#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:43 GMT TreeBASE (cc) 1994-2008 Study reference: Oh S., & Potter D. 2005. Molecular phylogenetic systematics and biogeography of tribe Neillieae (Rosaceae) using DNA sequennces of cpDNA, rDNA, and LEAFy. American Journal of Botany, 92: 179-192. TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S1440] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=37; TAXLABELS Lyonothamnus_floribudnus Neillia_affinis_144 Neillia_gracilis_255 Neillia_sinensis_140 Neillia_sinensis_149 Neillia_sparsiflora_264 Neillia_thibetica_145 Neillia_thibetica_169 Neillia_thyrsiflora_170 Neillia_thyrsiflora_254 Neillia_thyrsiflora_258 Neillia_uekii_152 Neillia_uekii_168 Physocarpus_alternans_175 Physocarpus_alternans_253 Physocarpus_amurensis_265 Physocarpus_capitatus_082 Physocarpus_capitatus_155 Physocarpus_capitatus_184 Physocarpus_malvaceus_252 Physocarpus_malvaceus_266A Physocarpus_malvaceus_266C Physocarpus_monogynus_183A Physocarpus_monogynus_183B Physocarpus_monogynus_269A Physocarpus_monogynus_269D Physocarpus_opulifolius_141 Physocarpus_opulifolius_142 Physocarpus_opulifolius_156 Physocarpus_opulifolius_164 Stephanandra_chinensis_147 Stephanandra_chinensis_172 Stephanandra_incisa_102 Stephanandra_incisa_160 Stephanandra_tanakae_162 Stephanandra_tanakae_171 Vauquelinia_californica ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=34; TAXLABELS Lyonothamnus_floribundus_050 Neillia_affinis_144 Neillia_gracilis_255 Neillia_sinensis_140 Neillia_sinensis_149 Neillia_sparsiflora_264 Neillia_thibetica_145 Neillia_thibetica_169 Neillia_thyrsiflora_170 Neillia_thyrsiflora_254 Neillia_thyrsiflora_258 Neillia_uekii_152 Neillia_uekii_168 Physocarpus_alternans_175 Physocarpus_alternans_253 Physocarpus_amurensis_265 Physocarpus_capitatus_082 Physocarpus_capitatus_155 Physocarpus_capitatus_184 Physocarpus_malvaceus_252 Physocarpus_malvaceus_266 Physocarpus_monogynus_183 Physocarpus_monogynus_269 Physocarpus_opulifolius_141 Physocarpus_opulifolius_142 Physocarpus_opulifolius_156 Physocarpus_opulifolius_164 Stephanandra_chinensis_147 Stephanandra_chinensis_172 Stephanandra_incisa_102 Stephanandra_incisa_160 Stephanandra_tanakae_162 Stephanandra_tanakae_171 Vauquelinia_californica_057 ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=78; TAXLABELS Neillia_affinis_144_A Neillia_affinis_144_B Neillia_gracilis_255 Neillia_sinensis_140_A Neillia_sinensis_140_B Neillia_sinensis_149 Neillia_thibetica_145_A Neillia_thibetica_145_B Neillia_thibetica_169_A Neillia_thibetica_169_B Neillia_thyrsiflora_170_A Neillia_thyrsiflora_170_B Neillia_thyrsiflora_170_C Neillia_thyrsiflora_254_A Neillia_thyrsiflora_254_B Neillia_thyrsiflora_254_C Neillia_thyrsiflora_258_A Neillia_thyrsiflora_258_B Neillia_uekii_152_PCR Neillia_uekii_168_PCR Physocarpus_alternans_175_B Physocarpus_alternans_175_C Physocarpus_alternans_175_D Physocarpus_alternans_253_A Physocarpus_alternans_253_B Physocarpus_alternans_253_C Physocarpus_alternans_253_D Physocarpus_alternans_253_E Physocarpus_alternans_253_F Physocarpus_amurensis_265_A Physocarpus_amurensis_265_B Physocarpus_amurensis_265_C Physocarpus_amurensis_265_D Physocarpus_capitatus_082_A Physocarpus_capitatus_082_B Physocarpus_capitatus_082_C Physocarpus_capitatus_082_D Physocarpus_capitatus_082_E Physocarpus_capitatus_155_A Physocarpus_capitatus_155_B Physocarpus_capitatus_155_C Physocarpus_capitatus_184_A Physocarpus_capitatus_184_B Physocarpus_capitatus_184_C Physocarpus_malvaceus_252_A Physocarpus_malvaceus_252_B Physocarpus_malvaceus_266_A Physocarpus_malvaceus_266_B Physocarpus_malvaceus_266_C Physocarpus_malvaceus_266_D Physocarpus_monogynus_183_A Physocarpus_monogynus_183_B Physocarpus_monogynus_183_C Physocarpus_monogynus_183_D Physocarpus_monogynus_183_E Physocarpus_monogynus_269_A Physocarpus_monogynus_269_D Physocarpus_opulifolius_141_A Physocarpus_opulifolius_141_B Physocarpus_opulifolius_141_C Physocarpus_opulifolius_141_D Physocarpus_opulifolius_141_E Physocarpus_opulifolius_141_F Physocarpus_opulifolius_142_A Physocarpus_opulifolius_142_B Physocarpus_opulifolius_142_C Physocarpus_opulifolius_156_A Physocarpus_opulifolius_156_B Physocarpus_opulifolius_156_C Physocarpus_opulifolius_164_A Physocarpus_opulifolius_164_B Stephanandra_chinensis_147 Stephanandra_chinensis_172_PCR Stephanandra_incisa_102_A Stephanandra_incisa_102_B Stephanandra_incisa_160_PCR Stephanandra_tanakae_162_PCR Stephanandra_tanakae_171_PCR ; END; BEGIN TAXA; TITLE Taxa4; DIMENSIONS NTAX=34; TAXLABELS Lyonothamnus_floribundus Neillia_affinis_144 Neillia_gracilis_255 Neillia_sinensis_140 Neillia_sinensis_149 Neillia_sparsiflora_264 Neillia_thibetica_145 Neillia_thibetica_169 Neillia_thyrsiflora_170 Neillia_thyrsiflora_254 Neillia_thyrsiflora_258 Neillia_uekii_152 Neillia_uekii_168 Physocarpus_alternans_175 Physocarpus_alternans_253 Physocarpus_amurensis_265 Physocarpus_capitatus_082 Physocarpus_capitatus_155 Physocarpus_capitatus_184 Physocarpus_malvaceus_252 Physocarpus_malvaceus_266 Physocarpus_monogynus_183 Physocarpus_monogynus_269 Physocarpus_opulifolius_141 Physocarpus_opulifolius_142 Physocarpus_opulifolius_156 Physocarpus_opulifolius_164 Stephanandra_chinensis_147 Stephanandra_chinensis_172 Stephanandra_incisa_102 Stephanandra_incisa_160 Stephanandra_tanakae_162 Stephanandra_tanakae_171 Vauquelinia_californica ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1596] TITLE LFY; LINK TAXA = Taxa3; DIMENSIONS NCHAR=2038; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Neillia_affinis_144_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGCGGTAAATACTTCGTCATTTACAACCTGCTCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CAAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TGTGTTGCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACACAATTGTTGGTGCAGAGTGCAGACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_affinis_144_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGCGGTAAATACTTCGTCATTTACAACCTGCTCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGCT-CAAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TGTGTTGCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACACAATTGTTGGTGCAGAGTGCGGACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTT-CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_gracilis_255 GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGCGGTAAATACTTCGTCATTTACAACCTGCTCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TGTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-CTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCAGAGTGCAGACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_sinensis_140_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACGAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTCTGTCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAAAACAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTTT-----CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_sinensis_140_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAATGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTCTTT---CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_sinensis_149 GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAATGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTCTTT---CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thibetica_145_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACACTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGAATCTAGGAGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCATAAAAA-------ATAC---TAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAA--GGCTTATTTATTGATATGCCCCCTGGAACATCACATTTGTTCCACTTTGCCCCATGAAATTTTAAATGGGTCACTTAACCCCCTGGACCACCATAACGTGTATCACTTTGCCCCCTGTAACTTTAAATAGGTCACTTAACCCCTGAACCACCATACCATGTATCACTTTGCCCCCTGGACCACCACCATACCGTGTATCACTTTGCCGTCTTGGCTTAATCCTTTCAAATATATACATACCTAACCACTGTATTCACCAAAATTCTGGAATGAAAAAGAAACAATTCTATTTTTCTCTCCTCTGTTTTCTATTGTCTATGTCCTGTTTAAAATCTTTTACTTTGAACGAGAACTCACACTAAACAATAGTGACTATTTCTTGTTTTAAGGGGCTTTTGGAATGAGAAAGAAACGACATAGCCCTGATTCAGGAAGATAATGTACAATGTAATTTCGGGTTTCTGGTTAGTAAATAGGGTTATGTTGTTTGTTTCTGAATAAGGAAGATGATGTACAATGTAAGCACCTTATTACCCTCAAAGTTAACGATTCAATTGACGGAATTGGCGTGAAATGACAAAGGGATACACGGTATGGTGGTCTAGGAGGTTAAGTGACCCATTTAAAGTTCCAGGGGGCAAAGTGATACATGGTATGGTGGTCAGGGGGTTAAGTGACCCATTTAAAGTTTCAGGGGGCAAACTGGAACAAATGTGATGTTTCAGGGGGCATATCAATAGATAAGCCTAGAAAAAAACACTTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTT------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thibetica_145_B GCGGTGAGAAATGTCCCACCAAGGTACGGATTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATTAATTTCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------CGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTGCAACAACCCTAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAA--TGCTTATTTATTGATATGTCCCCTGGAACATCACATTTGTTCTACTTTGCCCCCTGAAATTTTAAATGGGTCACTTAACCCCCTGGACCACCATAACGTGTATCACTTTGCCCCCTGCAACTTTAAATAGGTCACTTAACCCCTGAACCACCATACCATGTATCACTTTGCCCCCTGGACCACCACCATACCGTGTATCACTTTGCCGTCTTGGCTTAATCCTTTCAAATATATACATACCTAACCACTGTATTCACCAAAATTTTGGAATGAAAAAAAAACAATTCTATTTTTCTCTCCTCTGTTTTCTATTGTCTATGTCCTGTTTAAAATCTTTTACTTTGAACGAGAACTTACACTAAACAATAGTGACTATTGCTTGTTTTAAGGGGCTTTTGGAATGAGAAAGAAACGACATAGCCCTGATTCAGGAAGATAATGTACAATGTAATTTCGGGTTTCTGGTTAGTAAATAGGGTTATGTTGTTTGTTTCTGAATAAGGAAGATGATGTACAATGTAAGCACCTTATTACCCTCAAAGTTAACGATTCAATTGACGGAATTGGCGTGAAATGACAAAGTGATACACGATATGGTGGTCTAGGAGGTTAAGTGACTCATTTAAAGTTCCAGGGGGCAAAGTGATACATGGTATGGTGGCCAGGGGGTTAAGTGACCCATTTAAAGTTTCAGGGGGCAAACTGGAACAAATGTGATGTTTCAGGGGGCATATCAATAGATAAGCCTAGAAAAAAACACTTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCCATAATTTGAAATGTTTTTTTGTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thibetica_169_A GCGGTGAGAAATGTCCCACCAAGGTACGGATTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATTAATTTCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------CGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCCTAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAA--TGCTTATTTATTGATATGTCCCCTGGAACATCACATTTGTTCTACTTTGCCCCCTGAAATTTTAAATGGGTCACTTAACCCCCTGGACCACCATAACGTGTATCACTTTGCCCCCTGCAACTTTAAATAGGTCACTTAACCCCTGAACCACCATACCATGTATCACTTTGCCCCCTGGACCACCACCATACCGTGTATCACTTTGCCGTCTTGGCTTAATCCTTTCAAATATATACATACCTAACCACTGTATTCACCAAAATTTTGGAATGAAAAAAAAACAATTCTATTTTTCTCTCCTTTGTTTTCTATTGTCTATGTCCTGTTTAAAATCTTTTACTTTGAACGAGAACTTACACTAAACAATAGTGACTATTGCTTGTTTTAAGGGGCTTTTGGAATGAGAAAGAAACGACATAGCCCTGATTCAGGAAGATAATGTACAATGTAATTTCGGGTTTCTGGTTAGTAAATAGGGTTATGTTGTTTGTTTCTGAATAAGGAAGATGATGTACAATGTAAGCACCTTATTACCCTCAAAGTTAACGATTCAATTGACGGAATTGGCGTGAAATGACAAAGTGATACACGATATGGTGGTCTAGGAGGTTAAGTGACTCATTTAAAGTTCCAGGGGGCAAAGTGATACATGGTATGGTGGCCAGGGGGTTAAGTGACCCATTTAAAGTTTCAGGGGGCAAACTGGAACAAATGTGATGTTTCAGGGGGCATATCAATAGATAAGCCTAGAAAAAAACACTTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCCATAATTTGAAATGTTTTTTTGTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thibetica_169_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACACTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------CGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCCTAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAA--TGCTTATTTATTGATATGTCCCCTGGAACATCACATTTGTTCTACTTTGCCCCCTGAAATTTTAAATGGGTCACTTAACCCCCTGGACCACCATAACGTGTATCACTTTGCCCCCTGCAACTTTAAATAGGTCACTTAACCCCTGAACCACCATACCATGTATCACTTTGCCCCCTGGACCACCACCATACCGTGTATCACTTTGCCGTCTTGGCTTAATCCTTTCAAATATATACATACCTAACCACTGTATTCACCAAAATTCTGGAATGAAAAAGAAACAATTCTATTTTTCTCTCCTCTGTTTTCTATTGTCTATGTCCTGTTTAAAATCTTTTACTTTGAACGAGAACTCACACTAAACAATAGTGACTATTTCTTGTTTTAAGGGGCTTTTGGAATGAGAAAGAAACGACATAGCCCTGATTCAGGAAGATAATGTACAATGTAATTTCGGGTTTCTGGTTAGTAAATAGGGTTATGTTGTTTGTTTCTGAATAAGGAAGATGATGTACAATGTAAGCACCTTATTACCCTCAAAGTTAACGATTCAATTGACGGAATTGGCGTGAAATGACAAAGGGATACACGGTATGGTGGTCTAGGAGGTTAAGTGACCCATTTAAAGTTCCAGGGGGCAAAGTGATACATGGTATGGTGGTCAGGGGGTTAAGTGACCCATTTAAAGTTTCAGGGGGCAAACTGGAACAAATGTGATGTTTCAGGGGGCATATCAATAGATAAGCCTAGAAAAAAACACTTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTT------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_170_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-GGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTTCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGG---CGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCAAAATCACTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGGCCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_170_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-GGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTTCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGG---CGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCAAAATCACTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGGCCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTT--------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAGGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_170_C GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGGCACGTTCAATATAAATGTT-GGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTTCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGG---CGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCAAAATCACTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGGCCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_254_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTATAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAATAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_254_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTATAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTGCAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_254_C GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTATAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_258_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_258_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTT--------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_uekii_152_PCR GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACCTTCAATATATATGTT-CGAACT--AAATCTGGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTCCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTATAGAAAACACTTTCA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCGTCTCCAACAACCATCAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATCTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTTTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTGTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTATTTT----CTAACATTAACAACTGTCGTGGGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_uekii_168_PCR GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACCTTCAATATATATGTT-CGAACT--AAATCTGGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTCCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTATAGAAAACACTTTCA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCGTCTCCAACAACCATCAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATCTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTTTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTGTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTATTTT----CTAACATTAACAACTGTCGTGGGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_175_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTGACAACCTGATCTTTGTGGGCTAATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGTCACTTAGCACTACGGTT-------------TAGTAGGATTTTTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTATGTGGCTTAGTCTAATTCTCACCC-TTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTAGTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCTAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_175_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAG-CCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------TAGTAGGATTTTTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTATGTGGCTTAGTCTAATTCTCACCC-TTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_175_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTGACAACCTGATCTTTGTGGGCTAATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGTCACTTAGCACTACGGTT-------------TAGTAGGATTTTTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTATGTGGCTTAGTCTAATTCTCACCC-TTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTAGTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCTAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGTAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCATTACGGTT-------------TAGTAGGATTTCTCTTCACTTGTAAGTCAAAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCTTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTCTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCATTACGGTT-------------TAGTAGGATTTCTCTTCACTTGTAAGTCAAAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCTTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTCTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAGTTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCATTACGGTT-------------TAGTAGGATTTCTCTTCACTTGTAAGTCAAAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCTTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTCTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCATTACGGTT-------------TAGTAGGATTTCTCTTCACTTGCAAGTCAAAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCTTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTCTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253_E GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCATTACGGTT-------------TAGTAGGATTTCTCTTCACTTGTAAGTCAAAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCTTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATGGTGCGTTTACTAATCGGGTATGAAATTAGAAGGTATGGGTATGAGGGTGGGAAGGTATGGGTATGAGATAAACAACCCCCCCTTAGGTATGGGATACCTGATAAAATCAGGTATGAGAGGATATGGAAGGCAAAAAATTCATGTGGGCCCCATATATTAATTGATTTCTTAGGTGAAGTAAACATAGGATATGCAAGGTATGGGTATCATACCCATACCTTGCATACCCATACCTTGTAAGTAAACACACCATTATTGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253_F GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAG-CCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGTCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------TAGTAGTATTTCTCTTCATTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGTTTAGTCTAATTTTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAGCATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATGGTGCGTTTACTAATCGGGTATGAAATTAGAAGGTATGGGTATGAGGGTGGGAAGGTATGGGTATGAGATAAACAACCCCCCCTTAGGTATGGGATACCTGATAAAATCAGGTATGAGAGGATATGGAAGGCAAAAAATTCATGTGGGCCCCATATATTAATTGATTTCTTAGGTGAAGTAAACATAGGATATGCAAGGTATGGGTATCATACCCATACCTTGCATACCCATACCTTGTAAGTAAACACACCATTATTGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_amurensis_265_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATGAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTTGAGTAGTATTGTTGAGTAGTATTTTTCTTCACTTATAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--TTAATTTAGGAACTTTGGATTCCTTTGAAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAGCAAAAGCATTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAACACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTTGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATAATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_amurensis_265_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATGAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTTGAGTAGTATTGTTGAGTAGTATTTTTCTTCACTTATAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---TTAATTTAGGAACTTTGAATTCCTTTGAAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAGCAAAAGCATTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAACACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTTGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATAATTAGAAGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_amurensis_265_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATGAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTTGAGTAGTATTGTTGAGTAGTATTTTTCTTCACTTATAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAT---TTAATTTAGGAACTTTGAATTCCTTTGAAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAGCAAAAGCATTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAACACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTTGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATAATTAGAAGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_amurensis_265_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATGAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTTGAGTAGTATTGTTGAGTAGTATTTTTCTTCACTTATAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAT--TTAATTTAGGAACTTTGAATTCCTTTGAAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAGCAAAAGCATTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAACACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTTGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATAATTAGAAGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_082_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAACTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_082_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAAAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACGTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAATCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_082_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAAAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCGTAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACGTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_082_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCCTCAATATAAATGTTTTGAGCT--AGCTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAACTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_082_E GCGGTGAGAAATGTCCCACCAAGGTACAGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTTACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCCGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAACTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_155_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGATTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------TACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_155_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGATTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------TACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_155_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGATTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------TACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_184_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_184_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--GTAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGATC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAAGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_184_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGATC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_252_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGTTCATTGTGTGACTTAGTCTAATTCTCACCCCTTTAATGTAAATATCATTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_252_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGTTCATTGTGTGACTTAGTCTAATTCTCACCCCTTTAATGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_266_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGTTCATTGTGTGACTTAGTCTAATTCTCACCCCTTTAATGTAAATATCATTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGTAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_266_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGTTCATTGTGTGACTTAGTCTAATTCTCACCCCTTTAATGTAAATATCATTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTGAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_266_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCTATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_266_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGCCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ACTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCTATAGGTGAATGTTTTCTTTTT-GTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAGGTCTTAGGTTCAAGTCTCGGCAAGTCCATTGTGTAGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-AACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGTGAATGTTTTCTTTTTTGTTCTAC-GTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTAGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGAAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCGCTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAAAACTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCTGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTAGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGAAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGGTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACA-CAAAAGCACTCGGGAGTGCTCCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTCACTTATTATATGTGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAGGTCTTAGGTTCAAGTCTCGGCAAGTCCATTGTGTAGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-AACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGTGAATGTTTTCTTTTTTGTTCTAC-GTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183_E GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTAGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGAAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAAT-CACTTTTACCTATAAATACTTCTTTTACTAAAAGCACACCAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTCTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTA?CGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_269_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAATCTCGGCAAGCCCATTGTGTAGCTTAGTCTAAATATCACCCCTTTAGTGTAAATATTGTTGTATTTTAAAAAAAAAA-CGAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGACTACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCTAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_269_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAAATATCACCCCTTTAGTGTAAATATTGTTGTATTTTAAAAAAAAAA-CGAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGACTACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCGTTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGGTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATTCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTATACAGTTTGAAGCGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAA----CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTATACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTGCTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141_D GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATC----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141_E GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGGTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTGA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTATACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141_F GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGCTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTATACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_142_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_142_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_142_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGGCAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_156_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGACCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GGATAGTATTTCTCTTCACTTGTAAGTTAGAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTATAAATATTGTTGTATTTAAAAAAAAAAAACTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCATTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAA-GTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AATTAACATTAACAATTGTCGTAAGTACTAACGGTGC----ATAATAATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_156_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGACCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTCACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAAGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCTCTTTAGTGTAAATATTGGTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTCTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTGTT----------AACTAACATTAACAATTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_156_C GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGACCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGA{AG}GTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCTCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAAAACTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTCTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTGCAGTTTGAAGTGTTGTT----------AACTAACATTAACAATTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_164_A GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATGGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAATAGTATTTCTCTTCACTTGTAAGTTAGAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTATAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCATTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATAGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCGTAAGTACTAACGGTGC----ATAATAATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_164_B GCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGACCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAGGTTTTAGGTTCAAATTTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTATAAATATTGTTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCATTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTAT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTATCCGATAGGCGAATGCTTTCTTTTTTGTTCTACAGTTTGAAGTGTTGTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_chinensis_147 GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGGCACGTTCAATATAAATGTT-CGAACTATAAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTT---------------ACAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTAAAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACTCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTCCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_chinensis_172_PCR GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGGCACGTTCAATATAAATGTT-CGAACTATAAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTT---------------ACAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTAAAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACTCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTCCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_incisa_102_A GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTAT-AGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_incisa_102_B GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTAT-AGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTAAAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAA--ATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_incisa_160_PCR GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTT{AC}GTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTAT-AGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTA{AC}AAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTG{AC}A-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_tanakae_162_PCR GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCGTCCCTAC---GTTTATACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGACCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTAGGGTTCGTTTGGGATTATTTCTAT-AGGAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCGTGGGTAAAGACCAAATGTTGACCCA-----CTAATAATTAATCAGTCTTCTTCTCTTTCATAGTTAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAGTTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_tanakae_171_PCR GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCGTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGACCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTAGGGTTCGTTTGGGATTATTTCTAT-AGGAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCGTGGGTAAAGACCAAATGTTGACCCA-----CTAATAATTAATCAGTCTTCTTCTCTTTCATAGTTAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTT------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1597] TITLE 'Oh_rDNA'; LINK TAXA = Taxa4; DIMENSIONS NCHAR=1119; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Lyonothamnus_floribundus TCGATACCTGCGTAGCAGAACGACCCGAGAACCAGTCAAAA-CGTCGAGGG-CCGGGGGGCCTTGCGGCTCCTCGTCCCCTTATC-TCGGGAGGCGACCACCGCCAACGCGGCCGA---CCCTCCCGGGCGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAATTTGAACGAAAGTGCGCGCTCCCGTCGCCCCGGAAACGGTGCGCGTTCGGG-CAGCGTCGTCATCTTCAA----TATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC-----GCAACTCCCACGGGAACGCGAGG--GGACGGATGATGGCCTCCCGCGCGCTTTGCCGCTCGGCTGGCACAAATACCAAGTCCACGGCGACGGCCGCCA-CGACAATCGGTGGTTGCGAAA---CCTCGGTGCCCTGTCGTGCGCGGGCGTCGCGTTTCGCG-GGCTCGCGAAAAACAACTCTTCGCTCCGGCGAAGCTTTCAACATGGTCTGGCAGGCTCCGTGCTTCGGCATCGAACTGTTGGCTCCATACCCCTCGTCAGTG-ATGCAACAAGATT---TTCTTGTGCTAG-CAACGGATTCCTGTTTTGGCTACCTATTGTAACGGAATGGCGCTTCTCGATGTCCCTTTCCTTCTCTCGCC--CTCTCAGGGCTGTAGGAGGACACTGTAGCGGCTCTCGTGTCCCGATCAAGCCATGCATTGTCGTGAGATTGTGACGGTCCACGAGTTGTTGCTCGACTTCTCGGATGCGGAACATAAAGCCGACGTTGGGGGTCTTT--GACCCTCGATTGTCCAATCGATAGCCTTTGTCGCTTTACACGCACGACAGCCGCGCTCGCTGAGAGCTCCTCCGGCCCACAAGGTCGTTGGTTCTTGCACGGGCGTCGGCGTCGGAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_affinis_144 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAAATGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCGCACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGATGCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_gracilis_255 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-GGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCATCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGG{GT}CGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGATGCGTACGACTGCCGT{CG}GCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGTCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_sinensis_140 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGA{GT}GGGCC{AT}CGCGCCCT-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCACCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCG{AG}G-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGA{CT}GCGTACGACTGCCGT{CG}GCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGTCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_sinensis_149 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCCC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAA{AC}CGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCA{AC}CTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGGGCGCCA-CGACGATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCA{CT}GAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGA{CT}GCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGTCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_sparsiflora_264 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCATCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCGCACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGATGCGTACGACTGCCGTCGCTGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CG{CT}CGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_thibetica_145 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCGA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGAC{CT}CGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_thibetica_169 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCGA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGAC{CT}CGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCT{CT}CGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_thyrsiflora_170 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-GCTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAACCGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAGCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCCTAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTAAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--C-CCCGCGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACCTGGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCG{AC}TGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_thyrsiflora_254 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAACCGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC{AC}-TCCGCA{CG}CTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGC{CT}CCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTC{GT}GTGGCCTGCCGTG{CT}GCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACCTGGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGTTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_thyrsiflora_258 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAACCGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAGCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCG{CT}GCGGTTGGCCTAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTAAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACCTTGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_uekii_152 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-GGGAGGGGCCTCGCGCCCC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC-GGGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAACCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Neillia_uekii_168 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-GGGAGGGGCCTCGCGCCCC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC-GGGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAACCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_alternans_175 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GCGGGCGAAAGCCCTC{CT}-GGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_alternans_253 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GCGGGCGAAAGCCCTCC-GGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_amurensis_265 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTGACGCTCGGGGG-AGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAACTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGTTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAGGCCTCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_capitatus_082 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGG-AGG-GGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGTTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTTGCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_capitatus_155 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGG{AG}GGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTTGCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_capitatus_184 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTCTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAACTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTACAAAACCCCCC-GTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGTTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGT{GT}GCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_malvaceus_252 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTCTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-A{CG}GGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_malvaceus_266 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-A{CG}GGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_monogynus_183 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_monogynus_269 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGG-AGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTG{CT}CCGCTGCGGACT--{CT}TCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_opulifolius_141 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCTGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCTTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGGCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_opulifolius_142 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCTGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGGCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_opulifolius_156 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAAGTGGCCTCCCGTGCGCCCCGCCGCGCGG{AT}TGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTC{CT}TGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Physocarpus_opulifolius_164 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTAGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCC{CT}GCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGGCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Stephanandra_chinensis_147 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGCC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCT{GT}AACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACATCGTTGCCCCCCC-TCCGCA{CG}CTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCAGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTC{AG}TGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGAC{AC}CAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGC{CT}GTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Stephanandra_chinensis_172 