86 Embellisia_hyacinthi_CBS416_71 Embellisia_indefessa_CBS536_83 Embellisia_leptinellae_CBS477_90 Embellisia_lolii_CBS115266 Embellisia_novae_zelandiae_CBS478_90 Embellisia_phragmospora_CBS274_70 Embellisia_planifunda_CBS537_83 Embellisia_proteae_CBS475_90 Embellisia_tellustris_CBS538_83 Embellisia_tumida_CBS539_83 Nimbya_caricis_CBS480_90 Nimbya_gomphrenae_CBS108_27 Nimbya_scirpicola_CBS481_90 Pleospora_tarda_CBS714_68 Sinomyces_Alternariae_CBS126989 Stemphylium_herbarumCBS191_86 Teretispora_leucanthemi_CBS421_65 Teretispora_leucanthemi_CBS422_65 Ulocladium_arborescens_CBS115269 Ulocladium_atrum_CBS195_67 Ulocladium_botrytis_CBS197_67 Ulocladium_botrytis_CBS198_67 Ulocladium_brassicae_CBS121493 Ulocladium_cantlous_CBS123007 Ulocladium_capsicuma_CBS120006 Ulocladium_chartarum_CBS200_67 Ulocladium_consortiale_CBS104_31 Ulocladium_cucurbitae_CBS483_81 Ulocladium_multiforme_CBS102060 Ulocladium_obovoideum_CBS101229 Ulocladium_oudemansii_CBS114_07 Ulocladium_septosporum_CBS109_38 Ulocladium_solani_CBS123376 Ulocladium_subcucurbitae_CBS121491 Ulocladium_tuberculatum_CBS202_67 Undifilum_bornmuelleri_DAOM231361 ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=121; TAXLABELS Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS916_96 Alternaria_anigozanthi_CBS121920 Alternaria_arborescens_CBS102605 Alternaria_argyranthemi_CBS116530 Alternaria_armoraciae_CBS118702 Alternaria_avenicola_CBS121459 Alternaria_axiaeriisporifera_CBS118715 Alternaria_brassicae_CBS116528 Alternaria_brassicicola_CBS118699 Alternaria_calycipyricola_CBS121545 Alternaria_capsici_annui_CBS504_74 Alternaria_carotiincultae_CBS109381 Alternaria_cheiranthi_CBS109384 Alternaria_chlamydospora_CBS491_72 Alternaria_cinerariae_CBS116495 Alternaria_conjuncta_CBS196_86 Alternaria_cumini_CBS121329 Alternaria_dauci_CBS117097 Alternaria_daucifolii_CBS118812 Alternaria_dianthicola_CBS116491 Alternaria_elegans_CBS109159 Alternaria_ellipsoidea_CBS119674 Alternaria_eryngii_CBS121339 Alternaria_ethzedia_CBS197_86 Alternaria_gaisen_CBS632_93 Alternaria_geniostomatis_CBS118701 Alternaria_gypsophilae_CBS107_41 Alternaria_helianthiinficiens_CBS117370 Alternaria_helianthiinficiens_CBS208_86 Alternaria_infectoria_CBS210_86 Alternaria_japonica_CBS118390 Alternaria_juxtiseptata_CBS119673 Alternaria_limaciformis_CBS481_81 Alternaria_limoniasperae_CBS102595 Alternaria_longipes_CBS540_94 Alternaria_macrospora_CBS117228 Alternaria_mimicula_CBS118696 Alternaria_molesta_CBS548_81 Alternaria_mouchaccae_CBS119671 Alternaria_nepalensis_CBS118700 Alternaria_nobilis_CBS116490 Alternaria_oregonensis_CBS542_94 Alternaria_panax_CBS482_81 Alternaria_perpunctulata_CBS115267 Alternaria_petroselini_CBS112_41 Alternaria_photistica_CBS212_86 Alternaria_porri_CBS116698 Alternaria_pseudorostrata_CBS119411 Alternaria_radicina_CBS245_67 Alternaria_resedae_CBS115_44 Alternaria_saponariae_CBS116492 Alternaria_selini_CBS109382 Alternaria_septorioides_CBS106_41 Alternaria_simsimi_CBS115265 Alternaria_smyrnii_CBS109380 Alternaria_solani_CBS116651 Alternaria_soliaridae_CBS118387 Alternaria_solidaccana_CBS118698 Alternaria_sonchi_CBS119675 Alternaria_tagetica_CBS479_81 Alternaria_tenuissima_CBS918_96 Alternaria_thalictrigena_CBS121712 Alternaria_triglochinicola_CBS119676 Alternaria_vaccariae_CBS116533 Alternaria_vaccariicola_CBS118714 Botryomyces_caespitosus_CBS177_80 Brachycladium_penicillatum_CBS116608 Chalastospora_cetera_CBS121340 Chalastospora_ellipsoidea_CBS121331 Chalastospora_obclavata_CBS124120 Chmelia_slovaca_CBS567_66 Clathrospora_heterospora_CBS175_52 Comoclathris_magna_CBS174_52 Crivellia_homothallica_CBS116606 Crivellia_papaveracea_CBS116607 Embellisia_abundans_CBS534_83 Embellisia_allii_CBS339_71 Embellisia_annulata_CBS302_84 Embellisia_chlamydospora_CBS341_71 Embellisia_conoidea_CBS132_89 Embellisia_dennisii_CBS110533 Embellisia_dennisii_CBS476_90 Embellisia_didymospora_CBS766_79 Embellisia_eureka_CBS193_86 Embellisia_hyacinthi_CBS416_71 Embellisia_indefessa_CBS536_83 Embellisia_leptinellae_CBS477_90 Embellisia_lolii_CBS115266 Embellisia_novae_zelandiae_CBS478_90 Embellisia_phragmospora_CBS274_70 Embellisia_planifunda_CBS537_83 Embellisia_proteae_CBS475_90 Embellisia_tellustris_CBS538_83 Embellisia_tumida_CBS539_83 Nimbya_caricis_CBS480_90 Nimbya_gomphrenae_CBS108_27 Nimbya_scirpicola_CBS481_90 Pleospora_tarda_CBS714_68 Sinomyces_alternariae_CBS126989 Stemphylium_herbarumCBS191_86 Teretispora_leucanthemi_CBS421_65 Teretispora_leucanthemi_CBS422_65 Ulocladium_arborescens_CBS115269 Ulocladium_atrum_CBS195_67 Ulocladium_botrytis_CBS197_67 Ulocladium_botrytis_CBS198_67 Ulocladium_brassicae_CBS121493 Ulocladium_cantlous_CBS123007 Ulocladium_capsicuma_CBS120006 Ulocladium_chartarum_CBS200_67 Ulocladium_consortiale_CBS104_31 Ulocladium_cucurbitae_CBS483_81 Ulocladium_multiforme_CBS102060 Ulocladium_obovoideum_CBS101229 Ulocladium_oudemansii_CBS114_07 Ulocladium_septosporum_CBS109_38 Ulocladium_solani_CBS123376 Ulocladium_subcucurbitae_CBS121491 Ulocladium_tuberculatum_CBS202_67 Undifilum_bornmuelleri_DAOM231361 ; END; BEGIN TAXA; TITLE Taxa5; DIMENSIONS NTAX=121; TAXLABELS Alternaria_alternantherae_CBS124392 Alternaria_alternata_CBS916_96 Alternaria_anigozanthi_CBS121920 Alternaria_arborescens_CBS102605 Alternaria_argyranthemi_CBS116530 Alternaria_armoraciae_CBS118702 Alternaria_avenicola_CBS121459 Alternaria_axiaeriisporifera_CBS118715 Alternaria_brassicae_CBS116528 Alternaria_brassicicola_CBS118699 Alternaria_calycipyricola_CBS121545 Alternaria_capsici_annui_CBS504_74 Alternaria_carotiincultae_CBS109381 Alternaria_cheiranthi_CBS109384 Alternaria_chlamydospora_CBS491_72 Alternaria_cinerariae_CBS116495 Alternaria_conjuncta_CBS196_86 Alternaria_cumini_CBS121329 Alternaria_dauci_CBS117097 Alternaria_daucifolii_CBS118812 Alternaria_dianthicola_CBS116491 Alternaria_elegans_CBS109159 Alternaria_ellipsoidea_CBS119674 Alternaria_eryngii_CBS121339 Alternaria_ethzedia_CBS197_86 Alternaria_gaisen_CBS632_93 Alternaria_geniostomatis_CBS118701 Alternaria_gypsophilae_CBS107_41 Alternaria_helianthiinficiens_CBS117370 Alternaria_helianthiinficiens_CBS208_86 Alternaria_infectoria_CBS210_86 Alternaria_japonica_CBS118390 Alternaria_juxtiseptata_CBS119673 Alternaria_limaciformis_CBS481_81 Alternaria_limoniasperae_CBS102595 Alternaria_longipes_CBS540_94 Alternaria_macrospora_CBS117228 Alternaria_mimicula_CBS118696 Alternaria_molesta_CBS548_81 Alternaria_mouchaccae_CBS119671 Alternaria_nepalensis_CBS118700 Alternaria_nobilis_CBS116490 Alternaria_oregonensis_CBS542_94 Alternaria_panax_CBS482_81 Alternaria_perpunctulata_CBS115267 Alternaria_petroselini_CBS112_41 Alternaria_photistica_CBS212_86 Alternaria_porri_CBS116698 Alternaria_pseudorostrata_CBS119411 Alternaria_radicina_CBS245_67 Alternaria_resedae_CBS115_44 Alternaria_saponariae_CBS116492 Alternaria_selini_CBS109382 Alternaria_septorioides_CBS106_41 Alternaria_simsimi_CBS115265 Alternaria_smyrnii_CBS109380 Alternaria_solani_CBS116651 Alternaria_soliaridae_CBS118387 Alternaria_solidaccana_CBS118698 Alternaria_sonchi_CBS119675 Alternaria_tagetica_CBS479_81 Alternaria_tenuissima_CBS918_96 Alternaria_thalictrigenaCBS121712 Alternaria_triglochinicola_CBS119676 Alternaria_vaccariae_CBS116533 Alternaria_vaccariicola_CBS118714 Botryomyces_caespitosus_CBS177_80 Brachycladium_penicillatum_CBS116608 Chalastospora_cetera_CBS121340 Chalastospora_ellipsoidea_CBS121331 Chalastospora_obclavata_CBS124120 Chmelia_slovaca_CBS567_66 Clathrospora_heterospora_CBS175_52 Comoclathris_magna_CBS174_52 Crivellia_homothallica_CBS116606 Crivellia_papaveracea_CBS116607 Embellisia_abundans_CBS534_83 Embellisia_allii_CBS339_71 Embellisia_annulata_CBS302_84 Embellisia_chlamydospora_CBS341_71 Embellisia_conoidea_CBS132_89 Embellisia_dennisii_CBS110533 Embellisia_dennisii_CBS476_90 Embellisia_didymospora_CBS766_79 Embellisia_eureka_CBS193_86 Embellisia_hyacinthi_CBS416_71 Embellisia_indefessa_CBS536_83 Embellisia_leptinellae_CBS477_90 Embellisia_lolii_CBS115266 Embellisia_novae_zelandiae_CBS478_90 Embellisia_phragmospora_CBS274_70 Embellisia_planifunda_CBS537_83 Embellisia_proteae_CBS475_90 Embellisia_tellustris_CBS538_83 Embellisia_tumida_CBS539_83 Nimbya_caricis_CBS480_90 Nimbya_gomphrenae_CBS108_27 Nimbya_scirpicola_CBS481_90 Pleospora_tarda_CBS714_68 Sinomyces_alternariae_CBS126989 Stemphylium_herbarum_CBS191_86 Teretispora_leucanthemi_CBS421_65 Teretispora_leucanthemi_CBS422_65 Ulocladium_arborescens_CBS115269 Ulocladium_atrum_CBS195_67 Ulocladium_botrytis_CBS198_67 Ulocladium_botrytisCBS197_67 Ulocladium_brassicae_CBS121493 Ulocladium_cantlous_CBS123007 Ulocladium_capsicuma_CBS120006 Ulocladium_chartarum_CBS200_67 Ulocladium_consortiale_CBS104_31 Ulocladium_cucurbitae_CBS483_81 Ulocladium_multiforme_CBS102060 Ulocladium_obovoideum_CBS101229 Ulocladium_oudemansiiCBS114_07 Ulocladium_septosporum_CBS109_38 Ulocladium_solani_CBS123376 Ulocladium_subcucurbitae_CBS121491 Ulocladium_tuberculatum_CBS202_67 Undifilum_bornmuelleri_DAOM231361 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17365] TITLE All_Character_Matrix; LINK TAXA = Taxa3; DIMENSIONS NCHAR=4077; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAGATATGAAGGCGGGGCTGGAACCTCTCGGGGTT----------------------------------GCAGTC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCA--TGAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ACAATC-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCTGGCTTTGC-TGGAGACTCGCCTTAAAGGAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG--CCACGGTCTGGCA-TCCATGAAGCC--TTTTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCG-CCCAACTCGCCGATACAAT-CTATCCGAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----GCCAGG-CCATCCA-AATCGTGACG-ATAGTCCTTGCGATGCGCT-GAAGCTCCTCTGTGG-TCGCAGAATGCACGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACCAACACCCCTGTTGGTCGTGATGGAAAGCTGGCAAAGCCGCGACAACTCCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGGAACATGCAGCTTCTGGAAGAGTATGATCAAAATCAGAACCCCGACGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTCCGACGAAACGGAACCCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTATTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACTAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAGGAGGAGGAGACGGCCATGATAACATTCTCCCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAACTGGGCCTGCCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCCCGTATCCATGTATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS916_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_anigozanthi_CBS121920 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATCCCGACACGGGGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAAGAAGGC-GGGCTGGCTCTCTCCGGAGGA----------------------------------CTGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACAAACCA--TAAACC--TATTGTAATGGCAATCAGCGTCAGTAA-CAAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCGGC-TCGC-TGGAGACTCGCCTTAAAGTGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----ACATTTTCCACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-GCTGCTCCACTGATACAATTGATCAAAAGCTGACCGC-GTGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCGATGCGAT-GGTACCGTTGCCTTG-TCATAGAGCGCAGGCTAATATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCGCATATGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTAGGTGTCCACTCCAACGCTCAACAGCTCGTTACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTTACAGACGCTGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAACCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAAGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTGATCCAGGACGGTGTTGTCGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCCGAGGATCTCGAGGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCATCGTCTCCGACGCCTCAAGCCGCTACCAGACCCACGCATCCATGTATAACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTT-------TAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACACGC-AATCTTCCTCGCTAT--GTTGGCTACAGCTAGCTAATAATCCTCACAGGAAGCTGCCGAACTC Alternaria_arborescens_CBS102605 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTCCGACGTCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_argyranthemi_CBS116530 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCTAACAGTGCAGTTGCATTGCAGTGTGCGCTGTTGGGG---CCAGTC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCGTAAGGACAATTCA--TAAACC-TTTTTGTAATTGCAATCAGCGTCAGTAA-CAAT--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC-----TTTCTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CACGCTTCATCGATACCATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTCAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGACTACA--CACGATACAG----CCACAG-CCGTCCATTCTCGAGACA-TCAGTTCTCGCCATGCGAT-GGAGCTATCTCATGG-CCGCAGAACACAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGAAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGATGGCAAGCTGGCTAAGCCGCGACAACTTCACAATTCCCACTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCGTCACCCATCATCGATTTCATGACACAACGAAACATGCAACTTTTGGAAGAGTACGACCAAAACCAGAACCCCGACGCAACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACCCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAGGAGACAAGCACGCGACAGGGATGGAGTCAAGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAGGAGGAGGAGACCGCCATGATAACCTTCTCTCCCGAAGATCTGGAAGAGTGGCGGGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTACGGCATCACTTTTCCTTC-----ATACGG-ACAATCGCGCCCAATCA--GATGCATCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TATTTTGGGCGG-TGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCTCAC------TCTGGCCAAAGCATGCTAACAAGCCTCTCAGGAAGCCGCCGAACTC Alternaria_armoraciae_CBS118702 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATCCCTCCTGCTGGGCACTGCTTCACGGCGTGCGCAGTAGGGG-----CCGGCC-CTGCTGAACTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAACCA--TAAACC-TTTTTGTAATAGCAATCCGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCCAGC-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTTCATCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC------TTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GAGCTATTGTGCTA-TCGCAGGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACTTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGAAAGCTAGACAAGCCGCGACAGCTTCACAACACCCACTGGGGTCTTGTCTGCCCCGCTGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAGAACCAGAACCCAGACGCGACCAAGGTATTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAGCTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTTTCTTACTAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTTAAGCAGGAGCAACAAGAAACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATTTGGAAGAATGGCGAGAGATGAAGCAGGGTCTGCCTGCAGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCCGACCCACGCATCCACGTACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_avenicola_CBS121459 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTCTCGGGAGG----------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACGCTGTCCCATGTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_axiaeriisporifera_CBS118715 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGAAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCAATCCACAAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGTATCCACGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--AGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_brassicae_CBS116528 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGTCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-AGGCTGAAATCTCTCGAGACG----------------------------------ACGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCTA-TAAACC--TTTTGTAATTGAAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CAAAGGTC-AGTA-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGCTTCG-CCCATTCGATTGATACAACTATATCGAAGCTGACCGC-GTGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-TCCAAGCATC--CACACTACAG----CTACAG-CCATCCA-GGTCGCGACA-CCAGTCCTTGCGATGCGCT-AGAGCTCCT-----------AGAATGCAGGCTAACATA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCAGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCTACACTGTCCCATGTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCATAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTTGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAATCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACGGTCGTTCAAGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGGCCACTTTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCCACCACCTTATCTTCACCAAGGACATTAGCAACAAGCTTAAGCAGGAACAACAAGAGACGAGCACGCGACAGGGATGGAGCCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGTCTTATTCAGGATGGTGTAGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCTGAAGATCTGGAAGAGTGGCGAGAGATGAAGCAGGGCTTGCCTGCTGCGGAGCGATCTACTGAGGGTGAACACCGTCTCCGACGTCTCAAGCCACTACCAGACCCCCGTATCCATGTTTGGCATCACTTTTCCTTT-----ACACGC-ACAGTTGCGTCCACTCGGTGTATCCTCTGAGCGCGCAGCCA-TATCCT-GGTTTTT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCGTGCGG-CCCTCGC--GAACCCCAACACG------ATGACGCACATGC-AATTTCTATAT------TTTGGCTACAGCAAACTGACAAGTCTAACAGGAAGCCGCCGAACTC Alternaria_brassicicola_CBS118699 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCACCTCAGCAGCATCTGCTGTTGGGG-------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCATAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_calycipyricola_CBS121545 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTCTCGGGAGG----------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_capsici_annui_CBS504_74 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGGGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG----CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAATA-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAATCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_carotiincultae_CBS109381 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGAATCTTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAACAAAC-GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC----TCTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTGA-CCCATTGCGTCGATACAGT-GTATCAAAGCTGACGGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTC-CCTAAGCACC--CGCGCTACAG----CCACAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAGTGCTGGCTAACACA--TCTAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACGCTGTCACATTTGCGTCGAACAAACACTCCCGTTGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATCCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_cheiranthi_CBS109384 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTTGGAATCCTTCGGGGTTC--------------------------------TCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTTGGTGGGCTCGCCCACCA-TAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTCCA-CCCGCTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACCCACACACTACTG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTATTCCACGG-TCGCAGATTACAAGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGAAGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAATCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGTGACGCTTCACCCATTATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGTCTCATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGTCTACCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATTCATGTACGACATGACTTTGCTTTC-----ACATGG-ATAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACA------------------TCC-AATTCTGCTAT------TCTGGCCACAGTGCGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_chlamydospora_CBS491_72 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAAGAAGGC-GGGCTGGATACCCCCAGCAGTGCGTTGCTTCGCGGCGTGCGCTGTTGGG------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAACCCCA-TAAACC-TTTTTGTAATAGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-ATCCAG--CCAAGGTC-AGCG-TCCAGTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCC-CTCGCTCCAAGGATGCGGCAATATTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACA--T-GAAAACAG----TCACCG-CCATCCC-TCCCGCAGCA-TCAGTCCTTGGGATGCGAT-GGAGCTACGGTACAA-TCGCAGGATGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGAGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGGACCAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGGCAGGCTTGTGGTCTGGTCAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGATTTCATGACGCAGCGAAACATGCAACTTTTGGAGGAATACGACCAGAATCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTTCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTTTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTGGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCCACCGAAGGCGAGCACCGTCTTCGACGCCTGAAGCCGCTGCCAGATCCACGCATCCATGTATGGCATCACATCTCTTTC-----AAATGG-ACGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAATCCCCAGCACC------ATGACGCACATGC-AATTTCCCTAC------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_cinerariae_CBS116495 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAATAATGAAGGC-GGGCTGCACTCTCTCGGGAGG----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ACAATA-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGTTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TACCAG--CCAAGGTC-AGCA-TCCATCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTCCCG-CCCATTCGATTGATGCAATTATATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCGGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCTAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCGCGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTTCACGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACACTATCCCATTTGCGGCGCACAAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGTCAACTTCACAACTCTCATTGGGGTCTTGTCTGTCCTGCGGAGACTCCTGAAGGACAAGCTTGTGGCCTTGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAATGGAACTCTATCTTACGAGATGAGTCTGATTCGTGACATTCGCGACAGAGAGTTCAAGATCTTCACAGACGCCGGCCGTGTCATGAGACCACTTTTCGTTGTCGAGAATGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAGGCACGCGACAAGGATGGAGCCAGGACGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATTCAGGACGGTGTTGTGGAGTACCTAGACGCCGAGGAAGAGGAGACCGCCATGATAACGTTCTCCCCAGAAGACCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCGCTGCCAGATCCCCGTATCCATGTATGGCATCACTTTCCTTTC-----ACGCGGCACAGTTGCGTCCACTCGGCGCATCC-CTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------TTTGGCTACATCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_conjuncta_CBS196_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAAGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATATTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACCAGGC-GGGCTGGACACCCCCCGCTGGGCACTGCTTCACGGCGTGCGCGGCGGGG------CCGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCGCCCTCAGGACCAACCA--CAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-CGCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC-----TTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAACAGCCCACCCA-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGGCTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACATTGTCGCATTTGCGTCGAACGAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGTCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATTGACTTCATGACACAGCGAAACATGCAGCTTCTGGAAGAGTACGACCAAAATCAGAACCCAGATGCGACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTATTCGTGGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTAATCTTTACCAAGGAAATCAGTAACAAGCTGAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCCGAGGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGCTCTACCGAAGGCGAGCATCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCTGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCTTCAGTTTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_cumini_CBS121329 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTGTCAATACGACGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAAGAAGGC-GGGCTGGGCCCTCTCCGGAGGA---------------------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACAAACCA--TAAACC--TTTTGCAATGGCAATCAGCGTCAGTAA-CAAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCT------TCCC-AGAAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGTTCCGCTGATACAGCTGATCAAACACTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCACAG-CCATCCA-CCGCCCGATA-CCAATCTTCGCAATGCCAT-GGAGCCATTGCACGA-TCGCAGAACACAGGCTAACACATGCACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCAGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGTGTCCACTCCAACGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCGAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAGCAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGACGAGGTCGAACAAGCTACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTGGAATACTTGGACGCCGAAGAGGAAGAGACTGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCTCGCATTCATGTATGGCATCACTTTTCTTTC-----ATGCGC-ACAGTTGCATCCCCTTGGTGTATCCTCTGAGCGCGCAGCTG-GTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGTTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CATTCGC--GAAATGCAACACC------ATGACGCAGTTTC---------CAT------TCTGGTCACAGCACGCTAAGAACCCTTCCAGGAAGCCGCCGAACTC Alternaria_dauci_CBS117097 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC-TTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGCACCTCTCGGGGTG----------------------------------GCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAATCCA-TAAACC-TTTTTGTAATGGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCCC--TTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAGCCCCAAGGTCTAGCA-TCCAACAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCG-CCCAAATCATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-CTAGTCATTGCGATGCGCT-AGAGCTTCTCTACAG-CTGCAGAACGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATCACTTTTCCTTTC----ACACGC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTACTTATGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTC Alternaria_daucifolii_CBS118812 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_dianthicola_CBS116491 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGCGGGGCTGGCATCCTTTCGGGGGTT--------------------------------ACAGCC-TGGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCA-TAGGACAAACCAC-TAAACC--TTTTGTAATTGCAATCAGCGTCAATAA-CAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TCCCAG--CCAAGGTC-AGCG-TCCACGAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-TCCGATCTGCCAACACAATCGTATCAATGCTAACCCC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTTCCCCAAGCACC--CAAACTACAGC---TCAAAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-CGAGGCACCTCACAG-CCGTAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAATCTCACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCTGAAACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATTATCGACTTCATGACACAGCGAAATATGCAACTTTTGGAAGAATACGACCAGAATCAGAACCCCGATGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCACTCCAACGCTCAACAATTGGTCACAGTCGTGCAGGAGCTGCGACGAAATGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACCGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAACTCAAGCAGGAACAACAAGAGACGAGCACACGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACGTACGGTTGGAGAGGCCTTATCCAGGACGGTGTCGTGGAATACCTAGATGCCGAAGAGGAAGAGACAGCCATGATAACGTTCTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGTTTACCTGCGGCAGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCTCGCATCCATGTATGGTACCAAATTCATTTT-----TCATGG-ACCCTCAGATGCCCCCGATGCATGCTCTGAGCGCTCTGCCA-TTTTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CTTTCGC--GAAC--------------------------------------------------------ACACGCTAACAAGTCTCACAGGAAGCCGCTGAACTC Alternaria_elegans_CBS109159 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACTCCCTTTTGGGGGCT------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-TCCACTCTGCCATGACAATCGTATCAAAGCTGACCGC-ATCCTATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CAAACTACAGC---CCGTAG-CCATCCA-AATCGCGACG-GTAGTCCTTGCGATGCGCT-CGAGGCACTCCACGG-TCTCAGCTTGCAGGCTAACACA--TTCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTTTCCCATTTGCGTCGAACAAACACCCCTGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAAACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAATACGACCAAAATCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTCGTCACAGTCGTGCAGGAGCTTCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGCGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAACTCAAGCAGGAACAACAAGAGACGAGTACGCGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTTATCCAGGATGGTGTCGTAGAATACCTTGATGCTGAAGAGGAGGAGACAGCCATGATAACGTTCTCCCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGACTCAAGCCACTGCCAGACCCTCGTATCCATGTATGGCATCGCCTTTCCTCTCCTC-TCATGGAACCCCCTCGTCCACTTGATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_ellipsoidea_CBS119674 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCAATCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATTACGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACTACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGTTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAACGCTCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_eryngii_CBS121339 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTCTCGGGAGG----------------------------------CGGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGGGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCCTTTTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCTATCCCACGCCATTGATACCATCATCTCAAAAGTAACCGC-ATGCCATAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCGCGCACC--CAAAATACAG----CCACAG-CAATGCA-AATCGCGACA-CCGGTCCTTGTGATGCGCT-GGAGCTATTCCACGA----CAAAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAATCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATTCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAACTAGCCAAGCCACGACAACTTCACAACTCCCATTGGGGTCTTGTCTGTCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTCGAGAACGACATTCGGAAGCCGAATCGTAACCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTTTCTCCTGAGGACCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTATGGCATCAATTTTCTTTC-----ACCTGG-ACGGTCGCATGCCTCAGATGCATTCCTCAAGTGCCCAGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTC----------CTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCTGCCGAACTC Alternaria_ethzedia_CBS197_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACAAGGC-GGGCTGGACACCCCCCGCTGGGCACTGCTTCACGGCGTGCGCGGCGGGG------CCGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCGCCCTCAGGACCAACCA--CAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-TGCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC----TTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAATAGCCCACCCT-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGGTTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGCGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCGCATTTGCGTCGAACGAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTGGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAAATCAGCAACAAGCTGAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCCGAGGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCGCGCATCCACGTACGGCATCACTCTCCTTTC-----ACATGG-GCATTCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCTTCAGTCTGCTAACAGGCCTCACAGGAAGCCGCCGAACTC Alternaria_gaisen_CBS632_93 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCCTGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCAAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTCCGACGTCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_geniostomatis_CBS118701 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGTCAATACGACGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGAGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAAGAAGGC-GGGCTGGCTCTCTCCGGAGGA----------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCGCCACCAGGACAAACCA--TAAACC--TTTTGCAGTTGCAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCAGC-TCGC-TGGAGACTCGCCTTAAAGTGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC-----ATTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGCTCCACTGATACAATTGATCGAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCGTAG-CTATCCA-CCGCGCGAAA-TCAATCTTCGCGATGCGAT-GGAGCCGTTGCCTTA-TCATAGAGCGCAGGCTAACACATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAAAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAAGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCCGCTCCCTCTGCCGACGCCCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACATTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGATGGTAAATTAGTGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTGTGGGTGGGTGTTCACTCCAACGCTCAACAGCTCGTCACGGTTGTGCAGGAGCTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATATCTAGACGCAGAAGAGGAAGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGACAACACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATGC-CATGTCGCTAT------TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gypsophilae_CBS107_41 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGAAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCC--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCAATCCACAAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATTGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAATGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_helianthiinficiens_CBS117370 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-AGGCTGAAATCTCTCGGGAGG----------------------------------ACAGCC-TCGCTGAATTATTC-ACCCATGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTGCGCCCGCCA-TAGGACAAACTA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTTATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG--CCAAGGTT-AGCA-TCCATCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTGGGTTTCG-TCCGTTCCATGGATAAAGCTCTTTCAAAGCTGACCGC-ATGCCGCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAGACGCC--CGCACCACAA----CCACAG-CCATCCA-GATCGCGACA-TGAGTCCTTGCGATGCGCT-AGAGTCCCTTTTCGG-TCGCACAACACAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGCCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGTTATGTCAGTGTCGGTAGCGACGCTTCACCCATTATCGACTTCATGACACAGCGAAACATGCAACTCTTGGAGGAGTACGATCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTGAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACCTACGGCTGGAGAGGCCTTATCCAGGACGGTGTTGTAGAATACCTTGACGCAGAAGAGGAAGAAACTGCCATGATAACGTTCTCCCCCGAAGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_helianthiinficiens_CBS208_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-AGGCTGAAATCTCTCGGGAGG----------------------------------ACAGCC-TCGCTGAATTATTC-ACCCATGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTGCGCCCGCCA-TAGGACAAACTA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTTATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG--CCAAGGTT-AGCA-TCCATCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTGGGTTTCG-TCCGTTCCATGGATAAAGCTCTTTCAAAGCTGACCGC-ATGCCGCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAGACGCC--CGCACCACAA----CCACAG-CCATCCA-GATCGCGACA-TGAGTCCTTGCGATGCGCT-AGAGTCCCTTTTCGG-TCGCACAACACAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGCCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGTTATGTCAGTGTCGGTAGCGACGCTTCACCCATTATCGACTTCATGACACAGCGAAACATGCAACTCTTGGAGGAGTACGATCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTGAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACCTACGGCTGGAGAGGCCTTATCCAGGACGGTGTTGTAGAATACCTTGACGCAGAAGAGGAAGAAACTGCCATGATAACGTTCTCCCCCGAAGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_infectoria_CBS210_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAAGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATATTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACAAGGC-GGGCTGGACACCCCCCGCTGGGCACTGCTTCACGGCGTGCGCGGCGGGG------CCGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCGCCCTCAGGACCAACCA--CAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-CGCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC----TTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCATAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCAT--CCCGCGCAAA--CACAAACCCA----TAATAGCCCACCCA-TCTTTGCACA-TCGGCTTTTACGATGCCAC-GGAGCGGTTCTACGA-CTACAGTACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACCTGAAGGGTGGAGCCAAGAAGGTTGTTATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCTACATTGTCGCATTTGCGTCGAACAAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCCTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTGGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATCCGGAAACCGAACCGCAACCACCTCATCTTTACCAAAGAAATCAGTAATAAGCTGAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGAGTTGTGGAATACCTCGACGCCGAAGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGTTCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ACACGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAATAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_japonica_CBS118390 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCTAGCAGTGCATTGCTTTACGGCGTGCGCTGTTAGCGG---CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CAAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCGGTTGATACAGTTGTATCAAAGTTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCATC--CACACGACAG----CCACAG-CCATCCA-AGCCCCGACA-GCAGTCCTTGTGATGCGCT-AAAGCTATTCCATGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAATCAGAACCCTGATGCAACAAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACGGTCGTGCAAGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGGTGGAACAAGCCACTTACGGCTGGAGAGGCTTGATCCAGGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGATCCCCGCATCCATGTACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_juxtiseptata_CBS119673 