#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 5:34 GMT TreeBASE (cc) 1994-2008 Study reference: Liu W., & Kirschner R. 2013. Two new hosts of anamorphic Erysiphe quercicola: Cinnomomum camphora and Murraya paniculata. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14403] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=31; TAXLABELS Erysiphe_alphitoides_MUMH_2471_AB292699 Erysiphe_alphitoides_MUMH_2620_AB292701 Erysiphe_alphitoides_MUMH_3169_AB292702 Erysiphe_alphitoides_MUMH_3250_AB292704 Erysiphe_epigena_MUMH_3795_AB292722 'Erysiphe euonymi-japonici MUMH133 AB250228' 'Erysiphe euonymi-japonici MUMH2470 AB250229' Erysiphe_hypogena_MUMH_3794_AB292725 Erysiphe_monascogera_AB331645 Erysiphe_monascogera_AB331646 Erysiphe_monascogera_AB331647 Erysiphe_quercicola_JQ034229 Erysiphe_quercicola_MUMH_1955_AB292690 Erysiphe_quercicola_MUMH_1956_AB292691 Erysiphe_quercicola_MUMH_3242_AB292693 Erysiphe_sp._Anamorph_on_Cinnamomum_camphora_KC857653 Erysiphe_sp._Anamorph_on_Murraya_paniculata_KC85765 'Erysiphe sp. Wisley-2007 EF183498' Oidium_anacardii_Anamorph_on_Anacardium_occidentale_AB237786 Oidium_bixae_Anamorph_on_Bixa_orrellana_AB237787 Oidium_bixae_Anamorph_on_Bixa_orrellana_AB237789 Oidium_citri_Anamorph_on_Citrus_limon_AB237791 Oidium_citri_Anamorph_on_Citrus_sinensis_AB237793 Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193589 Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193606 Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193607 Oidium_sp._MUMH1183_Anamorph_on_Acacia_mangium_AB237809 Oidium_sp._MUMH1805_Anamorph_on_Acacia_auriculiformis_AB237804 Oidium_sp._MUMH2546_Anamorph_on_Acacia_auriculiformis_AB237803 Oidium_sp._MUMH3241_Anamorph_on_Acacia_auriculiformis_AB237805 Oidium_sp._VPRI20907_Anamorph_on_Acacia_mangium_AB237808 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17874] TITLE Kirschner_Oidium; LINK TAXA = Taxa1; DIMENSIONS NCHAR=588; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Erysiphe_alphitoides_MUMH_2471_AB292699 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_alphitoides_MUMH_2620_AB292701 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_alphitoides_MUMH_3169_AB292702 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_alphitoides_MUMH_3250_AB292704 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_epigena_MUMH_3795_AB292722 CGGAAGGATCATTACAGAGTGTGAGGCACAGTCGTGGCATCTGCTGCGTACTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGC-CCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTCAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGTTGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG 'Erysiphe euonymi-japonici MUMH133 AB250228' CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-CAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG 'Erysiphe euonymi-japonici MUMH2470 AB250229' CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-CAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_hypogena_MUMH_3794_AB292725 CGGAAGGATCATTACAGAGTGTGAGGCCCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGC-CCGCAAGGACATGCGTCGGCCGCCCACCGGCTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTATTTTTGTCGTCTCAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCGTTGTGTGGCTGCGGTGTTGGGGCCCGTCGCGTTGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_monascogera_AB331645 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGGGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTCAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_monascogera_AB331646 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGGGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTCAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATC{AG}AATCTTT{AG}AACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_monascogera_AB331647 CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCCGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGGGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTCAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_quercicola_JQ034229 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_quercicola_MUMH_1955_AB292690 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_quercicola_MUMH_1956_AB292691 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_quercicola_MUMH_3242_AB292693 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Erysiphe_sp._Anamorph_on_Cinnamomum_camphora_KC857653 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGG-TGACCTCGAATCAGG Erysiphe_sp._Anamorph_on_Murraya_paniculata_KC85765 