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCTT--ATGTC------------CCG-----GCGGGCGA---CCGTC-GGGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCT-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCT{CT}GTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Stephanandra_incisa_102 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCACCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACACAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCC{CT}GCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Stephanandra_incisa_160 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCACCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACACAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCC{CT}GCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGT{CG}GCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Stephanandra_tanakae_162 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGCC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTTGCGGGGGGCGGCGTGGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACATGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACCCGAG-GGCTCGTCGGACCCAACGCTTCGCTCCGGCGACGCTTTCAACATGCGGCGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGGTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGT--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGGGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGC-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Stephanandra_tanakae_171 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGCC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTTGCGGGGGGCGGCGTTGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACATGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACCCGAG-GGCTCGTCGGACCCAACGCTTCGCT{CT}CGGCGACGCTTTCAACATGCGGCGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTG{CG}TGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCG{CT}--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGGGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGG{CT}-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT Vauquelinia_californica TCGA-ACCTGCCCAACAGAACGACCCGAGAACCAGTTTCAA-CGTCGGGTG-CCGGGGGCCCTTCGGGCTCTCCGTCCCGT--TAATC------------CCG-----G-GAGC-A---CGCTCCCGGGCGTACAAACGAACACCGGCGCGTATTGCGCCAAGGAACCCGAAAGAAA{CG}AGCGCGCT{CT}CCGCCGCCCCGAAAACGGTGCGCGCGCGGGT--GCGTCGTCTTCTTCAATGTATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCC-TCCGCGCCTCCCTCGGGAGCGTCGGGGGGAGCGGATGATGGCCTCCCGTGCGTCACCCCGCGCGGTTGGCACAAATGCCGGGTCCTCGGCGACGAGCGCCAACGACGATCGGTGGTTGTCAAA---CCTCGGTTGCATGTCGTGGCCGCCCGTCGCGCTTCGAGCGGCTCGCGACGCACGTCGCTCTGCTTCGGCGGAGCTTTCAACATTCGACGGCAGGCTCCGTGCTTTGGCATCGAACTGTCGGCTC-GTACCCCGCTTCAGTG-ATGCATCAAGATTTGTGTCTTGTGCGCG--GTTAGGTTTCTGTTTTGGCTACCTATCGTAAAGGAATGTTGCCTCTCGTTG-TCCCTTCATCCTCTTGCTGGCCTTGCTGGCGGGAGGACGACATTGTAGCGATGCCCGTGTCCCGAACAACCCACA-GTTTTTGTGCGATTGTGTCGGTGCTCGAGTTTTTGCTTGATATCTCGGATGCGGAACACTAGAGGGACGATGGG--TCTCTATGGCCTCCTATCGTCCA-TTCGAAGCCTT-GTCGCTCGATGCGTACGACTGTTGTGCCCGTGGCGAGCG--ATCGACCTTCAAGGTCGTTTGT-CTCGCGCGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGT ; END; BEGIN SETS; CHARSET 18S (CHARACTERS = 'Oh_rDNA') = 1060-1119; CHARSET ITS (CHARACTERS = 'Oh_rDNA') = 1-632; CHARSET ETS (CHARACTERS = 'Oh_rDNA') = 633-1059; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1594] TITLE cpDNA; LINK TAXA = Taxa2; DIMENSIONS NCHAR=3196; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Lyonothamnus_floribundus_050 CTTTCCAATTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGGTTTCAGAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGGGTTGGCTGCGTTGTGTTAGGAAAGGAATCTTTCCATCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCAAATGATTAATGACGACCCGAATCTGTATTTTTT-ATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTTCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATTATTCACTCCATCATAGTCTGATAGATCT--TTTTAAGAATTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATAGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACCCGGTTGACCCCCTAATT-----ATTTA-TTTTCTCATTTTGTTAACGATTA-----AAAATTCGTTATGTTTCTCATTCATTCTCATTTTACTCTTT-----CACAAACGGATCTGAGCGGAAATTTTTTTTCTTATCACAAGCCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCAT----------ATTTAATTTGAATAATTAACAATACATA---------------------------CCAT-TACTTGTACTGAAACTTTCAAAGTCTTCTTTTTGAAGATCCAAGAAATTCTATCAGGACCGGGATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTATATTAAATTTTTTTTAAATAAAACGAGGATGATGCGTCGTGAATGATAACCATAGTAAAATAAAGTAT--------------------ACGTATTTTTATGATTTCATTCTAACCCTTTCAATTTGGATTATAATTGGCGTGTTGTAACAGAGCTGGGA--GTGATATATTGATAGCCATA----TGGATATGCGCTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGCCAAATCAATTGGATAATAAATCTTTCAATGAAAAAAGT-TTTTT-ATTTAGTCTTTTCGTTAGACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGATTCATAATTTGTTGGAAAAATAGATTAAATAAATAGT-----------------------------------------------------GGTATAGATATATCAGAACATTTTTCTCTTCC---------------CGGGGGTCGGGCAGTTCTGGAGAGCAACAAATGGGTTATATTATATCATTTCGTGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGGAAGAATCAATTCCAGACTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCACTAGACGATGGGGGCATACTTGCACGACCGCCATCATACTATGCTCATAGTATGAATAGTTTTTTTAAATTGTCAATATATATGGAATGGTATGACTCGATACGAAGGGTCTTTACATTTTTCACGATTC----TATAGAATTTTTTT------CGCTAAAAATTTGGTTCAAAAGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATGAATTTAGTTATGATGTCAATTAGGATCGGTCTTGAAACAATTCATTGTATTGATATTTATCAAATCCAATATCAATAAACCGTTTTATTTTACCTATATT-----CACTAGT---ATACC--------CCAAACC---------CTATATTAAAA----TTAAAATTCAAT-----------TTACTGGATAAAAAATATAAATAAAAATTTTCATTCCTGAATGAACCCACTATACTTATTATAAGATATATCTATGTACATATATTATAATAAGTATATATACTAAACTCATAGTGGCTTTATT-AGGAATTGGATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGATTAGGTTCGAAATTATTGGAAGAATTCTTTACGGAAGAAGACCAGATTCTTTCTTTGATCTTCCCAAGAGCTTCTTATACTTTGAAGAAGTTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGTTTATGTGACCGTGTAAAT-G--A-TC--TTTAAA-------TAATGAAGAAATAA-CAAAAAATTCAGTTATTTATATTATGTTATGAAATGTTCATGTAGTAAGAATAAGGGTTGATCAACTGAGTATTCAACTTTCTT------AGAGTCATGTATAGGGAAGGAACTGGATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCTAATTAAAAATGTGTCCCGGGCAACCCATTATAATTAGCATATCGAAATCGTGTATATATAAATCCTAATTTTTTAATTCAACTCATT--TATTC-----AAAAAAATTTAAAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTATTTCTATATTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTACCTGATGATTAATGATTAAATAATAACAAGATTTTTCCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_affinis_144 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGGAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCTAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATTAA--ATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCAAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------AATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_gracilis_255 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCTAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAAAACTTTGTAAAACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT-------------TAAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTT---CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTAAGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTT?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Neillia_sinensis_140 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_sinensis_149 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_sparsiflora_264 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGGAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCTAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_thibetica_145 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_thibetica_169 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_thyrsiflora_170 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAA-------TGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTAAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATATAGA------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCATGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTTTTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_thyrsiflora_254 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAA-------TGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTAAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATATAGATAGATATAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAAAAAATAGAGTAAATAAATAATGGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCATGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTTTTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_thyrsiflora_258 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAA-------TGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTAAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATATAGATAGATATAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAAAAAATAGAGTAAATAAATAATGGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCATGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTTTTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_uekii_152 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTTAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCCTTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Neillia_uekii_168 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTTAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCCTTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_alternans_175 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAATATTAAATAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT---AAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_alternans_253 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATATCATTACTTGTAACAATACATATCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTATACATAAATAAAATTAAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAATTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT--AAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_amurensis_265 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGCTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATTTTTATTAGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT--AAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_capitatus_082 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAA-----------------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_capitatus_155 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_capitatus_184 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_malvaceus_252 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_malvaceus_266 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_monogynus_183 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT-AAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_monogynus_269 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATATCATTACTTGTAACAATACATATCATTACTTGTACT------GAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATTTTATTATTTTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT---AAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_opulifolius_141 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_opulifolius_142 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_opulifolius_156 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Physocarpus_opulifolius_164 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Stephanandra_chinensis_147 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Stephanandra_chinensis_172 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-AT?????