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTGTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTAGAATCCCTCGGGGTG----------------------------------ACAGCC-TTGCTGAAATATTC-ACCCGTGTCTTTTGCGTACTACTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCA--TCAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CCAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATACCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCCCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATGCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCCCCTCCGCGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGGCAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGATTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCACAACAACTTGTCACAGTTGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGATATCCGGAAGCCAAACCGCAATCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTACGGCTGGAGAGGTCTCATCCAGGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACTGAGGGTGAACACCGTCTCCGGCGCCTCAAGCCACTGCCAGACCCCCGCATCCATGTATGGCATTACTTTTCTTCC-----ACGCAC-ACTGTTGCATCCACATGGTGCTTCCTTTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGACGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_limaciformis_CBS481_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATACCCCCAGCAGTGCGTTGCTTCGCGGCGTGCGCTGTTGGG------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCA-TAGGACAAACCA--TAAACC-TTTTTGTAATAGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAGTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGTAATGCGTACGTTTCC-CTCCTTCCATAGATACAGCAAC-TCCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCA------------------------------------------ACA-TCAGTCCTTGCGATACGAT-GGAGCCACGGTGTAA-TCGCAGGATATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGCCACACTGTCTCATTTGCGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAATACGACCAAAACCAAAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGTGTTCACTCCAACGCGCAGCAGCTTGTCACAGTTGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTTTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACATACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCTGAAGAAGAGGAGACCGCCATGATAACGTTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTAGGCTTGCCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTGAAGCCTCTACCAGATCCACGCATCCATGTACGGCATCACTTTTCCTTC-----AAACAG-ACGGGCGCAATCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_limoniasperae_CBS102595 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes_CBS540_94 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC-----TTTTTTCCAACTTTTGACCTCGGATCAGGTAGGGATACCTATTGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_macrospora_CBS117228 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGCACCTCTCGGGGTGG---------------------------------CCAGCC-TTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCA-TAAACC-TTTTTGTAATGGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTACCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAGCCCCAAGGTCTAGCA-TCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTATGTTTCG-CCCAATTCATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACTG----CCATGG-CCATCCG-CATCGCGACA-CTAGTCCTTGCGATGCGCT-AAAGCTTCTCTACAG-CTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCATCCACGTATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTCCCCATGATGCACATCT-AACTTCTCAAC------TATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_mimicula_CBS118696 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCACCTCAGCAGCATCTGCTGTTGGGG-------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCATAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_molesta_CBS548_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATACCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGCTGGG------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCA-TAGGACAAACCCA-TAAACC-TTTTTGTAATAGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAGTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTATGTTTCC-CTCCCTCCATAGATCCAGCAAC-TTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCG------------------------------------------ACA-TCAGTCCTTGCGACACGAT-GGAGCTACGGTACGA-TTGCAGGACGCTGGCTAACACA--CCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGCTACACTGTCCCATTTGCGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCTAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAATACGACCAGAACCAAAACCCCGATGCTACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGCGTTCACTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGTCGTGTCATGAGACCACTTTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTGGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCGCCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCTGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTGAAGCCGCTACCAGATCCACGCATCCATGTACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_mouchaccae_CBS119671 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATACCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGG------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCA-TAGGACAAACCCA-TAAACC-TTTTTGTAATAGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAGTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCC-CTCCCTCCATAGATCCAGCAAC-TTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCG------------------------------------------ACA-TCAGTCCTTGCGACACGAT-GGAGCTACGGTACGA-TTGCAAGACGCTGGCTAACACA--CCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGCTACACTGTCCCATTTACGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGGCAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAATACGACCAGAACCAAAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTAGGTGTTCACTCCAACGCTCAGCAGCTTGTTACAGTTGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAAATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTTTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTGGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTTTCACCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCTGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTGAAGCCGCTACCAGATCCACGCATCCATGTACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_nepalensis_CBS118700 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCTAGCAGTGCATTGCTTTACGGCGTGCGCTGTTAGCGG---CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CAAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCGGTTGATACAGTTGTATCAAAGTTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCATC--CACACGACAG----CCACAG-CCATCCA-AGCCCCGACA-GCAGTCCTTGTGATGCGCT-AAAGCTATTCCATGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAATCAGAACCCTGATGCAACAAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACGGTCGTGCAAGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGGTGGAACAAGCCACTTACGGCTGGAGAGGCTTGATCCAGGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGATCCCCGCATCCATGTACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_nobilis_CBS116490 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCAATCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATTACGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACTACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGTTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAACGCTCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCTCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_oregonensis_CBS542_94 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACAAGGC-GGGCTGGACACCCCCAGCCGGGCACTGCTTCACGGCGTGCGCGGCTGGG------CCGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCGCCATCAGGACCAACCA--CAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-TGCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC-----TTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAATAGCCCACCCA-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGTTTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCATATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCGCATTTGCGTCGAACGAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTCGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAAGTCTTCGTTAATGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACATACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGATGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ATATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTGTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATTACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_panax_CBS482_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTCTCGGGAGG----------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTATGTCTCA-CCCACTCCGTTGATACCATCATATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAGCGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----CCACAG-CCATGCA-AATCGCGACA-CCCGCTCTTGCCATGCGCT-GGAGCTACTACACGA-CCGCAGAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAATCACGAGACTTACAAGCCCGACATCGAGCGACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCACGACAACTTCACAACTCCCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTCCTAGAAGAGTACGACCAGAATCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAATCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGGGAGATGAAGCTGGGCTTGCCTGCGGCTGAGCGATCAACTGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGTATTCATGTACCACATCCCTTTTCTTTC-----ACATGG-ACGGTCGCACGTCCTCGATGCATCCTCTGAGCGCCTAGCCA-TTTCCT-GGCTGAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC----ACTCCACCACC------ATGACGCACATCC-AATTTTCCCAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_perpunctulata_CBS115267 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAGATATGAAGGCGGGGCTGGAACCTCTCGGGGTT----------------------------------GCAGTC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCA--TGAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ACAATC-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGCATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCTGGCTTTGC-TGGAGACTCGCCTTAAAGGAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG--CCACGGTCTGGCA-TCCATGAAGCC-TTTTTTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCG-CCCAACTCGCCGATACAAT-CTATCCGAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----GCCAGG-CCATCCA-AATCGTGACG-ATAGTCCTTGCGATGCGCT-GAAGCTCCTCTGTGG-TCGCAGAATGCACGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACCAACACCCCTGTTGGTCGTGATGGAAAGCTGGCAAAGCCGCGACAACTCCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGGAACATGCAGCTTCTGGAAGAGTATGATCAAAATCAGAACCCCGACGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTCCGACGAAACGGAACCCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTATTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACTAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAGGAGGAGGAGACGGCCATGATAACATTCTCCCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAACTGGGCCTGCCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCCCGTATCCATGTATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_petroselini_CBS112_41 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGAAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--CAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAACAAAT-GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC-----TCTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCC-CCCAAGCACC--TACACTACAG-----------CCGTCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACGGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGCGACACTGTCACATTTGCGTCGAACAAACACTCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTTGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTCGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_photistica_CBS212_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTCTCGGGAGG----------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGCATACCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCAC--TACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_porri_CBS116698 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGCACCTCCCGGGGTGG---------------------------------CCAGCC-TTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCA-TAAACC-TTTTTGCAATGGCAATCAGCGTCAGTAA-CAAT--GTAATA-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCTCC--TTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAGCCCCAAGGTCTAGCA-TCCACCAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTCATTGATACAGTCG-ACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-CTGCGGAATGCAGGCTAACAAA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTATCCATGTATGACATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAAACGAACACCCACTTAATGATGCACATTT-AACTTCTCAAC------CCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTC Alternaria_pseudorostrata_CBS119411 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCTTTCTGGAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGCACCTCTCGGGGTGG---------------------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCA-TAAACC--TTTTGCAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCCC--TTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG-CCCAAGGTCTAGCA-TCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTCCG-CCCGATTCATTGATACAATTG-ATTTGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CACCGCGACA-TTGGTCCTTGCGATGCGCC-AGAGCTCCTCTACAG-CTGCAGAACGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAAAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTCGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACTAGCACACGACAGGGATGGAGTCAAGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATCACTTTTTCTTTC----ACACAC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAACTTTTTACGCGCTAGCGCTAGCCCGCTTGCGG-CCGACATCGAAAACCGAACACCCTGGTAATGATGCACATCC-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_radicina_CBS245_67 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGAATCTTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAACAAAC-GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC----TCTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTGCGTCGATACAGT-GTATCAAAGCTGACGGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTC-CCTAAGCACC--CGCGCTACAG----CCACAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAGTGCTGGCTAACACA--TCTAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACGCTGTCACATTTGCGTCGAACAAACACTCCCGTTGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATCCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_resedae_CBS115_44 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTTGGAATCCTTCGGGGTTC--------------------------------TCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCA-TAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-CCCGCTCCATTGATACAATTGTATCAAAGCTAACCAC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCGGTAAGCTTT-CCCAAGCACCCACAAACTACAG----CTATAG-TCATCCA-AATCGCAGCA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTAGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAATACGACCAAAACCAGAACCCTGATGCAACTAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTTGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTGGAGAACGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTTGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGTTTACCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATTCATGTACGACATCACTTTTCTTTC-----ACATGG-ATAGTCACATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAAGCCGCATACGG-CGTTCGC--GAACTTCAACA---------------ACGTCC-AATTTCCCTGT------TCTGGCCACAGTACGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_saponariae_CBS116492 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TGCCAG--CCAAGGTC-AGCAATCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACTGC-ATGCTACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCTAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGCCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGTTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGCTCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_selini_CBS109382 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGAAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--CAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAACAAAT-GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC-----TCTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCC-CCCAAGCACC--TACACTACAG-----------CCGTCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACGGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGCGACACTGTCACATTTGCGTCGAACAAACACTCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTTGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTCGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTCCAT------CTTGGCTACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_septorioides_CBS106_41 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCACCTCAGCAGCATCTGCTGTTGGGG-------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA--CAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCATAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_simsimi_CBS115265 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACTCCCTTTTGGGGGCT------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGTCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-TCCACTCTGCCATGACAATCGTATCAAAGCTGACCGC-ATGCTATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CAAACTACAGC---CCGTAG-CCATCCA-AATCGCGACG-GTAGTCCTTGCGATGCGCT-CGAGGCACTCCACGG-TCTCAGCTTGCAGGCTAACACA--TTCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACTCCTGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAAACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAATATGCAACTTCTGGAAGAATACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTCGTCACAGTCGTGCAGGAGCTTCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAACTCAAGCAGGAACAACAAGAGACGAGTACGCGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTTATCCAGGATGGTGTCGTAGAATACCTTGATGCTGAAGAGGAGGAGACAGCCATGATAACGTTCTCCCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGACTCAAGCCACTGCCAGACCCTCGTATCCATGTATGGCATCGCCTTTCCTCTCCTCCTTATGGAACCCCCTCGTCCACTTCATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCTGAACTC Alternaria_smyrnii_CBS109380 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAACAAAT-GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC-----TCTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCT-CCCAAGCACC--CACACTACAG-----------CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGCGACACTGTCACATTTGCGTCGAACAAACACTCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCAAACCGTAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATCCAAGACGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCATCACTTTTTTTTCC----ACACGG-ACAGCTATATCCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATAC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_solani_CBS116651 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGCACCTCCCGGGGTGG---------------------------------CCAGCC-TTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCA-TAAACC-TTTTTGCAATGGCAATCAGCGTCAGTAA-CAAT--GTAATA-ATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCCC--TTGC-GGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAGCCCCAAGGTCTAGCA-TCCACCAAGCC---TTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTCATTGATACAATCG-ACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-CTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTATCCATGTATGACATCACTTTTCCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAGACCGAACACC--AAGGACGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTC Alternaria_soliaridae_CBS118387 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATACCCCCAGCCGTGCGTTGCTTTACGGCGTGCGCGGTTGGGG-----CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCGCCACAAGGACAATTCA--TAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTT--TTTGTCTCCCGT-TCGC-GGGAGACTCGCCTCAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAACAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTCTCA-CCCTCTCCATTGATGCAGCAACATGCAGTCTAACCAC-ATGCTACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGTCTATA--CACAATACAG----CCATAG-CCATCTC-----------------CCTTGCGACGCGAT-AGAGCTTCTGTATAA-TCGCAGGATGCAGGCTAACACAC-ACCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGATTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACATACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACACCCGTTGGTCGTGACGGCAAACTAGCCAAGCCGCGACAACTTCACAACTCACATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTAAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGTGACGCGTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAAAACCAGAATCCAGATGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAAATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGTCGTGTCATGAGACCACTATTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTCGTGGAATACCTGGACGCTGAGGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACTGAGGGTGAGCACCGTCTTCGACGACTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACGCGG-ATGGTTGCAACCACCCGGTGCATCCTCTGA--GCTTAGCCA-TATCCT-GGCTTGT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCT-AATTATCCTAT------TTTGGCCACAACATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_solidaccana_CBS118698 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCACCTCAGCAGCATCTGCTGTTGGGG-------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCATAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGGTACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_sonchi_CBS119675 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAATAATGAAGGC-GGGCTGAACTCTCTCGGGAGG----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--ATAATA-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGT-TTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTT-TACCAG--CCAAGGTC-AGCA-TCCATCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCG-CCCATTCGATTGATGCAATTATATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCGGTGAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCACC--CACAATACAG----CCGCAG-CCATCCA-AATCGCGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTTCACGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCTTGAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAAGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACACTATCCCATTTGCGTCGCACAAACACCCCTGTTGGTCGCGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGCAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAAGAGCTGCGACGAAATGGAACTCTATCTTACGAGATGAGTCTGATTCGTGACATTCGCGACAGAGAGTTCAAGATCTTCACAGACGCCGGCCGTGTCATGAGACCACTTTTCGTTGTCGAGAATGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAGGCACGCGACAGGGATGGAGCCAGGACGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATTCAGGACGGTGTTGTGGAGTATCTAGACGCCGAGGAAGAGGAGACCGCCATGATAACGTTCTCCCCAGAAGATCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGTATCCATGTACAGCATTACTTTCCTTTC-----ACGCGGCACAGTTGCGTTCACTTGACGCATCCTCTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------CTTAGCTACATCACGCTAACAATCCTCACAGGAAGCCGCCGAACTC Alternaria_tagetica_CBS479_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGACTGGCACCTCTCGGGGGTGG--------------------------------CCAGCC-TTGCTGAATTATTCCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACCCA-TAAACC-TTTTTGTAATGGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCCCCCTTGCGGGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAGCCCCAAGGTCTAGCA-TCCAACAAGCC--TTTTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTTATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAAATGCAG----CCTTGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCCATGCGCT-AGAGCTCCTCTACAG-CTGCAGAACGCAGGCTTACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACATCCCACACATGATGCACATCT-AACTTCTCAAT------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_tenuissima_CBS918_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_thalictrigena_CBS121712 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCAACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGAGTCTCTCGGGATT----------------------------------CCGGCT-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACTCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTTCAGTCTTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTCCCA-CCCACTCCATTGATACCATCATATCTAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CTCAAGTGCC--CACACTATAG----CTGCAGCCCATCCG-AATCGCGACA-TCAGGAGCTACGATGCGCT-GGAGCTACGTCACGG-TCGCAGAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACAGAGAAGGCCAAGGCCCACTTGAAAGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACAAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGTACTCTGTCCTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTGATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTAGAATATCTAGACGCCGAAGAGGAGGAGACCGCGATGATAACGTTCTCTCCTGAGGATCTTGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCCACTGAGGGTGAGCATCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTAACGCATCACCTTTCTTTC-----ACATGG-CCAATCGCATGCACCCGATGCATTCTCTGAGCGCTCAGCCA-TTTTCT-GCCTTAT--CGCGAGGAGGGGCA-TTTTTACCTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGCTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCCT------TCTGCCTACAGTGTGCTAACAAGCCTCGCAGGAAGCCGCCGAACTC Alternaria_triglochinicola_CBS119676 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATCCCGACACGGGGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTCAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTCTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGAGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAAGAAGGC-GGGCTGGCTCTCTCCGGAGGA----------------------------------CTGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAACCA--TAAACC--TTTTGCAATGGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCGGC-TTGC-TGGAGACTCGCCTTAAAGTGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----ACATTTTCCACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCTGCTCCATTGATACAATTGATCAAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCAATGCGAT-GGTACCATTGCCTTG-TCATAGAGCGGAGGCTAACATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCCCATTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCGCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTGGGTGTCCACTCCAACGCTCAACAGCTCGTTACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATATTCACAGACGCCGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAAGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTGATCCAGGACGGTGTTGTCGAATATCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCTGAGGATCTCGAGGAGTGGCGTGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCACGTATCCATGTATGCCATCACTTTTCTTTC-----ACACGG-ACCGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-CTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAATCCAACACC------ATGACGCACATGT-CATGATCCTAT------ATTGGCTACAGCAAGCTAACAATCCTCCCAGGAAGCTGCCGAACTC Alternaria_vaccariae_CBS116533 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGAAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCC--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTCCAGTTTCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCAATCCACAAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGTATCCACGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_vaccariicola_CBS118714 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTGTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTAGCATCCCTCGGGGTG----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACCAACCA--TCAACC--TTTTGTAATGGCAATCAGCGTCAGTAA-CCAAC-CTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCCCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTTGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATGCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTGTCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATAGAGCCCCACTACGCTGTAAGCCTC-CCCAAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCCCCTCCACGG-CCGTAGAATGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAAAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGGCAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTTGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGATATTCGGAAGCCAAACCGCAATCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTACGGCTGGAGAGGTCTCATCCAGGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACTGAGGGTGAACATCGTCTCCGGCGCCTCAAGCCACTGCCAGACCCCCGCATCCATGTATGGCATAACTTTTCTTCC-----ACGCAG-ACTGTTGCATCCACATGGTGCTTCCTCTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Botryomyces_caespitosus_CBS177_80 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACAAGGC-GGGCTGGACACCCCCCGCTGGGCACTGCTTCACGGCGTGCGCGGCGGGG------CCGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCGCCCTCAGGACCAACCA--CAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-CGCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC-----TTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCGAA--CACAAACCCA----TAATAGCCCACCCG-TCTTTTCACA-TCGGCTTTTGCGATGCCAC-GGAGCAGTTCTACGG-CTACAGGACGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACATTGTCGCATTTGCGTCGAACGAATACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTCGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACATACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGATGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGTA-CCTCTGAGCGCTCAGCCA-TTT-TC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Brachycladium_penicillatum_CBS116608 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATCCCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG-----CCAGCC-TGGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGCTTCA-TCCCTCTTATCAACACAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATGGAAGACAG----TCATAG-CCATCCA-GCTCGCGACA-TTACTCCTTGCGTTGCGAT-AGAGCTACTGCATGG-TTGCACAATGCAGGCTAACACACACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCCGTTGGTCGTGACGGCAAGTTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGACTTGTCTGTCCTGCTGAAACTCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCTGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGAGACGAAACGGAACTTTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGGCGGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTTTCTCCTGAAGATCTGGAAGAGTGGCGAGAAATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Chalastospora_cetera_CBS121340 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGGCTAACTCCTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTTACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATACGAAGGC-GGGCTGGACACCCCTAGCTGGGCACTGCTTCACGGCGTGCGCGGCTGGG------CCGGCC-CTGCTGAACTATTT-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAACCA--TAAACC-TTTTTGTAATAGCAATCCGCGTCAGTAA-CAATC-GTAATAAAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGC-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAACAAGCC-----TTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGTATA--TACAAGACCG----TTGCAG-CCATCCG----------------------CGATGCGAC--GAGCTGTTGTACTA-TCGCACGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAACACTCCCGTTGGTCGTGATGGCAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTCGTCTGCCCCGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTAAAGAACCTGTCCTTGATGTGTTATGTCAGTGTCGGAAGTGACGCTTCACCCATCATCGACTTTATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAATCCGGACGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTACGACGAAATGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAGAACGATATCCGGAAGCCAAACCGCAACCACCTTATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAAACCGCCATGATAACATTTTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGCAGGGTCTACCTGCAGCTGAGCGATCTACTGAGGGCGAACATCGCCTTCGACGCCTTAAGCCACTACCCGACCCGCGCATTCATGTACGACATCACTCTTTTTTC-----ACATGG-GCTGTTGCAACCATCCGGTGCA-CCTCTGAGCGCGCCGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGGCGCACATAC-AA--TCCCCAA------TTTAGTCACAGCATGCTAACAAGTCAAACAGGAAGCCGCCGAACTC Chalastospora_ellipsoidea_CBS121331 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGTAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATCCCTCCTGCTGGGCACTGCTTCACGGCGTGCGCAGTAGGGG-----CCGGCC-CTGCTGAACTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAACCA--TAAACC-TTTTTGTAATAGCAATCTGCGTCAGTAA-CAAT--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCCAGC-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTTCTTCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC-----TTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTTCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GGGCTATTATGCTA-TCGCAGGACGTAGGCTAACATA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAACACCCCTGTTGGTCGTGATGGCAAGCTAGCTAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTCGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACGCAGCGAAAGATGCAACTTCTGGAGGAGTACGATCAGAACCAGAACCCAGACGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTTAAGCAGGAGCAACAAGAAACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATTTGGAAGAATGGCGAGAGATGAAGCAGGGTCTGCCTGCAGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCCGACCCACGCATCCACGTACGACATCACTATTTTTTTC----ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCCACA----GCTAACAAGCCTCATAGGAAGCCGCCGAACTC Chalastospora_obclavata_CBS124120 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATACGAAGGCGGGGCTGGACACCCCCAGCTGGGCACTGCTTCACGGCGTGCGCGGTTGGG------CTGGCC-CTGCTGAACTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAACCA--TAAACC-TTTTTGTAATAGCAATCCGCGTCAGTAA-CAATC-GTAATAAAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGC-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAACAAGCC----TTTTTATTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCATT-CCTACGTATA--CACAAGACCG----TTGCAG-CCATCCG----------------------CGATGCGAC--GAGGTGTTGTAATA-TCGCACGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATTCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAACACTCCTGTTGGTCGTGATGGCAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTTGTCTGCCCCGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTAAAGAACCTGTCCTTGATGTGTTATGTCAGTGTCGGAAGTGACGCTTCACCCATCATCGACTTTATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAATCCGGACGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTACGACGAAATGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGGCCACTCTTCGTCGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAGCAAATGGAGACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTCGATGCCGAGGAGGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGCAAGGTCTACCTGCAGCTGAGCGATCTACTGAGGGCGAACATCGCCTTCGACGCCTTAAGCCACTACCCGACCCGCGCATTCATGTATGGCATCACTCTTTTTTTA----ACATGG-GTTGTCGCATCCATCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATAC-AATTTCCCCAG------TTTGGCCACAGCATGCTAACAAGTCGAACAGGAAGCCGCCGAACTC Chmelia_slovaca_CBS567_66 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAAGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATATTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACAAGGC-GGGCTGGACACCCCCCGCTGGGCACTGCTTCACGGCGTGCGCGGCGGGG------CCGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCGCCCTCAGGACCAACCA--CAAACC--TTTTGCAATAGCAATCAGCGTCAGTAA-CAAC--GTAATT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC-TTTTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-TGCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC-----TTTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCGAA--CACAAACCCA----TAATAGCCCACCCA-TCTTTTCACA-TCGGCTTTTGCGATGCCAC-GGAGCAATTATATGA-CTACAGGGCACAGGCTAACACA--CATAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACATTGTCGCATTTGCGTCGAACAAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTCCTGGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATCCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAAATCAGTAACAAGCTCAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCCGAGGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCGCGCATCCACGTACGGCATCACTCTCCTTTC-----ATGTGG-GCATCCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCAACTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Clathrospora_heterospora_CBS175_52 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Comoclathris_magna_CBS174_52 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAACCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Crivellia_homothallica_CBS116606 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATCCCCCTAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG-----CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAATCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGTAATGCGTACGTTTGA-TCCATCTTATCAACAGAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCATAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATACAATACAG----TCATAG-GCATCCA-GCTCGCGACA-TTACTCCTTGCATTGCGAT-GGAGCTACTGCATGG-TTGCAGAATGCAGGCTAACGCA--CACAGGCCTACATGCTTAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATTGAGCTACACTGTCCCATTTGCGTCGAACGAATACCCCCGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTCTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCTGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGAGACGAAACGGAACTTTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGAGACCGCTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGGCGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACAGCTATGATAACATTCTCTCCTGAAGATTTGGAAGAGTGGCGAGAGATGAAGTTGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATTCTCTTCACGCTCAGCCA-ATTACT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGA-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACA------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Crivellia_papaveracea_CBS116607 