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGCATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG 'Erysiphe sp. Wisley-2007 EF183498' CGGAAGGATCATTACAGAGTGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCTCCGCAAGGACATGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCAACCAAAACTCATGTTGTTTTTGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGCTGCCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGCGATGCGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGTGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_anacardii_Anamorph_on_Anacardium_occidentale_AB237786 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_bixae_Anamorph_on_Bixa_orrellana_AB237787 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_bixae_Anamorph_on_Bixa_orrellana_AB237789 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCCAAAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCACGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_citri_Anamorph_on_Citrus_limon_AB237791 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_citri_Anamorph_on_Citrus_sinensis_AB237793 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTGTTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193589 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTCAACATGGATCACAGGTTGACCTCGAATCAGG Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193606 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193607 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_sp._MUMH1183_Anamorph_on_Acacia_mangium_AB237809 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_sp._MUMH1805_Anamorph_on_Acacia_auriculiformis_AB237804 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_sp._MUMH2546_Anamorph_on_Acacia_auriculiformis_AB237803 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_sp._MUMH3241_Anamorph_on_Acacia_auriculiformis_AB237805 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG Oidium_sp._VPRI20907_Anamorph_on_Acacia_mangium_AB237808 CGGAAGGATCATTACAGAGCGTGAGGCTCAGTCGTGGCATCTGCTGCGTGCTGGGCCGACCCTCCCACCCGTGTCGATTTGTATCTTGTTGCTTTGGCGGGCCGGGCCGCGTCGTCGCTGCCCCGCAAGGACAAGCGTCGGCCGCCCACCGGTTTCGGCTGGAGCGCGCCCGCC-AAAGACCCCATCAAAACTCATGTTGTTTATGTCGTCTTAGCTTTATTATTGAAATTGATAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATAACACCCCCTCCAGTTACCTTTGTGTGGCTGCGGTGTTGGGGCTCGTCGTGATACGGCGGCCCTTAAAGACAGTGGCGGTCCCGGCGTGGGCTCTACGCGTAGTAACTTGCTTCTCGCGACAGAGTGACGACGGCGGCTTGCCAGAACAACCCACTTGCTCCAGTC-ACATGGATCACAGGTTGACCTCGAATCAGG ; END; BEGIN TREES; TITLE Kirschner_Oidium; LINK TAXA = Taxa1; TRANSLATE 1 Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193589, 2 Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193606, 3 Oidium_heveae_Anamorph_on_Hevea_brasilienssis_AB193607, 4 Oidium_anacardii_Anamorph_on_Anacardium_occidentale_AB237786, 5 Oidium_bixae_Anamorph_on_Bixa_orrellana_AB237787, 6 Oidium_bixae_Anamorph_on_Bixa_orrellana_AB237789, 7 Oidium_citri_Anamorph_on_Citrus_limon_AB237791, 8 Oidium_citri_Anamorph_on_Citrus_sinensis_AB237793, 9 Oidium_sp._MUMH2546_Anamorph_on_Acacia_auriculiformis_AB237803, 10 Oidium_sp._MUMH1805_Anamorph_on_Acacia_auriculiformis_AB237804, 11 Oidium_sp._MUMH3241_Anamorph_on_Acacia_auriculiformis_AB237805, 12 Oidium_sp._VPRI20907_Anamorph_on_Acacia_mangium_AB237808, 13 Oidium_sp._MUMH1183_Anamorph_on_Acacia_mangium_AB237809, 14 'Erysiphe euonymi-japonici MUMH133 AB250228', 15 'Erysiphe euonymi-japonici MUMH2470 AB250229', 16 Erysiphe_quercicola_MUMH_1955_AB292690, 17 Erysiphe_quercicola_MUMH_1956_AB292691, 18 Erysiphe_quercicola_MUMH_3242_AB292693, 19 Erysiphe_alphitoides_MUMH_2471_AB292699, 20 Erysiphe_alphitoides_MUMH_2620_AB292701, 21 Erysiphe_alphitoides_MUMH_3169_AB292702, 22 Erysiphe_alphitoides_MUMH_3250_AB292704, 23 Erysiphe_epigena_MUMH_3795_AB292722, 24 Erysiphe_hypogena_MUMH_3794_AB292725, 25 Erysiphe_monascogera_AB331645, 26 Erysiphe_monascogera_AB331646, 27 Erysiphe_monascogera_AB331647, 28 'Erysiphe sp. Wisley-2007 EF183498', 29 Erysiphe_quercicola_JQ034229, 30 Erysiphe_sp._Anamorph_on_Murraya_paniculata_KC85765, 31 Erysiphe_sp._Anamorph_on_Cinnamomum_camphora_KC857653; TREE result = [&R] ((((23:0.0033345,24:0.00872654):0.00242974,(25:1.0E-8,26:1.0E-8,27:1.0E-8):0.00534713):0.00172912,(19:1.0E-8,20:1.0E-8,21:1.0E-8,22:1.0E-8,28:1.0E-8,(14:1.0E-8,15:1.0E-8):0.00217326):1.0E-8):0.01271009,(1:1.0E-8,2:1.0E-8,3:1.0E-8,4:1.0E-8,5:1.0E-8,6:0.00214946,9:1.0E-8,10:1.0E-8,11:1.0E-8,12:1.0E-8,13:1.0E-8,16:1.0E-8,17:1.0E-8,18:1.0E-8,29:1.0E-8,30:0.00216621,31:1.0E-8,(7:1.0E-8,8:1.0E-8):0.00215365):0.01271009); END;