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Stephanandra_incisa_102 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTATTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Stephanandra_incisa_160 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTATATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT----------AAATAATGGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAAGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATA--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Stephanandra_tanakae_162 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGGGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Stephanandra_tanakae_171 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG Vauquelinia_californica_057 CTTTCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGGTTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCATCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCAAAATGATTAATGACGACCCAAATCTGTATTTTTTTATATTTATATGAAAAATGAAAGACTTGTTGTGAATCGATTAAAAATTGAAAAAAGAATCGAATATTCATTGATCAAACCATTCACTCCACCGTAGTCTGATAGATCT--TTTTAATAATTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTATACATGTTAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATTATTTATTTTAATTTTATCATTTTGTTAGCGATTCAAATCAAAATTCGTTATATTTATCATTCATTCTCATTCTACTCTTTTCTTTCACAAATGGATCTGAGCGGAAATTTTTTT-CTTATCACAAGACTTGTGTGTGATATATATGATACGCGTACAGTACAAATGA-TTTGAGCAAGGAATCC--------------ATTAAATTTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTAGAAAAT-TTATTTTTGAAGATCCAAGAAATTCTATTAGATCCTGTATAATACTTTGTAATACTTTTT-CGTTTTTCTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAAAAAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCTTTCAATTTAGATTAGAATTGGCGGGTTGTAACAGAGCCGCGAGTGTGATATATCGACACCCATA----TGTATATGTACTTTAGTGAGAGCAGCCCGGTATTACTAGTAATCCTTTCGTTATTGCCAAATCAATTGGATAATCACTCGTTCAATCAAAAAAGTTTTTTTTATTTACTCTTTTCCTTAAACTTTACTTTATAGTTACGGATCCTGATATGAATCTAGATCATTAGCAAGAT-CAGAATTTCTTGTAAAAAGAGAGTAAATAAATAGT-----------------------------------------------------GGTATAGATATATCATAAAATGGATTTCTTCCGTATTG----GGATTGGGGGATCGGGCATTTCTGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGCGGATCGGCAAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGGAAGAATCAATTCCAGGCTTATTGATAATCCACGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCAGACTTGCACGACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTCTTTCTATACAATTTTTTT------CGATAAAAGTTTGGTTCAAAGGCCACGCCGAATCTCTTTATCCGAATCTCTTTATCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGATACATGTATCACTCAAATGAATTTAGTTATGATGTCAATTAGGAT-------GAAACAATTCATTGTATTGATATTTATCAAATCCAATATCAATAAACCGTTTTATTTTACCTATATTATATACTCTAACCCTATATTAAATTATATTAAATTATTTATAAATTATATTAAA-----TTA---TTTAATATAATTTAATTTTACTGGATAAA---------GAAAATTTTTCATTCCTGAATGAACCC-TTATACTTATTATAAGATATATCTATGTACATCTATTATAATA------TATACTAAACTCATAGTGTCTTTATTCAGGAATTGGATCCGATTTGTGCATATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTATAAATTATTGGACGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTAATCTTCCCAAGAGCTTCTTATACTTTGAAGAAGTTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCGATCGTAGAAATGGAAATTCTATTTAAA-------TAATGAAGAGATAA-CAAAAAATTCA----TTTAT-TTCTATTATGAAATGTTCATCCAGTAAGATTAAGGGTTGATCAACTGAGTATTCAACTTTCTT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCTAATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCGAAATCATGTGTATATAAATCCT----------TTAAATTCATT--TATTCTAAAAAAAAAAATTCATAAATATAGATATATAATAACATAGATATCTATC------GATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTATTTCTAT-TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG ; END; BEGIN SETS; CHARSET trnDT (CHARACTERS = cpDNA) = 983-2294; CHARSET trnCF (CHARACTERS = cpDNA) = 1-982; CHARSET psbAtrnK (CHARACTERS = cpDNA) = 2295-3196; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M1595] TITLE combined; LINK TAXA = Taxa1; DIMENSIONS NCHAR=6096; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 4040 4050 4060 4070 4080 4090 4100 4110 4120 4130 4140 4150 4160 4170 4180 4190 4200 4210 4220 4230 4240 4250 4260 4270 4280 4290 4300 4310 4320 4330 4340 4350 4360 4370 4380 4390 4400 4410 4420 4430 4440 4450 4460 4470 4480 4490 4500 4510 4520 4530 4540 4550 4560 4570 4580 4590 4600 4610 4620 4630 4640 4650 4660 4670 4680 4690 4700 4710 4720 4730 4740 4750 4760 4770 4780 4790 4800 4810 4820 4830 4840 4850 4860 4870 4880 4890 4900 4910 4920 4930 4940 4950 4960 4970 4980 4990 5000 5010 5020 5030 5040 5050 5060 5070 5080 5090 5100 5110 5120 5130 5140 5150 5160 5170 5180 5190 5200 5210 5220 5230 5240 5250 5260 5270 5280 5290 5300 5310 5320 5330 5340 5350 5360 5370 5380 5390 5400 5410 5420 5430 5440 5450 5460 5470 5480 5490 5500 5510 5520 5530 5540 5550 5560 5570 5580 5590 5600 5610 5620 5630 5640 5650 5660 5670 5680 5690 5700 5710 5720 5730 5740 5750 5760 5770 5780 5790 5800 5810 5820 5830 5840 5850 5860 5870 5880 5890 5900 5910 5920 5930 5940 5950 5960 5970 5980 5990 6000 6010 6020 6030 6040 6050 6060 6070 6080 6090 6100 6110 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Lyonothamnus_floribudnus TCGATACCTGCGTAGCAGAACGACCCGAGAACCAGTCAAAA-CGTCGAGGG-CCGGGGGGCCTTGCGGCTCCTCGTCCCCTTATC-TCGGGAGGCGACCACCGCCAACGCGGCCGA---CCCTCCCGGGCGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAATTTGAACGAAAGTGCGCGCTCCCGTCGCCCCGGAAACGGTGCGCGTTCGGG-CAGCGTCGTCATCTTCAA----TATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC-----GCAACTCCCACGGGAACGCGAGG--GGACGGATGATGGCCTCCCGCGCGCTTTGCCGCTCGGCTGGCACAAATACCAAGTCCACGGCGACGGCCGCCA-CGACAATCGGTGGTTGCGAAA---CCTCGGTGCCCTGTCGTGCGCGGGCGTCGCGTTTCGCG-GGCTCGCGAAAAACAACTCTTCGCTCCGGCGAAGCTTTCAACATGGTCTGGCAGGCTCCGTGCTTCGGCATCGAACTGTTGGCTCCATACCCCTCGTCAGTG-ATGCAACAAGATT---TTCTTGTGCTAG-CAACGGATTCCTGTTTTGGCTACCTATTGTAACGGAATGGCGCTTCTCGATGTCCCTTTCCTTCTCTCGCC--CTCTCAGGGCTGTAGGAGGACACTGTAGCGGCTCTCGTGTCCCGATCAAGCCATGCATTGTCGTGAGATTGTGACGGTCCACGAGTTGTTGCTCGACTTCTCGGATGCGGAACATAAAGCCGACGTTGGGGGTCTTT--GACCCTCGATTGTCCAATCGATAGCCTTTGTCGCTTTACACGCACGACAGCCGCGCTCGCTGAGAGCTCCTCCGGCCCACAAGGTCGTTGGTTCTTGCACGGGCGTCGGCGTCGGAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCCAATTCAGAGAAACCCTGGAATAAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGGTTTCAGAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACGAATGGGGTTGGCTGCGTTGTGTTAGGAAAGGAATCTTTCCATCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCAAATGATTAATGACGACCCGAATCTGTATTTTTT-ATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTTCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATTATTCACTCCATCATAGTCTGATAGATCT--TTTTAAGAATTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATAGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAAAGACCCGGTTGACCCCCTAATT-----ATTTA-TTTTCTCATTTTGTTAACGATTA-----AAAATTCGTTATGTTTCTCATTCATTCTCATTTTACTCTTT-----CACAAACGGATCTGAGCGGAAATTTTTTTTCTTATCACAAGCCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCAT----------ATTTAATTTGAATAATTAACAATACATA---------------------------CCAT-TACTTGTACTGAAACTTTCAAAGTCTTCTTTTTGAAGATCCAAGAAATTCTATCAGGACCGGGATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTATATTAAATTTTTTTTAAATAAAACGAGGATGATGCGTCGTGAATGATAACCATAGTAAAATAAAGTAT--------------------ACGTATTTTTATGATTTCATTCTAACCCTTTCAATTTGGATTATAATTGGCGTGTTGTAACAGAGCTGGGA--GTGATATATTGATAGCCATA----TGGATATGCGCTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGCCAAATCAATTGGATAATAAATCTTTCAATGAAAAAAGT-TTTTT-ATTTAGTCTTTTCGTTAGACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGATTCATAATTTGTTGGAAAAATAGATTAAATAAATAGT-----------------------------------------------------GGTATAGATATATCAGAACATTTTTCTCTTCC---------------CGGGGGTCGGGCAGTTCTGGAGAGCAACAAATGGGTTATATTATATCATTTCGTGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGGAAGAATCAATTCCAGACTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCACTAGACGATGGGGGCATACTTGCACGACCGCCATCATACTATGCTCATAGTATGAATAGTTTTTTTAAATTGTCAATATATATGGAATGGTATGACTCGATACGAAGGGTCTTTACATTTTTCACGATTC----TATAGAATTTTTTT------CGCTAAAAATTTGGTTCAAAAGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATGAATTTAGTTATGATGTCAATTAGGATCGGTCTTGAAACAATTCATTGTATTGATATTTATCAAATCCAATATCAATAAACCGTTTTATTTTACCTATATT-----CACTAGT---ATACC--------CCAAACC---------CTATATTAAAA----TTAAAATTCAAT-----------TTACTGGATAAAAAATATAAATAAAAATTTTCATTCCTGAATGAACCCACTATACTTATTATAAGATATATCTATGTACATATATTATAATAAGTATATATACTAAACTCATAGTGGCTTTATT-AGGAATTGGATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGCACTTTTTTGAAAAGATTAGGTTCGAAATTATTGGAAGAATTCTTTACGGAAGAAGACCAGATTCTTTCTTTGATCTTCCCAAGAGCTTCTTATACTTTGAAGAAGTTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGTTTATGTGACCGTGTAAAT-G--A-TC--TTTAAA-------TAATGAAGAAATAA-CAAAAAATTCAGTTATTTATATTATGTTATGAAATGTTCATGTAGTAAGAATAAGGGTTGATCAACTGAGTATTCAACTTTCTT------AGAGTCATGTATAGGGAAGGAACTGGATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCTAATTAAAAATGTGTCCCGGGCAACCCATTATAATTAGCATATCGAAATCGTGTATATATAAATCCTAATTTTTTAATTCAACTCATT--TATTC-----AAAAAAATTTAAAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTATTTCTATATTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTACCTGATGATTAATGATTAAATAATAACAAGATTTTTCCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Neillia_affinis_144 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAAATGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCGCACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGATGCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGGAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCTAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATTAA--ATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCAAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------AATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGCGGTAAATACTTCGTCATTTACAACCTGCTCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CAAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TGTGTTGCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACACAATTGTTGGTGCAGAGTGCAGACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_gracilis_255 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-GGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCATCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGG{GT}CGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGATGCGTACGACTGCCGT{CG}GCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGTCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCTAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAAAACTTTGTAAAACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT-------------TAAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTT---CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTAAGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTT??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGCGGTAAATACTTCGTCATTTACAACCTGCTCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TGTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-CTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCAGAGTGCAGACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_sinensis_140 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGA{GT}GGGCC{AT}CGCGCCCT-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCACCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCG{AG}G-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGA{CT}GCGTACGACTGCCGT{CG}GCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGTCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACGAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTCTGTCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAAAACAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTTT-----CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_sinensis_149 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCCC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAA{AC}CGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCA{AC}CTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGGGCGCCA-CGACGATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCA{CT}GAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGA{CT}GCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGTCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAATGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTCTTT---CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_sparsiflora_264 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCATCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCGCACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGATGCGTACGACTGCCGTCGCTGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CG{CT}CGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGGAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCTAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? Neillia_thibetica_145 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCGA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGAC{CT}CGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCAAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACACTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGAATCTAGGAGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCATAAAAA-------ATAC---TAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAA--GGCTTATTTATTGATATGCCCCCTGGAACATCACATTTGTTCCACTTTGCCCCATGAAATTTTAAATGGGTCACTTAACCCCCTGGACCACCATAACGTGTATCACTTTGCCCCCTGTAACTTTAAATAGGTCACTTAACCCCTGAACCACCATACCATGTATCACTTTGCCCCCTGGACCACCACCATACCGTGTATCACTTTGCCGTCTTGGCTTAATCCTTTCAAATATATACATACCTAACCACTGTATTCACCAAAATTCTGGAATGAAAAAGAAACAATTCTATTTTTCTCTCCTCTGTTTTCTATTGTCTATGTCCTGTTTAAAATCTTTTACTTTGAACGAGAACTCACACTAAACAATAGTGACTATTTCTTGTTTTAAGGGGCTTTTGGAATGAGAAAGAAACGACATAGCCCTGATTCAGGAAGATAATGTACAATGTAATTTCGGGTTTCTGGTTAGTAAATAGGGTTATGTTGTTTGTTTCTGAATAAGGAAGATGATGTACAATGTAAGCACCTTATTACCCTCAAAGTTAACGATTCAATTGACGGAATTGGCGTGAAATGACAAAGGGATACACGGTATGGTGGTCTAGGAGGTTAAGTGACCCATTTAAAGTTCCAGGGGGCAAAGTGATACATGGTATGGTGGTCAGGGGGTTAAGTGACCCATTTAAAGTTTCAGGGGGCAAACTGGAACAAATGTGATGTTTCAGGGGGCATATCAATAGATAAGCCTAGAAAAAAACACTTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTT------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thibetica_169 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCGA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGAC{CT}CGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCT{CT}CGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTCGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACAACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTATTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTT-CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGATTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATTAATTTCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATTCTGACACCTTCAATATAAATGTT-CGAACT--AAATCTAGG-------CGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGGTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGGATTACTTTTATCGAAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGTGTCTCCAACAACCCTAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATG---ACTCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGAAAAAA--TGCTTATTTATTGATATGTCCCCTGGAACATCACATTTGTTCTACTTTGCCCCCTGAAATTTTAAATGGGTCACTTAACCCCCTGGACCACCATAACGTGTATCACTTTGCCCCCTGCAACTTTAAATAGGTCACTTAACCCCTGAACCACCATACCATGTATCACTTTGCCCCCTGGACCACCACCATACCGTGTATCACTTTGCCGTCTTGGCTTAATCCTTTCAAATATATACATACCTAACCACTGTATTCACCAAAATTTTGGAATGAAAAAAAAACAATTCTATTTTTCTCTCCTTTGTTTTCTATTGTCTATGTCCTGTTTAAAATCTTTTACTTTGAACGAGAACTTACACTAAACAATAGTGACTATTGCTTGTTTTAAGGGGCTTTTGGAATGAGAAAGAAACGACATAGCCCTGATTCAGGAAGATAATGTACAATGTAATTTCGGGTTTCTGGTTAGTAAATAGGGTTATGTTGTTTGTTTCTGAATAAGGAAGATGATGTACAATGTAAGCACCTTATTACCCTCAAAGTTAACGATTCAATTGACGGAATTGGCGTGAAATGACAAAGTGATACACGATATGGTGGTCTAGGAGGTTAAGTGACTCATTTAAAGTTCCAGGGGGCAAAGTGATACATGGTATGGTGGCCAGGGGGTTAAGTGACCCATTTAAAGTTTCAGGGGGCAAACTGGAACAAATGTGATGTTTCAGGGGGCATATCAATAGATAAGCCTAGAAAAAAACACTTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCCATAATTTGAAATGTTTTTTTGTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_170 