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATCCCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG-----CCAGCC-TGGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTAGGCTTCA-TCCCTCTTATCAACACAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATGGAAGACAG----TCATAG-CCATCCA-GCTCGCGACA-TTACTCCTTGCGTTGCGAT-AGAGCTACTGCATGG-TTGCACAATGCAGGCTAACACACACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCCGTTGGTCGTGACGGCAAGTTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGACTTGTCTGTCCTGCTGAAACTCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCTGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGAGACGAAACGGAACTTTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGGCGGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTTTCTCCTGAAGATCTGGAAGAGTGGCGAGAAATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_abundans_CBS534_83 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATCCCTCCTGCTGGGCACTGCTTCACGGCGTGCGCAGTAGGGG-----CCGGCC-CTGCTGAACTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGCTCGCCCGCCACCAGGACCAACCA--TAAACC-TTTTTGTAATAGCAATCCGCGTCAGTAA-CAAC--GTAAGT-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCCAGC-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTTCATCCAG--CCAAGGTC-AGCG-TCCAGCAAGCC------TTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GAGCTATTGTGCTA-TCGCAGGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACTTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGAAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCACTGGGGTCTTGTCTGCCCCGCTGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAGAACCAGAACCCAGACGCGACCAAGGTATTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAGCTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTTAAGCAGGAGCAACAAGAAACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATTTGGAAGAATGGCGAGAGATGAAGCAGGGTCTGCCTGCAGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCCGACCCACGCATCCACGTACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_allii_CBS339_71 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATACTCTGTAGTAGTGCATTGCTGTACGGCGTGCGCTGCTGGAGAGC-CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCGCCACATGGACAACTCA--TAAACC--TTTTGTAATAGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTT-TTCCAG--CCAAGGTC-AGCG-TCCAACAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTCTTA-CCTACTCCATCGATATAGCAACTATCAAGCTAACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACA--TGAAAAACAG----TCACAG-CCATCCG-CCTCGCGACA-TCAGTCCTTGCGATGCAAT-GGAACTACCGTATGA-TCGCACGACATAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCGCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTTTCCCATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCGCCCATCATCGACTTCATGACACAGCGAAATATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCAGATGCAACCAAAGTCTTCGTTAACGGCGTCTGGGTCGGTGTCCACTCAAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAAACGAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGCGTTGTGGAATACCTGGACGCCGAGGAGGAGGAGACCGCCATGATAACCTTTTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGTACCGTCTTCGACGCCTCAAGCCACTACCCGATCCACGCATCCATGTACGGCATCACCTCTCTTTC-----ACGCGC-ATAGTGGCAATCATCCGGTGCATTCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTTT-----TTTGGCCACAGCACGCTAACAAGTTTCACAGGAAGCCGCTGAGCTC Embellisia_annulata_CBS302_84 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGTTGGGACCTCATCTCGGTGGGGGCT---------------------------CCAGCT-TGTCTGAATTATTC-ACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCAACCATAAACCTTTTTTTGTAATTGCAATCAGCGTCAGTAAACAAT--GTAAT--TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCTCAC--------GAGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA-TCTTGCACTTCT-GATCAG--CCATGGTTGAGCA-TCCATCAAGAC--CACATTTTTCTCACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTCTGA-TGGAA-CCGTCAATTCTGCCTTATCAAAGCTAACCAC-GTTTCACAGGGTCGAGCACAACGATGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATC-CCCGGACACA--ACGCAATCTT----TCCTGA-CAACCCG-CCGCGCGTTT-CTTTTGATCGCCGCGATTG-GAAGTCATTTGTTGC-TAGTGGATTGCAGGCTAACGTCCATGCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGAAGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACGGGCGCCTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTTTCCCATCTTCGTCGAACAAATACTCCTGTTGGACGTGATGGTAAATTGGCTAAGCCGCGACAGCTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCCCTCATGTGCTATGTCAGTGTTGGTAGCGATGCATCGCCCATTATCGACTTCATGACTCAACGCAACATGCAACTTCTCGAGGAATACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGACGAAATGGCACCCTTTCCTACGAGATGAGTTTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGAGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTTTTCACCAAGGCGATTAGTAATAAACTCAAGGCTGAACAGCAAGAGACTAGCACACGCCAAGGCTGGAGTCAGGAGGAAGTCGAGCAGGCCACCTACGGTTGGAGAGGCCTTATCCAAGATGGTGTTGTCGAATACCTCGATGCGGAGGAAGAAGAGACTGCAATGATAACCTTCTCTCCCGAGGACCTGGAGGAATGGCGAGAAATGAAAATGGGCTTACCCGCGGTTGAGCGATCCACTGAGGGCAAGGACCGACTTCGCCGTCTCAAGCCACAGCCAGACCCTCGAATTCATGTACGGCATCAATTTTCCTTC-----ATCTGC-AAAGTCGCTGCCACCTGGTGCATTTTCTGAGCATGTAGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGTGG-CCTTCGC--GAACTGCAATACC------ATGACGCACATGC-AAAATCCCATT------TTCCGCTGCACGATGCTAACAGGCTCCATAGGAAGCCGCCGAGCTC Embellisia_chlamydospora_CBS341_71 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATACTCTGTAGTAGTGCATTGCTTTACGGCGTGCGCTGCTGGAGAGC-CTAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCGCCACAAGGACAACTCA--TAAACC--TTTTGTAATAGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTT-TTCCAG--CCAAGGTC-AGCG-TCCAACAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTCTTT-CCCACTCCATCGATATAGCAACTATCAAGCTGACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGTACA--TTCAAAACAG----TCATAG-CCATCCG-ATTCGCGACA-TCACTCCTTGCGATGCGAT-AGAGCTACTGCATGA-TCGCAGGACATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACAGTCAATGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACACTTTCCCATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCGCCCATCATTGACTTCATGACACAGCGAAATATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCAGATGCAACCAAAGTCTTCGTTAACGGTGTCTGGGTCGGCGTCCACTCAAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGCAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGCGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTGGACGCAGAGGAGGAGGAGACCGCCATGATAACATTTTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGTACCGTCTTCGACGTCTCAAGCCACTACCCGATCCACGCATCCATGTACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_conoidea_CBS132_89 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCACCTCAGCAGCATCTGCTGTTGGGG-------------------CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCATAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CGCACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATTATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTTTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCGC------TCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_dennisii_CBS110533 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGACGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTAAAATCTGGCTCTTTTAGGGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGCAAGC-GGGCTGGATTCCCAAGCAGCTCGCTGTTTTGGGGC--------------------CCGGCC-TGGCTGAATTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAACCA--CCAACC--TTTTGCAATAGCATTCAGCGTCAGTAA-CCA---GTAAT--TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGC-TTGC-TGGGGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGGC-AGCG-TCCAGCAAGCC------GATTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCA-CCCGCTCTCTTAACACTGTTGTATCAGCCCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACC--CAACATACAG----CCATAG-CCATCCA-AATCGCGAGA-GCAGTCATTGCGATGCGCT-AGAGCTACTCCACAG-TCGCAGAATGCAGGCTAACAGA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAAGTTGATGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGGCAGGCTTGCGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAGCGGAATATGCAACTTCTCGAGGAGTACGACCAAAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGATATCCGTGACCGGGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATCGAACAAGCTACTTACGGTTGGAGAGGCCTGATCCAGGATGGTGTTGTGGAATACCTAGATGCTGAAGAGGAGGAGACCGCCATGATAACTTTCTCTCCCGAAGACCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCATCGTCTTCGTCGACTCAAGCCACTACCGGATCCCCGTATCCATGTACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_dennisii_CBS476_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATCGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGACGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTAAAATCTGGCTCTTTTAGGGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGCAAGC-GGGCTGGATTCCCAAGCAGCTCGCTGTTTTGGGGC--------------------CCGGCC-TGGCTGAATTATTC-ACCCGTGTCTTTTGCGTACCTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAACCA--CCAACC--TTTTGCAATAGCATTCAGCGTCAGTAA-CCA---GTAAT--TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGC-TTGC-TGGGGACTCGCCTTAAAATGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGGC-AGCG-TCCAGCAAGCC------GATTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCA-CCCGCTCTCTTAACACTGTTGTATCAGCCCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACC--CAACATACAG----CCATAG-CCATCCA-AATCGCGAGA-GCAGTCATTGCGATGCGCT-AGAGCTACTCCACAG-TCGCAGAATGCAGGCTAACAGA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAAGTTGATGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGGCAGGCTTGCGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAGCGGAATATGCAACTTCTCGAGGAGTACGACCAAAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGATATCCGTGACCGGGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATCGAACAAGCTACTTACGGTTGGAGAGGCCTGATCCAGGATGGTGTTGTGGAATACCTAGATGCTGAAGAGGAGGAGACCGCCATGATAACTTTCTCTCCCGAAGACCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCATCGTCTTCGTCGACTCAAGCCACTACCGGATCCCCGTATCCATGTACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_didymospora_CBS766_79 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATCCCCCCTAAGCAGTGCGTTGCTTCGCGGCGTGCGCTGTTTTGGGGCCCGGCCTTTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCA--TAAACC-TTTTTGTAATTGCAATCAGCGTCAGTAA-CAAT--GTAATA-AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TTCCAG-CCCAAGGTC-AGCG-TCCAGCAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCC-CTTACTCCATCGATCCGGCAACATCCAAGCTGACCAC-ATGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACG--TAAAAAACAG----TCATAG-CCATCCC-TTTCGCAACA-TCCCTCCTTGCAATGCGAT-AGAGCTACTGTACCA-TCGCAGGACGCAGGCTAACACG--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCCTCTGCCGACGCCCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACATTGTCCCATTTGCGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGAGAAACATGCAACTTCTGGAGGAATACGACCAAAACCAGAACCCCGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGCCGTGTCATGAGACCCCTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAAGAGACCGCCATGATAACGTTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCTGAGCGGTCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCACGCATCCATGTACGGCATCACTTTCCTTTC-----ATGTGG-ACGGTCGCAACCACCCGATGTATCTTCTGAGCGCTCAGCCA-T-TTCT-GGCGTAC--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAACTCCCAACACC------ATGACGCACATCC-AATTTACTTAT------TTTGGACACAACATGCTAACGAATCTCGCAGGAAGCCGCCGAGCTC Embellisia_eureka_CBS193_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATCCCGACACGGGGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAACAAGGC-GGGCTGGCTCTCTCCCGGGAGGA--------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCCCCA---TAAACC--TTTTGCAATGGCAATCAGCGTCAGTAA-CAAC--ACAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--TTTGTCTCCGGC-TTGCCTGGAGACTCGCCTTAAAGTGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----ACCTTTTTTACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGCTCCACTGATACAATTGAGCAAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----ACATAG-TTGTCCA-TCGCGCGAAA-TCAGTCTTCGCGATGCGAT-GGAACCATTGCCTTG-TCGTAAAGCGCAGGCTAACACGTACGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCGCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAAAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTTGGTGTCCATTCGAACGCTCAACAGCTTGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCCGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATTTTCACCAAGGAGATTAGTAACAAGCTAAAGCAAGAGCAACAAGAGACAAGTACCCGACAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGGGGTCTGATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACATTTTCTCCTGAGGATCTCGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCGACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCACGTATCCATGTATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTTGGTGCATGCTCTGAGCGCGCAGCCA-GTTCCTAGGCTTAT--CGCGATGAGGGGCA-TTTTTGCGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACATGC-AACGTTCCTCCTTA---TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_hyacinthi_CBS416_71 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATAATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATACCAACACGGTGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACAATTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGAAAGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATATTTCCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGCAGGGAGCGTGGACCTCCTTAGGAGTGA-----------------------------CCTGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTTCAGC-TTGC-TGGAGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTCCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCATGAAGCC------TTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTGGGTTACA-TCCGTTCCATTGATACAACGAATTTAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--ACCAATACAA----CTG---------------CGCGATA-TTAGTCTTCGCTATGCGAC-GGAGCCATTGCATCA-TCGTAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATATGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTTGTTAACGGTGTCTGGGTTGGTGTCCATTCTAATGCTCAACAACTTGTTACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAACGATATCCGCAAGCCAAATCGCAACCACCTCATTTTCACCAAGGAAATCAGTAATAAGCTCAAGCTGGAACAGCAAGAGACAAGTACACGGCAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGTTGGAGGGGCCTGATCCAAGATGGTGTTGTGGAATACCTCGACGCCGAAGAAGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACTGAGGGTGAGCATCGTCTTCGCCGCCTCAAGCCGCTGCCAGACCCCCGCATTCATGTATGCCATTCCTTTTCTTTC-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCGATGAGGGGCT-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCACATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_indefessa_CBS536_83 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTTGGAATCCTTCGGGGTT---------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCACATAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTCTTTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CTCGCTCCATTGATACAATTGTATCCAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGATCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAGC---CCATAG-CCATCCA-AATCGCGACA-TTTGTCCTTGCGATGCGCT-AGAGCTACTCCATGG-TCGCAGATTGCAGGCTAACGCA--TCCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGAAGGCAACAACCTGACCGTCAACGGAAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACCCAGCGAAACATGCAACTTCTGGAAGAATACGACCAAAACCAGAACCCTGATGCAACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCTAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGTTTACCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATTCATGTACGACATCACTTTTCTTTC-----ACATGG-ACAGCCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTGT--CGCGATGAGGGGCA-TATTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACCCAAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_leptinellae_CBS477_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATCCCGACACGGGGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATAAGAAGGC-GGGCTGGCTCTCTCCGGAGGA----------------------------------CTGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACAAACCA--TAAACC--TTTTGTAATGGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTTTTGTCTCCGGC-TTGC-TGGAGACTCGCCTTAAAGTGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----ACATTTTCCACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTTG-CCTGCTCCACTGATACAATTGATCAAAAGCTGACCGC-ATGTCACAGCATCGAGCATAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCGCA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCGATGCGAT-GGTACCATTACCTTG-TCATAGAGCGCAGGCTAATATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCGCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTGGGTGTCCACTCCAACGCTCAACAGCTCGTCACGGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAAGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTGATCCAGGACGGTGTTGTCGAATACCTCGACGCCGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCTGAGGATCTCGAGGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCACGTATCCATGTATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGTTCTGAGCGTGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGAATGCGG-CGTTCGC--GAAGTCCAACACC------GTGACGCACACGC-AATCTTCCTCCCTAT--ATTGGCTACAGCAAGTTAACACTCCTCACAGGAAGCTGCCGAACTC Embellisia_lolii_CBS115266 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGATACAGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGCAAGCGCCGGCACTCCTTGTGAGGA--------------------------------CTGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCA--TAAACC--TTTTGCAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTTCAGC-CTGC-TGGAGACTCGCCTTAAAGTGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTGGGTTCTA-CCTGTTCCATTGATGTAGTGCATTGAAAGCTAACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGTACA--CACAATACAA----CTATAG-CCATCCG-CCTCGCGATA-TCAGTCTTCGCGATGCGAG-GGAGCTATTGCATCA-TCGCAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTTATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGTAAACTAGCAAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCGTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCTTCACCCATCATAGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGGGAGTTCAAGATCTTCACAGATGCCGGTCGTGTCATGAGACCACTTTTTGTTGTTGAGAACGACATCCGCAAGCCAAATCGCAATCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGGCAAGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACTTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCTATTCTCTTTC-----ACATGG-GCAGTTACATCTACCTGGTGTATCCTCCGAGCGCGCAGTCA-GCCCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATCC-CATGTGTCTAT------TTCGGCAACAGCAAGCTAACACGCCTCACAGGAAGCCGCCGAACTC Embellisia_novae_zelandiae_CBS478_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATAATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATACCAACACGGTGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACAATTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGAAAGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATATTTCCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGCGGGGAGCGTGGTCCTCCTCAAGAGTGA-----------------------------CCTGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCAA-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTTCAGC-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCATGAAGCC------TTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTGGGTTACA-TCCGTTCCATTGATACAAAGAATTCAAAGCTGACCGC-GTGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGACCACA--AACAATACAA----CTA---------------CGCGATA-TCAGCCTTCGCTATGCGAC-GGAGCTATTGCATCA-TCGTAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCATTCTAATGCTCAACAACTTGTTACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCGCTGTTTGTGGTTGAGAATGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAAATCAGTAACAAGCTCAAGCTGGAACAGCAAGAGACGAGCACACGGCAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGTTGGAGAGGCCTGATCCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACTGAGGGTGAGCATCGTCTTCGACGCCTCAAGCCGCTGCCAGACCCCCGCATTCATGTATGCCATCCCTTTTCTTTT-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCAGATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_phragmospora_CBS274_70 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGATACCCCCAGCAGTGCGTTGCTTCGCGGCGTGCGCTGTTGGG------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAACCCCA-TAAACC-TTTTTGTAATAGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCAGTAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTTTCC-CTCACCCCAAGGGTATAGCAGTGTTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGCACA--T-GAAAACAG----TCACAG-CCATCCC-TCCCGCAGCA-TCAGTCCTTGCGATGCGAT-GGAGCTACGGTACGA-TCGCAGGACGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACCAACACCCCGGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGATTTCATGACGCAGCGAAACATGCAACTTCTGGAGGAATACGACCAAAATCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAGCAGCTTGTCACAGTCGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTATTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGCAAGAAACAAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTGAAGCCGCTGCCAGATCCACGCATCCATGTATGGCATCACATTTCTTTC-----AAACGG-ATGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CTTTCGC-GAATCCCTAACACC------ATGACGCACATGG-AATTTCCCTAC------TTTGACCACAGCATGCTAACAAGCCTCGTAGGAAGCCGCCGAGCTC Embellisia_planifunda_CBS537_83 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATAATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATACCAACACGGTGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCACTCCTTGAGAGGA---------------------------------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCA--TAAACC--TTTTGCAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTTCAGC-TTGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTGGGTTTCA-CCCGTTCCATTGATACAATGAATTGGAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCGGTAAGCTTC-CCTGAGCACA--CACAATACAA----CTAAAG-CCATCCA-TCTCGCGATA-TCAGTCTTCGCAATGCGAC-GGAGCTATTGCATCA-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCTATCATTGACTTCATGACACAGCGCAACATGCAACTTTTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTTAACGGTGTCTGGGTTGGTGTCCATTCGAATGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAATGACATCCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGCAATAAGCTCAAGCAGGAACAGCAAGAGACAAGCGCACGGCAGGGATGGAGTCAGGACGAGGTTGAACAAGCCACTTATGGTTGGAGAGGCCTGATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTTCCAGACCCCCGCATTCATGTATGGCATCCCTTTTCTTTC-----ACACGG-ATAGTTGCATCCACCTGGTGTGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGTGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTTCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_proteae_CBS475_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATAATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATACCAACACGGTGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACAATTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGAAAGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATATTTCCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGCGGGGATCGTGGACCTCCTTAGGAGTGA-----------------------------CCTGCC-CTGCTGAATTATTT-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCTCACCACCAGGACCAACCA--TAAACC--TTTTGCAATTGCAATCAGCGTCAGTAA-CAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTTCAGC-TTGC-TGGAGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCATGAAGCC------TTTTTTCAACCTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTGGGTTGCA-TCCGTTCCATTGATACAACGAATTTAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--CACAATACAA----CTGAAG-CCATTCA-TCCCGCGATA-TCAGTCTTCGCTATGCGAC-GGAGCTATTGCATCA-TCGTAGAATGTAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAAGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTTCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGACGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTCCATTCTAATGCTCAACAACTTGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTTTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGGGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAATGATATCCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAGCTCAAGCTGGAACAGCAAGAGACAAGTACACGGCAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTTTGATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTACCTGCGGCAGAGCGATCTACAGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCGCTGCCAGACCCCCGCATTCATGTATGCCGTCCCTTTTCTTTC-----AAATGG-ACGGTTGCATCCACCTGGTGCATCCTCTGAGCGCGCCGTCA-GTCTCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAGTTCCAACTCC------ATGACGCACATCC-AGTGTCCCTAT------CTCGGTTACAGCAAGCTAACAAATCTTACAGGAAGCCGCCGAACTC Embellisia_tellustris_CBS538_83 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGATACTCTGTAGTAGTGCATTGCTTTACGGCGTGCGCTGCTGGAGAGC-CTAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCGCCACAAGGACAACTCA--TAAACC--TTTTGTAATAGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTT-TTCCAG--CCAAGGTC-AGCG-TCCAACAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTACGTCTTT-CCCACTCCATCGATATAGCAACTATCAAGCTGACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGTACA--TTCAAAACAG----TCATAG-CCATCCG-ATTCGCGACA-TCACTCCTTGCGATGCGAT-AGAGCTACTGCATGA-TCGCAGGACATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACAGTCAATGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACACTTTCCCATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCGCCCATCATCGATTTCATGACACAGCGAAATATGCAACTTCTGGAGGAGTACGACCAAAATCAGAACCCAGATGCAACCAAAGTCTTCGTTAACGGTGTCTGGGTCGGTGTCCACTCAAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGCGACCGAGAGTTTAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTGGACGCCGAGGAGGAGGAGACCGCCATGATAACCTTTTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGTACCGTCTTCGACGCCTCAAGCCACTACCAGATCCACGCATCCATGTACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_tumida_CBS539_83 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATAATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATACCAACACGGTGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCACTCCTTGAGAGGA---------------------------------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACAAACCA--TAAACC--TTTTGCAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTTCAGC-TTGC-TGCAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCATCGTCTTCCGCAATGCGTGGGTTCCA-CCCGTTCTATTGATACAATGAATTGGAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCGGTAAGCTTC-CCTGAGCACA--CACAATACAA----CTAAAG-CCATCCA-TCTCGCGATC-TCAGTCTTCGCAATGCGAC-GGAGCTATTGCATCA-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGCCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCTATCATTGACTTCATGACACAGCGCAACATGCAACTTTTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTTAACGGTGTCTGGGTTGGTGTCCATTCGAATGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAATGACATCCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGCAATAAGCTCAAGCAGGAACAGCAAGAGACAAGCGCACGGCAGGGATGGAGTCAGGACGAGGTTGAACAAGCCACTTACGGTTGGAGAGGCCTGATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTTCCAGACCCCCGCATTCATGTATGGCATCCCTTTTCTTTC-----ACACGG-ACAGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTCCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCTGCCGAACTC Nimbya_caricis_CBS480_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGCTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAATTTAACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTT-TGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTTGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCGGAACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATACGAAGGC-GGGCTGGACACCTCCAGACGCGCATTGCTTCACGGCGTGCGCAGCTGGGG-----CCGGCC-CTGCTGAACTATTCTACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCGCCACAAGGACAACCCA--TAAACC--TTTTGCAATAGCAGTCAGCGTCAGTAT-AAAT--GTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-CCGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-TGCG-TGCAGCAAGTC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTA--CCCACTCCATCAATACCGCAACATCAAGACTGACTGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGCGTACA--TACAACACAG----TCACAACCCATCAT-CCTCGCGAAA-CCAGTCCCAGAGATGCGATCAAAGCTACTACATGG-TCACAGAACGTAGGCTAACACA--CATAGGCCTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCTACATTGTCCCATTTGCGTCGAACGAATACGCCGGTCGGTCGCGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAGACCCCCGAAGGGCAGGCCTGTGGCCTTGTCAAGAACCTGTCTTTGATGTGCTATGTTAGTGTTGGAAGTGACGCGTCACCCATCATCGATTTCATGACACAGCGAAACATGCAACTTTTGGAGGAGTACGACCAAAACCAGAACCCAGATGCGACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACCCTATCCTACGAGATGAGTCTTATTCGTGATATCCGTGACCGAGAGTTTAAGATTTTCACAGACGCTGGCCGTGTCATGCGACCGCTGTTTGTTGTGGAGAACGATATCCGGAAGCCGAACCGCAATCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGCCTCATCCAGGATGGTGTTGTGGAATACCTGGACGCCGAGGAGGAGGAGACCGCTATGATAACGTTCTCCCCCGAAGACTTGGAAGAGTGGCGAGAGATGAAGCTGGGTCTACCTGCTGCTGAGCGATCTACCGAAGGGGAGCACCGCCTTCGACGCCTCAAGCCACTCCCAGATCCACGCATTCATGTACGACATCACTTTTCTTCC-----ACATGA-ATGGTCGCTACCTCCCGGTGCATCTTTTGAGCGCGCAGCCA-TTTCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGTTTGCAG-CTTTCGC--GAACCCCAACACCCT----ATGACGCATATTC-AATTTTCCCAT------TTCGGCCACAACATGCTAACGAGCCTCACAGGAAGCCGCCGAGCTC Nimbya_gomphrenae_CBS108_27 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GGGCTGGAATCTCTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACA---TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAAA--TTAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTTGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCACTCTC-TATCAG--CAAAGGTCTAGCA-TCCATTAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTCG-CCCAACTCGTCGATACAAT-CTACCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--TACACTACAG----CCGCGG-CCATCCA-AATTGCGAAA-ACAGTTCTTGCGATGCGCT-AGAGCTCCT--GTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Nimbya_scirpicola_CBS481_90 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGCTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAATTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGTAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-AGGCTGGATACCCCTAGCAGTGCGTTGCCTTGCGGCGTGCGCTGGTAGG------CCGGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTTCTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACCAACTA--TAAACC--TTTTGTAATAGCAGTCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCTAGCTTGGC-TGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TCCCAG--CCAAGGTC-AGCGTTCCAGTAAGCC----TTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCCATCGATACAGTAGCATCGGAACTGACAGC-ATGCCCCAGCATCGAGCACAACGACGTCGACATTGTCGCCGTCAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCACGTACC--TACAATACAC----TCATAG-TCAACCT-CCTCGCGACA-TTAGTCTT---GTGACGAT-GCATCTACCGTGTGCTTCGCAGAACGCAGGCTAACAAA--CATAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACGTACAAGTCTGACATTGAGCGACACTATCCCATATGCGTCGAACGAACACCCCCGTTGGTCGTGACGGCAAATTGGCCAAGCCGCGTCAACTTCACAATTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGTTATGTCAGTGTTGGTAGTGACGCGTCACCCATCATCGATTTCATGACACAGCGGAACATGCAACTTTTGGAGGAGTACGACCAGAATCAGAACCCAGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGAAGAAACGGAACTTTATCCTACGAAATGAGTCTGATTCGTGACATCCGTGACAGAGAGTTCAAGATTTTCACAGACGCTGGCCGTGTCATGCGACCTCTGTTCGTTGTTGAAAATGACATTCGGAAGCCGAACCGTAATCATCTCATCTTCACAAAGGAAATCAGCAATAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAGGATGGTGTTGTGGAATACCTCGATGCCGAGGAAGAGGAAACCGCCATGATAACGTTCTCTCCCGAAGATTTAGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTTCCAGACCCACGCATTCATGTATGGCATCACTTTTCTTTC-----ACATGG-ATGGCCACAACCACCTGGTGCGTCTTCCGTGCGAATAGCCA-TTTCCTTGGCATAT--CGCATTGGAGGGGCATTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAT-CTTTCGC--GAAGCCCAACACC------ATGACGCACATCC-AATCTGCTTAT------TTTGGCCACGACATGCTAACAAGTCGCACAGGAAGCCGCCGAACTC Pleospora_tarda_CBS714_68 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGTTGGGACCTCACTTTGGTGAGGGCT---------------------------CCAGCT-CGTCTGAATTATTC-ACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCA-TAAACC-TTTTTGTAATTGCAATCAGCGTCAGTAAACAAT--GTAAT--TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC--CTTGTCTCTCAC--------GAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTG-AATCAG--CCTTGGTTGAGCA-TCCATCAAGAC---CACATTTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTGA-TTGAACCCGTCAATTCTGCCATATCAAAACTAACCGC-GTCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATC-CCCGGATACA--AGACAGTCTT----CCCGAA-AATCCGC-TGCGCGTTCC-ATCCGATCGCGGGCGGTTG-GGGGCCATTTGTTGC-TAGTATATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGTGTCAATCACGAGACATACAAGTCCGACATCGAGCCACACTTTCCCATCTTCGTCGAACAAATACCCCCGTTGGACGTGATGGTAAATTGGCCAAGCCGCGACAACTGCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCCGAAGGACAGGCCTGCGGCCTAGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGACGCATCGCCCATTATCGACTTCATGACTCAACGAAACATGCAACTTCTCGAGGAGTACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGCCGCAACGGCACCCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTCAAGATCTTCACAGATGCGGGCCGTGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTCTTCACCAAGGCGATTAGTAACAAACTCAAGGCTGAACAGCAAGAGACCAGCACACGTCAAGGTTGGAGTCAGGAGGAGGTCGAGAATGCCACCTACGGCTGGAGAGGCCTTATCCAAGACGGTGTTGTTGAATACCTCGATGCCGAGGAAGAGGAGACTGCCATGATAACCTTCTCTCCCGAGGACCTGGAAGAATGGCGAGAAATGAAGATGGGCTTGCCCGCGGTTGAGCGATCCACCGAGGGCAAGGACCGACTTCGCCGTCTCAAGCCGGCGCCAGACCCTCGCATTCATGTACGACATCACTTTTCTTTC-----ACCCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTCAT--CGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Sinomyces_Alternariae_CBS126989 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG----CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAATA-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAACCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Stemphylium_herbarumCBS191_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGTTGGGACCTCACCTCGGTGAGGGCT---------------------------CCAGCT-TGTCTGAATTATTC-ACCCATGTCTTTTGCGCACTTCTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCA-TAAACC-TTTTTGTAATTGCAATCAGCGTCAGTAAACAAT--GTAAT--TATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTTGTCTCTCAC-------GAGACTCGCCTTAAAATGATTGGCAGCCGACCTACTGGTTTCGGAGCGCAGCACAATTCTTGCACTTTG-AATCAG--CCTTGGTTGAGCA-TCCATCAAGAC-CACATTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGTTTGA-TTGAGCCCGTTAATTCTGCCATATCAAAGCTAACCGC-GTCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATC-CCCGGATACA--AGACAGTCTT----CCCGAC-AATCCGC-TGCGCGTTC--CATATGATCGCGGCGGTTG-GAGGCCATTTGTTCC-TAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGCCACACTCTCCCATCTTCGTCGAACAAATACCCCTGTTGGACGTGATGGTAAATTGGCCAAGCCGCGACAACTGCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCCTGCGGCCTGGTCAAGAACTTGTCTCTCATGTGCTACGTTAGTGTCGGTAGCGACGCATCGCCCATTATCGACTTTATGACCCAACGAAACATGCAACTTCTCGAGGAGTACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGCCGGAACGGCACCCTATCCTACGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTCAAGATTTTCACAGATGCGGGCCGTGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTCTTCACAAAGGCGATTAGTAACAAACTCAAGGCTGAACAGCAAGAGACCAGCACACGTCAAGGCTGGAGTCAGGAGGAGGTCGAGAATGCCACCTACGGCTGGCGAGGCCTTATCCAAGACGGTGTTGTTGAATACCTCGATGCCGAGGAAGAGGAGACTGCTATGATAACCTTCTCTCCCGAGGACCTGGAAGAATGGCGAGAAATGAAGATGGGCTTACCCGCGGTTGAGCGATCCACCGAGGGCAAGGACCGACTTCGCCGTCTCAAGCCCGCGCCAGACCCTCGCATCCATGTACGGCATCACTTTTCTTTC-----ACTCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTTAT--GGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATTCGG-CCTTCGC--GAATCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCATAGGAAGCCGCCGAGCTC Teretispora_leucanthemi_CBS421_65 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATAAACGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTTCCGGGAGG----------------------------------CTGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCAC-AAAACC--TCTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTTTCGT-TTGC-GGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTGCA-CCCGCTCCGCTGATACAAGTGCATCAAAGCTGACCGT-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACCCGCACTACAGCCAAAGCCACAG-CCATGCA-ACTCGCGACA-TCAGTCCTTGCGACGCGCT-AGAGATCCTCCACGG-TTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTTGTCATGGGTGTCAACCATGAGACTTACAAGTCCGACATCGAGCCACATTATCTCATTTGCGTCGAACCAACACCCCGGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTTTGGTTAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGGGTTCACTCCAATGCACAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGTAATGGAACTCTATCCTACGAAATGAGTTTGATTCGTGACATTCGCGACCGGGAGTTCAAGATCTTCACAGATGCCGGCCGTGTGATGAGACCACTGTTTGTGGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGCAAGAGACAAGCACGCGACAGGGTTGGAGTCAGGACGAGGTCGAACAAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAGTACCTAGACGCCGAAGAGGAGGAGACAGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTTCGACGCCTCTAGCCACTACCAGATCCCCGCATCCATGTACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Teretispora_leucanthemi_CBS422_65 