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-GCTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAACCGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAGCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCCTAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTAAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--C-CCCGCGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACCTGGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCG{AC}TGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAA-------TGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTAAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATATAGA------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCATGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTTTTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-GGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTTCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGG---CGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCAAAATCACTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGGCCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_254 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAACCGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC{AC}-TCCGCA{CG}CTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGC{CT}CCGCCGCGCGGTTGGCGTAAAT{AG}CCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTC{GT}GTGGCCTGCCGTG{CT}GCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACCTGGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGTTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAA-------TGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTAAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATATAGATAGATATAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAAAAAATAGAGTAAATAAATAATGGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCATGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTTTTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTATAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAATAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_thyrsiflora_258 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAACCGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCC-TCCGCAGCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCCGCCG{CT}GCGGTTGGCCTAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTAAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACCTTGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTGA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAA-------TGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTAAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATATAGATAGATATAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-------GGTATAGAAAAATAGAGTAAATAAAAAAATAGAGTAAATAAATAATGGTATAGATATATCAGAAAATTTTTCTCTTACGTATTGTATTGGGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCATGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTTGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACGTAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTTTTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATTGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAAGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATGTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTATAATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCGTTTGGTATTACTTCTAT-GGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTGTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCCTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_uekii_152 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-GGGAGGGGCCTCGCGCCCC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC-GGGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAACCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTTAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCCTTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACCTTCAATATATATGTT-CGAACT--AAATCTGGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTCCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTATAGAAAACACTTTCA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCGTCTCCAACAACCATCAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATCTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTTTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTGTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTATTTT----CTAACATTAACAACTGTCGTGGGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Neillia_uekii_168 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-GGGAGGGGCCTCGCGCCCC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC-GGGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTTCGCCGCGCGGTTGGCGTAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCATGTCGTGCGCGCGCGCCGCGACTCGAG-GGCTCTTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAACCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTTAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTT--CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCCTTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT---AAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTTGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACCTTCAATATATATGTT-CGAACT--AAATCTGGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTCCTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTATAGAAAACACTTTCA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCGTCTCCAACAACCATCAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATCTCAACCATGGGTCAAGACCAAATGTTGACCCA-----CTAATAATTAATC-GTGTTCTTTTCTTTCATAGAAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTGTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG--ATAGGTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTATTTT----CTAACATTAACAACTGTCGTGGGTACTAATTGTGCATTATATATAATTGGACGGATTAAGCAGCTTACCTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_175 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GCGGGCGAAAGCCCTC{CT}-GGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAATATTAAATAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT---AAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCATTACGGTT-------------TAGTAGGATTTCTCTTCACTTGTAAGTCAAAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTGGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCTTTCATTCTTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAA-TTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTGTATCCGATAGGTGAATGTCTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_alternans_253 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GCGGGCGAAAGCCCTCC-GGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATATCATTACTTGTAACAATACATATCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTATACATAAATAAAATTAAGTATACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAATTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT--AAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAG-CCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------TAGTAGGATTTTTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTATGTGGCTTAGTCTAATTCTCACCC-TTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_amurensis_265 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTGACGCTCGGGGG-AGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAACTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGTTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCATCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAGGCCTCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGCTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATTTTTATTAGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT--AAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATGAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTTGAGTAGTATTGTTGAGTAGTATTTTTCTTCACTTATAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--TTAATTTAGGAACTTTGGATTCCTTTGAAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAGCAAAAGCATTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAACACTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTTGACT---ATTATTGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATAATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_082 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGG-AGG-GGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGTTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTTGCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAA-----------------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAAAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACGTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAATCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_155 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGG{AG}GGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTTGCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGATTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------TACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_capitatus_184 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTCTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAACTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTACAAAACCCCCC-GTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGTTAAGCGGGCGT--GGGGTCTTT--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGT{GT}GCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTC-------------TAGTGGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAATCCATTGTGTGGCTTAGCCTAATTCTCACACTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCGTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAATATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTATATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_252 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTCTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-A{CG}GGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGTTCATTGTGTGACTTAGTCTAATTCTCACCCCTTTAATGTAAATATCATTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_266A TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-A{CG}GGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGTTCATTGTGTGACTTAGTCTAATTCTCACCCCTTTAATGTAAATATCATTGTATTTAAAAAAAAAAA-CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGTAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_malvaceus_266C TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTTTTAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGT{AC}GCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-A{CG}GGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTT-AGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCTATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTAGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTTTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183A TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT-AAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAGGTCTTAGGTTCAAGTCTCGGCAAGTCCATTGTGTAGCTTAGTCTAATTCTCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-AACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTACTGTATCCCATAGGTGAATGTTTTCTTTTTTGTTCTAC-GTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_183B TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--TTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT-AAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTAGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGAAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCGCTTGTAAGTCAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTATCACCCCTTTAGTGTAAATATTGTTGTATTTAAAAAAAAAAAACTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCTGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_269A TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGG-AGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTG{CT}CCGCTGCGGACT--{CT}TCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATATCATTACTTGTAACAATACATATCATTACTTGTACT------GAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATTTTATTATTTTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT---AAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTATTATTTCTCTTCACTTGTAAGTCAGAGGTCTTAGGTTCAAATCTCGGCAAGCCCATTGTGTAGCTTAGTCTAAATATCACCCCTTTAGTGTAAATATTGTTGTATTTTAAAAAAAAAA-CGAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGACTACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCTAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTTTATCCTATAGGTGAATGTTTTCTTTTTTGTTCTATAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_monogynus_269D TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGG-AGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAGCTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAAACCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTG{CT}CCGCTGCGGACT--{CT}TCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATATCATTACTTGTAACAATACATATCATTACTTGTACT------GAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTTTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----CGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATTTTATTATTTTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATAT---AAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACGATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAGTAGTATTTCTCTTCACTTGTAAGTTAGAGGTCTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAAATATCACCCCTTTAGTGTAAATATTGTTGTATTTTAAAAAAAAAA-CGAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGACTACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCGTTCGTTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGGTAGTGCA-------TTCGACT---ATTATTGTATTCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAACTGTCGTAAGTACTAACGGTGC----ATAATTATTAGACGGATTAGGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_141 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCTGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCTTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGGCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_142 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCCTGCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGGCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTTTGAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAACTTTGCCACTTAGCA---CGGTC-------------TAGTAGTATTTCTCTTCACTTGTAAGTCAGAGGTTTTAGGTTTAAGTCTCGGCAAATCCATTGTGTGGCTTAGTCTAATTCTCACTCTTTTAGTGTAAATATCGTTGTATTTAAAAAAAAA---CTAATTTAGGAACTTTGGATTCCTTTGGAATTACTTCTATAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAGTGCTTCTCCAAGAACCATAAAAATGCGTTCATTATTTTAA----CCAAA-CACTATCAGCAGCACTTGTGGATTTTTGAAAGCACTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACAGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTGTATCCCATAGGCGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCATAAGTACTAACGGTGC----ATAATTATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_156 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAAGTGGCCTCCCGTGCGCCCCGCCGCGCGG{AT}TGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTC{CT}TGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGCCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATC????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGACCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATAGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GGATAGTATTTCTCTTCACTTGTAAGTTAGAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTATAAATATTGTTGTATTTAAAAAAAAAAAACTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCATTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATGGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAA-GTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AATTAACATTAACAATTGTCGTAAGTACTAACGGTGC----ATAATAATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Physocarpus_opulifolius_164 TCGATGCCTGCCTAGCAGAACGACCCGAGAACAAGTT-TAACGCTCGGGGGGAGGGGGGGTCTCGCGCCTC-CCGTCCCCTTTTTGTC------------CCG-----GAGGGCGAAAGCCCTCCCGGGCGATCAAACGAACACCGGCGCGAA{CT}TGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTCGCGGGGGGCGGCGTAGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCC---TCCGCAATTCCCTCGGGAACGCGGG-CGGGGCGGAAGGTGGCCTCCCGTGCGCCC{CT}GCCGCGCGGTTGGCATAAATACCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGCTTTCAAA-CCCCCCCGTTGCGTGCCGTGCGCGCCCGTCGCGACTCGAG-GGCTCGCTTGCCCCTCTGCTTCGCTCCGGCGACGCTCTCAACATGCGGCGGCAGGCTCCGTGCTTCGGCACCGAACTGTCGCCTC-GCTTCCCTCGTCAGTG-GCGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTCTTTCCTCCTCCTGCC--CTTCGCGGGTCGGAGGGGGACGTTGTAGCACTGCTTGCGTCCCGATCAAGCCGCACATTGTTGCGAGCCTGCGACGGTCCCCAAGTTGCTGCTCGATTTCTCGGATGCGGAATGCTAAGCGGGCGT--GGGGTCTTC--GACCTCCCATCGTCCAATTCGAAGCCTTTGTCGCTTGACGCGGACGACTGCCGTGGCCGCTGCGGACT--CTCGACCTC-AGGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAAAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATTAAAGAATTGTTGTGAATCGATTCAAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACCATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTCTCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACATGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGTATTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATACAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATAATGCGTCGTGAATAATAACCATAATAAAATTAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCCTTCAATTTAGATTAGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATACCCATA----TGGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGT-TTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAAT-----------------------------------------------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGGGTATCGGGCATTTCGGGAAAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATAAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTT-----AGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACCGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTTAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTACATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------TATTATGAAATGTTCATACAGTAAGAGTAAGGGTTGATCAACTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTTAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCT-ATTTTAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTA--AAAAAAAAAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGACTTACCCTCCTCCCTACAATATTGTTAGAAACGATAATT----TCTACTGTGGTAAATACTT-GTAATTTACAACCTGATCTTTGTGGGCCCATTGTAGGCTAGTGGGCCACAATTGAAGAGGCCTGCTGACACCTTCAATATAAATGTTT-GAGCT--AACTGTAGG-------AGCCCAAATTCACAAGAAATCAAAATCTTTA--ATGGGTTTGTTACTAATTTAGGAATTTTGCCACTTAGCACTACGGTT-------------GAATAGTATTTCTCTTCACTTGTAAGTTAGAGGTTTTAGGTTCAAGTCTCGGCAAGCCCATTGTGTAGCTTAGTCTAATTCTCACCCTTTTAGTATAAATATTGTTGTATTTAAAAAAAAAA--CTAATTTAGGAACTTTGGATTCCTTTGGGATTACTTCTAGAGAATACACTTTTACCTATAAATACTTCTTTTACTAAAAGCACAACAAAAGCACTCGGGAATGCTTCTCCAAGAACCATAAAAATGCATTCATTATTTTAA----CCAAA-CACTATCAGCA---CTTGTGGATTTTTGAAAGCGCTTTTAGCCCTGTAAAATAGGCTCTAAATATTCCAACATTTATCTAAATTTGGTTTGACTGGCCAGATGTTAGACGGTGATTGATTTCAAACATAGGTCAAGACCAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCATAATTTTGTAGGAAAAAAGTCTAGACCCAATTGTTAGTGCA-------TTCGACT---ATTATTGTATCCGATAGGTGAATGTTTTCTTTTTTGTTCTACAGTTTGAAGTGTTTTT----------AACTAACATTAACAATTGTCGTAAGTACTAACGGTGC----ATAATAATTAGACGGATTAAGTATCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_chinensis_147 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGCC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCT{GT}AACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACATCGTTGCCCCCCC-TCCGCA{CG}CTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCTCAGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTC{AG}TGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGAC{AC}CAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-GCGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGC{CT}GTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTAAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGGCACGTTCAATATAAATGTT-CGAACTATAAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTT---------------ACAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTAAAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACTCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTCCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_chinensis_172 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCTT--ATGTC------------CCG-----GCGGGCGA---CCGTC-GGGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCT-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACCCAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCT{CT}GTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-AT?????????GTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGGCACGTTCAATATAAATGTT-CGAACTATAAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTT---------------ACAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTAAAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACTCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTCCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_incisa_102 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCACCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACACAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCC{CT}GCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTATTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTAT-AGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_incisa_160 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGTC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCCTGCGGGGGGCGGCGTCGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCC--TCCGCACCTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACTCGAG-GGCTCGTCGGACACAACGCTTCGCTTCGGCGACGCTTTCAACATGCGACGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCC{CT}GCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGCTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGC--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGT{CG}GCTTGACGCGTACGACTGCCGTGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGT-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTATATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT----------AAATAATGGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAAGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATA--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCCTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTT{AC}GTCATTTACAACCTGATCGTTGTGGGCCCATCGTTGGCTAGTGGCCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG------------------------------AATAATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTTGGGTTCATTTGGGATTACTTCTAT-AGAAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTA{AC}AAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCATGGGTCAAGACCAAATGTTGATCCA-----CTAATAATTAATC-GTGTTCTTCTCTTTCATAGTAAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTG{AC}A-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTGTTTTTTTTTTCTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_tanakae_162 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGCC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTTGCGGGGGGCGGCGTGGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACATGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACCCGAG-GGCTCGTCGGACCCAACGCTTCGCTCCGGCGACGCTTTCAACATGCGGCGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTCGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTGGTGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCGT--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGGGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGGC-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGGGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCGTCCCTAC---GTTTATACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGACCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTAGGGTTCGTTTGGGATTATTTCTAT-AGGAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCGTGGGTAAAGACCAAATGTTGACCCA-----CTAATAATTAATCAGTCTTCTTCTCTTTCATAGTTAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAGTTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTT-------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Stephanandra_tanakae_171 TCGATACCTGCCTAGCAGAACGACCCGAGAACGCGTTATGA-ACTCGGGGG-AGGAGGGGCCTCGCGCCTC-TCGTCCCCT--TTGCC------------CCG-----GCGGGCGA---CCGTC--GGGCGAACAAACGAACACCGGCGCGAATTGCGCCAAGGAACCTTAACGAAAGAGCGCGCTCCCTCCGCCCCGGAAACGGTGCTTGCGGGGGGCGGCGTTGCGATCTTCAA---ATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACATGTCGTTGCCCCCCC-TCCGCAACTCCCTCGGGAATGCGGGGCGGGGCGGAAGATGGCCTCCCGTGCGCCCCGCCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGAGCGCCA-CGACAATCGGTGGTTGTCAAA---CCTCGGTGGCCTGTCGTGTGCGCGCGTCGCGACCCGAG-GGCTCGTCGGACCCAACGCTTCGCT{CT}CGGCGACGCTTTCAACATGCGGCGGCAGGCTCCATGCTTCGGCATCGAACTGTCGCCTC-ACGCCCCTGGTCAGTTTACGCATCAAGATT---GGCTTGTGCGAA-TGTCGGGTTCCTGTGTTGCCTACCTATCTCGAAGGAATGTTGCCTCTCGTTG-CTATTTCCTCCTCCAGCC--CCCCGCGGGTCGGAGGAGGACGTCGTAGCACTGCTTGTGTCCCGATCAAGCCACACATCGTTGTGAGATTGTGACGGTCCACGAGTTG{CG}TGCTCGATTTCTCGGATGCGGAACGCTAAGCGGGCG{CT}--GGAGTCTTC--GGCCTCCGATCGTCCAACTCGAAGCCTTTGTCGCTTGACGCGTACGACTGCCGGGGCCGCTGCGGGCT--TTCGACCTCCAAGGTCGCTGG{CT}-CTCGCACGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAACGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGATTTCATAAACCGAGAATAAAAAAAAA-GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATTCTTCCACCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCCGAATGATTAATGACGACCCGAGTCTGTATTTTTTTATATTTATATGAAAAATGAAAGAATTGTTGTGAATCGATTCCAAATTGAAAAAAGAATCGAATATTCATTGATCAAATCATTCACTCCACGATAGTCTGATAGATCTCTTTTTAAGAATTTATTAATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATT-----TTTTA-TTTTATCATTTTGTTAGCGATTT-----GAAATTCGTTATGTTTCTCATTCATTCT------ACTCTTT-----CACAAATGGATATGAGCGGAAATTTTTTT-CTTATCACAAGTCTTGTGTGTGATATATATGATACACGTACAA-ATGAACATCTTTGAGCAAGGAATCCCCATTTTAAATTAAATTTGATTTGAATAATTAACAATACATA---------------------------ACTTATACT-GTACTGAAACTTACAAAAT-TTATTTTTGAAGATCGAAGAAATTCTATCAGGGCCTGTATAATACTTTGTAATACTTTTTTCGTTTTTGTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAATTAAGTAT--------------AAGTATACATATTTTTATGATTTCATTCTAACCCCTTCGATTTAGATTCGAATTAGCGTGTTGTAACAGAGCCGCGAATGTGATATATTGATA----------TAGATAGGCACTTTAGTGAGAGCAGCCTGG-ATTACTAGTAATCTTTTCGTTATTGACAAATCCATTGGATAATCACTCTTTCAATGAAAAAAGTGTTTTT-ATTTACTCTTTTCCTTAAACTTTACTTTATACTTACAGATCCTGATATGAATCTAGATCATTAGCAAGAT-CATAATTTGTTGGAAAAATAGAGTAAATAAATAATAAATAATGGTATAGAAAAATAGAGTAAATAAATAAT-----------------GGTATAGATATATCAGAAAATTTTTCTCTTACGTATTG-----GGGTGGAGTATCGGGCATTTCGGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGTGGATCGGCGAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGAAAGAATCAATTCCAGGCTTATTGATAATCCATGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCATACTTGCACAACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTC----TATAGAATTTTTTTTTTTTTCGCTAAAAATGTGGTTCAAAGGCCACGCCGAATCTCTTTA--------------TCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGGTACATGTATCACTCAAATTAATTTAGTTATGATGTCAATTAGGATAGGTCTTGAAACAATACATTGTATTGATATTTATCAAATCCAATATCAAGAAACTGTTTTATTTTACCTATATT-----CACTAGC---ATACC--------CTAACCC----------TATATT--------TTA---TTAAAT-----------TTACTGGATAAA---------TTTAATTTATCATTCCTTACCGAACCC-CTATACTTATTATAAGATATATCTATGTGCATCTAGTATAATAAGTATATATACTAAACTCATAGTGGCTTTATTCAGGAATTGAATCCGATTTGTGCGTATATGCAGAAATCTTTCTCATTATTACAGCGGATCCTCAAGAAAAAGGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACCTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTCTAAATTATTGGAAGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTGATCTTCCCAAGAACTTCTTATACTTTGAAGAAGCTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCTATCGTAGAAACGGAAATTCTCTTTAAA-------TAATGAAGAGATAACCATTTATTTCTATTAT--------------GAAATGTTCATACAGTAAGAGTAAGGGTTGATCAATTGAGTATTCAACTTTATT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGGTTTTTTACCT-ATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCTAAATCGTGT--------------------------CATTTATTAATTTATT--AAAAAAAAAATTATAAATATAGATAGATAAGAACATAGATATCTATCGATGTTGATATTGGTTGACATGGGTATATAAATCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTAT-------TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGGGCGGTGAGAAATGTCCCACCAAGGTACGGAGTTACACCCGTCCCTAC---GTTTTTACAAACGCTAATT----TCTACCGTGGTAAATACTTCGTCATTTACAACCTGATCGTTGTGGACCCATCGTTGGCTAGTGGGCCGCAATTGGAGAGGCATGCTGACACGTTCAATATAAATGTT-CGAACT--AAATCTAGG-------AGCCCAAGTTCACAAGAAAT-AAAATCATTA--ATAG-TTTGTTACTAAATTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAACTTAGGGTTCGTTTGGGATTATTTCTAT-AGGAACACTTTTA-------------------TTAAAAGCACAACAAAAA-----GGAAGTGCATCTCCAACAACCATAAAAA-------ATACTTTTAGAGTACAAAATCAC--------------------------------TTTTA-------------------------------------------------------------------------ATT-ATTTCAACCGTGGGTAAAGACCAAATGTTGACCCA-----CTAATAATTAATCAGTCTTCTTCTCTTTCATAGTTAAAAA-CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTGCACTATTTTGTAGGATAAAAATCTAGACCCAATTGTTGGTGCA-------GACGACTTCTATTG-TGTACG------GTGAATGTTTTATGTTTTCTTCTATAATTTGAAATGTTTTTTTTTTT------CTAACATTAACAACTGTCGTAAGTACTAATTGTGCATTATGTATAATTGGACGGATTAAGCAGCTTACTTATTATATATGCAGGTGACAAACCAGGTGTTTAGGTATGCCAAAAAGG Vauquelinia_californica TCGA-ACCTGCCCAACAGAACGACCCGAGAACCAGTTTCAA-CGTCGGGTG-CCGGGGGCCCTTCGGGCTCTCCGTCCCGT--TAATC------------CCG-----G-GAGC-A---CGCTCCCGGGCGTACAAACGAACACCGGCGCGTATTGCGCCAAGGAACCCGAAAGAAA{CG}AGCGCGCT{CT}CCGCCGCCCCGAAAACGGTGCGCGCGCGGGT--GCGTCGTCTTCTTCAATGTATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCC-TCCGCGCCTCCCTCGGGAGCGTCGGGGGGAGCGGATGATGGCCTCCCGTGCGTCACCCCGCGCGGTTGGCACAAATGCCGGGTCCTCGGCGACGAGCGCCAACGACGATCGGTGGTTGTCAAA---CCTCGGTTGCATGTCGTGGCCGCCCGTCGCGCTTCGAGCGGCTCGCGACGCACGTCGCTCTGCTTCGGCGGAGCTTTCAACATTCGACGGCAGGCTCCGTGCTTTGGCATCGAACTGTCGGCTC-GTACCCCGCTTCAGTG-ATGCATCAAGATTTGTGTCTTGTGCGCG--GTTAGGTTTCTGTTTTGGCTACCTATCGTAAAGGAATGTTGCCTCTCGTTG-TCCCTTCATCCTCTTGCTGGCCTTGCTGGCGGGAGGACGACATTGTAGCGATGCCCGTGTCCCGAACAACCCACA-GTTTTTGTGCGATTGTGTCGGTGCTCGAGTTTTTGCTTGATATCTCGGATGCGGAACACTAGAGGGACGATGGG--TCTCTATGGCCTCCTATCGTCCA-TTCGAAGCCTT-GTCGCTCGATGCGTACGACTGTTGTGCCCGTGGCGAGCG--ATCGACCTTCAAGGTCGTTTGT-CTCGCGCGG-CGCCGGCGTCGAAGAGGAATGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTCTTTCAAATTCAGAGAAACCCTGGAATTAAAAATGGGCAATCCTGAGCCAAATCCTGTTTTATGAAAACAAACAAGGGTTTCATAAACCGAGAATAAAAAA----GGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTGTGTTAGTAAAGGAATCCTTCCATCGAAACTTCAGAAAGGATGAAGGATAAACCTATATACATACGTATAGTACTGAAATACTATCTCAAAATGATTAATGACGACCCAAATCTGTATTTTTTTATATTTATATGAAAAATGAAAGACTTGTTGTGAATCGATTAAAAATTGAAAAAAGAATCGAATATTCATTGATCAAACCATTCACTCCACCGTAGTCTGATAGATCT--TTTTAATAATTGATTAATCGGACGAGAATAAAGATAGAGTCCCATTATACATGTTAATATCGACAACAATGAAATTTATAGTAAGAGGAAAATCCGTCGACTTTAGAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAAAACGACCCGGTTGACTCCCTAATTATTTATTTTAATTTTATCATTTTGTTAGCGATTCAAATCAAAATTCGTTATATTTATCATTCATTCTCATTCTACTCTTTTCTTTCACAAATGGATCTGAGCGGAAATTTTTTT-CTTATCACAAGACTTGTGTGTGATATATATGATACGCGTACAGTACAAATGA-TTTGAGCAAGGAATCC--------------ATTAAATTTGAATAATTAACAATACATA----------------------TCATTACTTGTACT-GTACTGAAACTTAGAAAAT-TTATTTTTGAAGATCCAAGAAATTCTATTAGATCCTGTATAATACTTTGTAATACTTTTT-CGTTTTTCTAATTGACATAGACCCAAGTCCTATATTA---------------AAATAAAATGAGGATGATGCGTCGTGAATGATAACCATAATAAAAAAAAGTAT--------------------ACATATTTTTATGATTTCATTCTAACCCTTTCAATTTAGATTAGAATTGGCGGGTTGTAACAGAGCCGCGAGTGTGATATATCGACACCCATA----TGTATATGTACTTTAGTGAGAGCAGCCCGGTATTACTAGTAATCCTTTCGTTATTGCCAAATCAATTGGATAATCACTCGTTCAATCAAAAAAGTTTTTTTTATTTACTCTTTTCCTTAAACTTTACTTTATAGTTACGGATCCTGATATGAATCTAGATCATTAGCAAGAT-CAGAATTTCTTGTAAAAAGAGAGTAAATAAATAGT-----------------------------------------------------GGTATAGATATATCATAAAATGGATTTCTTCCGTATTG----GGATTGGGGGATCGGGCATTTCTGGAGAGCAACAAATGGGTTATATTATATCATTTCATGGCGGATCGGCAAATTATTGGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGACCCAGGAAGAATCAATTCCAGGCTTATTGATAATCCACGATCAACTTCCTTTCGTAGTACCCTACCCCCAGGGGAAGTCGAATCCCCGCTGCCTCCTTGAAAGAGAGATGTCCTGAACCGCTAGACGATGGGGGCAGACTTGCACGACCGCCATCATACTATGTTCATAGTATGAATAGTTTTTTAAAATTGTCAATATA-ATGGAATGGTATGACTCGATACGAAGGATCTTTCCGTCTTTCACGATTCTTTCTATACAATTTTTTT------CGATAAAAGTTTGGTTCAAAGGCCACGCCGAATCTCTTTATCCGAATCTCTTTATCAATGATTCAATGAAATATCTTGGATCTATGTTAAATTAGTGGATACATGTATCACTCAAATGAATTTAGTTATGATGTCAATTAGGAT-------GAAACAATTCATTGTATTGATATTTATCAAATCCAATATCAATAAACCGTTTTATTTTACCTATATTATATACTCTAACCCTATATTAAATTATATTAAATTATTTATAAATTATATTAAA-----TTA---TTTAATATAATTTAATTTTACTGGATAAA---------GAAAATTTTTCATTCCTGAATGAACCC-TTATACTTATTATAAGATATATCTATGTACATCTATTATAATA------TATACTAAACTCATAGTGTCTTTATTCAGGAATTGGATCCGATTTGTGCATATATGCAGAAATCTTTCTCATTATTACAGTGGATCCTCAAGAAAAAAGAGTTTGTATCGAATAAAATATATACTTCGACTTTCTTGTGTTAAAACTTTGGCTCGTAAACACAAAAGTACTGTACGAACTTTTTTGAAAAGATTAGGTTATAAATTATTGGACGAATTCTTTACGGAAGAAGAACAGATTCTTTCTTTAATCTTCCCAAGAGCTTCTTATACTTTGAAGAAGTTTTATAGAGGTCGAATTTGGTATTTGGATATTTTTTGCATCAATGATCTAGTCAATCATGAATAATTGGTTATGCGATCGTAGAAATGGAAATTCTATTTAAA-------TAATGAAGAGATAA-CAAAAAATTCA----TTTAT-TTCTATTATGAAATGTTCATCCAGTAAGATTAAGGGTTGATCAACTGAGTATTCAACTTTCTT------AGAGTCGTGTATAGGGAAGGAACTGAATTTTAGATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGTTTGGGGAGGGATTTTTTACCTAATTAAAAATTTGTCCCGGGCAACCCATTATAATTAGCATATCGAAATCATGTGTATATAAATCCT----------TTAAATTCATT--TATTCTAAAAAAAAAAATTCATAAATATAGATATATAATAACATAGATATCTATC------GATATTGGTTGACATGGGTATATAAGTCATGTTATACTGTTGAATAACAAGCCCTCAATTATCTATTATTTCTAT-TTATCTATTTATAGAGAATTCGTGTGCTTGGGAGTCCCTGATGATTAATGATTAAATAA-ACCAAGATTTTACCATGACTGCAATTTTAGAGAGACGCGAAAGCGAAAGCCTATGG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ; END; BEGIN SETS; CHARSET rDNA (CHARACTERS = combined) = 1-1119; CHARSET cpDNA (CHARACTERS = combined) = 1200-4315; CHARSET LFY (CHARACTERS = combined) = 4316-6096; END; BEGIN TREES; TITLE Tb7544; LINK TAXA = Taxa4; TRANSLATE 1 Stephanandra_tanakae_171, 2 Stephanandra_tanakae_162, 3 Stephanandra_incisa_160, 4 Stephanandra_incisa_102, 5 Stephanandra_chinensis_172, 6 Stephanandra_chinensis_147, 7 Neillia_uekii_168, 8 Neillia_uekii_152, 9 Neillia_thyrsiflora_258, 10 Neillia_thyrsiflora_254, 11 Neillia_thyrsiflora_170, 12 Neillia_thibetica_169, 13 Neillia_thibetica_145, 14 Neillia_sparsiflora_264, 15 Neillia_sinensis_149, 16 Neillia_sinensis_140, 17 Neillia_gracilis_255, 18 Neillia_affinis_144, 19 Physocarpus_opulifolius_164, 20 Physocarpus_opulifolius_156, 21 Physocarpus_opulifolius_142, 22 Physocarpus_opulifolius_141, 23 Physocarpus_monogynus_269, 24 Physocarpus_monogynus_183, 25 Physocarpus_malvaceus_266, 26 Physocarpus_malvaceus_252, 27 Physocarpus_capitatus_184, 28 Physocarpus_capitatus_155, 29 Physocarpus_capitatus_082, 30 Physocarpus_amurensis_265, 31 Physocarpus_alternans_253, 32 Physocarpus_alternans_175, 33 Vauquelinia_californica, 34 Lyonothamnus_floribundus; TREE rDNA = [&R] (34,(33,(((30,((29,27),28),26,25,24,23,(20,(22,21,19))),31,32),((2,1),(((((16,15),(8,7)),(13,12),18),14,17),((11,9),10),6,5,4,3))))); END; BEGIN TREES; TITLE Tb7541; LINK TAXA = Taxa1; TRANSLATE 1 Stephanandra_tanakae_171, 2 Stephanandra_tanakae_162, 3 Stephanandra_incisa_160, 4 Stephanandra_incisa_102, 5 Stephanandra_chinensis_172, 6 Stephanandra_chinensis_147, 7 Neillia_uekii_168, 8 Neillia_uekii_152, 9 Neillia_thyrsiflora_258, 10 Neillia_thyrsiflora_254, 11 Neillia_thyrsiflora_170, 12 Neillia_thibetica_169, 13 Neillia_thibetica_145, 14 Neillia_sparsiflora_264, 15 Neillia_sinensis_149, 16 Neillia_sinensis_140, 17 Neillia_gracilis_255, 18 Neillia_affinis_144, 19 Physocarpus_opulifolius_164, 20 Physocarpus_opulifolius_156, 21 Physocarpus_opulifolius_142, 22 Physocarpus_opulifolius_141, 23 Physocarpus_monogynus_269D, 24 Physocarpus_monogynus_269A, 25 Physocarpus_monogynus_183B, 26 Physocarpus_monogynus_183A, 27 Physocarpus_malvaceus_266C, 28 Physocarpus_malvaceus_266A, 29 Physocarpus_malvaceus_252, 30 Physocarpus_capitatus_184, 31 Physocarpus_capitatus_155, 32 Physocarpus_capitatus_082, 33 Physocarpus_amurensis_265, 34 Physocarpus_alternans_253, 35 Physocarpus_alternans_175, 36 Vauquelinia_californica, 37 Lyonothamnus_floribudnus; TREE combined = [&R] (37,(36,((35,(34,(33,((((32,(31,30)),(22,21)),(29,28)),((27,(25,(24,23))),(26,(20,19))))))),(((((18,14),17),(11,(10,9))),(((6,5),(4,3)),(2,1))),(((16,15),(13,12)),(8,7)))))); END; BEGIN TREES; TITLE Tb7542; LINK TAXA = Taxa3; TRANSLATE 1 Stephanandra_tanakae_171_PCR, 2 Stephanandra_tanakae_162_PCR, 3 Stephanandra_incisa_160_PCR, 4 Stephanandra_incisa_102_B, 5 Stephanandra_incisa_102_A, 6 Stephanandra_chinensis_172_PCR, 7 Stephanandra_chinensis_147, 8 Neillia_uekii_168_PCR, 9 Neillia_uekii_152_PCR, 10 Neillia_thyrsiflora_258_B, 11 Neillia_thyrsiflora_258_A, 12 Neillia_thyrsiflora_254_C, 13 Neillia_thyrsiflora_254_B, 14 Neillia_thyrsiflora_254_A, 15 Neillia_thyrsiflora_170_C, 16 Neillia_thyrsiflora_170_B, 17 Neillia_thyrsiflora_170_A, 18 Neillia_thibetica_169_B, 19 Neillia_thibetica_169_A, 20 Neillia_thibetica_145_B, 21 Neillia_thibetica_145_A, 22 Neillia_sinensis_149, 23 Neillia_sinensis_140_B, 24 Neillia_sinensis_140_A, 25 Neillia_gracilis_255, 26 Neillia_affinis_144_B, 27 Neillia_affinis_144_A, 28 Physocarpus_opulifolius_156_C, 29 Physocarpus_opulifolius_156_B, 30 Physocarpus_opulifolius_156_A, 31 Physocarpus_opulifolius_142_C, 32 Physocarpus_opulifolius_142_B, 33 Physocarpus_opulifolius_142_A, 34 Physocarpus_monogynus_269_D, 35 Physocarpus_monogynus_269_A, 36 Physocarpus_monogynus_183_E, 37 Physocarpus_monogynus_183_D, 38 Physocarpus_monogynus_183_C, 39 Physocarpus_monogynus_183_B, 40 Physocarpus_monogynus_183_A, 41 Physocarpus_malvaceus_266_D, 42 Physocarpus_malvaceus_266_C, 43 Physocarpus_malvaceus_266_B, 44 Physocarpus_malvaceus_266_A, 45 Physocarpus_malvaceus_252_B, 46 Physocarpus_malvaceus_252_A, 47 Physocarpus_opulifolius_164_B, 48 Physocarpus_opulifolius_164_A, 49 Physocarpus_opulifolius_141_F, 50 Physocarpus_opulifolius_141_E, 51 Physocarpus_opulifolius_141_D, 52 Physocarpus_opulifolius_141_C, 53 Physocarpus_opulifolius_141_B, 54 Physocarpus_opulifolius_141_A, 55 Physocarpus_capitatus_184_C, 56 Physocarpus_capitatus_184_B, 57 Physocarpus_capitatus_184_A, 58 Physocarpus_capitatus_155_C, 59 Physocarpus_capitatus_155_B, 60 Physocarpus_capitatus_155_A, 61 Physocarpus_capitatus_082_E, 62 Physocarpus_capitatus_082_D, 63 Physocarpus_capitatus_082_C, 64 Physocarpus_capitatus_082_B, 65 Physocarpus_capitatus_082_A, 66 Physocarpus_amurensis_265_D, 67 Physocarpus_amurensis_265_C, 68 Physocarpus_amurensis_265_B, 69 Physocarpus_amurensis_265_A, 70 Physocarpus_alternans_175_D, 71 Physocarpus_alternans_175_C, 72 Physocarpus_alternans_175_B, 73 Physocarpus_alternans_253_F, 74 Physocarpus_alternans_253_E, 75 Physocarpus_alternans_253_D, 76 Physocarpus_alternans_253_C, 77 Physocarpus_alternans_253_B, 78 Physocarpus_alternans_253_A; TREE LEAFY = [&R] ((((((78,77,76,75),74),73,((72,70),71),(((((65,62,61),57,56,55),(60,59,58)),(64,63)),(54,(53,52,50,49),51,33,32,31))),((46,43,45),44),((((48,30),47),(29,28)),(40,37),34),(42,(41,(39,38,36),35))),(69,(68,67,66))),(((((27,26),25),((17,16,15),((14,13,12),11,10))),(((7,6),4,3,5),(2,1))),((24,(23,22),(21,((20,19),18))),(9,8)))); END; BEGIN TREES; TITLE Tb7543; LINK TAXA = Taxa2; TRANSLATE 1 Stephanandra_tanakae_171, 2 Stephanandra_tanakae_162, 3 Stephanandra_incisa_160, 4 Stephanandra_incisa_102, 5 Stephanandra_chinensis_172, 6 Stephanandra_chinensis_147, 7 Neillia_uekii_168, 8 Neillia_uekii_152, 9 Neillia_thyrsiflora_258, 10 Neillia_thyrsiflora_254, 11 Neillia_thyrsiflora_170, 12 Neillia_thibetica_169, 13 Neillia_thibetica_145, 14 Neillia_sparsiflora_264, 15 Neillia_sinensis_149, 16 Neillia_sinensis_140, 17 Neillia_gracilis_255, 18 Neillia_affinis_144, 19 Physocarpus_opulifolius_164, 20 Physocarpus_opulifolius_156, 21 Physocarpus_opulifolius_142, 22 Physocarpus_opulifolius_141, 23 Physocarpus_monogynus_269, 24 Physocarpus_monogynus_183, 25 Physocarpus_malvaceus_266, 26 Physocarpus_malvaceus_252, 27 Physocarpus_capitatus_184, 28 Physocarpus_capitatus_155, 29 Physocarpus_capitatus_082, 30 Physocarpus_amurensis_265, 31 Physocarpus_alternans_253, 32 Physocarpus_alternans_175, 33 Vauquelinia_californica_057, 34 Lyonothamnus_floribundus_050; TREE cpDNA = [&R] (34,(33,((32,31,23,(24,30,(19,20,21,29,25,22,28,27,26))),((((9,10),11),((18,14),17)),((12,13,15,16),((7,8),(6,(2,3,4,5,1)))))))); END;