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATAAACGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAGGC-GGGCTGGCCTCTTCCGGGAGG----------------------------------CTGGCC-CTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGCTCGCCCACCACAAGGACAAACCAC-AAAACC--TCTTGTAATTGCAATCAGCGTCAGTAA-CAAC--ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGCGTC---TTGTCTTTCGT-TTGC-GGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCG-TCCACAAAGCC-----TTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTGCA-CCCGCTCCGCTGATACAAGTGCATCAAAGCTGACCGT-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACCCGCACTACAGCCAAAGCCACAG-CCATGCA-ACTCGCGACA-TCAGTCCTTGCGACGCGCT-AGAGATCCTCCACGG-TTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTTGTCATGGGTGTCAACCATGAGACTTACAAGTCCGACATCGAGCCACATTATCTCATTTGCGTCGAACCAACACCCCGGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTTTGGTTAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGGGTTCACTCCAATGCACAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGTAATGGAACTCTATCCTACGAAATGAGTTTGATTCGTGACATTCGCGACCGGGAGTTCAAGATCTTCACAGATGCCGGCCGTGTGATGAGACCACTGTTTGTGGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGCAAGAGACAAGCACGCGACAGGGTTGGAGTCAGGACGAGGTCGAACAAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAGTACCTAGACGCCGAAGAGGAGGAGACAGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Ulocladium_arborescens_CBS115269 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGAATCCTTTGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CGAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGATATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGTCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_atrum_CBS195_67 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAATGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytis_CBS197_67 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG----CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAATA-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAACCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_botrytis_CBS198_67 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_brassicae_CBS121493 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cantlous_CBS123007 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGAAAAAAAAAATTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAATCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACGCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGTGATGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTATGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTAGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGTTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTTCTTTC-----ACATAG-ACAGTCGCGCCCACCTAGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCTGAACTC Ulocladium_capsicuma_CBS120006 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGAATCCTTTGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CGAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTAGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGATGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_chartarum_CBS200_67 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGAATCCTTTGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CGAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGATATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGTCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_consortiale_CBS104_31 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cucurbitae_CBS483_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_multiforme_CBS102060 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_obovoideum_CBS101229 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_oudemansii_CBS114_07 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGACTCCCCCCAGCAGTGCGTTGCTTTGCGGCGTGCGCTGTTGGGG----CCAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACAAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CAATA-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGGGACTCGCCTTAAAGTTATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAACCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCATTTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_septosporum_CBS109_38 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGAATCCTTTGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCAT-TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAAA-TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CGAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGATATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGTCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_solani_CBS123376 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC-TTTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCTGTTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AGTCGCGACA-CCAGTCCTTGTGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAATTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_subcucurbitae_CBS121491 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC-TTTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCTGTTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AGTCGCGACA-CCAGTCCTTGTGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAATTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_tuberculatum_CBS202_67 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACAC-AATATGAAAGC-GGGCTGGCATCCTTCGGGGTT----------------------------------ACAGCC-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCA-TAGGACAAACCA--TAAACC--TTTTGTAATTGCAATCAGCGTCAGTAAAAAAA--TTAAT--AATTACAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCAGT-TCGC-TGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTC-TTCCAG--CCAAGGTC-AGCA-TCCACAAAGCC------TTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Undifilum_bornmuelleri_DAOM231361 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGTACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCAGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGAAATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAATATCATTACACAAATATGAAGGC-GAGCTGGATCCCCCTTAGCCGTGCGTTGCTGTACGGCGTGCGCGGCTGGGG----CCAGCG-TTGCTGAATTATTC-ACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGTTCGCCCACCACCAGGACCAACCAC-CAAACC--TTTTGTAATTGCAATCAGCGTCAGTAA-CCAAC-ATAAT--AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTC---TTGTCTCCCGT-TCGC-TGGGGACTCGCCTTAAAGTCATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAA--GTCGCGCTCTT-TTCCAG--CCAAGGTC-AGCG-TCCACCAAGCC-----ACATTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCTATCGTCTTCCGCAATGCGTAGGTTGCA-CCCATGCCATCGATACGGTCGTGCCAAAGCTAACCCCAATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTT-CCAGAATACA--CCCAATTCAG----TCCTAG-CCATCCG-CCTCGCGACA-TCAGTCCTTGCAATGCGCT-AGAGCTGCTCCACAG-TCGCAGAATGCAGACTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACCCACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATTCCATGGAGCGAGACCGGCGCTTACTATGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGCAAGCTAGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTAAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCGATCATCGACTTCATGACACAGCGAAACATGCAACTTCTAGAGGAATACGATCAAAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAATGGAACTTTATCCTACGAGATGAGTTTGATTCGTGACATTCGGGACAGAGAATTCAAGATCTTCACAGACGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAAGACATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAAGTCGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAAGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGCTGGGCTTACCTGCGGCGGAGCGATCTACAGAAGGTGAGCATCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-AATGTGGCATCCGCCCGGTGCATCCGCTGAGCGCTCAGCCA-ACTCGT-GGCTCAT--TGCGATGAGGGGCA--TTTTGGGTAGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCACTAGTCTGCATACGG-CGTTCGC--GAACTTCAACACC------ATGACGCACATCC-AATTTCCTCATTTTAGCTTTTGCAATAGCATGCTAACAAACCCCACAGGAAGCCGCCGAGCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17357] TITLE GAPDHRPB2TEF1_Character_Matrix; LINK TAXA = Taxa2; DIMENSIONS NCHAR=1628; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 TATCGTCTTCCGCAATGCGTAAGCTTCG-CCCAACTCGCCGATACAAT-CTATCCGAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----GCCAGG-CCATCCA-AATCGTGACG-ATAGTCCTTGCGATGCGCT-GAAGCTCCTCTGTGG-TCGCAGAATGCACGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACCAACACCCCTGTTGGTCGTGATGGAAAGCTGGCAAAGCCGCGACAACTCCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGGAACATGCAGCTTCTGGAAGAGTATGATCAAAATCAGAACCCCGACGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTCCGACGAAACGGAACCCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTATTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACTAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAGGAGGAGGAGACGGCCATGATAACATTCTCCCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAACTGGGCCTGCCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCCCGTATCCATGTATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS916_96 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_anigozanthi_CBS121920 TATCGTCTTCCGCAATGCGTAGGTTTTG-GCTGCTCCACTGATACAATTGATCAAAAGCTGACCGC-GTGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCGATGCGAT-GGTACCGTTGCCTTG-TCATAGAGCGCAGGCTAATATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCGCATATGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTAGGTGTCCACTCCAACGCTCAACAGCTCGTTACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTTACAGACGCTGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAACCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAAGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTGATCCAGGACGGTGTTGTCGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCCGAGGATCTCGAGGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCATCGTCTCCGACGCCTCAAGCCGCTACCAGACCCACGCATCCATGTATAACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTT-------TAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACACGC-AATCTTCCTCGCTAT--GTTGGCTACAGCTAGCTAATAATCCTCACAGGAAGCTGCCGAACTC Alternaria_arborescens_CBS102605 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTCCGACGTCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_argyranthemi_CBS116530 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACGCTTCATCGATACCATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTCAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGACTACA--CACGATACAG----CCACAG-CCGTCCATTCTCGAGACA-TCAGTTCTCGCCATGCGAT-GGAGCTATCTCATGG-CCGCAGAACACAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGAAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGATGGCAAGCTGGCTAAGCCGCGACAACTTCACAATTCCCACTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCGTCACCCATCATCGATTTCATGACACAACGAAACATGCAACTTTTGGAAGAGTACGACCAAAACCAGAACCCCGACGCAACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACCCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAGGAGACAAGCACGCGACAGGGATGGAGTCAAGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAGGAGGAGGAGACCGCCATGATAACCTTCTCTCCCGAAGATCTGGAAGAGTGGCGGGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTACGGCATCACTTTTCCTTC-----ATACGG-ACAATCGCGCCCAATCA--GATGCATCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TATTTTGGGCGG-TGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCTCAC------TCTGGCCAAAGCATGCTAACAAGCCTCTCAGGAAGCCGCCGAACTC Alternaria_armoraciae_CBS118702 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GAGCTATTGTGCTA-TCGCAGGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACTTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGAAAGCTAGACAAGCCGCGACAGCTTCACAACACCCACTGGGGTCTTGTCTGCCCCGCTGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAGAACCAGAACCCAGACGCGACCAAGGTATTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAGCTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTTTCTTACTAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTTAAGCAGGAGCAACAAGAAACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATTTGGAAGAATGGCGAGAGATGAAGCAGGGTCTGCCTGCAGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCCGACCCACGCATCCACGTACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_avenicola_CBS121459 CATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACGCTGTCCCATGTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_axiaeriisporifera_CBS118715 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGTATCCACGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--AGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_brassicae_CBS116528 TATCGTCTTCCGCAATGCGTAGGCTTCG-CCCATTCGATTGATACAACTATATCGAAGCTGACCGC-GTGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-TCCAAGCATC--CACACTACAG----CTACAG-CCATCCA-GGTCGCGACA-CCAGTCCTTGCGATGCGCT-AGAGCTCCT-----------AGAATGCAGGCTAACATA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCAGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCTACACTGTCCCATGTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCATAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTTGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAATCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACGGTCGTTCAAGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGGCCACTTTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCCACCACCTTATCTTCACCAAGGACATTAGCAACAAGCTTAAGCAGGAACAACAAGAGACGAGCACGCGACAGGGATGGAGCCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGTCTTATTCAGGATGGTGTAGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCTGAAGATCTGGAAGAGTGGCGAGAGATGAAGCAGGGCTTGCCTGCTGCGGAGCGATCTACTGAGGGTGAACACCGTCTCCGACGTCTCAAGCCACTACCAGACCCCCGTATCCATGTTTGGCATCACTTTTCCTTT-----ACACGC-ACAGTTGCGTCCACTCGGTGTATCCTCTGAGCGCGCAGCCA-TATCCT-GGTTTTT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCGTGCGG-CCCTCGC--GAACCCCAACACG------ATGACGCACATGC-AATTTCTATAT------TTTGGCTACAGCAAACTGACAAGTCTAACAGGAAGCCGCCGAACTC Alternaria_brassicicola_CBS118699 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_calycipyricola_CBS121545 CATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_capsici_annui_CBS504_74 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAATCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_carotiincultae_CBS109381 TATCGTCTTCCGCAATGCGTAGGTTTGA-CCCATTGCGTCGATACAGT-GTATCAAAGCTGACGGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTC-CCTAAGCACC--CGCGCTACAG----CCACAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAGTGCTGGCTAACACA--TCTAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACGCTGTCACATTTGCGTCGAACAAACACTCCCGTTGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATCCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_cheiranthi_CBS109384 CATCGTCTTCCGCAATGCGTAGGTTCCA-CCCGCTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACCCACACACTACTG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTATTCCACGG-TCGCAGATTACAAGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGAAGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAATCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTTGGTAGTGACGCTTCACCCATTATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGTCTCATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGTCTACCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATTCATGTACGACATGACTTTGCTTTC-----ACATGG-ATAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACA------------------TCC-AATTCTGCTAT------TCTGGCCACAGTGCGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_chlamydospora_CBS491_72 TATCGTCTTCCGCAATGCGTACGTTTCC-CTCGCTCCAAGGATGCGGCAATATTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACA--T-GAAAACAG----TCACCG-CCATCCC-TCCCGCAGCA-TCAGTCCTTGGGATGCGAT-GGAGCTACGGTACAA-TCGCAGGATGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGAGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGGACCAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGGCAGGCTTGTGGTCTGGTCAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGATTTCATGACGCAGCGAAACATGCAACTTTTGGAGGAATACGACCAGAATCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTTCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTTTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTGGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCCACCGAAGGCGAGCACCGTCTTCGACGCCTGAAGCCGCTGCCAGATCCACGCATCCATGTATGGCATCACATCTCTTTC-----AAATGG-ACGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAATCCCCAGCACC------ATGACGCACATGC-AATTTCCCTAC------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_cinerariae_CBS116495 TATCGTCTTCCGCAATGCGTAGGTCCCG-CCCATTCGATTGATGCAATTATATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCGGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCTAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCGCGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTTCACGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACACTATCCCATTTGCGGCGCACAAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGTCAACTTCACAACTCTCATTGGGGTCTTGTCTGTCCTGCGGAGACTCCTGAAGGACAAGCTTGTGGCCTTGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAATGGAACTCTATCTTACGAGATGAGTCTGATTCGTGACATTCGCGACAGAGAGTTCAAGATCTTCACAGACGCCGGCCGTGTCATGAGACCACTTTTCGTTGTCGAGAATGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAGGCACGCGACAAGGATGGAGCCAGGACGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATTCAGGACGGTGTTGTGGAGTACCTAGACGCCGAGGAAGAGGAGACCGCCATGATAACGTTCTCCCCAGAAGACCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCGCTGCCAGATCCCCGTATCCATGTATGGCATCACTTTCCTTTC-----ACGCGGCACAGTTGCGTCCACTCGGCGCATCC-CTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------TTTGGCTACATCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_conjuncta_CBS196_86 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAACAGCCCACCCA-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGGCTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACATTGTCGCATTTGCGTCGAACGAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGTCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATTGACTTCATGACACAGCGAAACATGCAGCTTCTGGAAGAGTACGACCAAAATCAGAACCCAGATGCGACCAAGGTCTTCGTCAACGGTGTATGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTATTCGTGGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTAATCTTTACCAAGGAAATCAGTAACAAGCTGAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCCGAGGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGCTCTACCGAAGGCGAGCATCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCTGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCTTCAGTTTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_cumini_CBS121329 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGTTCCGCTGATACAGCTGATCAAACACTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCACAG-CCATCCA-CCGCCCGATA-CCAATCTTCGCAATGCCAT-GGAGCCATTGCACGA-TCGCAGAACACAGGCTAACACATGCACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCAGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCGGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGTGTCCACTCCAACGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCGAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAGCAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGACGAGGTCGAACAAGCTACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTGGAATACTTGGACGCCGAAGAGGAAGAGACTGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCTCGCATTCATGTATGGCATCACTTTTCTTTC-----ATGCGC-ACAGTTGCATCCCCTTGGTGTATCCTCTGAGCGCGCAGCTG-GTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGTTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CATTCGC--GAAATGCAACACC------ATGACGCAGTTTC---------CAT------TCTGGTCACAGCACGCTAAGAACCCTTCCAGGAAGCCGCCGAACTC Alternaria_dauci_CBS117097 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAAATCATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-CTAGTCATTGCGATGCGCT-AGAGCTTCTCTACAG-CTGCAGAACGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGTTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATCACTTTTCCTTTC----ACACGC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTACTTATGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTC Alternaria_daucifolii_CBS118812 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_dianthicola_CBS116491 TATCGTCTTCCGCAATGCGTAGGTTCCA-TCCGATCTGCCAACACAATCGTATCAATGCTAACCCC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTTCCCCAAGCACC--CAAACTACAGC---TCAAAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-CGAGGCACCTCACAG-CCGTAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAATCTCACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCTGAAACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATTATCGACTTCATGACACAGCGAAATATGCAACTTTTGGAAGAATACGACCAGAATCAGAACCCCGATGCTACCAAGGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCACTCCAACGCTCAACAATTGGTCACAGTCGTGCAGGAGCTGCGACGAAATGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATTCGTGACCGAGAGTTCAAGATCTTCACCGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAACTCAAGCAGGAACAACAAGAGACGAGCACACGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACGTACGGTTGGAGAGGCCTTATCCAGGACGGTGTCGTGGAATACCTAGATGCCGAAGAGGAAGAGACAGCCATGATAACGTTCTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGTTTACCTGCGGCAGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCTCGCATCCATGTATGGTACCAAATTCATTTT-----TCATGG-ACCCTCAGATGCCCCCGATGCATGCTCTGAGCGCTCTGCCA-TTTTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CTTTCGC--GAAC--------------------------------------------------------ACACGCTAACAAGTCTCACAGGAAGCCGCTGAACTC Alternaria_elegans_CBS109159 TATCGTCTTCCGCAATGCGTAGGTTCCA-TCCACTCTGCCATGACAATCGTATCAAAGCTGACCGC-ATCCTATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CAAACTACAGC---CCGTAG-CCATCCA-AATCGCGACG-GTAGTCCTTGCGATGCGCT-CGAGGCACTCCACGG-TCTCAGCTTGCAGGCTAACACA--TTCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTTTCCCATTTGCGTCGAACAAACACCCCTGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAAACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAATACGACCAAAATCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTCGTCACAGTCGTGCAGGAGCTTCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGCGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAACTCAAGCAGGAACAACAAGAGACGAGTACGCGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTTATCCAGGATGGTGTCGTAGAATACCTTGATGCTGAAGAGGAGGAGACAGCCATGATAACGTTCTCCCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGACTCAAGCCACTGCCAGACCCTCGTATCCATGTATGGCATCGCCTTTCCTCTCCTC-TCATGGAACCCCCTCGTCCACTTGATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_ellipsoidea_CBS119674 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATTACGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACTACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGTTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAACGCTCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_eryngii_CBS121339 TATCGTCTTCCGCAATGCGTAGGTTCTATCCCACGCCATTGATACCATCATCTCAAAAGTAACCGC-ATGCCATAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCGCGCACC--CAAAATACAG----CCACAG-CAATGCA-AATCGCGACA-CCGGTCCTTGTGATGCGCT-GGAGCTATTCCACGA----CAAAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAATCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATTCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAACTAGCCAAGCCACGACAACTTCACAACTCCCATTGGGGTCTTGTCTGTCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTCGAGAACGACATTCGGAAGCCGAATCGTAACCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTTTCTCCTGAGGACCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACTGAGGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTATGGCATCAATTTTCTTTC-----ACCTGG-ACGGTCGCATGCCTCAGATGCATTCCTCAAGTGCCCAGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTC----------CTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCTGCCGAACTC Alternaria_ethzedia_CBS197_86 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAATAGCCCACCCT-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGGTTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGCGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCGCATTTGCGTCGAACGAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTGGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTCAATGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAAATCAGCAACAAGCTGAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCCGAGGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCGCGCATCCACGTACGGCATCACTCTCCTTTC-----ACATGG-GCATTCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCTTCAGTCTGCTAACAGGCCTCACAGGAAGCCGCCGAACTC Alternaria_gaisen_CBS632_93 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCCTGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCAAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAATTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAATCCTGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAGCAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATTACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTCCGACGTCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_geniostomatis_CBS118701 CATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGCTCCACTGATACAATTGATCGAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCGTAG-CTATCCA-CCGCGCGAAA-TCAATCTTCGCGATGCGAT-GGAGCCGTTGCCTTA-TCATAGAGCGCAGGCTAACACATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAAAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAAGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCCGCTCCCTCTGCCGACGCCCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACATTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGATGGTAAATTAGTGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCTGATGCCACCAAAGTCTTCGTCAATGGTGTGTGGGTGGGTGTTCACTCCAACGCTCAACAGCTCGTCACGGTTGTGCAGGAGCTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATATCTAGACGCAGAAGAGGAAGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGACAACACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATGC-CATGTCGCTAT------TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gypsophilae_CBS107_41 CATTGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAATGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_helianthiinficiens_CBS117370 TATCGTCTTCCGCAATGCGTGGGTTTCG-TCCGTTCCATGGATAAAGCTCTTTCAAAGCTGACCGC-ATGCCGCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAGACGCC--CGCACCACAA----CCACAG-CCATCCA-GATCGCGACA-TGAGTCCTTGCGATGCGCT-AGAGTCCCTTTTCGG-TCGCACAACACAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGCCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGTTATGTCAGTGTCGGTAGCGACGCTTCACCCATTATCGACTTCATGACACAGCGAAACATGCAACTCTTGGAGGAGTACGATCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTGAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACCTACGGCTGGAGAGGCCTTATCCAGGACGGTGTTGTAGAATACCTTGACGCAGAAGAGGAAGAAACTGCCATGATAACGTTCTCCCCCGAAGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_helianthiinficiens_CBS208_86 TATCGTCTTCCGCAATGCGTGGGTTTCG-TCCGTTCCATGGATAAAGCTCTTTCAAAGCTGACCGC-ATGCCGCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAGACGCC--CGCACCACAA----CCACAG-CCATCCA-GATCGCGACA-TGAGTCCTTGCGATGCGCT-AGAGTCCCTTTTCGG-TCGCACAACACAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGCCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATCTGTCTTTGATGTGTTATGTCAGTGTCGGTAGCGACGCTTCACCCATTATCGACTTCATGACACAGCGAAACATGCAACTCTTGGAGGAGTACGATCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATTAGTAACAAGCTGAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACCTACGGCTGGAGAGGCCTTATCCAGGACGGTGTTGTAGAATACCTTGACGCAGAAGAGGAAGAAACTGCCATGATAACGTTCTCCCCCGAAGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_infectoria_CBS210_86 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCATAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCAT--CCCGCGCAAA--CACAAACCCA----TAATAGCCCACCCA-TCTTTGCACA-TCGGCTTTTACGATGCCAC-GGAGCGGTTCTACGA-CTACAGTACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACCTGAAGGGTGGAGCCAAGAAGGTTGTTATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCTACATTGTCGCATTTGCGTCGAACAAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCCTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTGGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATCCGGAAACCGAACCGCAACCACCTCATCTTTACCAAAGAAATCAGTAATAAGCTGAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGAGTTGTGGAATACCTCGACGCCGAAGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGTTCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ACACGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAATAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_japonica_CBS118390 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCGGTTGATACAGTTGTATCAAAGTTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCATC--CACACGACAG----CCACAG-CCATCCA-AGCCCCGACA-GCAGTCCTTGTGATGCGCT-AAAGCTATTCCATGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAATCAGAACCCTGATGCAACAAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACGGTCGTGCAAGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGGTGGAACAAGCCACTTACGGCTGGAGAGGCTTGATCCAGGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGATCCCCGCATCCATGTACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_juxtiseptata_CBS119673 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATGCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCCCCTCCGCGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGGCAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCTATCATCGATTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCACAACAACTTGTCACAGTTGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGATATCCGGAAGCCAAACCGCAATCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTACGGCTGGAGAGGTCTCATCCAGGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACTGAGGGTGAACACCGTCTCCGGCGCCTCAAGCCACTGCCAGACCCCCGCATCCATGTATGGCATTACTTTTCTTCC-----ACGCAC-ACTGTTGCATCCACATGGTGCTTCCTTTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGACGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_limaciformis_CBS481_81 TATCGTCTTCCGTAATGCGTACGTTTCC-CTCCTTCCATAGATACAGCAAC-TCCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCA------------------------------------------ACA-TCAGTCCTTGCGATACGAT-GGAGCCACGGTGTAA-TCGCAGGATATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGCCACACTGTCTCATTTGCGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAATACGACCAAAACCAAAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGTGTTCACTCCAACGCGCAGCAGCTTGTCACAGTTGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTTTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACATACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCTGAAGAAGAGGAGACCGCCATGATAACGTTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTAGGCTTGCCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTGAAGCCTCTACCAGATCCACGCATCCATGTACGGCATCACTTTTCCTTC-----AAACAG-ACGGGCGCAATCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_limoniasperae_CBS102595 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes_CBS540_94 TATTGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTATGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_macrospora_CBS117228 TATCGTCTTCCGCAATGCGTATGTTTCG-CCCAATTCATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACTG----CCATGG-CCATCCG-CATCGCGACA-CTAGTCCTTGCGATGCGCT-AAAGCTTCTCTACAG-CTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCTATGATAACGTTCTCTCCTGAGGACCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCCCGCATCCACGTATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTCCCCATGATGCACATCT-AACTTCTCAAC------TATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_mimicula_CBS118696 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_molesta_CBS548_81 TATCGTCTTCCGCAATGCGTATGTTTCC-CTCCCTCCATAGATCCAGCAAC-TTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCG------------------------------------------ACA-TCAGTCCTTGCGACACGAT-GGAGCTACGGTACGA-TTGCAGGACGCTGGCTAACACA--CCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGCTACACTGTCCCATTTGCGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCTAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAATACGACCAGAACCAAAACCCCGATGCTACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGCGTTCACTCCAACGCTCAGCAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGTCGTGTCATGAGACCACTTTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTGGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCGCCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCTGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTGAAGCCGCTACCAGATCCACGCATCCATGTACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_mouchaccae_CBS119671 TATCGTCTTCCGCAATGCGTACGTTTCC-CTCCCTCCATAGATCCAGCAAC-TTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCG------------------------------------------ACA-TCAGTCCTTGCGACACGAT-GGAGCTACGGTACGA-TTGCAAGACGCTGGCTAACACA--CCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGCTACACTGTCCCATTTACGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGGCAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTGGAAGAATACGACCAGAACCAAAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTAGGTGTTCACTCCAACGCTCAGCAGCTTGTTACAGTTGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAAATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTTTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTGGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTTTCACCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCTGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTGAAGCCGCTACCAGATCCACGCATCCATGTACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_nepalensis_CBS118700 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCGGTTGATACAGTTGTATCAAAGTTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCATC--CACACGACAG----CCACAG-CCATCCA-AGCCCCGACA-GCAGTCCTTGTGATGCGCT-AAAGCTATTCCATGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTATCCCATTTGCGTCGAACGAATACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGTCAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAATCAGAACCCTGATGCAACAAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACGGTCGTGCAAGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGGCAGGGATGGAGTCAGGATGAGGTGGAACAAGCCACTTACGGCTGGAGAGGCTTGATCCAGGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGATCCCCGCATCCATGTACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_nobilis_CBS116490 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATTACGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACTACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGTTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAACGCTCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCTCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_oregonensis_CBS542_94 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAATAGCCCACCCA-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGTTTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCATATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCGCATTTGCGTCGAACGAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTCGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAAGTCTTCGTTAATGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACATACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGATGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ATATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTGTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATTACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_panax_CBS482_81 TATCGTCTTCCGCAATGCGTATGTCTCA-CCCACTCCGTTGATACCATCATATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAGCGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----CCACAG-CCATGCA-AATCGCGACA-CCCGCTCTTGCCATGCGCT-GGAGCTACTACACGA-CCGCAGAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAATCACGAGACTTACAAGCCCGACATCGAGCGACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCACGACAACTTCACAACTCCCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTCCTAGAAGAGTACGACCAGAATCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAATCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGGGAGATGAAGCTGGGCTTGCCTGCGGCTGAGCGATCAACTGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGTATTCATGTACCACATCCCTTTTCTTTC-----ACATGG-ACGGTCGCACGTCCTCGATGCATCCTCTGAGCGCCTAGCCA-TTTCCT-GGCTGAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC----ACTCCACCACC------ATGACGCACATCC-AATTTTCCCAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_perpunctulata_CBS115267 TATCGTCTTCCGCAATGCGTAAGCTTCG-CCCAACTCGCCGATACAAT-CTATCCGAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----GCCAGG-CCATCCA-AATCGTGACG-ATAGTCCTTGCGATGCGCT-GAAGCTCCTCTGTGG-TCGCAGAATGCACGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACCAACACCCCTGTTGGTCGTGATGGAAAGCTGGCAAAGCCGCGACAACTCCACAACTCTCACTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGGAACATGCAGCTTCTGGAAGAGTATGATCAAAATCAGAACCCCGACGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAGCTTGTCACAGTTGTGCAGGAGCTCCGACGAAACGGAACCCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTATTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACTAAGGAGATTAGTAACAAGCTCAAGCAGGAGCAACTAGAGACAAGCACACGACAAGGTTGGAGCCAGGATGAGGTCGAATCAGCCACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAGGAGGAGGAGACGGCCATGATAACATTCTCCCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAACTGGGCCTGCCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCCCGTATCCATGTATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_petroselini_CBS112_41 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCC-CCCAAGCACC--TACACTACAG-----------CCGTCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACGGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGCGACACTGTCACATTTGCGTCGAACAAACACTCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTTGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTCGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_photistica_CBS212_86 CATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACGCTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACGCAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGAGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGTACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGCATACCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCAC--TACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_porri_CBS116698 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTCATTGATACAGTCG-ACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-CTGCGGAATGCAGGCTAACAAA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTATCCATGTATGACATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAAACGAACACCCACTTAATGATGCACATTT-AACTTCTCAAC------CCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTC Alternaria_pseudorostrata_CBS119411 TATCGTCTTCCGCAATGCGTACGTTCCG-CCCGATTCATTGATACAATTG-ATTTGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CACCGCGACA-TTGGTCCTTGCGATGCGCC-AGAGCTCCTCTACAG-CTGCAGAACGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAAAATTTGTCTTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTCGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGATATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACTAGCACACGACAGGGATGGAGTCAAGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATCACTTTTTCTTTC----ACACAC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAACTTTTTACGCGCTAGCGCTAGCCCGCTTGCGG-CCGACATCGAAAACCGAACACCCTGGTAATGATGCACATCC-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_radicina_CBS245_67 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTGCGTCGATACAGT-GTATCAAAGCTGACGGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTC-CCTAAGCACC--CGCGCTACAG----CCACAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAGTGCTGGCTAACACA--TCTAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACGCTGTCACATTTGCGTCGAACAAACACTCCCGTTGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTCTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATCCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_resedae_CBS115_44 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCGCTCCATTGATACAATTGTATCAAAGCTAACCAC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCGGTAAGCTTT-CCCAAGCACCCACAAACTACAG----CTATAG-TCATCCA-AATCGCAGCA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTAGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAATACGACCAAAACCAGAACCCTGATGCAACTAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTTGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTGGAGAACGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTTGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGTTTACCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATTCATGTACGACATCACTTTTCTTTC-----ACATGG-ATAGTCACATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAAGCCGCATACGG-CGTTCGC--GAACTTCAACA---------------ACGTCC-AATTTCCCTGT------TCTGGCCACAGTACGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_saponariae_CBS116492 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACTGC-ATGCTACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCTAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGCCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGTTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGCTCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_selini_CBS109382 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCC-CCCAAGCACC--TACACTACAG-----------CCGTCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACGGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGCGACACTGTCACATTTGCGTCGAACAAACACTCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTTGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTCGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTCCAT------CTTGGCTACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_septorioides_CBS106_41 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_simsimi_CBS115265 TATCGTCTTCCGCAATGCGTAGGTTCCA-TCCACTCTGCCATGACAATCGTATCAAAGCTGACCGC-ATGCTATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CAAACTACAGC---CCGTAG-CCATCCA-AATCGCGACG-GTAGTCCTTGCGATGCGCT-CGAGGCACTCCACGG-TCTCAGCTTGCAGGCTAACACA--TTCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACTCCTGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAAACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAATATGCAACTTCTGGAAGAATACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTCGTCACAGTCGTGCAGGAGCTTCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGACGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAACTCAAGCAGGAACAACAAGAGACGAGTACGCGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTTATCCAGGATGGTGTCGTAGAATACCTTGATGCTGAAGAGGAGGAGACAGCCATGATAACGTTCTCCCCTGAAGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGACTCAAGCCACTGCCAGACCCTCGTATCCATGTATGGCATCGCCTTTCCTCTCCTCCTTATGGAACCCCCTCGTCCACTTCATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCTGAACTC Alternaria_smyrnii_CBS109380 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCT-CCCAAGCACC--CACACTACAG-----------CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGCGACACTGTCACATTTGCGTCGAACAAACACTCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAACCCCGATGCGACTAAAGTCTTTGTCAATGGTGTCTGGGTTGGTGTCCACTCCAATGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATCCGGAAGCCAAACCGTAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACATATGGCTGGAGAGGTCTCATCCAAGACGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTTTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGCATTCATGTATGGCATCACTTTTTTTTCC----ACACGG-ACAGCTATATCCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATAC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_solani_CBS116651 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTCATTGATACAATCG-ACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-CTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTTGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGGTGGAGTCAGGATGAGATTGATTCAGCTACTTATGGCTGGAGAGGTCTTATTCAAGATGGTGTCGTGGAGTACCTGGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCCTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGTATCCATGTATGACATCACTTTTCCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAGACCGAACACC--AAGGACGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTC Alternaria_soliaridae_CBS118387 TATCGTCTTCCGCAATGCGTACGTCTCA-CCCTCTCCATTGATGCAGCAACATGCAGTCTAACCAC-ATGCTACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGTCTATA--CACAATACAG----CCATAG-CCATCTC-----------------CCTTGCGACGCGAT-AGAGCTTCTGTATAA-TCGCAGGATGCAGGCTAACACAC-ACCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGATTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACATACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACACCCGTTGGTCGTGACGGCAAACTAGCCAAGCCGCGACAACTTCACAACTCACATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTCTGGTAAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGTGACGCGTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAAAACCAGAATCCAGATGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAAATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGTCGTGTCATGAGACCACTATTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTCGTGGAATACCTGGACGCTGAGGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACTGAGGGTGAGCACCGTCTTCGACGACTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACGCGG-ATGGTTGCAACCACCCGGTGCATCCTCTGA--GCTTAGCCA-TATCCT-GGCTTGT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCT-AATTATCCTAT------TTTGGCCACAACATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_solidaccana_CBS118698 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGGTACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_sonchi_CBS119675 TATCGTCTTCCGCAATGCGTAGGTTCCG-CCCATTCGATTGATGCAATTATATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCGGTGAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCACC--CACAATACAG----CCGCAG-CCATCCA-AATCGCGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTTCACGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCTTGAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAAGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCGACACTATCCCATTTGCGTCGCACAAACACCCCTGTTGGTCGCGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGTCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTTGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGCAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAAGAGCTGCGACGAAATGGAACTCTATCTTACGAGATGAGTCTGATTCGTGACATTCGCGACAGAGAGTTCAAGATCTTCACAGACGCCGGCCGTGTCATGAGACCACTTTTCGTTGTCGAGAATGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAGGCACGCGACAGGGATGGAGCCAGGACGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTTATTCAGGACGGTGTTGTGGAGTATCTAGACGCCGAGGAAGAGGAGACCGCCATGATAACGTTCTCCCCAGAAGATCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTGCCAGATCCCCGTATCCATGTACAGCATTACTTTCCTTTC-----ACGCGGCACAGTTGCGTTCACTTGACGCATCCTCTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------CTTAGCTACATCACGCTAACAATCCTCACAGGAAGCCGCCGAACTC Alternaria_tagetica_CBS479_81 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTTATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAAATGCAG----CCTTGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCCATGCGCT-AGAGCTCCTCTACAG-CTGCAGAACGCAGGCTTACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCCGTCGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTCGTCAAGAATTTGTCTTTGATGTGCTACGTGAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACCGTTGTGCAGGAGCTGCGACGTAACGGAACTCTGTCCTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAAAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGATTGATTCGGCTACTTATGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAGTACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGGGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACTGAGGGCGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCACGTATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACATCCCACACATGATGCACATCT-AACTTCTCAAT------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_tenuissima_CBS918_96 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTGGAGTACCTTGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_thalictrigenaCBS121712 TATCGTCTTCCGCAATGCGTAGGTCCCA-CCCACTCCATTGATACCATCATATCTAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CTCAAGTGCC--CACACTATAG----CTGCAGCCCATCCG-AATCGCGACA-TCAGGAGCTACGATGCGCT-GGAGCTACGTCACGG-TCGCAGAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACAGAGAAGGCCAAGGCCCACTTGAAAGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCGGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGTCTCTGATGTGCTACGTCAGTGTCGGTAGCGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACAAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGTACTCTGTCCTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCGAACCGCAACCACCTGATCTTCACCAAGGAGATTAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCTACTTACGGCTGGAGAGGTCTCATTCAAGACGGTGTTGTAGAATATCTAGACGCCGAAGAGGAGGAGACCGCGATGATAACGTTCTCTCCTGAGGATCTTGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCCACTGAGGGTGAGCATCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTAACGCATCACCTTTCTTTC-----ACATGG-CCAATCGCATGCACCCGATGCATTCTCTGAGCGCTCAGCCA-TTTTCT-GCCTTAT--CGCGAGGAGGGGCA-TTTTTACCTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGCTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCCT------TCTGCCTACAGTGTGCTAACAAGCCTCGCAGGAAGCCGCCGAACTC Alternaria_triglochinicola_CBS119676 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCTGCTCCATTGATACAATTGATCAAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCAATGCGAT-GGTACCATTGCCTTG-TCATAGAGCGGAGGCTAACATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCCCATTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCGCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTGGGTGTCCACTCCAACGCTCAACAGCTCGTTACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGATCGAGAGTTCAAGATATTCACAGACGCCGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAAGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTGATCCAGGACGGTGTTGTCGAATATCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCTGAGGATCTCGAGGAGTGGCGTGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCACGTATCCATGTATGCCATCACTTTTCTTTC-----ACACGG-ACCGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-CTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAATCCAACACC------ATGACGCACATGT-CATGATCCTAT------ATTGGCTACAGCAAGCTAACAATCCTCCCAGGAAGCTGCCGAACTC Alternaria_vaccariae_CBS116533 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACAAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCATAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCTGGCCGTGTTATGAGGCCATTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTATGGCTGGAGAGGCCTTATTCAGGACGGTGTTGTAGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACCTTCTCTCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGTATCCACGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_vaccariicola_CBS118714 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATGCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTGTCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATAGAGCCCCACTACGCTGTAAGCCTC-CCCAAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCCCCTCCACGG-CCGTAGAATGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAAAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCCCACTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGGCAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCACAACAACTTGTCACAGTTGTACAGGAGCTGCGACGAAACGGAACTCTCTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAATTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCATTGTTCGTTGTTGAGAACGATATTCGGAAGCCAAACCGCAATCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAATCAGCTACTTACGGCTGGAGAGGTCTCATCCAGGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACTGAGGGTGAACATCGTCTCCGGCGCCTCAAGCCACTGCCAGACCCCCGCATCCATGTATGGCATAACTTTTCTTCC-----ACGCAG-ACTGTTGCATCCACATGGTGCTTCCTCTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Botryomyces_caespitosus_CBS177_80 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCGAA--CACAAACCCA----TAATAGCCCACCCG-TCTTTTCACA-TCGGCTTTTGCGATGCCAC-GGAGCAGTTCTACGG-CTACAGGACGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACATTGTCGCATTTGCGTCGAACGAATACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTTCTCGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACATACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGATGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCACGCATCCACGTACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGTA-CCTCTGAGCGCTCAGCCA-TTT-TC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Brachycladium_penicillatum_CBS116608 CATCGTCTTCCGCAATGCGTAGGCTTCA-TCCCTCTTATCAACACAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATGGAAGACAG----TCATAG-CCATCCA-GCTCGCGACA-TTACTCCTTGCGTTGCGAT-AGAGCTACTGCATGG-TTGCACAATGCAGGCTAACACACACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCCGTTGGTCGTGACGGCAAGTTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGACTTGTCTGTCCTGCTGAAACTCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCTGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGAGACGAAACGGAACTTTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGGCGGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTTTCTCCTGAAGATCTGGAAGAGTGGCGAGAAATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Chalastospora_cetera_CBS121340 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGTATA--TACAAGACCG----TTGCAG-CCATCCG----------------------CGATGCGAC--GAGCTGTTGTACTA-TCGCACGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAACACTCCCGTTGGTCGTGATGGCAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTCGTCTGCCCCGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTAAAGAACCTGTCCTTGATGTGTTATGTCAGTGTCGGAAGTGACGCTTCACCCATCATCGACTTTATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAATCCGGACGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTACGACGAAATGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGGCCACTGTTCGTCGTTGAGAACGATATCCGGAAGCCAAACCGCAACCACCTTATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAAACCGCCATGATAACATTTTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGCAGGGTCTACCTGCAGCTGAGCGATCTACTGAGGGCGAACATCGCCTTCGACGCCTTAAGCCACTACCCGACCCGCGCATTCATGTACGACATCACTCTTTTTTC-----ACATGG-GCTGTTGCAACCATCCGGTGCA-CCTCTGAGCGCGCCGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGGCGCACATAC-AA--TCCCCAA------TTTAGTCACAGCATGCTAACAAGTCAAACAGGAAGCCGCCGAACTC Chalastospora_ellipsoidea_CBS121331 TATCGTCTTTCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GGGCTATTATGCTA-TCGCAGGACGTAGGCTAACATA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAACACCCCTGTTGGTCGTGATGGCAAGCTAGCTAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTCGTCTGCCCCGCCGAGACACCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACCTGTCTCTCATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACGCAGCGAAAGATGCAACTTCTGGAGGAGTACGATCAGAACCAGAACCCAGACGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTCTGATTCGTGACATTCGTGATCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTTAAGCAGGAGCAACAAGAAACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATTTGGAAGAATGGCGAGAGATGAAGCAGGGTCTGCCTGCAGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCCGACCCACGCATCCACGTACGACATCACTATTTTTTTC----ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCCACA----GCTAACAAGCCTCATAGGAAGCCGCCGAACTC Chalastospora_obclavata_CBS124120 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCATT-CCTACGTATA--CACAAGACCG----TTGCAG-CCATCCG----------------------CGATGCGAC--GAGGTGTTGTAATA-TCGCACGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATTCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAACACTCCTGTTGGTCGTGATGGCAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTTGTCTGCCCCGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTCGTAAAGAACCTGTCCTTGATGTGTTATGTCAGTGTCGGAAGTGACGCTTCACCCATCATCGACTTTATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAAAACCAGAATCCGGACGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACCGTTGTACAGGAGCTACGACGAAATGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGGCCACTCTTCGTCGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGCAACAAGCTCAAGCAGGAGCAAATGGAGACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTCGATGCCGAGGAGGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGCAAGGTCTACCTGCAGCTGAGCGATCTACTGAGGGCGAACATCGCCTTCGACGCCTTAAGCCACTACCCGACCCGCGCATTCATGTATGGCATCACTCTTTTTTTA----ACATGG-GTTGTCGCATCCATCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATAC-AATTTCCCCAG------TTTGGCCACAGCATGCTAACAAGTCGAACAGGAAGCCGCCGAACTC Chmelia_slovaca_CBS567_66 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCGAA--CACAAACCCA----TAATAGCCCACCCA-TCTTTTCACA-TCGGCTTTTGCGATGCCAC-GGAGCAATTATATGA-CTACAGGGCACAGGCTAACACA--CATAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACATTGTCGCATTTGCGTCGAACAAACACCCCAGTCGGTCGTGACGGCAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCGTCGCCTATCATCGACTTCATGACACAGCGAAACATGCAGCTCCTGGAAGAGTACGACCAAAACCAGAACCCAGATGCGACCAAGGTCTTCGTTAACGGTGTCTGGGTTGGTGTTCACTCCAACGCCCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATCCGGAAACCGAACCGCAACCACCTCATCTTTACCAAGGAAATCAGTAACAAGCTCAAGCAGGAACAGATGGAGACAAGCACGCGACAGGGGTGGAGTCAGGATGAGGTTGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTCGACGCCGAGGAAGAGGAGACCGCCATGATAACATTCTCTCCCGAGGATCTGGAAGAGTGGCGAGAGATGAAGATGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGTCTCAAGCCACTACCAGACCCGCGCATCCACGTACGGCATCACTCTCCTTTC-----ATGTGG-GCATCCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCAACTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Clathrospora_heterospora_CBS175_52 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Comoclathris_magna_CBS174_52 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCACATTTGCGTCGAACGAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTCCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTAGAGGAGTGGCGAGAGATGAAATTGGGTTTGCCGGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Crivellia_homothallica_CBS116606 TATCGTCTTCCGTAATGCGTACGTTTGA-TCCATCTTATCAACAGAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCATAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATACAATACAG----TCATAG-GCATCCA-GCTCGCGACA-TTACTCCTTGCATTGCGAT-GGAGCTACTGCATGG-TTGCAGAATGCAGGCTAACGCA--CACAGGCCTACATGCTTAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATTGAGCTACACTGTCCCATTTGCGTCGAACGAATACCCCCGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTCTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCTGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGAGACGAAACGGAACTTTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGACGTGTCATGAGACCGCTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGGCGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACAGCTATGATAACATTCTCTCCTGAAGATTTGGAAGAGTGGCGAGAGATGAAGTTGGGCCTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATTCTCTTCACGCTCAGCCA-ATTACT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGA-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACA------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Crivellia_papaveracea_CBS116607 CATCGTCTTCCGCAATGCGTAGGCTTCA-TCCCTCTTATCAACACAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATGGAAGACAG----TCATAG-CCATCCA-GCTCGCGACA-TTACTCCTTGCGTTGCGAT-AGAGCTACTGCATGG-TTGCACAATGCAGGCTAACACACACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCCGTTGGTCGTGACGGCAAGTTAGCGAAGCCGCGACAACTTCACAACTCCCATTGGGGACTTGTCTGTCCTGCTGAAACTCCTGAGGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTTTGGAGGAATACGACCAAAACCAGAACCCTGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGAGACGAAACGGAACTTTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAAAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGTAACAAGCTCAAGGCGGAACAACAAGAGACAAGTACACGACAGGGATGGAGTCAAGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTAGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTTTCTCCTGAAGATCTGGAAGAGTGGCGAGAAATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_abundans_CBS534_83 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GAGCTATTGTGCTA-TCGCAGGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACTTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACATTGTCACATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGAAAGCTAGCCAAGCCGCGACAGCTTCACAACTCCCACTGGGGTCTTGTCTGCCCCGCTGAGACTCCTGAAGGACAAGCTTGTGGTCTGGTCAAAAATCTGTCCTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGATCAGAACCAGAACCCAGACGCGACCAAGGTATTCGTTAACGGTGTCTGGGTTGGTGTTCATTCCAACGCTCAACAGCTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTTTCTTACGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTTAAGCAGGAGCAACAAGAAACAAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAAGATGGTGTTGTGGAATACCTCGACGCCGAGGAGGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATTTGGAAGAATGGCGAGAGATGAAGCAGGGTCTGCCTGCAGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCCGACCCACGCATCCACGTACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_allii_CBS339_71 TATCGTCTTCCGCAATGCGTACGTCTTA-CCTACTCCATCGATATAGCAACTATCAAGCTAACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACA--TGAAAAACAG----TCACAG-CCATCCG-CCTCGCGACA-TCAGTCCTTGCGATGCAAT-GGAACTACCGTATGA-TCGCACGACATAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCGCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTTTCCCATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCGCCCATCATCGACTTCATGACACAGCGAAATATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCAGATGCAACCAAAGTCTTCGTTAACGGCGTCTGGGTCGGTGTCCACTCAAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTATGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAAACGAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGCGTTGTGGAATACCTGGACGCCGAGGAGGAGGAGACCGCCATGATAACCTTTTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGTACCGTCTTCGACGCCTCAAGCCACTACCCGATCCACGCATCCATGTACGGCATCACCTCTCTTTC-----ACGCGC-ATAGTGGCAATCATCCGGTGCATTCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTTT-----TTTGGCCACAGCACGCTAACAAGTTTCACAGGAAGCCGCTGAGCTC Embellisia_annulata_CBS302_84 TATCGTCTTCCGCAATGCGTAAGTCTGA-TGGAA-CCGTCAATTCTGCCTTATCAAAGCTAACCAC-GTTTCACAGGGTCGAGCACAACGATGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATC-CCCGGACACA--ACGCAATCTT----TCCTGA-CAACCCG-CCGCGCGTTT-CTTTTGATCGCCGCGATTG-GAAGTCATTTGTTGC-TAGTGGATTGCAGGCTAACGTCCATGCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGAAGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACGGGCGCCTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTTTCCCATCTTCGTCGAACAAATACTCCTGTTGGACGTGATGGTAAATTGGCTAAGCCGCGACAGCTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCTTGCGGTCTGGTCAAGAACTTGTCCCTCATGTGCTATGTCAGTGTTGGTAGCGATGCATCGCCCATTATCGACTTCATGACTCAACGCAACATGCAACTTCTCGAGGAATACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTTGGTGTTCATTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGACGAAATGGCACCCTTTCCTACGAGATGAGTTTGATTCGTGATATTCGCGATCGAGAGTTCAAGATCTTCACAGATGCTGGCCGAGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTTTTCACCAAGGCGATTAGTAATAAACTCAAGGCTGAACAGCAAGAGACTAGCACACGCCAAGGCTGGAGTCAGGAGGAAGTCGAGCAGGCCACCTACGGTTGGAGAGGCCTTATCCAAGATGGTGTTGTCGAATACCTCGATGCGGAGGAAGAAGAGACTGCAATGATAACCTTCTCTCCCGAGGACCTGGAGGAATGGCGAGAAATGAAAATGGGCTTACCCGCGGTTGAGCGATCCACTGAGGGCAAGGACCGACTTCGCCGTCTCAAGCCACAGCCAGACCCTCGAATTCATGTACGGCATCAATTTTCCTTC-----ATCTGC-AAAGTCGCTGCCACCTGGTGCATTTTCTGAGCATGTAGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGTGG-CCTTCGC--GAACTGCAATACC------ATGACGCACATGC-AAAATCCCATT------TTCCGCTGCACGATGCTAACAGGCTCCATAGGAAGCCGCCGAGCTC Embellisia_chlamydospora_CBS341_71 TATCGTCTTCCGCAATGCGTACGTCTTT-CCCACTCCATCGATATAGCAACTATCAAGCTGACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGTACA--TTCAAAACAG----TCATAG-CCATCCG-ATTCGCGACA-TCACTCCTTGCGATGCGAT-AGAGCTACTGCATGA-TCGCAGGACATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACAGTCAATGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACACTTTCCCATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCGCCCATCATTGACTTCATGACACAGCGAAATATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCAGATGCAACCAAAGTCTTCGTTAACGGTGTCTGGGTCGGCGTCCACTCAAACGCTCAACAGCTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGCAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGCGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTGGACGCAGAGGAGGAGGAGACCGCCATGATAACATTTTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGTACCGTCTTCGACGTCTCAAGCCACTACCCGATCCACGCATCCATGTACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_conoidea_CBS132_89 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CGCACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACCAACACTCCTGTCGGTCGTGACGGAAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTAATGTGCTATGTCAGTGTTGGTAGTGACGCTTCTCCCATTATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTTTTCGTCAATGGTGTCTGGGTTGGTGTACACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTTAAGATCTTCACAGATGCCGGTCGTGTTATGAGACCACTGTTTGTTGTTGAGAATGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCTACTTATGGCTGGCGGGGTCTTATTCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTAGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCTCGTATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCGC------TCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_dennisii_CBS110533 TATCGTCTTCCGCAATGCGTACGTTTCA-CCCGCTCTCTTAACACTGTTGTATCAGCCCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACC--CAACATACAG----CCATAG-CCATCCA-AATCGCGAGA-GCAGTCATTGCGATGCGCT-AGAGCTACTCCACAG-TCGCAGAATGCAGGCTAACAGA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAAGTTGATGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGGCAGGCTTGCGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAGCGGAATATGCAACTTCTCGAGGAGTACGACCAAAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGATATCCGTGACCGGGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATCGAACAAGCTACTTACGGTTGGAGAGGCCTGATCCAGGATGGTGTTGTGGAATACCTAGATGCTGAAGAGGAGGAGACCGCCATGATAACTTTCTCTCCCGAAGACCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCATCGTCTTCGTCGACTCAAGCCACTACCGGATCCCCGTATCCATGTACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_dennisii_CBS476_90 TATCGTCTTCCGCAATGCGTACGTTTCA-CCCGCTCTCTTAACACTGTTGTATCAGCCCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACC--CAACATACAG----CCATAG-CCATCCA-AATCGCGAGA-GCAGTCATTGCGATGCGCT-AGAGCTACTCCACAG-TCGCAGAATGCAGGCTAACAGA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAAGTTGATGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGGCAGGCTTGCGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCTCCCATCATTGACTTCATGACACAGCGGAATATGCAACTTCTCGAGGAGTACGACCAAAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTCGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTCTGATTCGTGATATCCGTGACCGGGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATTAGCAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGATCGAACAAGCTACTTACGGTTGGAGAGGCCTGATCCAGGATGGTGTTGTGGAATACCTAGATGCTGAAGAGGAGGAGACCGCCATGATAACTTTCTCTCCCGAAGACCTGGAAGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGTGAGCATCGTCTTCGTCGACTCAAGCCACTACCGGATCCCCGTATCCATGTACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_didymospora_CBS766_79 TATCGTCTTCCGCAATGCGTACGTTTCC-CTTACTCCATCGATCCGGCAACATCCAAGCTGACCAC-ATGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACG--TAAAAAACAG----TCATAG-CCATCCC-TTTCGCAACA-TCCCTCCTTGCAATGCGAT-AGAGCTACTGTACCA-TCGCAGGACGCAGGCTAACACG--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCCTCTGCCGACGCCCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACATTGTCCCATTTGCGTCGAACGAACACCCCAGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGAGAAACATGCAACTTCTGGAGGAATACGACCAAAACCAGAACCCCGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATCCGTGACCGAGAGTTCAAGATTTTCACAGATGCTGGCCGTGTCATGAGACCCCTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAACCATCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGACGGTGTTGTGGAATACCTAGACGCTGAAGAGGAAGAGACCGCCATGATAACGTTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCTGAGCGGTCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCACGCATCCATGTACGGCATCACTTTCCTTTC-----ATGTGG-ACGGTCGCAACCACCCGATGTATCTTCTGAGCGCTCAGCCA-T-TTCT-GGCGTAC--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAACTCCCAACACC------ATGACGCACATCC-AATTTACTTAT------TTTGGACACAACATGCTAACGAATCTCGCAGGAAGCCGCCGAGCTC Embellisia_eureka_CBS193_86 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGCTCCACTGATACAATTGAGCAAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----ACATAG-TTGTCCA-TCGCGCGAAA-TCAGTCTTCGCGATGCGAT-GGAACCATTGCCTTG-TCGTAAAGCGCAGGCTAACACGTACGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCGCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAAACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAAAACCCTGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTTGGTGTCCATTCGAACGCTCAACAGCTTGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCCGGTCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATTTTCACCAAGGAGATTAGTAACAAGCTAAAGCAAGAGCAACAAGAGACAAGTACCCGACAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGGGGTCTGATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAAGAGACCGCCATGATAACATTTTCTCCTGAGGATCTCGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCGACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTGCCAGACCCACGTATCCATGTATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTTGGTGCATGCTCTGAGCGCGCAGCCA-GTTCCTAGGCTTAT--CGCGATGAGGGGCA-TTTTTGCGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACATGC-AACGTTCCTCCTTA---TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_hyacinthi_CBS416_71 CATCGTCTTCCGCAATGCGTGGGTTACA-TCCGTTCCATTGATACAACGAATTTAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--ACCAATACAA----CTG---------------CGCGATA-TTAGTCTTCGCTATGCGAC-GGAGCCATTGCATCA-TCGTAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATATGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTTGTTAACGGTGTCTGGGTTGGTGTCCATTCTAATGCTCAACAACTTGTTACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAACGATATCCGCAAGCCAAATCGCAACCACCTCATTTTCACCAAGGAAATCAGTAATAAGCTCAAGCTGGAACAGCAAGAGACAAGTACACGGCAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGTTGGAGGGGCCTGATCCAAGATGGTGTTGTGGAATACCTCGACGCCGAAGAAGAGGAGACTGCCATGATAACATTCTCTCCCGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACTGAGGGTGAGCATCGTCTTCGCCGCCTCAAGCCGCTGCCAGACCCCCGCATTCATGTATGCCATTCCTTTTCTTTC-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCGATGAGGGGCT-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCACATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_indefessa_CBS536_83 TATCGTCTTCCGCAATGCGTAGGTTTCA-CTCGCTCCATTGATACAATTGTATCCAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGATCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAGC---CCATAG-CCATCCA-AATCGCGACA-TTTGTCCTTGCGATGCGCT-AGAGCTACTCCATGG-TCGCAGATTGCAGGCTAACGCA--TCCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGAAGGCAACAACCTGACCGTCAACGGAAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACTTGTCTCTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACCCAGCGAAACATGCAACTTCTGGAAGAATACGACCAAAACCAGAACCCTGATGCAACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCTAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGTTTACCTGCGGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATTCATGTACGACATCACTTTTCTTTC-----ACATGG-ACAGCCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTGT--CGCGATGAGGGGCA-TATTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACCCAAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_leptinellae_CBS477_90 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCTGCTCCACTGATACAATTGATCAAAAGCTGACCGC-ATGTCACAGCATCGAGCATAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCGCA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCGATGCGAT-GGTACCATTACCTTG-TCATAGAGCGCAGGCTAATATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCGCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACCTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCTATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTGTGGGTGGGTGTCCACTCCAACGCTCAACAGCTCGTCACGGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGACGCTGGCCGTGTCATGAGACCACTGTTTGTTGTTGAGAACGACATTCGGAAACCGAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAAGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGTTGGAGAGGTCTGATCCAGGACGGTGTTGTCGAATACCTCGACGCCGAAGAGGAGGAGACTGCCATGATAACGTTCTCTCCTGAGGATCTCGAGGAGTGGCGGGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTACCAGACCCACGTATCCATGTATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGTTCTGAGCGTGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGAATGCGG-CGTTCGC--GAAGTCCAACACC------GTGACGCACACGC-AATCTTCCTCCCTAT--ATTGGCTACAGCAAGTTAACACTCCTCACAGGAAGCTGCCGAACTC Embellisia_lolii_CBS115266 TATCGTCTTCCGCAATGCGTGGGTTCTA-CCTGTTCCATTGATGTAGTGCATTGAAAGCTAACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGTACA--CACAATACAA----CTATAG-CCATCCG-CCTCGCGATA-TCAGTCTTCGCGATGCGAG-GGAGCTATTGCATCA-TCGCAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTTATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGTAAACTAGCAAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCGTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGCGACGCTTCACCCATCATAGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAATGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGGGAGTTCAAGATCTTCACAGATGCCGGTCGTGTCATGAGACCACTTTTTGTTGTTGAGAACGACATCCGCAAGCCAAATCGCAATCACCTCATCTTCACCAAGGAGATCAGTAATAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGGCAAGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACTTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCTGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCTATTCTCTTTC-----ACATGG-GCAGTTACATCTACCTGGTGTATCCTCCGAGCGCGCAGTCA-GCCCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATCC-CATGTGTCTAT------TTCGGCAACAGCAAGCTAACACGCCTCACAGGAAGCCGCCGAACTC Embellisia_novae_zelandiae_CBS478_90 TATCGTCTTCCGCAATGCGTGGGTTACA-TCCGTTCCATTGATACAAAGAATTCAAAGCTGACCGC-GTGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGACCACA--AACAATACAA----CTA---------------CGCGATA-TCAGCCTTCGCTATGCGAC-GGAGCTATTGCATCA-TCGTAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGATGCCACCAAAGTCTTTGTCAACGGTGTCTGGGTTGGTGTTCATTCTAATGCTCAACAACTTGTTACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACAGAGAGTTCAAGATCTTCACAGATGCTGGACGTGTCATGAGACCGCTGTTTGTGGTTGAGAATGACATCCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAAATCAGTAACAAGCTCAAGCTGGAACAGCAAGAGACGAGCACACGGCAGGGATGGAGTCAGGATGAGGTTGAACAAGCCACTTACGGTTGGAGAGGCCTGATCCAAGACGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACTGAGGGTGAGCATCGTCTTCGACGCCTCAAGCCGCTGCCAGACCCCCGCATTCATGTATGCCATCCCTTTTCTTTT-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCAGATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_phragmospora_CBS274_70 TATCGTCTTCCGCAATGCGTACGTTTCC-CTCACCCCAAGGGTATAGCAGTGTTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGCACA--T-GAAAACAG----TCACAG-CCATCCC-TCCCGCAGCA-TCAGTCCTTGCGATGCGAT-GGAGCTACGGTACGA-TCGCAGGACGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGCCACACTGTCCCATTTGCGTCGAACCAACACCCCGGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGATTTCATGACGCAGCGAAACATGCAACTTCTGGAGGAATACGACCAAAATCAGAACCCCGATGCTACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTTCACTCCAACGCTCAGCAGCTTGTCACAGTCGTGCAAGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTATTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGCAAGAAACAAGTACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACATTCTCACCCGAAGACCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTGCCTGCGGCGGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTGAAGCCGCTGCCAGATCCACGCATCCATGTATGGCATCACATTTCTTTC-----AAACGG-ATGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CTTTCGC-GAATCCCTAACACC------ATGACGCACATGG-AATTTCCCTAC------TTTGACCACAGCATGCTAACAAGCCTCGTAGGAAGCCGCCGAGCTC Embellisia_planifunda_CBS537_83 CATCGTCTTCCGCAATGCGTGGGTTTCA-CCCGTTCCATTGATACAATGAATTGGAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCGGTAAGCTTC-CCTGAGCACA--CACAATACAA----CTAAAG-CCATCCA-TCTCGCGATA-TCAGTCTTCGCAATGCGAC-GGAGCTATTGCATCA-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCTATCATTGACTTCATGACACAGCGCAACATGCAACTTTTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTTAACGGTGTCTGGGTTGGTGTCCATTCGAATGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAATGACATCCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGCAATAAGCTCAAGCAGGAACAGCAAGAGACAAGCGCACGGCAGGGATGGAGTCAGGACGAGGTTGAACAAGCCACTTATGGTTGGAGAGGCCTGATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTTCCAGACCCCCGCATTCATGTATGGCATCCCTTTTCTTTC-----ACACGG-ATAGTTGCATCCACCTGGTGTGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGTGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTTCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_proteae_CBS475_90 TATCGTCTTCCGCAATGCGTGGGTTGCA-TCCGTTCCATTGATACAACGAATTTAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--CACAATACAA----CTGAAG-CCATTCA-TCCCGCGATA-TCAGTCTTCGCTATGCGAC-GGAGCTATTGCATCA-TCGTAGAATGTAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAAGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTTCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTCGGTCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTCGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAGAACCAGAACCCCGACGCCACCAAGGTCTTTGTTAACGGTGTCTGGGTTGGTGTCCATTCTAATGCTCAACAACTTGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTTTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGGGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAATGATATCCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAAATCAGTAATAAGCTCAAGCTGGAACAGCAAGAGACAAGTACACGGCAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTTTGATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGACCTGGAGGAGTGGCGAGAGATGAAGCTGGGCTTACCTGCGGCAGAGCGATCTACAGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCGCTGCCAGACCCCCGCATTCATGTATGCCGTCCCTTTTCTTTC-----AAATGG-ACGGTTGCATCCACCTGGTGCATCCTCTGAGCGCGCCGTCA-GTCTCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAGTTCCAACTCC------ATGACGCACATCC-AGTGTCCCTAT------CTCGGTTACAGCAAGCTAACAAATCTTACAGGAAGCCGCCGAACTC Embellisia_tellustris_CBS538_83 TATCGTCTTCCGCAATGCGTACGTCTTT-CCCACTCCATCGATATAGCAACTATCAAGCTGACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGTACA--TTCAAAACAG----TCATAG-CCATCCG-ATTCGCGACA-TCACTCCTTGCGATGCGAT-AGAGCTACTGCATGA-TCGCAGGACATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACAGTCAATGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGCCACACTTTCCCATTTGCGTCGAACGAATACTCCTGTTGGTCGTGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCCCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCCTGTGGTCTCGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCGCCCATCATCGATTTCATGACACAGCGAAATATGCAACTTCTGGAGGAGTACGACCAAAATCAGAACCCAGATGCAACCAAAGTCTTCGTTAACGGTGTCTGGGTCGGTGTCCACTCAAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGCGACCGAGAGTTTAAGATCTTTACAGATGCCGGCCGTGTCATGAGACCGCTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACGAGCACGCGACAGGGTTGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAATACCTGGACGCCGAGGAGGAGGAGACCGCCATGATAACCTTTTCTCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGTACCGTCTTCGACGCCTCAAGCCACTACCAGATCCACGCATCCATGTACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_tumida_CBS539_83 CATCGTCTTCCGCAATGCGTGGGTTCCA-CCCGTTCTATTGATACAATGAATTGGAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCGGTAAGCTTC-CCTGAGCACA--CACAATACAA----CTAAAG-CCATCCA-TCTCGCGATC-TCAGTCTTCGCAATGCGAC-GGAGCTATTGCATCA-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGCCGTGACGGTAAACTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCTATCATTGACTTCATGACACAGCGCAACATGCAACTTTTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTTAACGGTGTCTGGGTTGGTGTCCATTCGAATGCTCAACAACTCGTCACGGTCGTGCAGGAGCTGCGACGAAACGGAACTCTGTCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCACTGTTTGTGGTTGAGAATGACATCCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGCAATAAGCTCAAGCAGGAACAGCAAGAGACAAGCGCACGGCAGGGATGGAGTCAGGACGAGGTTGAACAAGCCACTTACGGTTGGAGAGGCCTGATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACTGCCATGATAACATTCTCTCCTGAGGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCGGAGCGATCTACTGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCGCTTCCAGACCCCCGCATTCATGTATGGCATCCCTTTTCTTTC-----ACACGG-ACAGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTCCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCTGCCGAACTC Nimbya_caricis_CBS480_90 TATCGTCTTCCGCAATGCGTAGGTTTA--CCCACTCCATCAATACCGCAACATCAAGACTGACTGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGCGTACA--TACAACACAG----TCACAACCCATCAT-CCTCGCGAAA-CCAGTCCCAGAGATGCGATCAAAGCTACTACATGG-TCACAGAACGTAGGCTAACACA--CATAGGCCTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGCTACATTGTCCCATTTGCGTCGAACGAATACGCCGGTCGGTCGCGACGGCAAGTTAGCCAAGCCGCGACAACTTCACAACTCTCACTGGGGTCTTGTTTGCCCTGCTGAGACCCCCGAAGGGCAGGCCTGTGGCCTTGTCAAGAACCTGTCTTTGATGTGCTATGTTAGTGTTGGAAGTGACGCGTCACCCATCATCGATTTCATGACACAGCGAAACATGCAACTTTTGGAGGAGTACGACCAAAACCAGAACCCAGATGCGACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACCCTATCCTACGAGATGAGTCTTATTCGTGATATCCGTGACCGAGAGTTTAAGATTTTCACAGACGCTGGCCGTGTCATGCGACCGCTGTTTGTTGTGGAGAACGATATCCGGAAGCCGAACCGCAATCATCTCATCTTTACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGCCTCATCCAGGATGGTGTTGTGGAATACCTGGACGCCGAGGAGGAGGAGACCGCTATGATAACGTTCTCCCCCGAAGACTTGGAAGAGTGGCGAGAGATGAAGCTGGGTCTACCTGCTGCTGAGCGATCTACCGAAGGGGAGCACCGCCTTCGACGCCTCAAGCCACTCCCAGATCCACGCATTCATGTACGACATCACTTTTCTTCC-----ACATGA-ATGGTCGCTACCTCCCGGTGCATCTTTTGAGCGCGCAGCCA-TTTCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGTTTGCAG-CTTTCGC--GAACCCCAACACCCT----ATGACGCATATTC-AATTTTCCCAT------TTCGGCCACAACATGCTAACGAGCCTCACAGGAAGCCGCCGAGCTC Nimbya_gomphrenae_CBS108_27 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCCAACTCGTCGATACAAT-CTACCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--TACACTACAG----CCGCGG-CCATCCA-AATTGCGAAA-ACAGTTCTTGCGATGCGCT-AGAGCTCCT--GTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAATACCCCTGTTGGTCGAGATGGAAAGCTCGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACAGATGCTGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTAATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAAGTCGAATCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGATGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACTGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Nimbya_scirpicola_CBS481_90 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCCATCGATACAGTAGCATCGGAACTGACAGC-ATGCCCCAGCATCGAGCACAACGACGTCGACATTGTCGCCGTCAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCACGTACC--TACAATACAC----TCATAG-TCAACCT-CCTCGCGACA-TTAGTCTT---GTGACGAT-GCATCTACCGTGTGCTTCGCAGAACGCAGGCTAACAAA--CATAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACGTACAAGTCTGACATTGAGCGACACTATCCCATATGCGTCGAACGAACACCCCCGTTGGTCGTGACGGCAAATTGGCCAAGCCGCGTCAACTTCACAATTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCCGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGTTATGTCAGTGTTGGTAGTGACGCGTCACCCATCATCGATTTCATGACACAGCGGAACATGCAACTTTTGGAGGAGTACGACCAGAATCAGAACCCAGATGCAACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAGCAACTTGTCACAGTCGTGCAGGAGCTGCGAAGAAACGGAACTTTATCCTACGAAATGAGTCTGATTCGTGACATCCGTGACAGAGAGTTCAAGATTTTCACAGACGCTGGCCGTGTCATGCGACCTCTGTTCGTTGTTGAAAATGACATTCGGAAGCCGAACCGTAATCATCTCATCTTCACAAAGGAAATCAGCAATAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAGCAAGCCACTTACGGCTGGAGAGGTCTCATTCAGGATGGTGTTGTGGAATACCTCGATGCCGAGGAAGAGGAAACCGCCATGATAACGTTCTCTCCCGAAGATTTAGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTTCCAGACCCACGCATTCATGTATGGCATCACTTTTCTTTC-----ACATGG-ATGGCCACAACCACCTGGTGCGTCTTCCGTGCGAATAGCCA-TTTCCTTGGCATAT--CGCATTGGAGGGGCATTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAT-CTTTCGC--GAAGCCCAACACC------ATGACGCACATCC-AATCTGCTTAT------TTTGGCCACGACATGCTAACAAGTCGCACAGGAAGCCGCCGAACTC Pleospora_tarda_CBS714_68 TATCGTCTTCCGCAATGCGTAAGTTTGA-TTGAACCCGTCAATTCTGCCATATCAAAACTAACCGC-GTCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATC-CCCGGATACA--AGACAGTCTT----CCCGAA-AATCCGC-TGCGCGTTCC-ATCCGATCGCGGGCGGTTG-GGGGCCATTTGTTGC-TAGTATATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGTGTCAATCACGAGACATACAAGTCCGACATCGAGCCACACTTTCCCATCTTCGTCGAACAAATACCCCCGTTGGACGTGATGGTAAATTGGCCAAGCCGCGACAACTGCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCCGAAGGACAGGCCTGCGGCCTAGTCAAGAACTTGTCTCTCATGTGCTACGTCAGTGTTGGTAGCGACGCATCGCCCATTATCGACTTCATGACTCAACGAAACATGCAACTTCTCGAGGAGTACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGCCGCAACGGCACCCTGTCCTACGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTCAAGATCTTCACAGATGCGGGCCGTGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTCTTCACCAAGGCGATTAGTAACAAACTCAAGGCTGAACAGCAAGAGACCAGCACACGTCAAGGTTGGAGTCAGGAGGAGGTCGAGAATGCCACCTACGGCTGGAGAGGCCTTATCCAAGACGGTGTTGTTGAATACCTCGATGCCGAGGAAGAGGAGACTGCCATGATAACCTTCTCTCCCGAGGACCTGGAAGAATGGCGAGAAATGAAGATGGGCTTGCCCGCGGTTGAGCGATCCACCGAGGGCAAGGACCGACTTCGCCGTCTCAAGCCGGCGCCAGACCCTCGCATTCATGTACGACATCACTTTTCTTTC-----ACCCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTCAT--CGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Sinomyces_alternariae_CBS126989 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAACCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Stemphylium_herbarum_CBS191_86 TATCGTCTTCCGCAATGCGTAAGTTTGA-TTGAGCCCGTTAATTCTGCCATATCAAAGCTAACCGC-GTCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATC-CCCGGATACA--AGACAGTCTT----CCCGAC-AATCCGC-TGCGCGTTC--CATATGATCGCGGCGGTTG-GAGGCCATTTGTTCC-TAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGCCACACTCTCCCATCTTCGTCGAACAAATACCCCTGTTGGACGTGATGGTAAATTGGCCAAGCCGCGACAACTGCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACGCCTGAAGGACAGGCCTGCGGCCTGGTCAAGAACTTGTCTCTCATGTGCTACGTTAGTGTCGGTAGCGACGCATCGCCCATTATCGACTTTATGACCCAACGAAACATGCAACTTCTCGAGGAGTACGACCAAAACCAAAATCCGGATGCGACCAAGGTCTTCGTCAACGGTGTTTGGGTCGGTGTTCACTCCAACGCTCAACAACTTGTCACAGTCGTACAGGAGCTTCGCCGGAACGGCACCCTATCCTACGAGATGAGTTTGATTCGTGATATTCGCGACCGAGAGTTCAAGATTTTCACAGATGCGGGCCGTGTCATGAGACCGCTGTTCGTCGTTGAGAACGATTTCCGGAGAGAGAACCGAAACCAGCTCGTCTTCACAAAGGCGATTAGTAACAAACTCAAGGCTGAACAGCAAGAGACCAGCACACGTCAAGGCTGGAGTCAGGAGGAGGTCGAGAATGCCACCTACGGCTGGCGAGGCCTTATCCAAGACGGTGTTGTTGAATACCTCGATGCCGAGGAAGAGGAGACTGCTATGATAACCTTCTCTCCCGAGGACCTGGAAGAATGGCGAGAAATGAAGATGGGCTTACCCGCGGTTGAGCGATCCACCGAGGGCAAGGACCGACTTCGCCGTCTCAAGCCCGCGCCAGACCCTCGCATCCATGTACGGCATCACTTTTCTTTC-----ACTCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTTAT--GGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATTCGG-CCTTCGC--GAATCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCATAGGAAGCCGCCGAGCTC Teretispora_leucanthemi_CBS421_65 TATCGTCTTCCGCAATGCGTAGGTTGCA-CCCGCTCCGCTGATACAAGTGCATCAAAGCTGACCGT-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACCCGCACTACAGCCAAAGCCACAG-CCATGCA-ACTCGCGACA-TCAGTCCTTGCGACGCGCT-AGAGATCCTCCACGG-TTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTTGTCATGGGTGTCAACCATGAGACTTACAAGTCCGACATCGAGCCACATTATCTCATTTGCGTCGAACCAACACCCCGGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTTTGGTTAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGGGTTCACTCCAATGCACAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGTAATGGAACTCTATCCTACGAAATGAGTTTGATTCGTGACATTCGCGACCGGGAGTTCAAGATCTTCACAGATGCCGGCCGTGTGATGAGACCACTGTTTGTGGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGCAAGAGACAAGCACGCGACAGGGTTGGAGTCAGGACGAGGTCGAACAAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAGTACCTAGACGCCGAAGAGGAGGAGACAGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTTCGACGCCTCTAGCCACTACCAGATCCCCGCATCCATGTACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Teretispora_leucanthemi_CBS422_65 TATCGTCTTCCGCAATGCGTAGGTTGCA-CCCGCTCCGCTGATACAAGTGCATCAAAGCTGACCGT-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACCCGCACTACAGCCAAAGCCACAG-CCATGCA-ACTCGCGACA-TCAGTCCTTGCGACGCGCT-AGAGATCCTCCACGG-TTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTTGTCATGGGTGTCAACCATGAGACTTACAAGTCCGACATCGAGCCACATTATCTCATTTGCGTCGAACCAACACCCCGGTCGGTCGTGACGGTAAATTAGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTCTGCCCTGCTGAGACTCCTGAAGGACAGGCCTGTGGTTTGGTTAAGAACTTGTCCTTGATGTGCTATGTCAGTGTCGGTAGTGATGCTTCTCCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTGGGGGTTCACTCCAATGCACAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGTAATGGAACTCTATCCTACGAAATGAGTTTGATTCGTGACATTCGCGACCGGGAGTTCAAGATCTTCACAGATGCCGGCCGTGTGATGAGACCACTGTTTGTGGTTGAGAACGACATTCGGAAGCCAAACCGCAACCACCTTATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAACAGCAAGAGACAAGCACGCGACAGGGTTGGAGTCAGGACGAGGTCGAACAAGCTACTTATGGCTGGAGAGGCCTTATTCAAGATGGTGTTGTAGAGTACCTAGACGCCGAAGAGGAGGAGACAGCCATGATAACGTTCTCTCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAGATGGGCTTGCCTGCGGCGGAGCGATCCACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Ulocladium_arborescens_CBS115269 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGATATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGTCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_atrum_CBS195_67 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAATGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytis_CBS198_67 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytisCBS197_67 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAACCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_brassicae_CBS121493 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cantlous_CBS123007 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAATCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACGCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCTGTCGGTCGTGACGGTAAATTAGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTTGGTAGTGATGCTTCACCCATCATTGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTATGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGCCGTGTCATGAGACCGCTGTTCGTTGTAGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGTTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTTCTTTC-----ACATAG-ACAGTCGCGCCCACCTAGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCTGAACTC Ulocladium_capsicuma_CBS120006 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTAGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGAGATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGCCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGATGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_chartarum_CBS200_67 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGATATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGTCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_consortiale_CBS104_31 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cucurbitae_CBS483_81 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_multiforme_CBS102060 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAGGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_obovoideum_CBS101229 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_oudemansiiCBS114_07 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGCCACACTGTCCCATTTGCGTCGAACGAACACTCCTGTTGGTCGTGACGGCAAGTTGGCCAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTATGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTCCTGGAGGAGTACGATCAAAATCAGAACCCCGATGCAACCAAAGTTTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCGCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTACGAGATGAGTTTGATTCGTGATATCCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTCGTTGAGAACGACATTCGGAAGCCAAATCGCAACCATCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAACAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGCCTGATCCAAGATGGTGTTGTTGAATACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCAGAGCGATCTACCGAAGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCATTTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_septosporum_CBS109_38 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACGAACACCCCCGTCGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCTGAGACTCCCGAAGGACAGGCTTGTGGTTTGGTCAAGAATTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAGAATCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTTACCAAGGATATCAGTAATAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGTCAGGGATGGAGTCAGGATGAGGTCGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATACCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACCTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCGGCTGAGCGATCTACCGAAGGCGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_solani_CBS123376 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCTGTTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AGTCGCGACA-CCAGTCCTTGTGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAATTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_subcucurbitae_CBS121491 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCTGTTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AGTCGCGACA-CCAGTCCTTGTGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAATTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGACATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_tuberculatum_CBS202_67 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGCCACACTGTCCCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGTAAATTGGCGAAGCCGCGACAACTTCACAACTCTCATTGGGGTCTTGTTTGTCCTGCTGAGACTCCTGAAGGACAGGCTTGTGGTTTGGTCAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGATGCTTCACCCATCATCGACTTCATGACACAGCGAAACATGCAACTTCTGGAAGAGTACGACCAAAACCAGAACCCCGATGCCACCAAGGTCTTTGTCAATGGTGTCTGGGTTGGTGTGCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGTTGCGACGAAACGGAACTCTATCTTACGAGATGAGTTTGATCCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCCGGCCGTGTCATGAGACCACTGTTCGTTGTCGAGAACGATATTCGGAAGCCAAATCGCAACCACCTCATCTTCACCAAAGAGATCAGTAACAAGCTCAAGCAAGAACAACAAGAGACAAGCACACGACAGGGATGGAGTCAGGATGAGGTAGAACAAGCCACTTACGGCTGGAGAGGTCTTATCCAGGATGGTGTTGTGGAATATCTAGACGCCGAAGAGGAGGAGACCGCCATGATCACGTTCTCCCCCGAAGACTTGGAGGAGTGGCGAGAGATGAAGTTGGGCTTACCTGCAGCGGAGCGATCTACCGAGGGTGAGCACCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGTATCCATGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Undifilum_bornmuelleri_DAOM231361 TATCGTCTTCCGCAATGCGTAGGTTGCA-CCCATGCCATCGATACGGTCGTGCCAAAGCTAACCCCAATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTT-CCAGAATACA--CCCAATTCAG----TCCTAG-CCATCCG-CCTCGCGACA-TCAGTCCTTGCAATGCGCT-AGAGCTGCTCCACAG-TCGCAGAATGCAGACTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACCCACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATTCCATGGAGCGAGACCGGCGCTTACTATGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGCCACACTGTCTCATTTGCGTCGAACAAACACCCCTGTTGGTCGTGACGGCAAGCTAGCCAAGCCACGACAACTTCACAACTCTCATTGGGGTCTTGTTTGCCCTGCCGAGACTCCTGAAGGACAGGCTTGTGGTCTAGTAAAGAACTTGTCTTTGATGTGCTACGTCAGTGTCGGTAGTGACGCTTCACCGATCATCGACTTCATGACACAGCGAAACATGCAACTTCTAGAGGAATACGATCAAAACCAGAACCCCGATGCCACCAAAGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCACTCCAACGCTCAACAACTTGTCACAGTCGTGCAGGAGCTGCGACGAAATGGAACTTTATCCTACGAGATGAGTTTGATTCGTGACATTCGGGACAGAGAATTCAAGATCTTCACAGACGCCGGCCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATTCGGAAGCCAAACCGCAACCATCTCATCTTCACCAAAGACATCAGTAACAAGCTCAAGCAGGAACAACAAGAGACAAGCACGCGACAGGGATGGAGTCAGGATGAAGTCGAACAAGCCACTTACGGCTGGAGAGGCCTTATCCAAGATGGTGTTGTGGAATACCTAGACGCCGAAGAAGAGGAGACCGCCATGATAACGTTCTCTCCCGAAGATCTGGAAGAGTGGCGAGAGATGAAGCTGGGCTTACCTGCGGCGGAGCGATCTACAGAAGGTGAGCATCGTCTTCGACGCCTCAAGCCACTACCAGATCCCCGCATCCATGTACGGCATCACTTTTCTTTC-----ACACGG-AATGTGGCATCCGCCCGGTGCATCCGCTGAGCGCTCAGCCA-ACTCGT-GGCTCAT--TGCGATGAGGGGCA--TTTTGGGTAGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCACTAGTCTGCATACGG-CGTTCGC--GAACTTCAACACC------ATGACGCACATCC-AATTTCCTCATTTTAGCTTTTGCAATAGCATGCTAACAAACCCCACAGGAAGCCGCCGAGCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17366] TITLE TEF1_Character_Matrix; LINK TAXA = Taxa5; DIMENSIONS NCHAR=269; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 TATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS916_96 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_anigozanthi_CBS121920 TATAACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTT-------TAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACACGC-AATCTTCCTCGCTAT--GTTGGCTACAGCTAGCTAATAATCCTCACAGGAAGCTGCCGAACTC Alternaria_arborescens_CBS102605 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_argyranthemi_CBS116530 TACGGCATCACTTTTCCTTC-----ATACGG-ACAATCGCGCCCAATCA--GATGCATCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TATTTTGGGCGG-TGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCTCAC------TCTGGCCAAAGCATGCTAACAAGCCTCTCAGGAAGCCGCCGAACTC Alternaria_armoraciae_CBS118702 TACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_avenicola_CBS121459 TACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_axiaeriisporifera_CBS118715 TATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--AGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_brassicae_CBS116528 TTTGGCATCACTTTTCCTTT-----ACACGC-ACAGTTGCGTCCACTCGGTGTATCCTCTGAGCGCGCAGCCA-TATCCT-GGTTTTT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCGTGCGG-CCCTCGC--GAACCCCAACACG------ATGACGCACATGC-AATTTCTATAT------TTTGGCTACAGCAAACTGACAAGTCTAACAGGAAGCCGCCGAACTC Alternaria_brassicicola_CBS118699 TACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_calycipyricola_CBS121545 TACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_capsici_annui_CBS504_74 TACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_carotiincultae_CBS109381 TATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_cheiranthi_CBS109384 TACGACATGACTTTGCTTTC-----ACATGG-ATAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACA------------------TCC-AATTCTGCTAT------TCTGGCCACAGTGCGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_chlamydospora_CBS491_72 TATGGCATCACATCTCTTTC-----AAATGG-ACGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAATCCCCAGCACC------ATGACGCACATGC-AATTTCCCTAC------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_cinerariae_CBS116495 TATGGCATCACTTTCCTTTC-----ACGCGGCACAGTTGCGTCCACTCGGCGCATCC-CTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------TTTGGCTACATCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_conjuncta_CBS196_86 TACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCTGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCTTCAGTTTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_cumini_CBS121329 TATGGCATCACTTTTCTTTC-----ATGCGC-ACAGTTGCATCCCCTTGGTGTATCCTCTGAGCGCGCAGCTG-GTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGTTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CATTCGC--GAAATGCAACACC------ATGACGCAGTTTC---------CAT------TCTGGTCACAGCACGCTAAGAACCCTTCCAGGAAGCCGCCGAACTC Alternaria_dauci_CBS117097 TATGGCATCACTTTTCCTTTC----ACACGC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTACTTATGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTC Alternaria_daucifolii_CBS118812 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_dianthicola_CBS116491 TATGGTACCAAATTCATTTT-----TCATGG-ACCCTCAGATGCCCCCGATGCATGCTCTGAGCGCTCTGCCA-TTTTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CTTTCGC--GAAC--------------------------------------------------------ACACGCTAACAAGTCTCACAGGAAGCCGCTGAACTC Alternaria_elegans_CBS109159 TATGGCATCGCCTTTCCTCTCCTC-TCATGGAACCCCCTCGTCCACTTGATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_ellipsoidea_CBS119674 TATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_eryngii_CBS121339 TATGGCATCAATTTTCTTTC-----ACCTGG-ACGGTCGCATGCCTCAGATGCATTCCTCAAGTGCCCAGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTC----------CTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCTGCCGAACTC Alternaria_ethzedia_CBS197_86 TACGGCATCACTCTCCTTTC-----ACATGG-GCATTCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCTTCAGTCTGCTAACAGGCCTCACAGGAAGCCGCCGAACTC Alternaria_gaisen_CBS632_93 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_geniostomatis_CBS118701 TATGACAACACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATGC-CATGTCGCTAT------TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gypsophilae_CBS107_41 TATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_helianthiinficiens_CBS117370 TATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_helianthiinficiens_CBS208_86 TATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_infectoria_CBS210_86 TACGGCATCACTCTCCTTTC-----ACACGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAATAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_japonica_CBS118390 TACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_juxtiseptata_CBS119673 TATGGCATTACTTTTCTTCC-----ACGCAC-ACTGTTGCATCCACATGGTGCTTCCTTTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGACGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_limaciformis_CBS481_81 TACGGCATCACTTTTCCTTC-----AAACAG-ACGGGCGCAATCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_limoniasperae_CBS102595 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes_CBS540_94 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_macrospora_CBS117228 TATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTCCCCATGATGCACATCT-AACTTCTCAAC------TATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_mimicula_CBS118696 TACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_molesta_CBS548_81 TACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_mouchaccae_CBS119671 TACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_nepalensis_CBS118700 TACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_nobilis_CBS116490 TACGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCTCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_oregonensis_CBS542_94 TACGGCATCACTCTCCTTTC-----ATATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTGTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATTACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_panax_CBS482_81 TACCACATCCCTTTTCTTTC-----ACATGG-ACGGTCGCACGTCCTCGATGCATCCTCTGAGCGCCTAGCCA-TTTCCT-GGCTGAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC----ACTCCACCACC------ATGACGCACATCC-AATTTTCCCAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_perpunctulata_CBS115267 TATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_petroselini_CBS112_41 TATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_photistica_CBS212_86 TACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGCATACCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCAC--TACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_porri_CBS116698 TATGACATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAAACGAACACCCACTTAATGATGCACATTT-AACTTCTCAAC------CCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTC Alternaria_pseudorostrata_CBS119411 TATGGCATCACTTTTTCTTTC----ACACAC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAACTTTTTACGCGCTAGCGCTAGCCCGCTTGCGG-CCGACATCGAAAACCGAACACCCTGGTAATGATGCACATCC-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_radicina_CBS245_67 TATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_resedae_CBS115_44 TACGACATCACTTTTCTTTC-----ACATGG-ATAGTCACATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAAGCCGCATACGG-CGTTCGC--GAACTTCAACA---------------ACGTCC-AATTTCCCTGT------TCTGGCCACAGTACGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_saponariae_CBS116492 TATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_selini_CBS109382 TATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTCCAT------CTTGGCTACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_septorioides_CBS106_41 TACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_simsimi_CBS115265 TATGGCATCGCCTTTCCTCTCCTCCTTATGGAACCCCCTCGTCCACTTCATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCTGAACTC Alternaria_smyrnii_CBS109380 TATGGCATCACTTTTTTTTCC----ACACGG-ACAGCTATATCCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATAC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_solani_CBS116651 TATGACATCACTTTTCCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAGACCGAACACC--AAGGACGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTC Alternaria_soliaridae_CBS118387 TACGGCATCACTTTTCTTTC-----ACGCGG-ATGGTTGCAACCACCCGGTGCATCCTCTGA--GCTTAGCCA-TATCCT-GGCTTGT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCT-AATTATCCTAT------TTTGGCCACAACATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_solidaccana_CBS118698 TACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_sonchi_CBS119675 TACAGCATTACTTTCCTTTC-----ACGCGGCACAGTTGCGTTCACTTGACGCATCCTCTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------CTTAGCTACATCACGCTAACAATCCTCACAGGAAGCCGCCGAACTC Alternaria_tagetica_CBS479_81 TATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACATCCCACACATGATGCACATCT-AACTTCTCAAT------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_tenuissima_CBS918_96 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_thalictrigenaCBS121712 TAACGCATCACCTTTCTTTC-----ACATGG-CCAATCGCATGCACCCGATGCATTCTCTGAGCGCTCAGCCA-TTTTCT-GCCTTAT--CGCGAGGAGGGGCA-TTTTTACCTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGCTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCCT------TCTGCCTACAGTGTGCTAACAAGCCTCGCAGGAAGCCGCCGAACTC Alternaria_triglochinicola_CBS119676 TATGCCATCACTTTTCTTTC-----ACACGG-ACCGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-CTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAATCCAACACC------ATGACGCACATGT-CATGATCCTAT------ATTGGCTACAGCAAGCTAACAATCCTCCCAGGAAGCTGCCGAACTC Alternaria_vaccariae_CBS116533 TATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_vaccariicola_CBS118714 TATGGCATAACTTTTCTTCC-----ACGCAG-ACTGTTGCATCCACATGGTGCTTCCTCTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Botryomyces_caespitosus_CBS177_80 TACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGTA-CCTCTGAGCGCTCAGCCA-TTT-TC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Brachycladium_penicillatum_CBS116608 TACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Chalastospora_cetera_CBS121340 TACGACATCACTCTTTTTTC-----ACATGG-GCTGTTGCAACCATCCGGTGCA-CCTCTGAGCGCGCCGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGGCGCACATAC-AA--TCCCCAA------TTTAGTCACAGCATGCTAACAAGTCAAACAGGAAGCCGCCGAACTC Chalastospora_ellipsoidea_CBS121331 TACGACATCACTATTTTTTTC----ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCCACA----GCTAACAAGCCTCATAGGAAGCCGCCGAACTC Chalastospora_obclavata_CBS124120 TATGGCATCACTCTTTTTTTA----ACATGG-GTTGTCGCATCCATCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATAC-AATTTCCCCAG------TTTGGCCACAGCATGCTAACAAGTCGAACAGGAAGCCGCCGAACTC Chmelia_slovaca_CBS567_66 TACGGCATCACTCTCCTTTC-----ATGTGG-GCATCCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCAACTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Clathrospora_heterospora_CBS175_52 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Comoclathris_magna_CBS174_52 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Crivellia_homothallica_CBS116606 TACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATTCTCTTCACGCTCAGCCA-ATTACT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGA-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACA------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Crivellia_papaveracea_CBS116607 TACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_abundans_CBS534_83 TACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_allii_CBS339_71 TACGGCATCACCTCTCTTTC-----ACGCGC-ATAGTGGCAATCATCCGGTGCATTCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTTT-----TTTGGCCACAGCACGCTAACAAGTTTCACAGGAAGCCGCTGAGCTC Embellisia_annulata_CBS302_84 TACGGCATCAATTTTCCTTC-----ATCTGC-AAAGTCGCTGCCACCTGGTGCATTTTCTGAGCATGTAGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGTGG-CCTTCGC--GAACTGCAATACC------ATGACGCACATGC-AAAATCCCATT------TTCCGCTGCACGATGCTAACAGGCTCCATAGGAAGCCGCCGAGCTC Embellisia_chlamydospora_CBS341_71 TACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_conoidea_CBS132_89 TACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCGC------TCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_dennisii_CBS110533 TACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_dennisii_CBS476_90 TACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_didymospora_CBS766_79 TACGGCATCACTTTCCTTTC-----ATGTGG-ACGGTCGCAACCACCCGATGTATCTTCTGAGCGCTCAGCCA-T-TTCT-GGCGTAC--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAACTCCCAACACC------ATGACGCACATCC-AATTTACTTAT------TTTGGACACAACATGCTAACGAATCTCGCAGGAAGCCGCCGAGCTC Embellisia_eureka_CBS193_86 TATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTTGGTGCATGCTCTGAGCGCGCAGCCA-GTTCCTAGGCTTAT--CGCGATGAGGGGCA-TTTTTGCGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACATGC-AACGTTCCTCCTTA---TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_hyacinthi_CBS416_71 TATGCCATTCCTTTTCTTTC-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCGATGAGGGGCT-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCACATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_indefessa_CBS536_83 TACGACATCACTTTTCTTTC-----ACATGG-ACAGCCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTGT--CGCGATGAGGGGCA-TATTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACCCAAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_leptinellae_CBS477_90 TATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGTTCTGAGCGTGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGAATGCGG-CGTTCGC--GAAGTCCAACACC------GTGACGCACACGC-AATCTTCCTCCCTAT--ATTGGCTACAGCAAGTTAACACTCCTCACAGGAAGCTGCCGAACTC Embellisia_lolii_CBS115266 TATGGCATCTATTCTCTTTC-----ACATGG-GCAGTTACATCTACCTGGTGTATCCTCCGAGCGCGCAGTCA-GCCCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATCC-CATGTGTCTAT------TTCGGCAACAGCAAGCTAACACGCCTCACAGGAAGCCGCCGAACTC Embellisia_novae_zelandiae_CBS478_90 TATGCCATCCCTTTTCTTTT-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCAGATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_phragmospora_CBS274_70 TATGGCATCACATTTCTTTC-----AAACGG-ATGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CTTTCGC-GAATCCCTAACACC------ATGACGCACATGG-AATTTCCCTAC------TTTGACCACAGCATGCTAACAAGCCTCGTAGGAAGCCGCCGAGCTC Embellisia_planifunda_CBS537_83 TATGGCATCCCTTTTCTTTC-----ACACGG-ATAGTTGCATCCACCTGGTGTGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGTGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTTCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_proteae_CBS475_90 TATGCCGTCCCTTTTCTTTC-----AAATGG-ACGGTTGCATCCACCTGGTGCATCCTCTGAGCGCGCCGTCA-GTCTCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAGTTCCAACTCC------ATGACGCACATCC-AGTGTCCCTAT------CTCGGTTACAGCAAGCTAACAAATCTTACAGGAAGCCGCCGAACTC Embellisia_tellustris_CBS538_83 TACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_tumida_CBS539_83 TATGGCATCCCTTTTCTTTC-----ACACGG-ACAGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTCCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCTGCCGAACTC Nimbya_caricis_CBS480_90 TACGACATCACTTTTCTTCC-----ACATGA-ATGGTCGCTACCTCCCGGTGCATCTTTTGAGCGCGCAGCCA-TTTCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGTTTGCAG-CTTTCGC--GAACCCCAACACCCT----ATGACGCATATTC-AATTTTCCCAT------TTCGGCCACAACATGCTAACGAGCCTCACAGGAAGCCGCCGAGCTC Nimbya_gomphrenae_CBS108_27 TATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Nimbya_scirpicola_CBS481_90 TATGGCATCACTTTTCTTTC-----ACATGG-ATGGCCACAACCACCTGGTGCGTCTTCCGTGCGAATAGCCA-TTTCCTTGGCATAT--CGCATTGGAGGGGCATTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAT-CTTTCGC--GAAGCCCAACACC------ATGACGCACATCC-AATCTGCTTAT------TTTGGCCACGACATGCTAACAAGTCGCACAGGAAGCCGCCGAACTC Pleospora_tarda_CBS714_68 TACGACATCACTTTTCTTTC-----ACCCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTCAT--CGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Sinomyces_alternariae_CBS126989 TACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Stemphylium_herbarum_CBS191_86 TACGGCATCACTTTTCTTTC-----ACTCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTTAT--GGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATTCGG-CCTTCGC--GAATCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCATAGGAAGCCGCCGAGCTC Teretispora_leucanthemi_CBS421_65 TACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Teretispora_leucanthemi_CBS422_65 TACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Ulocladium_arborescens_CBS115269 TACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_atrum_CBS195_67 TACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytis_CBS198_67 TACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytisCBS197_67 TACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_brassicae_CBS121493 TACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cantlous_CBS123007 TACGACATCACTTTTCTTTC-----ACATAG-ACAGTCGCGCCCACCTAGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCTGAACTC Ulocladium_capsicuma_CBS120006 TACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_chartarum_CBS200_67 TACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_consortiale_CBS104_31 TACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cucurbitae_CBS483_81 TACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_multiforme_CBS102060 TACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_obovoideum_CBS101229 TACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_oudemansiiCBS114_07 TACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCATTTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_septosporum_CBS109_38 TACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_solani_CBS123376 TACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_subcucurbitae_CBS121491 TACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_tuberculatum_CBS202_67 TACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Undifilum_bornmuelleri_DAOM231361 TACGGCATCACTTTTCTTTC-----ACACGG-AATGTGGCATCCGCCCGGTGCATCCGCTGAGCGCTCAGCCA-ACTCGT-GGCTCAT--TGCGATGAGGGGCA--TTTTGGGTAGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCACTAGTCTGCATACGG-CGTTCGC--GAACTTCAACACC------ATGACGCACATCC-AATTTCCTCATTTTAGCTTTTGCAATAGCATGCTAACAAACCCCACAGGAAGCCGCCGAGCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17362] TITLE LSU_Character_Matrix; LINK TAXA = Taxa4; DIMENSIONS NCHAR=851; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_alternata_CBS916_96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_anigozanthi_CBS121920 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_arborescens_CBS102605 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_argyranthemi_CBS116530 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_armoraciae_CBS118702 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_avenicola_CBS121459 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_axiaeriisporifera_CBS118715 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_brassicae_CBS116528 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGTCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_brassicicola_CBS118699 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_calycipyricola_CBS121545 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_capsici_annui_CBS504_74 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGGGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_carotiincultae_CBS109381 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_cheiranthi_CBS109384 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_chlamydospora_CBS491_72 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_cinerariae_CBS116495 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_conjuncta_CBS196_86 ACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAAGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATATTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_cumini_CBS121329 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_dauci_CBS117097 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC-TTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_daucifolii_CBS118812 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_dianthicola_CBS116491 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_elegans_CBS109159 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_ellipsoidea_CBS119674 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_eryngii_CBS121339 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_ethzedia_CBS197_86 ACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gaisen_CBS632_93 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_geniostomatis_CBS118701 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGAGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_gypsophilae_CBS107_41 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_helianthiinficiens_CBS117370 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_helianthiinficiens_CBS208_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_infectoria_CBS210_86 ACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAAGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATATTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_japonica_CBS118390 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_juxtiseptata_CBS119673 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTGTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_limaciformis_CBS481_81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_limoniasperae_CBS102595 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_longipes_CBS540_94 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_macrospora_CBS117228 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_mimicula_CBS118696 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_molesta_CBS548_81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_mouchaccae_CBS119671 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_nepalensis_CBS118700 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_nobilis_CBS116490 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_oregonensis_CBS542_94 ACCGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_panax_CBS482_81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_perpunctulata_CBS115267 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_petroselini_CBS112_41 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_photistica_CBS212_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_porri_CBS116698 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_pseudorostrata_CBS119411 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_radicina_CBS245_67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_resedae_CBS115_44 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_saponariae_CBS116492 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_selini_CBS109382 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_septorioides_CBS106_41 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_simsimi_CBS115265 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_smyrnii_CBS109380 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_solani_CBS116651 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_soliaridae_CBS118387 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_solidaccana_CBS118698 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_sonchi_CBS119675 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_tagetica_CBS479_81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGCTTTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_tenuissima_CBS918_96 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_thalictrigena_CBS121712 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCAACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_triglochinicola_CBS119676 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTCAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTCTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGAGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_vaccariae_CBS116533 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Alternaria_vaccariicola_CBS118714 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTGTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Botryomyces_caespitosus_CBS177_80 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Brachycladium_penicillatum_CBS116608 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Chalastospora_cetera_CBS121340 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Chalastospora_ellipsoidea_CBS121331 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGTAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Chalastospora_obclavata_CBS124120 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Chmelia_slovaca_CBS567_66 ACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAAGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATATTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Clathrospora_heterospora_CBS175_52 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Comoclathris_magna_CBS174_52 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Crivellia_homothallica_CBS116606 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Crivellia_papaveracea_CBS116607 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_abundans_CBS534_83 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_allii_CBS339_71 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_annulata_CBS302_84 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTCAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_chlamydospora_CBS341_71 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_conoidea_CBS132_89 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_dennisii_CBS110533 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTAAAATCTGGCTCTTTTAGGGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_dennisii_CBS476_90 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCATCAGCTCAAATTTAAAATCTGGCTCTTTTAGGGTCCGAGTTGTACTTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGCAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_didymospora_CBS766_79 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_eureka_CBS193_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGGAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_hyacinthi_CBS416_71 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACAATTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGAAAGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATATTTCCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_indefessa_CBS536_83 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAACGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_leptinellae_CBS477_90 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGACCCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_lolii_CBS115266 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_novae_zelandiae_CBS478_90 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACAATTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGAAAGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATATTTCCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_phragmospora_CBS274_70 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGGCGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGACCCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_planifunda_CBS537_83 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_proteae_CBS475_90 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACAATTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGAAAGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATATTTCCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_tellustris_CBS538_83 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Embellisia_tumida_CBS539_83 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTCGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Nimbya_caricis_CBS480_90 ACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTTGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTCTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCGGAACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGCAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Nimbya_gomphrenae_CBS108_27 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGT--TTTTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Nimbya_scirpicola_CBS481_90 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTAGGAACCCGTAAGGGTGCACTATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Pleospora_tarda_CBS714_68 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Sinomyces_alternariae_CBS126989 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Stemphylium_herbarumCBS191_86 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGGGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTAGCTATCGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTGGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACCACCAGCCTAGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGAAGTTTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Teretispora_leucanthemi_CBS421_65 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATAAACGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Teretispora_leucanthemi_CBS422_65 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATAAACGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_arborescens_CBS115269 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_atrum_CBS195_67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_botrytis_CBS197_67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_botrytis_CBS198_67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_brassicae_CBS121493 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_cantlous_CBS123007 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_capsicuma_CBS120006 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_chartarum_CBS200_67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_consortiale_CBS104_31 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_cucurbitae_CBS483_81 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_multiforme_CBS102060 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_obovoideum_CBS101229 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_oudemansii_CBS114_07 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_septosporum_CBS109_38 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_solani_CBS123376 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_subcucurbitae_CBS121491 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Ulocladium_tuberculatum_CBS202_67 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT Undifilum_bornmuelleri_DAOM231361 ACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTGCAGTTGCTCATCCAGGC--TTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCTCTTCGGGGAGGCCTTATAGGGGAGACGAAATACCACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGCCCGTCTTGAAACACGGACCAAGGAGTCTAACATCTATGCGAGTGTTTGGGTGTCAAGCCCGAGCGCGTAATGAAAGTGAACGGAGGTGGGAACCCGCAAGGGTGCACCATCGACCGATCCTGATGTCTTCGGAAGGATTTGAGTAAGAGCATGGCTGTTGGGACCCGAAAGATGGTGAACTATGCTTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGCAGCGGTTCTGACGTGCAAATCGATCGTCAAATTTGGGCATAGGGGCGAAAGACTAAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17359] TITLE GAPDHTEF_Character_Matrix; LINK TAXA = Taxa1; DIMENSIONS NCHAR=842; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 TATCGTCTTCCGCAATGCGTAAGCTTCG-CCCAACTCGCCGATACAAT-CTATCCGAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----GCCAGG-CCATCCA-AATCGTGACG-ATAGTCCTTGCGATGCGCT-GAAGCTCCTCTGTGG-TCGCAGAATGCACGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_alternata_CBS916_96 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_anigozanthi_CBS121920 TATCGTCTTCCGCAATGCGTAGGTTTTG-GCTGCTCCACTGATACAATTGATCAAAAGCTGACCGC-GTGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCGATGCGAT-GGTACCGTTGCCTTG-TCATAGAGCGCAGGCTAATATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATAACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTT-------TAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACACGC-AATCTTCCTCGCTAT--GTTGGCTACAGCTAGCTAATAATCCTCACAGGAAGCTGCCGAACTC Alternaria_arborescens_CBS102605 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCTGATGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_argyranthemi_CBS116530 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACGCTTCATCGATACCATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTCAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGACTACA--CACGATACAG----CCACAG-CCGTCCATTCTCGAGACA-TCAGTTCTCGCCATGCGAT-GGAGCTATCTCATGG-CCGCAGAACACAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGAAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATCACTTTTCCTTC-----ATACGG-ACAATCGCGCCCAATCA--GATGCATCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TATTTTGGGCGG-TGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCTCAC------TCTGGCCAAAGCATGCTAACAAGCCTCTCAGGAAGCCGCCGAACTC Alternaria_armoraciae_CBS118702 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GAGCTATTGTGCTA-TCGCAGGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACTTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_avenicola_CBS121459 CATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_axiaeriisporifera_CBS118715 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--AGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_brassicae_CBS116528 TATCGTCTTCCGCAATGCGTAGGCTTCG-CCCATTCGATTGATACAACTATATCGAAGCTGACCGC-GTGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-TCCAAGCATC--CACACTACAG----CTACAG-CCATCCA-GGTCGCGACA-CCAGTCCTTGCGATGCGCT-AGAGCTCCT-----------AGAATGCAGGCTAACATA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCAGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTTTGGCATCACTTTTCCTTT-----ACACGC-ACAGTTGCGTCCACTCGGTGTATCCTCTGAGCGCGCAGCCA-TATCCT-GGTTTTT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCGTGCGG-CCCTCGC--GAACCCCAACACG------ATGACGCACATGC-AATTTCTATAT------TTTGGCTACAGCAAACTGACAAGTCTAACAGGAAGCCGCCGAACTC Alternaria_brassicicola_CBS118699 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_calycipyricola_CBS121545 CATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGTATGCCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_capsici_annui_CBS504_74 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_carotiincultae_CBS109381 TATCGTCTTCCGCAATGCGTAGGTTTGA-CCCATTGCGTCGATACAGT-GTATCAAAGCTGACGGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTC-CCTAAGCACC--CGCGCTACAG----CCACAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAGTGCTGGCTAACACA--TCTAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_cheiranthi_CBS109384 CATCGTCTTCCGCAATGCGTAGGTTCCA-CCCGCTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACCCACACACTACTG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTATTCCACGG-TCGCAGATTACAAGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGAAGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAATCCGACATTGAGTACGACATGACTTTGCTTTC-----ACATGG-ATAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACA------------------TCC-AATTCTGCTAT------TCTGGCCACAGTGCGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_chlamydospora_CBS491_72 TATCGTCTTCCGCAATGCGTACGTTTCC-CTCGCTCCAAGGATGCGGCAATATTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACA--T-GAAAACAG----TCACCG-CCATCCC-TCCCGCAGCA-TCAGTCCTTGGGATGCGAT-GGAGCTACGGTACAA-TCGCAGGATGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGAGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACATCTCTTTC-----AAATGG-ACGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAATCCCCAGCACC------ATGACGCACATGC-AATTTCCCTAC------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_cinerariae_CBS116495 TATCGTCTTCCGCAATGCGTAGGTCCCG-CCCATTCGATTGATGCAATTATATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCGGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCTAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCGCGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTTCACGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATCACTTTCCTTTC-----ACGCGGCACAGTTGCGTCCACTCGGCGCATCC-CTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------TTTGGCTACATCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_conjuncta_CBS196_86 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAACAGCCCACCCA-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGGCTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCTGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCTTCAGTTTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_cumini_CBS121329 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGTTCCGCTGATACAGCTGATCAAACACTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCACAG-CCATCCA-CCGCCCGATA-CCAATCTTCGCAATGCCAT-GGAGCCATTGCACGA-TCGCAGAACACAGGCTAACACATGCACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCAGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATCACTTTTCTTTC-----ATGCGC-ACAGTTGCATCCCCTTGGTGTATCCTCTGAGCGCGCAGCTG-GTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGTTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CATTCGC--GAAATGCAACACC------ATGACGCAGTTTC---------CAT------TCTGGTCACAGCACGCTAAGAACCCTTCCAGGAAGCCGCCGAACTC Alternaria_dauci_CBS117097 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAAATCATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-CTAGTCATTGCGATGCGCT-AGAGCTTCTCTACAG-CTGCAGAACGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATCACTTTTCCTTTC----ACACGC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCTCTGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTACTTATGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GCCTCATAGGAAGCCGCCGAACTC Alternaria_daucifolii_CBS118812 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_dianthicola_CBS116491 TATCGTCTTCCGCAATGCGTAGGTTCCA-TCCGATCTGCCAACACAATCGTATCAATGCTAACCCC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTTCCCCAAGCACC--CAAACTACAGC---TCAAAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-CGAGGCACCTCACAG-CCGTAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAATCTCACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGTACCAAATTCATTTT-----TCATGG-ACCCTCAGATGCCCCCGATGCATGCTCTGAGCGCTCTGCCA-TTTTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGGTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CTTTCGC--GAAC--------------------------------------------------------ACACGCTAACAAGTCTCACAGGAAGCCGCTGAACTC Alternaria_elegans_CBS109159 TATCGTCTTCCGCAATGCGTAGGTTCCA-TCCACTCTGCCATGACAATCGTATCAAAGCTGACCGC-ATCCTATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CAAACTACAGC---CCGTAG-CCATCCA-AATCGCGACG-GTAGTCCTTGCGATGCGCT-CGAGGCACTCCACGG-TCTCAGCTTGCAGGCTAACACA--TTCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGCATCGCCTTTCCTCTCCTC-TCATGGAACCCCCTCGTCCACTTGATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_ellipsoidea_CBS119674 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATTACGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACTACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGTATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_eryngii_CBS121339 TATCGTCTTCCGCAATGCGTAGGTTCTATCCCACGCCATTGATACCATCATCTCAAAAGTAACCGC-ATGCCATAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCGCGCACC--CAAAATACAG----CCACAG-CAATGCA-AATCGCGACA-CCGGTCCTTGTGATGCGCT-GGAGCTATTCCACGA----CAAAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAATCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATTCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGAACTACAAGTCCGACATCGAGTATGGCATCAATTTTCTTTC-----ACCTGG-ACGGTCGCATGCCTCAGATGCATTCCTCAAGTGCCCAGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTC----------CTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCTGCCGAACTC Alternaria_ethzedia_CBS197_86 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAATAGCCCACCCT-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGGTTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGCGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGGCATCACTCTCCTTTC-----ACATGG-GCATTCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCTTCAGTCTGCTAACAGGCCTCACAGGAAGCCGCCGAACTC Alternaria_gaisen_CBS632_93 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCCTGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCAAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTT Alternaria_geniostomatis_CBS118701 CATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGCTCCACTGATACAATTGATCGAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCGTAG-CTATCCA-CCGCGCGAAA-TCAATCTTCGCGATGCGAT-GGAGCCGTTGCCTTA-TCATAGAGCGCAGGCTAACACATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAAAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAAGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCCGCTCCCTCTGCCGACGCCCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGACAACACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-GTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATGC-CATGTCGCTAT------TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_gypsophilae_CBS107_41 CATTGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_helianthiinficiens_CBS117370 TATCGTCTTCCGCAATGCGTGGGTTTCG-TCCGTTCCATGGATAAAGCTCTTTCAAAGCTGACCGC-ATGCCGCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAGACGCC--CGCACCACAA----CCACAG-CCATCCA-GATCGCGACA-TGAGTCCTTGCGATGCGCT-AGAGTCCCTTTTCGG-TCGCACAACACAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_helianthiinficiens_CBS208_86 TATCGTCTTCCGCAATGCGTGGGTTTCG-TCCGTTCCATGGATAAAGCTCTTTCAAAGCTGACCGC-ATGCCGCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAGACGCC--CGCACCACAA----CCACAG-CCATCCA-GATCGCGACA-TGAGTCCTTGCGATGCGCT-AGAGTCCCTTTTCGG-TCGCACAACACAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGCCATTCTTTTTCCTTTC----ACACGT-CCGGTTGCGCCCACTCGGTGCGTCCTCTGAGCGTGCAGTCA-CATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT--GGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-CGTTCGC--AAA---TAGCACC------ATGACGCACTTCC-AAATTCCCCAT------GCTGGCCATAGTAAGCTAACAATTCTC-TAGGAAGCTGCCGAACTC Alternaria_infectoria_CBS210_86 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCATAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCAT--CCCGCGCAAA--CACAAACCCA----TAATAGCCCACCCA-TCTTTGCACA-TCGGCTTTTACGATGCCAC-GGAGCGGTTCTACGA-CTACAGTACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGTGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACCTGAAGGGTGGAGCCAAGAAGGTTGTTATCTCTGCTCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTCTCCTTTC-----ACACGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAATAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_japonica_CBS118390 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCGGTTGATACAGTTGTATCAAAGTTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCATC--CACACGACAG----CCACAG-CCATCCA-AGCCCCGACA-GCAGTCCTTGTGATGCGCT-AAAGCTATTCCATGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_juxtiseptata_CBS119673 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATGCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCCCCTCCGCGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATTACTTTTCTTCC-----ACGCAC-ACTGTTGCATCCACATGGTGCTTCCTTTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGACGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_limaciformis_CBS481_81 TATCGTCTTCCGTAATGCGTACGTTTCC-CTCCTTCCATAGATACAGCAAC-TCCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCA------------------------------------------ACA-TCAGTCCTTGCGATACGAT-GGAGCCACGGTGTAA-TCGCAGGATATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGTACGGCATCACTTTTCCTTC-----AAACAG-ACGGGCGCAATCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_limoniasperae_CBS102595 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_longipes_CBS540_94 TATTGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTGAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGGCCCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TTTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_macrospora_CBS117228 TATCGTCTTCCGCAATGCGTATGTTTCG-CCCAATTCATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACTG----CCATGG-CCATCCG-CATCGCGACA-CTAGTCCTTGCGATGCGCT-AAAGCTTCTCTACAG-CTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCCGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACACCCTCCCCATGATGCACATCT-AACTTCTCAAC------TATGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_mimicula_CBS118696 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_molesta_CBS548_81 TATCGTCTTCCGCAATGCGTATGTTTCC-CTCCCTCCATAGATCCAGCAAC-TTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCG------------------------------------------ACA-TCAGTCCTTGCGACACGAT-GGAGCTACGGTACGA-TTGCAGGACGCTGGCTAACACA--CCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGTACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_mouchaccae_CBS119671 TATCGTCTTCCGCAATGCGTACGTTTCC-CTCCCTCCATAGATCCAGCAAC-TTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCG------------------------------------------ACA-TCAGTCCTTGCGACACGAT-GGAGCTACGGTACGA-TTGCAAGACGCTGGCTAACACA--CCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCTGACATCGAGTACGGCATCACTTTTCCTTC-----AAACGG-ACGGGCGCAGTCACTTGGTGCATCTTCTGAGCGCTCTGCCG-T-TGCT-GGCATAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAG-CTTTCGC--GAACCGCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACAGCATGCTAACAAGCCTCGCAGGAAGCCGCCGAGCTC Alternaria_nepalensis_CBS118700 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCGGTTGATACAGTTGTATCAAAGTTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCATC--CACACGACAG----CCACAG-CCATCCA-AGCCCCGACA-GCAGTCCTTGTGATGCGCT-AAAGCTATTCCATGG-TCGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTCTTATT-----ATGCGG-ACAGTTGCATCCGCCCGGTGCATCATCTGAGCGCATGGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTAGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTCGCCCAT------TTTGGCTACAGCAGACTGACAAGCCTCCCAGGAAGCCGCCGAACTC Alternaria_nobilis_CBS116490 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATTACGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACTACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGTACGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCTCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_oregonensis_CBS542_94 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCAAA--CACAAACCCA----GAATAGCCCACCCA-TCTTTGCACA-TCGGCTTTTGCGATGCCAT-GCAGCGTTTCTACGA-CTACGGGACGCAAGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCATATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGGCATCACTCTCCTTTC-----ATATGG-GCATCCGCGACCGTCCAGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTGTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATTACGCACATCC-AATTTTCCCAA------TCCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_panax_CBS482_81 TATCGTCTTCCGCAATGCGTATGTCTCA-CCCACTCCGTTGATACCATCATATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAGCGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----CCACAG-CCATGCA-AATCGCGACA-CCCGCTCTTGCCATGCGCT-GGAGCTACTACACGA-CCGCAGAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAATCACGAGACTTACAAGCCCGACATCGAGTACCACATCCCTTTTCTTTC-----ACATGG-ACGGTCGCACGTCCTCGATGCATCCTCTGAGCGCCTAGCCA-TTTCCT-GGCTGAT--CGCGATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGTTCGC----ACTCCACCACC------ATGACGCACATCC-AATTTTCCCAT------TCTGGCCACAGTACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_perpunctulata_CBS115267 TATCGTCTTCCGCAATGCGTAAGCTTCG-CCCAACTCGCCGATACAAT-CTATCCGAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----GCCAGG-CCATCCA-AATCGTGACG-ATAGTCCTTGCGATGCGCT-GAAGCTCCTCTGTGG-TCGCAGAATGCACGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACTCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATTTCTCTTCTTTC-----ACCCGG-ACCGTTGTGCTCGCCTGGTGCTTTCTCTGAGCGCGTAGCCA-CAGCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGGAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATCC-AATTCCCCCAT------GCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_petroselini_CBS112_41 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCC-CCCAAGCACC--TACACTACAG-----------CCGTCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACGGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGTATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_photistica_CBS212_86 CATCGTCTTCCGCAATGCGTACGTCTCA-CCCACTCCATTGATACCATCGTATCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACC--CACACTACAG----TCACAG-CCATGCA-AATCGCGACA-CCCGTCCTTGCTATGCGCT-GGAGCTACTTCACGG-CCGCAGAATGCAGGCTAATGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACTTGG-ACGGTCGCATACCCTTGGTGCATTCTCTGAGCGCCTAGCCA-TTTCCT-GGCTTAC--CGCGATGAGGGGCA-TTTTTGGGTGGC-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CATTCGC----ACTCCAACACC------ATGACGCACATCC-AATTTTCCTAT------TCTGGCCAC--TACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_porri_CBS116698 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTCATTGATACAGTCG-ACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-CTGCGGAATGCAGGCTAACAAA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGACATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAAACGAACACCCACTTAATGATGCACATTT-AACTTCTCAAC------CCTGGTTATAGTAGGCTAACA-GTCTCATAGGAAGCTGCCGAACTC Alternaria_pseudorostrata_CBS119411 TATCGTCTTCCGCAATGCGTACGTTCCG-CCCGATTCATTGATACAATTG-ATTTGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CACCGCGACA-TTGGTCCTTGCGATGCGCC-AGAGCTCCTCTACAG-CTGCAGAACGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAATCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATCACTTTTTCTTTC----ACACAC-ACTGCTGCATCCACCTGGTGCTTCCTCTGAGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAACTTTTTACGCGCTAGCGCTAGCCCGCTTGCGG-CCGACATCGAAAACCGAACACCCTGGTAATGATGCACATCC-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_radicina_CBS245_67 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTGCGTCGATACAGT-GTATCAAAGCTGACGGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTC-CCTAAGCACC--CGCGCTACAG----CCACAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAGTGCTGGCTAACACA--TCTAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCACCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACTCGGTGCTTCCTCTGCGCACGCAGTCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTTCCCAT------TTTGGCCCCAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_resedae_CBS115_44 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCGCTCCATTGATACAATTGTATCAAAGCTAACCAC-ATGCCACAGTATCGAGCACAACGACGTCGACATCGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCGGTAAGCTTT-CCCAAGCACCCACAAACTACAG----CTATAG-TCATCCA-AATCGCAGCA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTAGTCATCTCTGCTCCTTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACATGG-ATAGTCACATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTCAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAAGCCGCATACGG-CGTTCGC--GAACTTCAACA---------------ACGTCC-AATTTCCCTGT------TCTGGCCACAGTACGCTGACAAGCCTTACAGGAAGCCGCCGAACTC Alternaria_saponariae_CBS116492 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATACAAT-GTATCAGAGCTGACTGC-ATGCTACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCTAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCTCCTCCACGG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAATTACAAGTCCGACATCGAGTATGGCACTACTTTTCTTCC-----ACGCGG-ACTGTTGCATCCACACGGTGCTTCCTCTGATCGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAAGACC------ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_selini_CBS109382 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCC-CCCAAGCACC--TACACTACAG-----------CCGTCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACGGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGTATGGCATCACTTTTCTTTC-----ACACGG-ACAGCTACATGCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCTCCAT------CTTGGCTACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_septorioides_CBS106_41 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_simsimi_CBS115265 TATCGTCTTCCGCAATGCGTAGGTTCCA-TCCACTCTGCCATGACAATCGTATCAAAGCTGACCGC-ATGCTATAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CAAACTACAGC---CCGTAG-CCATCCA-AATCGCGACG-GTAGTCCTTGCGATGCGCT-CGAGGCACTCCACGG-TCTCAGCTTGCAGGCTAACACA--TTCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGCATCGCCTTTCCTCTCCTCCTTATGGAACCCCCTCGTCCACTTCATGCGTCCTCTGAGCGCTCAGCCATTTTCCTGGGCTTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACGCCAACACC------ATGACGCACATGC-GATGTTCCTAT------TCTGGTCACAGCACGCTAACAAGCCTTACAGGAAGCCGCTGAACTC Alternaria_smyrnii_CBS109380 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCATTCCGTCGATACAGT-GTATCAGAGCTGACGGC-ATGCCACAGTATCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTCT-CCCAAGCACC--CACACTACAG-----------CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-TCGCAGAGTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGCCCGACATCGAGTATGGCATCACTTTTTTTTCC----ACACGG-ACAGCTATATCCACTCGGTGCTTCCTCTGAGCGCGCAGCCA-AAG--T-GGCTTAT--CGCGATGAGGGGCATTTTTTTGGGTGG-TGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATAC-AATTTCCCCAT------CTTGGCCACAGCAAGCTAACAAGCCTCATAGGAAGCCGCCGAACTC Alternaria_solani_CBS116651 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTCATTGATACAATCG-ACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CACAATACAG----CCATGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCGATGCGCT-AGAGCTCCTCTACAG-CTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGACATCACTTTTCCTTTC----ACACGG-ACTGCTGCATCCACCTGGTGCTTCCTCGTTGCGCGCAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAGACCGAACACC--AAGGACGATGCACATCT-AACTTCTCAAC------CCTGGTTACAGTAGGCTAACA-GTCTCGTAGGAAGCCGCCGAACTC Alternaria_soliaridae_CBS118387 TATCGTCTTCCGCAATGCGTACGTCTCA-CCCTCTCCATTGATGCAGCAACATGCAGTCTAACCAC-ATGCTACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGTCTATA--CACAATACAG----CCATAG-CCATCTC-----------------CCTTGCGACGCGAT-AGAGCTTCTGTATAA-TCGCAGGATGCAGGCTAACACAC-ACCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGATTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACATACAAGTCTGACATCGAGTACGGCATCACTTTTCTTTC-----ACGCGG-ATGGTTGCAACCACCCGGTGCATCCTCTGA--GCTTAGCCA-TATCCT-GGCTTGT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCT-AATTATCCTAT------TTTGGCCACAACATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Alternaria_solidaccana_CBS118698 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGGTACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CACACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCAC------TCTGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCCGCCGAACTC Alternaria_sonchi_CBS119675 TATCGTCTTCCGCAATGCGTAGGTTCCG-CCCATTCGATTGATGCAATTATATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCGGTGAACGACCCCTTCATCGAGCCCCACTATGCTGTAAGCTTT-CCCAAGCACC--CACAATACAG----CCGCAG-CCATCCA-AATCGCGACA-CTAGTCCTTGCGATGCGCT-AGAGCTCCTTCACGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCTTGAACCTGACCGTGAACGGCAAGACCATCCGTTTCCACATGGAGAAAGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACAGCATTACTTTCCTTTC-----ACGCGGCACAGTTGCGTTCACTTGACGCATCCTCTGAGCGCGCAGCCA-CATGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGT--GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAGCTCCAACACC------ATGACGCACATCC-AATTTTCCCAT------CTTAGCTACATCACGCTAACAATCCTCACAGGAAGCCGCCGAACTC Alternaria_tagetica_CBS479_81 TATCGTCTTCCGCAATGCGTACGTTTCG-CCCAATTTATTGATACAATCG-ATCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAAATGCAG----CCTTGG-CCATCCG-CATCGCGACA-TTAGTCCTTGCCATGCGCT-AGAGCTCCTCTACAG-CTGCAGAACGCAGGCTTACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGTGCTTATTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATTTCTGCTCCTTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGTATGGCATCACTTTTTCTTTC----ACACGG-ACTGCTGCATCCACCAGGTGCTTCCTCTGAGCGCACAGCCA-AACTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGGAC-TTTTACGCGCTAGCGCTAGCCCGCTTGCAG-CCGACATCGAAAATCGAACATCCCACACATGATGCACATCT-AACTTCTCAAT------CCTGGTTACAGTAGGCTAACA-GTCTCATAGGAAGCCGCCGAACTC Alternaria_tenuissima_CBS918_96 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_thalictrigenaCBS121712 TATCGTCTTCCGCAATGCGTAGGTCCCA-CCCACTCCATTGATACCATCATATCTAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CTCAAGTGCC--CACACTATAG----CTGCAGCCCATCCG-AATCGCGACA-TCAGGAGCTACGATGCGCT-GGAGCTACGTCACGG-TCGCAGAATGCAGGCTAACGCA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACAGAGAAGGCCAAGGCCCACTTGAAAGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTAACGCATCACCTTTCTTTC-----ACATGG-CCAATCGCATGCACCCGATGCATTCTCTGAGCGCTCAGCCA-TTTTCT-GCCTTAT--CGCGAGGAGGGGCA-TTTTTACCTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCTGCATGCGG-CGCTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCCCT------TCTGCCTACAGTGTGCTAACAAGCCTCGCAGGAAGCCGCCGAACTC Alternaria_triglochinicola_CBS119676 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCTGCTCCATTGATACAATTGATCAAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCAATGCGAT-GGTACCATTGCCTTG-TCATAGAGCGGAGGCTAACATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCCCATTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGCCATCACTTTTCTTTC-----ACACGG-ACCGTTGCACCCACTCGGTGCATGCTCTGAGCGCGCAGCCA-CTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAATCCAACACC------ATGACGCACATGT-CATGATCCTAT------ATTGGCTACAGCAAGCTAACAATCCTCCCAGGAAGCTGCCGAACTC Alternaria_vaccariae_CBS116533 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATCCCATTGATATAAT-GTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCACAG-CCATCCA-AATCACGACACCCAGTCCTTGTGATGCGCT-AGAGCTCCTCCACAG-TCGCAGAATGCAGGCTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGAACTACAAGTCCGACATCGAGTATGGCATTACTTTTCTTAC-----ACGCGG-ACTGTTGCATCCACATGGTGCTTCCTTTGATTGCGCAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGC---------ATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGA-TGTTCGC--GAACTCCAACACCC-----ATGACGCACATCC-AAATTCCCCAT------TTTGGCCACAGCAAACTAACAAGCCTCACAGGAAGCCGCCGAACTC Alternaria_vaccariicola_CBS118714 CATCGTCTTCCGCAATGCGTAGGTTTCG-CCCATGCCATTGATACAAT-GTATCAGAGCTGACCGC-ATGCCACAGTGTCGAGCACAATGACGTCGACATTGTCGCCGTAAACGACCCCTTCATAGAGCCCCACTACGCTGTAAGCCTC-CCCAAGCACC--CACACTACAG----CCGCAG-CCATCCA-AATCACGACA-CCAGTCCTTGCGATGCGCT-AGAGCCCCTCCACGG-CCGTAGAATGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAAAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGGCATAACTTTTCTTCC-----ACGCAG-ACTGTTGCATCCACATGGTGCTTCCTCTGAGCGCGCAGCCA-AAGCCT-GGCTTAT--CGTGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TTTGGCCACGGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Botryomyces_caespitosus_CBS177_80 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCGAA--CACAAACCCA----TAATAGCCCACCCG-TCTTTTCACA-TCGGCTTTTGCGATGCCAC-GGAGCAGTTCTACGG-CTACAGGACGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGTACGGCATCACTCTCCTTTC-----ACATGG-GCATCCGCGACCGTCCAGTGTA-CCTCTGAGCGCTCAGCCA-TTT-TC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCGGCTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Brachycladium_penicillatum_CBS116608 CATCGTCTTCCGCAATGCGTAGGCTTCA-TCCCTCTTATCAACACAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATGGAAGACAG----TCATAG-CCATCCA-GCTCGCGACA-TTACTCCTTGCGTTGCGAT-AGAGCTACTGCATGG-TTGCACAATGCAGGCTAACACACACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Chalastospora_cetera_CBS121340 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGTATA--TACAAGACCG----TTGCAG-CCATCCG----------------------CGATGCGAC--GAGCTGTTGTACTA-TCGCACGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCTCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGACATCACTCTTTTTTC-----ACATGG-GCTGTTGCAACCATCCGGTGCA-CCTCTGAGCGCGCCGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGGCGCACATAC-AA--TCCCCAA------TTTAGTCACAGCATGCTAACAAGTCAAACAGGAAGCCGCCGAACTC Chalastospora_ellipsoidea_CBS121331 TATCGTCTTTCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GGGCTATTATGCTA-TCGCAGGACGTAGGCTAACATA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGACATCACTATTTTTTTC----ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTTCCCAA------TTCGGCCACA----GCTAACAAGCCTCATAGGAAGCCGCCGAACTC Chalastospora_obclavata_CBS124120 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCATT-CCTACGTATA--CACAAGACCG----TTGCAG-CCATCCG----------------------CGATGCGAC--GAGGTGTTGTAATA-TCGCACGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATTCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTCTTTTTTTA----ACATGG-GTTGTCGCATCCATCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATAC-AATTTCCCCAG------TTTGGCCACAGCATGCTAACAAGTCGAACAGGAAGCCGCCGAACTC Chmelia_slovaca_CBS567_66 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCATC-CCCGCGCGAA--CACAAACCCA----TAATAGCCCACCCA-TCTTTTCACA-TCGGCTTTTGCGATGCCAC-GGAGCAATTATATGA-CTACAGGGCACAGGCTAACACA--CATAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCCGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGGCATCACTCTCCTTTC-----ATGTGG-GCATCCGCAACCACCTGGTGCA-CCTTTGAGCGCTCAGCCA-TTT-CC-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACCCCAACACC------ATGACGCACATAC-AATTTCCCCAA------TTCAACTTCAGTCTGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Clathrospora_heterospora_CBS175_52 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Comoclathris_magna_CBS_174_52 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCTAACTCGTCGATACAAT-CTACCAGAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--CACACTACAG----CCGCGG-CCATCCA-AGTTGCGAAA-ACAGTCCTTGCGATGCGCT-AGAGCTCCTCTGTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCA------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Crivellia_homothallica_CBS116606 TATCGTCTTCCGTAATGCGTACGTTTGA-TCCATCTTATCAACAGAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCATAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATACAATACAG----TCATAG-GCATCCA-GCTCGCGACA-TTACTCCTTGCATTGCGAT-GGAGCTACTGCATGG-TTGCAGAATGCAGGCTAACGCA--CACAGGCCTACATGCTTAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATTGAGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATTCTCTTCACGCTCAGCCA-ATTACT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGA-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACA------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Crivellia_papaveracea_CBS116607 CATCGTCTTCCGCAATGCGTAGGCTTCA-TCCCTCTTATCAACACAATTCCACTAAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCCTGCGTACATGGAAGACAG----TCATAG-CCATCCA-GCTCGCGACA-TTACTCCTTGCGTTGCGAT-AGAGCTACTGCATGG-TTGCACAATGCAGGCTAACACACACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTTGAGTCTACCGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCGGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATGACTCTCCTTTT-----ACATGG-ACAGTCGCAACCACCCGGTGCATCCTCTGAACGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCCTCGC--GAACTCTAACACC------ATGACGCACATCCAAATTTCGCTAC------TTTGGTTGCAGTAGGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_abundans_CBS534_83 TATCGTCTTCCGCAATGC----------------------------------------------------------TATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCATA--TACAAGACCG----TTGCAG-CCTTCCA----------------------CGATGCGAC--GAGCTATTGTGCTA-TCGCAGGACGCAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACTTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCTAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGACATCACTCTTTCTTCCC---ACATGG-GCTGTCGCAACCACCCGGTGCA-TCTCTGAGCGCGCCGCCA-TTT-CT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CCTTCGC--GAGCCCCAACACC------ATGACGCACATCC-AATTTCCCCAA------TTCGGCCACA----GCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_allii_CBS339_71 TATCGTCTTCCGCAATGCGTACGTCTTA-CCTACTCCATCGATATAGCAACTATCAAGCTAACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACA--TGAAAAACAG----TCACAG-CCATCCG-CCTCGCGACA-TCAGTCCTTGCGATGCAAT-GGAACTACCGTATGA-TCGCACGACATAGGCTAACACA--TACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCGCCCTCCGCTGATGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGGCATCACCTCTCTTTC-----ACGCGC-ATAGTGGCAATCATCCGGTGCATTCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTTT-----TTTGGCCACAGCACGCTAACAAGTTTCACAGGAAGCCGCTGAGCTC Embellisia_annulata_CBS302_84 TATCGTCTTCCGCAATGCGTAAGTCTGA-TGGAA-CCGTCAATTCTGCCTTATCAAAGCTAACCAC-GTTTCACAGGGTCGAGCACAACGATGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATC-CCCGGACACA--ACGCAATCTT----TCCTGA-CAACCCG-CCGCGCGTTT-CTTTTGATCGCCGCGATTG-GAAGTCATTTGTTGC-TAGTGGATTGCAGGCTAACGTCCATGCAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGAAGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACGGGCGCCTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCAATTTTCCTTC-----ATCTGC-AAAGTCGCTGCCACCTGGTGCATTTTCTGAGCATGTAGCCA-TTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGTGG-CCTTCGC--GAACTGCAATACC------ATGACGCACATGC-AAAATCCCATT------TTCCGCTGCACGATGCTAACAGGCTCCATAGGAAGCCGCCGAGCTC Embellisia_chlamydospora_CBS341_71 TATCGTCTTCCGCAATGCGTACGTCTTT-CCCACTCCATCGATATAGCAACTATCAAGCTGACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGTACA--TTCAAAACAG----TCATAG-CCATCCG-ATTCGCGACA-TCACTCCTTGCGATGCGAT-AGAGCTACTGCATGA-TCGCAGGACATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACAGTCAATGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGTACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_conoidea_CBS132_89 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCACTCGATTGATACAGCTGTATCAAAGCTGACCGC-ATGCCCCAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTT-CCCACGCACC--CGCACTACAG----CCACGG------------------------------CGATGCGCT-AGGGCTACTCCACGG-TCGCAGAATGCAGGCTGACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAATGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTTGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACACGG-ACAGTTGCGTCCACCTGGTGCATCCTCC-AGCGCGCGGTCA-AATCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGTGGGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGTATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATGC-AATCTCCTCGC------TCTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_dennisii_CBS110533 TATCGTCTTCCGCAATGCGTACGTTTCA-CCCGCTCTCTTAACACTGTTGTATCAGCCCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACC--CAACATACAG----CCATAG-CCATCCA-AATCGCGAGA-GCAGTCATTGCGATGCGCT-AGAGCTACTCCACAG-TCGCAGAATGCAGGCTAACAGA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAAGTTGATGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGTACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_dennisii_CBS476_90 TATCGTCTTCCGCAATGCGTACGTTTCA-CCCGCTCTCTTAACACTGTTGTATCAGCCCTGACCGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTTATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACC--CAACATACAG----CCATAG-CCATCCA-AATCGCGAGA-GCAGTCATTGCGATGCGCT-AGAGCTACTCCACAG-TCGCAGAATGCAGGCTAACAGA--TGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAAGTTGATGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACGTACAAGTCCGACATTGAGTACGACCTCGCTTTTCTTTC-----ATATGG-ACAGTCGCATCCAACTGGTGCACCCTCTGAACGCTCAGCCA-GTTCCT-GGCTTAT--CACGATGAGGGGCA-TTTTTGGGTGGT--GGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC--GAACTCCAACACC------ATGACGCACCTCC-AATTCCCCCAT------TTCGGCCACAGCATGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Embellisia_didymospora_CBS766_79 TATCGTCTTCCGCAATGCGTACGTTTCC-CTTACTCCATCGATCCGGCAACATCCAAGCTGACCAC-ATGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCATACG--TAAAAAACAG----TCATAG-CCATCCC-TTTCGCAACA-TCCCTCCTTGCAATGCGAT-AGAGCTACTGTACCA-TCGCAGGACGCAGGCTAACACG--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATTTCTGCTCCCTCTGCCGACGCCCCCATGTTTGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGTACGGCATCACTTTCCTTTC-----ATGTGG-ACGGTCGCAACCACCCGATGTATCTTCTGAGCGCTCAGCCA-T-TTCT-GGCGTAC--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTATGCGCTAGCGCTAGTCCGCATGCGG-CTTTCGC-GAACTCCCAACACC------ATGACGCACATCC-AATTTACTTAT------TTTGGACACAACATGCTAACGAATCTCGCAGGAAGCCGCCGAGCTC Embellisia_eureka_CBS193_86 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCCGCTCCACTGATACAATTGAGCAAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--AACAATGCAA----ACATAG-TTGTCCA-TCGCGCGAAA-TCAGTCTTCGCGATGCGAT-GGAACCATTGCCTTG-TCGTAAAGCGCAGGCTAACACGTACGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCTACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTTGGTGCATGCTCTGAGCGCGCAGCCA-GTTCCTAGGCTTAT--CGCGATGAGGGGCA-TTTTTGCGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAAGTCCAACACC------ATGACGCACATGC-AACGTTCCTCCTTA---TTTGGCCACAGCAAGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Embellisia_hyacinthi_CBS416_71 CATCGTCTTCCGCAATGCGTGGGTTACA-TCCGTTCCATTGATACAACGAATTTAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--ACCAATACAA----CTG---------------CGCGATA-TTAGTCTTCGCTATGCGAC-GGAGCCATTGCATCA-TCGTAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGCCATTCCTTTTCTTTC-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCGATGAGGGGCT-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCACATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_indefessa_CBS536_83 TATCGTCTTCCGCAATGCGTAGGTTTCA-CTCGCTCCATTGATACAATTGTATCCAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGATCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAGC---CCATAG-CCATCCA-AATCGCGACA-TTTGTCCTTGCGATGCGCT-AGAGCTACTCCATGG-TCGCAGATTGCAGGCTAACGCA--TCCAGGCCTATATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGAAGGCAACAACCTGACCGTCAACGGAAAGACCATCCGTTTCCACATGGAGAAGGATCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACATGG-ACAGCCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTGT--CGCGATGAGGGGCA-TATTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACCCAAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_leptinellae_CBS477_90 TATCGTCTTCCGCAATGCGTAGGTTTTG-CCTGCTCCACTGATACAATTGATCAAAAGCTGACCGC-ATGTCACAGCATCGAGCATAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCGCA--AACAATGCAA----CCATAG-CCATCCA-CCGCGCAGTA-TCAATCTTCGCGATGCGAT-GGTACCATTACCTTG-TCATAGAGCGCAGGCTAATATATACACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTTTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCCGCTCCCTCTGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTATGACATCACTTTTCTTTC-----ACACGG-ACAGTTGCACCCACTCGGTGCATGTTCTGAGCGTGCAGCCA-GTTTCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGG-TGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGAATGCGG-CGTTCGC--GAAGTCCAACACC------GTGACGCACACGC-AATCTTCCTCCCTAT--ATTGGCTACAGCAAGTTAACACTCCTCACAGGAAGCTGCCGAACTC Embellisia_lolii_CBS115266 TATCGTCTTCCGCAATGCGTGGGTTCTA-CCTGTTCCATTGATGTAGTGCATTGAAAGCTAACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGTACA--CACAATACAA----CTATAG-CCATCCG-CCTCGCGATA-TCAGTCTTCGCGATGCGAG-GGAGCTATTGCATCA-TCGCAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTTATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGCATCTATTCTCTTTC-----ACATGG-GCAGTTACATCTACCTGGTGTATCCTCCGAGCGCGCAGTCA-GCCCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAATTCCAACACC------ATGACGCACATCC-CATGTGTCTAT------TTCGGCAACAGCAAGCTAACACGCCTCACAGGAAGCCGCCGAACTC Embellisia_novae_zelandiae_CBS478_90 TATCGTCTTCCGCAATGCGTGGGTTACA-TCCGTTCCATTGATACAAAGAATTCAAAGCTGACCGC-GTGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGACCACA--AACAATACAA----CTA---------------CGCGATA-TCAGCCTTCGCTATGCGAC-GGAGCTATTGCATCA-TCGTAGAATGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAAAAGGCCAAGGCTCACTTGAAGGGTGGCGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGCCATCCCTTTTCTTTT-----ACACGG-ACTGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGCCA-GTCTCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGAGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTGCGC--GAGTTCCAACACC------ATGACGCAGATGC-AATGTCCCCAT------CTCGGTTACAGCAAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Embellisia_phragmospora_CBS274_70 TATCGTCTTCCGCAATGCGTACGTTTCC-CTCACCCCAAGGGTATAGCAGTGTTCAAGCTGACCGC-GTGCCACAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGCACA--T-GAAAACAG----TCACAG-CCATCCC-TCCCGCAGCA-TCAGTCCTTGCGATGCGAT-GGAGCTACGGTACGA-TCGCAGGACGCAGGCTAACACA--CGCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATCGAGTATGGCATCACATTTCTTTC-----AAACGG-ATGCGCGCAACCACCCGGTGCATCTTCTGAGCGCTCCGCCA-T-TGCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCTGCATGCGG-CTTTCGC-GAATCCCTAACACC------ATGACGCACATGG-AATTTCCCTAC------TTTGACCACAGCATGCTAACAAGCCTCGTAGGAAGCCGCCGAGCTC Embellisia_planifunda_CBS537_83 CATCGTCTTCCGCAATGCGTGGGTTTCA-CCCGTTCCATTGATACAATGAATTGGAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCGGTAAGCTTC-CCTGAGCACA--CACAATACAA----CTAAAG-CCATCCA-TCTCGCGATA-TCAGTCTTCGCAATGCGAC-GGAGCTATTGCATCA-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGCATCCCTTTTCTTTC-----ACACGG-ATAGTTGCATCCACCTGGTGTGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGTGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTTCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTACAGGAAGCCGCCGAACTC Embellisia_proteae_CBS475_90 TATCGTCTTCCGCAATGCGTGGGTTGCA-TCCGTTCCATTGATACAACGAATTTAAAGCTGACCGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCTTC-CCCGAGCACA--CACAATACAA----CTGAAG-CCATTCA-TCCCGCGATA-TCAGTCTTCGCTATGCGAC-GGAGCTATTGCATCA-TCGTAGAATGTAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAAGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTTCACATGGAGAAGGACCCCGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCAACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGATATCGAGTATGCCGTCCCTTTTCTTTC-----AAATGG-ACGGTTGCATCCACCTGGTGCATCCTCTGAGCGCGCCGTCA-GTCTCT-GGCGTAT--CGCGATGAGGGGCA-TTTTTGGATGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAGTTCCAACTCC------ATGACGCACATCC-AGTGTCCCTAT------CTCGGTTACAGCAAGCTAACAAATCTTACAGGAAGCCGCCGAACTC Embellisia_tellustris_CBS538_83 TATCGTCTTCCGCAATGCGTACGTCTTT-CCCACTCCATCGATATAGCAACTATCAAGCTGACCGC-ATGCCATAGCATCGAGCACAATGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCGCGTACA--TTCAAAACAG----TCATAG-CCATCCG-ATTCGCGACA-TCACTCCTTGCGATGCGAT-AGAGCTACTGCATGA-TCGCAGGACATAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGACATCAAGGTTGACGGCAACAACCTGACAGTCAATGGTAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAATATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCTAAGAAGGTTGTCATCTCTGCTCCCTCAGCTGATGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCTGACATTGAGTACGGCATTACCTCTCTTTC-----ACGCGC-ATGGTGGCAATCATCCGGTGCATCCTCTGAGCGCTTAGCCA-TTTGTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACCCCAACACC------ATGACGCACATCC-AATTTCCCTTT------TTTGGCCACAGCATGCTAACAAGCTTCATAGGAAGCCGCTGAGCTC Embellisia_tumida_CBS539_83 CATCGTCTTCCGCAATGCGTGGGTTCCA-CCCGTTCTATTGATACAATGAATTGGAAGCTGACTGC-ATGTCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCGGTAAGCTTC-CCTGAGCACA--CACAATACAA----CTAAAG-CCATCCA-TCTCGCGATC-TCAGTCTTCGCAATGCGAC-GGAGCTATTGCATCA-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACTATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCTTCCGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGCATCCCTTTTCTTTC-----ACACGG-ACAGTTGCATCCACCTGGTGCGTCCTCTGAGCGCGCAGTCA-GTCTTT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGCCCGCATGCGG-CGTTCGC--GAATGCCAACACC------ATGACGCACATCC-AATGTCCCCAT------CTCGGCCACAGCAAGCTAACAAGCCTTATAGGAAGCTGCCGAACTC Nimbya_caricis_CBS480_90 TATCGTCTTCCGCAATGCGTAGGTTTA--CCCACTCCATCAATACCGCAACATCAAGACTGACTGC-ATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCGCGTACA--TACAACACAG----TCACAACCCATCAT-CCTCGCGAAA-CCAGTCCCAGAGATGCGATCAAAGCTACTACATGG-TCACAGAACGTAGGCTAACACA--CATAGGCCTACATGCTCAAGTATGACAGCACACATGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCTGACGCTCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCTGACATCGAGTACGACATCACTTTTCTTCC-----ACATGA-ATGGTCGCTACCTCCCGGTGCATCTTTTGAGCGCGCAGCCA-TTTCCT-GGCTTAT--CGCAATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGTTTGCAG-CTTTCGC--GAACCCCAACACCCT----ATGACGCATATTC-AATTTTCCCAT------TTCGGCCACAACATGCTAACGAGCCTCACAGGAAGCCGCCGAGCTC Nimbya_gomphrenae_CBS108_27 TATCGTCTTCCGCAATGCGTAAGTTTCG-CCCAACTCGTCGATACAAT-CTACCAAAGCTGACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCTTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACC--TACACTACAG----CCGCGG-CCATCCA-AATTGCGAAA-ACAGTTCTTGCGATGCGCT-AGAGCTCCT--GTGG-TCGCAGAATGCAGGCTAACACA--TTCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACTGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATTTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTTATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTATGGCATCACTTTTCTTTC-----ACGCGG-CCTGTTGCGCCCACCCGGTGCTTTCTCTGAGCGCGTAGCCA-AAGCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGATGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACTCCAACGCC------ATGACGCACATGT-AATTTCCCCAT------TCTGGCCACAGCGAGCTAACAAGTCTCACAGGAAGCCGCCGAACTC Nimbya_scirpicola_CBS481_90 TATCGTCTTCCGCAATGCGTAGGTTCCA-CCCACTCCATCGATACAGTAGCATCGGAACTGACAGC-ATGCCCCAGCATCGAGCACAACGACGTCGACATTGTCGCCGTCAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTC-CCCACGTACC--TACAATACAC----TCATAG-TCAACCT-CCTCGCGACA-TTAGTCTT---GTGACGAT-GCATCTACCGTGTGCTTCGCAGAACGCAGGCTAACAAA--CATAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTTAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACTGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCCCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCCGCCGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACGTACAAGTCTGACATTGAGTATGGCATCACTTTTCTTTC-----ACATGG-ATGGCCACAACCACCTGGTGCGTCTTCCGTGCGAATAGCCA-TTTCCTTGGCATAT--CGCATTGGAGGGGCATTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACACGCTAGCGCTAGTCCGCATGCAT-CTTTCGC--GAAGCCCAACACC------ATGACGCACATCC-AATCTGCTTAT------TTTGGCCACGACATGCTAACAAGTCGCACAGGAAGCCGCCGAACTC Pleospora_tarda_CBS714_68 TATCGTCTTCCGCAATGCGTAAGTTTGA-TTGAACCCGTCAATTCTGCCATATCAAAACTAACCGC-GTCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAAGTATC-CCCGGATACA--AGACAGTCTT----CCCGAA-AATCCGC-TGCGCGTTCC-ATCCGATCGCGGGCGGTTG-GGGGCCATTTGTTGC-TAGTATATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCCACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCCGCTGATGCCCCCATGTTCGTCATGGGTGTCAATCACGAGACATACAAGTCCGACATCGAGTACGACATCACTTTTCTTTC-----ACCCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTCAT--CGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CCTTCGC--GAACCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Sinomyces_alternariae_CBS126989 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Stemphylium_herbarum_CBS191_86 TATCGTCTTCCGCAATGCGTAAGTTTGA-TTGAGCCCGTTAATTCTGCCATATCAAAGCTAACCGC-GTCTCACAGGGTCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCCGTAGGTATC-CCCGGATACA--AGACAGTCTT----CCCGAC-AATCCGC-TGCGCGTTC--CATATGATCGCGGCGGTTG-GAGGCCATTTGTTCC-TAGTGGATTGCAGGCTAACGTCCATGTAGGCATACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGTGAGATCAAGGTCGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCCTACTACGTCGTCGAGTCGACTGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGCGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACATACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACTCGC-AAAGTCGCCGCCACCTGGTGCATCTTCTGAGCGCGCAGCCA-TTTTCT-GGCTTAT--GGCGAAGAGGGGCACAAAATGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATTCGG-CCTTCGC--GAATCGCAACACC------ATGACGCACATGC-AAAATCCCATC------GTATGCTGCACGGTGCTAACAAGCCTCATAGGAAGCCGCCGAGCTC Teretispora_leucanthemi_CBS421_65 TATCGTCTTCCGCAATGCGTAGGTTGCA-CCCGCTCCGCTGATACAAGTGCATCAAAGCTGACCGT-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACCCGCACTACAGCCAAAGCCACAG-CCATGCA-ACTCGCGACA-TCAGTCCTTGCGACGCGCT-AGAGATCCTCCACGG-TTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTTGTCATGGGTGTCAACCATGAGACTTACAAGTCCGACATCGAGTACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Teretispora_leucanthemi_CBS422_65 TATCGTCTTCCGCAATGCGTAGGTTGCA-CCCGCTCCGCTGATACAAGTGCATCAAAGCTGACCGT-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATTGAGCCCCACTACGCTGTAAGCCTT-CCCAAGCACCCGCACTACAGCCAAAGCCACAG-CCATGCA-ACTCGCGACA-TCAGTCCTTGCGACGCGCT-AGAGATCCTCCACGG-TTGCAGAATGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTACGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACTGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTTGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTTGTCATGGGTGTCAACCATGAGACTTACAAGTCCGACATCGAGTACGATATCACTTTCTTC-------ACATCG-ACCGTCGCATCCATTCGATGCGTTCTCTGAGCGCCCAGCCA-CTTCCT-GGCTTAT--CGCGACGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AACTTCGCCAT------TTTGGCTACAGTACGCTAACAAGCCTAACAGGAAGCCGCCGAACTC Ulocladium_arborescens_CBS115269 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_atrum_CBS195_67 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAATGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytis_CBS198_67 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_botrytisCBS197_67 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_brassicae_CBS121493 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cantlous_CBS123007 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAATCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACGCACGGCCAGTTCAAGGGTGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCTGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACATAG-ACAGTCGCGCCCACCTAGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCTGAACTC Ulocladium_capsicuma_CBS120006 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_chartarum_CBS200_67 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_consortiale_CBS104_31 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_cucurbitae_CBS483_81 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_multiforme_CBS102060 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGTAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCTTTT------ACATGG-ACAGTCGCATCCACCTGGTGCATTCTTTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_obovoideum_CBS101229 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_oudemansiiCBS114_07 TATCGTCTTCCGCAATGCGTAGGTTTCA-CACACTTCATCGATACAATTACATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGTTTC-CCCAACTACA--CACGATACAG----CCATAC-CCGTCCA-CCCCGAGACA-TCAGTTCTCGCGATGCGAT-AGAGCTGTTTCGTGG-TCGCAGAACGCAGGCTAACACA--CACAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGATGGCAACAACCTCACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGCGTCAACCACGAGACCTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACATGG-ACAGTTGCATCCACGCGGTGCATCCTCTGAGCGCTCAGCCA-ATTCCT-GGCTTAT--CGCGATGAGGGGCATTTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAGTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCCAT------TTTGGCTACAGCATGCTGACAAGCCTCATAGGAAGCCGCCGAACTC Ulocladium_septosporum_CBS109_38 TATCGTCTTCCGCAATGCGTAGGTTTCA-CCCATTCCATTGATACAATTGTATCAAAGCTAACCGC-ATGCCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTT-CCCAAGCACC--CACACTACAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGAGCTACTCCACGG-TCGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTTCTTTC-----ACACGG-ACAGTCGCATCCACCCGGTGCATGCTCTGAGCGCTCAGCCA-TTTCCT-GGCTTATCGCGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTATTCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCT-AATTTCCCTAT------CCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAGCTC Ulocladium_solani_CBS123376 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCTGTTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AGTCGCGACA-CCAGTCCTTGTGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATTGAGTACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_subcucurbitae_CBS121491 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCTGTTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AGTCGCGACA-CCAGTCCTTGTGATGCGCT-AGAGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGATATTGAGTACGACATCACTTTTCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATCCGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Ulocladium_tuberculatum_CBS202_67 TATCGTCTTCCGCAATGCGTAAGCTTCA-CCCGCTCCATTGATTCAATTGTATCAAAGCTAACCGC-ATGTCACAGTATCGAGCACAACGACGTCGACATTGTCGCCGTAAACGACCCCTTCATCGAGCCCCACTACGCTGTAAGCTTC-CCCAAGCACT--CAAACTATAG----CCATAG-CCATCCA-AATCGCGACA-TCAGTCCTTGCGATGCGCT-AGGGCTACTCCACGG-TTGCAGATTGCAGGCTAACACA--TCCAGGCCTACATGCTCAAGTATGACAGCACACACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGTTTCCACATGGAGAAGGACCCCGCCAACATCCCATGGAGCGAGACCGGCGCTTACTACGTCGTTGAGTCCACCGGTGTCTTCACCACTACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCCCCCATGTTCGTCATGGGTGTCAACCACGAGACTTACAAGTCCGACATTGAGTACGACATCACTTTCCTTTC-----ACATGG-ACAGTCGCATCCACCTGGTGCATTCTCTGAGCGCTTAGCTA-TTTGCT-GGCTTAT--CGCGATGAGGGGCA-TTTTTGGGTGGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCGCTAATACGCATGCGG-CGTTCGC--GAACTCCAACACC------ATGACGCACATCC-AATTTCCCTAT------TCTGGCCACAGCACGCTAACAAGCCTCACAGGAAGCCGCCGAACTC Undifilum_bornmuelleri_DAOM231361 TATCGTCTTCCGCAATGCGTAGGTTGCA-CCCATGCCATCGATACGGTCGTGCCAAAGCTAACCCCAATGCCACAGCATCGAGCACAACGACGTCGACATTGTCGCCGTGAACGACCCCTTCATCGAGCCTCACTACGCTGTAAGCTTT-CCAGAATACA--CCCAATTCAG----TCCTAG-CCATCCG-CCTCGCGACA-TCAGTCCTTGCAATGCGCT-AGAGCTGCTCCACAG-TCGCAGAATGCAGACTAACACA--TGCAGGCCTACATGCTCAAGTATGACAGCACCCACGGCCAGTTCAAGGGCGAGATCAAGGTTGACGGCAACAACCTGACCGTCAACGGCAAGACCATCCGCTTCCACATGGAGAAGGACCCCGCCAACATTCCATGGAGCGAGACCGGCGCTTACTATGTCGTCGAGTCCACCGGTGTCTTCACCACCACCGAGAAGGCCAAGGCTCACTTGAAGGGTGGAGCCAAGAAGGTCGTCATCTCTGCTCCCTCTGCTGACGCTCCCATGTTCGTCATGGGCGTCAACCACGAGACTTACAAGTCCGACATCGAGTACGGCATCACTTTTCTTTC-----ACACGG-AATGTGGCATCCGCCCGGTGCATCCGCTGAGCGCTCAGCCA-ACTCGT-GGCTCAT--TGCGATGAGGGGCA--TTTTGGGTAGT-GGGGTTGTGCGAAC-TTTTACGCGCTAGCACTAGTCTGCATACGG-CGTTCGC--GAACTTCAACACC------ATGACGCACATCC-AATTTCCTCATTTTAGCTTTTGCAATAGCATGCTAACAAACCCCACAGGAAGCCGCCGAGCTC ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17368] TITLE SSU_Character_Matrix; LINK TAXA = Taxa3; DIMENSIONS NCHAR=1021; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Alternaria_alternantherae_CBS124392 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_alternata_CBS916_96 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_anigozanthi_CBS121920 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTATCCAATCCCGACACGGGGAGATAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_arborescens_CBS102605 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_argyranthemi_CBS116530 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_armoraciae_CBS118702 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_avenicola_CBS121459 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_axiaeriisporifera_CBS118715 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_brassicae_CBS116528 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_brassicicola_CBS118699 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_calycipyricola_CBS121545 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_capsici_annui_CBS504_74 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_carotiincultae_CBS109381 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_cheiranthi_CBS109384 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTTACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_chlamydospora_CBS491_72 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_cinerariae_CBS116495 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_conjuncta_CBS196_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_cumini_CBS121329 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTAACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTGTCAATACGACGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_dauci_CBS117097 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_daucifolii_CBS118812 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_dianthicola_CBS116491 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_elegans_CBS109159 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_ellipsoidea_CBS119674 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_eryngii_CBS121339 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_ethzedia_CBS197_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gaisen_CBS632_93 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_geniostomatis_CBS118701 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATGTCAATACGACGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGTT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_gypsophilae_CBS107_41 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_helianthiinficiens_CBS117370 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_helianthiinficiens_CBS208_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCCGTTGTCAGAGGTGAAATTCTTGGATTTACGGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_infectoria_CBS210_86 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_japonica_CBS118390 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_juxtiseptata_CBS119673 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_limaciformis_CBS481_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_limoniasperae_CBS102595 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_longipes_CBS540_94 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCTGGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_macrospora_CBS117228 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGTCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGACCTTCCTTTTAGCGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAACTAAGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_mimicula_CBS118696 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_molesta_CBS548_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_mouchaccae_CBS119671 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_nepalensis_CBS118700 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_nobilis_CBS116490 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_oregonensis_CBS542_94 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCGACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGCAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTCAAATCTCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAACTTGGGCCTGGCTGGCGGGTCCGCCTCACCGCGTGCACTCGTCCGGCCGGGCCTTCCTTCTGAAGAACCTCATGCCCTTCACTGGGCGTGCT-GGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCTTTGCTCGAATACGTTAGCATGGAATAATAAAATAGGGCGTGCGTTTCTATTTTGTTGGTTTCTAGAGACGCCGCAATGATTAACAGGAACAGTCGGGGGCATCAGTATTCAGTTGTCAGAGGTGAAATTCTTGGATTTACTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCGTAAACTATGCCGACTAGGGATCGGGCGATGTTCTTTTTCTGACTCGCTCGGCACCTTACGAGAAATCAAAGT Alternaria_panax_CBS482_81 TATACCGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAATACCTTACTACTTGGATAACCGTGGTAATTCTAGAGCTAATACATGCTGAAAATCCCAACTTCGGAAGGGATGTGTTTATTAGATAAAAAACCAATGCCCTTCGGGGCTTTTTGGTGATTCATGATAACTTTACGGATCGCATAGCCTTGCGCTGGCGACGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAAGGTATTGGCTTACCATGGTTTCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAATGAGTACAATTTAAACCTCTTA