#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 24, 2021; 10:29 GMT TreeBASE (cc) 1994-2008 Study reference: Menolli jr N., Breternitz B.S., & Capelari M. 2013. The genus Pleurotus in Brazil: a molecular and taxonomic overview. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14405] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=68; TAXLABELS Hohenbuehelia_auriscalpium_EF409725 Hohenbuehelia_mastrucata_EF409736 Pleurotus_abalonus_AY315806 Pleurotus_abalonus_AY315808 Pleurotus_abalonus_AY315810 Pleurotus_albidus_AF345658 Pleurotus_albidus_AF345659 Pleurotus_albidus_AF345660 Pleurotus_albidus_AF345661 Pleurotus_albidus_KF280332 Pleurotus_albidus_KF280333 Pleurotus_albidus_KF280334 Pleurotus_albidus_KF280335 Pleurotus_albidus_KF280336 Pleurotus_albidus_KF280337 Pleurotus_albidus_KF280338 Pleurotus_albidus_KF280339 Pleurotus_australis_AY315758 Pleurotus_citrinopileatus_HM561987 Pleurotus_citrinopileatus_JN234853 Pleurotus_cornucopiae_AY265817 Pleurotus_cornucopiae_AY450341 Pleurotus_cornucopiae_DQ342325 Pleurotus_cystidiosus_AY315767 Pleurotus_cystidiosus_AY315774 Pleurotus_cystidiosus_AY315777 Pleurotus_djamor_EU424288 Pleurotus_djamor_FJ040176 Pleurotus_djamor_GU722266 Pleurotus_djamor_GU722274 Pleurotus_djamor_KF280324 Pleurotus_djamor_KF280325 Pleurotus_djamor_KF280326 Pleurotus_djamor_KF280327 Pleurotus_djamor_KF280328 Pleurotus_djamor_KF280329 Pleurotus_dryinus_EU424293 Pleurotus_dryinus_EU424294 Pleurotus_dryinus_GU722278 Pleurotus_eryngii_AY368657 Pleurotus_eryngii_AY450347 Pleurotus_eryngii_EU424295 Pleurotus_eryngii_U04089 Pleurotus_euosmus_AY265826 Pleurotus_euosmus_AY368659 Pleurotus_euosmus_EU424298 Pleurotus_fuscosquamulosus_AY315788 Pleurotus_fuscosquamulosus_AY315789 Pleurotus_fuscosquamulosus_KF280330 Pleurotus_fuscosquamulosus_KF280331 Pleurotus_ostreatus_EU424300 Pleurotus_ostreatus_EU424309 Pleurotus_ostreatus_EU424310 Pleurotus_ostreatus_GU722281 Pleurotus_populinus_AY368666 Pleurotus_populinus_AY368667 Pleurotus_populinus_AY450346 Pleurotus_populinus_U04095 Pleurotus_pulmonarius_AM269807 Pleurotus_pulmonarius_GU722282 Pleurotus_pulmonarius_KF280340 Pleurotus_pulmonarius_U04093 Pleurotus_pulmonarius_U60648 Pleurotus_rickii_KF280341 Pleurotus_rickii_KF280342 Pleurotus_smithii_AY315779 Pleurotus_smithii_AY315780 Pleurotus_smithii_AY315784 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17835] TITLE Pleurotus_sp.; LINK TAXA = Taxa1; DIMENSIONS NCHAR=687; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Hohenbuehelia_auriscalpium_EF409725 CATTATTGTATTCAC------CTGCGATGCTG---TTGCTGGCTCCTTGTGGGCA-TGTGCACGCTTCGTAAGT----TAATTTCAACCACCTGTGAACCTTTTGTAGTCTTGGGT-------GACG-CTA------TAACTCAAAGGAAACTTTGGATTTGA-ATGCTGCAGGCTTGTAAAAAGGTCGGCTTCATAGCAGA-GCCTGTACTATGCTTTATACA---CCCCATTGTATGTCATA----GAATGTAAATCAA---G----GGCTTCAATGCCTTT--AAACTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTT----AGAAGGCTTTGTC------TT-TCTAAG-----GCTTGGA-TGTGGAGGTTTGCGGGCTTTCT------AAGTCGGCTCCTCTGAAATGCATTAGCTGGGT----TTGCGCCTTCAGC--CTATTGGTGTGATAA-TTATCTACGGTCGTTAGCGTGTATAAATCTTTCCAGCT-TCTAACCGTCCGCAAGGACAACAC--TTGACTATTTGACCT Hohenbuehelia_mastrucata_EF409736 CATTATTGAATTCGC------CTTTGAAGCTG---TTGCTGGCCCCTTAGGGGTA-TGTGCACGCTTCATAAGT-----CATTTCAACCACCTGTGCACCTTTTGTAGTCTTGGGT-------GACGCT--------CCTCTCAAAGGAAACTTTGGATTTGAA-TGCTGCAGGCG-CAAGTCCGCTTCATTCTACATCCCGGGTCTA-----TACTTTATACA--CCCTA--TTTATGTCCTA----GAATGTGATTCAG---G----GGCTTCAATGCCTTT-AAATCT--ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTT--GAAAGGCTCT--------------TGTAGTCTTTCGCTTGGAT--GTGGGGGTTGCGGGCT---TTAAC--AAGTCGGCTCCTCTTAAATGTATTAGCTGGGT----TTGCGCCTTCAGC--CTATTGGTGTGATAA-TTATCTACGGTCGTTTGCGTGTTTATCT---TTCTAGCTTCTAATCGTCCGCAAGGACAACAC--TTGACCATTTGACCT Pleurotus_abalonus_AY315806 CATTAATGAATTCAC------TCATGAAGCTG---ATGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GC-------AGAG-TTGC-----CCTCTCAGGTCAGTAAA-TGACTTGGTTGGTCGGGATTG-TCACAGTCCTGGCTTTGACTTTGTGGGTCTA---TTATCTTAT-ACA-----CACTTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--ATAGAGCTTT-----------TT-TGTGA-TATAAATTTGGATTGTTGGGGGCTGCTGGCTTT-TTACC--AAGTTGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGACAAGTCCAGCTTTCTAATTGTCTTTCAAGACAATGAC-TTGACAATTTGACCT Pleurotus_abalonus_AY315808 CATTAATGAATTCAC------TCATGAAGCTG---ATGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GC-------AGAG-TTGC-----CCTCTCAGGTCAGTAAA-TGACTTGGTTGGTCGGGATTG-TCACAGTCCTGGCTTTGACTTTGTGGGTCTA---TTATCTTAT-ACA-----CACTTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--ATAGAGCTTT-----------TT-TGTGA-TATAAATTTGGATTGTTGGGGGCTGCTGGCTTT-TTACC--AAGTTGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGACAAGTCCAGCTTTCTAATTGTCTTTCAAGACAATGAC-T?GACAATTTGACCT Pleurotus_abalonus_AY315810 CATTAATGAATTCAC------TCATGAAGCTG---ATGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GC-------AGAG-TTGC-----CCTCTCAGGTCAGTAAA-TGACTTGGTTGGTCGGGATTG-TCACAGTCCTGGCTTTGACTTTGTGGGTCTA---TTATCTTAT-ACA-----CACTTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--ATAGAGCTTT-----------TT-TGTGA-TATAGATTTGGATTGTTGGGGGCTGCTGGCTTT-TTACC--AAGTTGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGACAAGTCCAGCTTTCTAACTGTCTTTCAAGACAATGAC-TTGACAATTTGACCT Pleurotus_albidus_AF345658 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTTGGTTTTTTCCAAT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_albidus_AF345659 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAAA?C?CA-CCAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_albidus_AF345660 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGAAGAAGAAC?CAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_albidus_AF345661 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----ACACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTGCTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_albidus_KF280332 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_albidus_KF280333 ------TGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_albidus_KF280334 -------------------------------G---TTGCTGCCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCA--------------------------------------------------------- Pleurotus_albidus_KF280335 ----------------------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCA--------------------------------------------------------- Pleurotus_albidus_KF280336 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAAT---------------------------------------------------- Pleurotus_albidus_KF280337 ---------------------------------------------------------------GCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAAT---------------------------------------------------- Pleurotus_albidus_KF280338 -------------------------GGAGTTG---TTGCTGCCCTTTC-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAAT----------------------------------- Pleurotus_albidus_KF280339 -----------------------------------------------------------------------AGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAC---TTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTAC-ACA--CCCCAAATGTATGTTT-AT---GAATGTCATATAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTC-----------AT-TGTGAT-----GTTTGGAATGTTGGGGGTTGCTGGCC---TTGAC--AGGTCAGCTCCTCTTAAATGCATTAGCAGGAC-TTGTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATC-------------------------------------------------------------------- Pleurotus_australis_AY315758 CATTAATGAATTCAC------TCTTGGAGCTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATCAGT-----CCTTTCAACCACCTGTGCACTCTTGATAGATTCGTGA-------GCAG-TTAT-----TGCTTCAAGTCAAGTA--TGACTTGGT-TGCTGGGTGAAGTCAGTAGCCTAGCTTTGATGTAGCGGGTCTATA--TATCTTAC-ACA--CCCT-AATGTATGTCTAAT---GAATGTTAT-TA-CTTG----GGCCATG-TGCCTAT--AAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--ATAGCATTTT--------------TGTGC-TGTATATTTGGATTGTTGGAGGTTGCCGGCT---TTCGC-GAGTCCGGCTCCTCTTAAATGCATTAGCAGGAC--TTTTGTTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGAT-GCATGCAATGACAAGTCGAGCTCTCGAACCGTCTCTCGAGACAATCAA-TTGACAATTTGACCT Pleurotus_citrinopileatus_HM561987 CATTAATGAATTCGC------TTTTGAAGCTG--AATGCTGGCCCTTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAAAGACGG-TCG-------CC-TCACGG--------TGACTTGA--------------------ACTCCGGTGGGTC----------TA---TAACCATTACACA---CACAAACGTATGTCT-AC---GAATGTCATTTATA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTAAAT-CGTAGT-----GTTTGGATTGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTGC-TACA-TGGTGTGATAA-TTATCTACGCCAGACCGTACGCAATGATGAGTCCAGCTCTCTAATCGTCTTC--GGACAGCTTT-CTGACCATTTGACCT Pleurotus_citrinopileatus_JN234853 CATTAATGAATTCGC------TTTTGAAGCTG--AATGCTGGCCCTTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAAAGACGG-TCG-------CC-TCACGG--------TGACTTGA--------------------ACTCCGGTGGGTC----------TA---TAACCATTACACA---CACAAACGTATGTCT-AC---GAATGTCATTTATA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTAAAT-CGTAGT-----GTTTGGATTGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTGC-TACA-TGGTGTGATAA-TTATCTACGCCAGACCGTACGCAATGATGAGTCCAGCTCTCTAATCGTCTTC--GGACAGCTTT-CTGACCATTTGACCT Pleurotus_cornucopiae_AY265817 CATTAATGAATTCAC------TTTTGAAGCTG--AATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAGAGACGG-TCG-------CCTTCACGG--------TGGC------------------TTG--AACTTCGGTGGGTC----------TA----TACCATTACACA---CACAAACGTATGTCT-AT---GAATGTCATTTACA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTGAAT-CGTAGT-----GTTTGGATCGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTTGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTAC-CACA-TGGTGTGATAA-TTATCTACGCCAGACCGTATGCAATGATGAGTCCAGCTCTCTAATCGTCTTC--GGACAGCTT--TTGACCATTTGACCT Pleurotus_cornucopiae_AY450341 CATTAATGAATTCAC------TTTTGAAGCTG--AATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAGAGACGG-TCG-------CCTTCACGG--------TGGC------------------TTG--AACTTCGGTGGGTC----------TA----TACCATTACACA---CACAAACGTATGTCT-AT---GAATGTCATTTACA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTGAAT-CGTAGT-----GTTTGGATCGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTTGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTAC-CACA-TGGTGTGATAA-TTATCTACGCCAGACCGTATGCAATGATGAGTCCAGCTCTCTAATCGTCTTC--GGACAGCTT--TTGACCATTTGACCT Pleurotus_cornucopiae_DQ342325 CATTAATGAATTCAC------TTTTGAAGCTG--AATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAGAGACGG-TCG-------CCTTCACGG--------TGGC------------------TTG--AACTTCGGTGGGTC----------TA----TACCATTACACA---CACAAACGTATGTCT-AT---GAATGTCATTTACA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTGAAT-CGTAGT-----GTTTGGATCGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTTGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTAC-CACA-TGGTGTGATAA-TTATCTACGCCAGACCGTATGCAATGATGAGTCCAGCTCTCTAATCGTCTTC--GGACAGCTT--TTGACCATTTGACCT Pleurotus_cystidiosus_AY315767 CATTAATGAATTCTC-----ACGCTGAAGTTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACCTGTGCACTTTTGATAGATTC--GC-------AGAG-TCGC-----TCCCTCAAGTCAGTCAA-TGACTTGGTAGGTTGGGATTG-TCGCAGTCCTGGCTTTGACTTTGTGGGTCTATTATTATCTTAC-ACA--CCCCAAATGTATGTCC-AT---GAATGTTAT-TA-CTTG----GGCCATG-TGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATCAAATTCTCAAATCTATAGAGCGTTTT------------T-CGTGA-TATAGGTTTGGATTGCTGGGGGTTGCTGGCTT--CTGACTG-AGTCAGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAATTTATCTACGCTGGCTGTCATGCAATGACGAGTCTAGCTCTCCAATCGTCTTTCGAGACAATGAC-TTGACAATTTGACCT Pleurotus_cystidiosus_AY315774 CATTAATGAATTCAC------TCTTGAAGTTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACCTGTGCACTTTTGATAGATTC--GC-------AGAG-TCGC-----TCCCTCAAGTCAGTCAA-TGACTTGGTAGGTTGGGATTG-TCGCAGTCCTGGCTTTGACTTTGTGGGTCTATTATTATCTTAC-ACA--CCCCAAATGTATGTCC-AT---GAATGTTAT-TA-CTTG----GGCCATG-TGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATCAAATTCTCAAATCTATAGAGCGTTTT------------T-CGTGA-TATAGGTTTGGATTGCTGGGGGTTGCTGGCTT--CTGACTG-AGTCAGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAATTTATCTACGCTGGCTGTCATGCAATGACGAGTCTAGCTCTCCAATCGTCTTTCGGGACAATGAC-TTGACAATTTGACCT Pleurotus_cystidiosus_AY315777 CATTAATGAATTCAC------TCTTGAAGTTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACCTGTGCACTTTTGATAGATTC--GC-------AGAG-TCGC-----TCCCTCAAGTCAGTCAA-TGACTTGGTAGGTCGGGATTG-TCGCAGTCCTGGCTTTGACTTTGTGGGTCTATTATTATCTTAC-ACA--CCCCAAATGTATGTCC-AT---GAATGTTAT-TA-CTTG----GGCCATG-TGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATCAAATTCTCAAATCTATAGAGCGTTTT------------T-CGTGA-TATAGGTTTGGATTGCTGGGGGTTGCTGGCTT--CTGACTG-AGTCAGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAATTTATCTACGCTGGCTGTCATGCAATGACGAGTCTAGCTCTCCAATCGTCTTTCGAGACAATGAC-TTGACAATTTGACCT Pleurotus_djamor_EU424288 CATTAATGAATTTACAAAAGCTTTTGAAGTTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGTT------TGGG-TTA------TCCTTTGGTTTTTT------TCTTAATTGGAAAGGCCT--TTGGTTTCCTTAACACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATTAAGAATGGTTTATAA--TAACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTTC--TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGCTGGGGGTTGCTGGCATC-TTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAATTACTTTGACAATTTGACCT Pleurotus_djamor_FJ040176 --------------------GCTTTTGAGTTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGTT------TGGG-TTA------TCCTTTGGTTTTTT-----TTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAATTACTTTGACAATTTGACCT Pleurotus_djamor_GU722266 ---------AATTACAAAAGCTTTTGAA-TTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGT-------TTGGGTTA------TCCTTTGGTTTTTT-----TTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAATTACTTTGACAATTTGACCT Pleurotus_djamor_GU722274 ------------------AAGCTTTTGAGTTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGTT------TGGG-TTA------TCCTTTGGTTTTTT----TTTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAATTACTTTGACAATTTGACCT Pleurotus_djamor_KF280324 CATTAATGAATT-ACAAAAGCTTTTGAAGTTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGTT------TGGG-TTA------TCCTTTGGTTTTTT-----TTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAATTAC---------------- Pleurotus_djamor_KF280325 CATTAATGAATT-ACAAAAGCTTTTGAAGTTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGTT------TGGG-TTA------TCCTTTGGTTTTTT-----TTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAA-------------------- Pleurotus_djamor_KF280326 CATTAATGAATT-ACAAAAGCTTTTGAAGTTG-TTTTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGTT------TGGG-TTA------TCCTTTGGTTTTTT----TTTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG-CTAGACGCATGCAATTCTTTGTCCAGCTTTCTAATCGTCTCAAGGGACAATTACTTTGACAATTTGACCT Pleurotus_djamor_KF280327 ----------------------------GTT----TTGCTGGTCTCTAGGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGT-------TTGGGTTA------TCCTTTGGTTTTTT----TTTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTACG----------------------------------------------------------------------- Pleurotus_djamor_KF280328 ------------------------------------------------GGGACAT-TGTGCACGCTTCATTAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGT-------TTGGGTTA------TCCTTTGGTTTTTT----TTTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATC--------------------------------------------------------------------------- Pleurotus_djamor_KF280329 ----------------------------------------------------------------------TAGT--TTCCACTTCATACCCCTGTGCACCTTTGATAGATTTCGGT-------TTGGGTTA------TCCTTTGGTTTTTT----TTTCTTAAT-TGAAAGGCCT--TTGGTTTCCTTAAAACGAC-------TTCTA----TACTATACCACA--CACCAAATGTATGTTTTATAATGAATGGTTTATAA--TGACAAGGCCATGAGCCTTAT--AAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC---TATGACTTT-----------AT-TGTTGTAGCT-GTTTGGATTGTTGGGGGTTGCTGGCTTCTTTCTTTGAAGTCGGCTCCTCTTAAATGCATTAGCGGGAC---TTTGTTGCCTCTGC--GCA-TAGTGTGATAA-TTATCTTG------------------------------------------------------------------------ Pleurotus_dryinus_EU424293 CATTAATGAATTCAC------TCTTGAAGCTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATCAGTCCAATTCCCCCAACCACCTGTGCACTTTTGATAGACTC----------------------------------------------------------------------------------AC-------GTCTA------TATTATCACA--CACACTTTGTATGTCA-AT---GAATGTTACATATG-TG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTATGCCTGTTTGAGTGTCATTAAATTCTCAAACCTATATATTGCTTT--------------TGTGAGTATAGGCTTGGATTGTTGGGGGCTGCTGGCT---TTCACT--AGCCAGCTCCTCTTAAATGCATTAGCGGGAC---TCTGTTGCCTCTGCGTATA-TGGTGTGATAA-TTATCTAC-ATCAGCTGCATGCGATCAC---TCCAGCTCTCTAATTGT-------AGCAATACCCTTGACCATTTGACCT Pleurotus_dryinus_EU424294 CATTAATGAATTCAC------TCTTGAAGCTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATCAGTCCAATTCCCCCAACCACCTGTGCACTTTTGATAGACTC----------------------------------------------------------------------------------AC-------GTCTA------TATTATCACA--CACACTTTGTATGTCA-AT---GAATGTTACATATG-TG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTATGCCTGTTTGAGTGTCATTAAATTCTCAAACCTATATATTGCTTT--------------TGTGAGTATAGGCTTGGATTGTTGGGGGCTGCTGGCT---TTCACT--AGCCAGCTCCTCTTAAATGCATTAGCGGGAC---TCTGTTGCCTCTGCGTATA-TGGTGTGATAA-TTATCTAC-ATCAGCTGCATGCGATCAC---TCCAGCTCTCTAATTGT-------AGCAATACCCTTGACCATTTGACCT Pleurotus_dryinus_GU722278 -----------------------------CTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATCAGTCCAATTCCCCCAACCACCTGTGCACTTTTGATAGACTC----------------------------------------------------------------------------------AC-------GTCTA------TATTATCACA--CACACTTTGTATGTCA-AT---GAATGTTACATATG-TG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTATGCCTGTTTGAGTGTCATTAAATTCTCAAACCTATATATTGCTTT--------------TGTGAGTATAGGCTTGGATTGTTGGGGGCTGCTGGCT---TTCACT--AGCCAGCTCCTCTTAAATGCATTAGCGGGAC---TCTGTTGCCTCTGCGTATA-TGGTGTGATAA-TTATCTAC-ATCAGCTGCATGCGATCAC---TCCAGCTCTCTAATTGT-------AGCAATACCCTTGACCATTTGACCT Pleurotus_eryngii_AY368657 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTT----AGACTTGGTTTGCTGGGAT---GTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTATAACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--AG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTCTGGTTTTT-CCAAT-TGTGAT-----GTTTGGATTGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCTGGCTCTCTAACCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_eryngii_AY450347 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGAA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTT----AGACTTGGTTTGCTGGGAT---GTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTATAACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--AG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTCTGGTTTTT-CCAAT-TGTGAT-----GTTTGGATTGTTGGAGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-CTATCACTCATCAATAGCACGCATGAATGAGTCTGGCTCTCTAACCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_eryngii_EU424295 -------------------------------G---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTT----AGACTTGGTTTGCTGGGAT---GTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTATAACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--AG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTCTGGTTTTT-CCAAT-TGTGAT-----GTTTGGATTGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCTGGCTCTCTAACCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_eryngii_U04089 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTC?CAAGTCGTT----AGACTTGGTTTGCTGGGAT---GTAAACGTCTCGGTGTGACTACGCA-GTCTA---TTTACTTATAACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--AG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCT------------------------------------------------------------------------------------------------------------------------------------- Pleurotus_euosmus_AY265826 CATTAATGAATTCAC------TTTTGAAGCTG--AATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAGAGACGG-TCG-------CCTTCACGG--------TGGCTTGA--------------------ACTTCGGTGGGTC----------TA----TACCATTACACA---CACAAACGTATGTCT-AT---GAATGTCATTTACA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTGAAT-CGTAGT-----GTTTGGATCGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTAC-CACA-TGGTGTGATAA-TTATCTACGCCAGACCGTATGCAATGATGAGTCCAGCTCTCTAATTGTCTTC--GGACAGCTT--TTGACCATTTGACCT Pleurotus_euosmus_AY368659 CATTAATGAATTCAC------TTTTGAAGCTG--AATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAGAGACGG-TCG-------CCTTCACGG--------TGGCTTGA--------------------ACTTCGGTGGGTC----------TA----TACCATTACACA---CACAAACGTATGTCT-AT---GAATGTCATTTACA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTGAAT-CGTAGT-----GTTTGGATCGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTAC-CACA-TGGTGTGATAA-TTATCTACGCCAGACCGTATGCAATGATGAGTCCAGCTCTCTAATTGTCTTC--GGACAGCTT--TTGACCATTTGACCT Pleurotus_euosmus_EU424298 CATTAATGAATTCAC------TTTTGAAGCTG--AATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATTAGT---CCCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GCTGGAGAGACGG-TCG-------CCTTCACGG--------TGGCTTGA--------------------ACTTCGGTGGGTC----------TA----TACCATTACACA---CACAAACGTATGTCT-AT---GAATGTCATTTACA-TG----GGCCATGCTGCCTATAAAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTTGTGAAT-CGTAGT-----GTTTGGATCGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCGGGACTTTGTTGTTGCCTCTAC-CACA-TGGTGTGATAA-TTATCTACGCCAGACCGTATGCAATGATGAGTCCAGCTCTCTAATTGTCTTC--GGACAGCTT--TTGACCATTTGACCT Pleurotus_fuscosquamulosus_AY315788 CATTAATGAATTCAC------TCTTGAAGCTG---ATGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GT-------AGAG-TTGC-----CCTCTCAGGTCAGTCAA-TGACATGGTTGGTCGGGATTG-TAACAGTCCTGGCTTTGACTCTGCGGGTCTA---TTATCTTAC-ACAAACCCCAACTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--GTAGAGCTTT-----------ATTTGTGA-TATAGATTTGGATTGTTGGGGGCTGCTGGCT---TTTACTG-AGTTGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGATAAGTCCAGCTTTCTAACCGTCTTTCAAGACAATGAC-TTGACAATTTGACCT Pleurotus_fuscosquamulosus_AY315789 CATTAATGAATTCAC------TCTTGAAGCTG---ATGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GT-------AGAG-TTGC-----CCTCTCAGGTCAGTCAA-TGACATGGTTGGTCGGGATTG-TAACAGTCCTGGCTTTGACTCTGCGGGTCTA---TTATCTTAC-ACAAACCCCAACTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--GTAGAGCTTT-----------ATTTGTGA-TATAGATTTGGATTGTTGGGGGCTGCTGGCT---TTTACTG-AGTTGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGA?AAGTCCAGCTTTCTAACCGTCTTTCAAGACAATGAC-TTGACAATTTGACCT Pleurotus_fuscosquamulosus_KF280330 CATTAATGAATTCAC------TCTTGAAGCTG---ATGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GT-------AGAG-TTGC-----CCTCTCAGGTCAGTCAA-TGACATGGTTGGTCGGGATTG-TAACAGTCCTGGCTTTGACTCTGCGGGTCTA---TTATCTTAC-ACAAACCCCAACTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--GTAGAGCTTT-----------ATTTGTGA-TATAGATTTGGATTGTTGGGGGCTGCTGGCT---TTTACTG-AGTTGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGACAAGTCCAGCTTTCTAACCGTCTTTCAAGACAATGAC-TTGACAATTTGACCT Pleurotus_fuscosquamulosus_KF280331 ------------------------------------------------------------------TCATAAGT-----ACATTCAACCACTTGTGCACTTTTGATAGATTC--GT-------AGAGTTTGC-----CCTCTCAGGTCAGTCAA-TGACATGGTTGGTCGGGATTG-TAACAGTCCTGGCTTTGACTCTGCGGGTCTA---TTATCTTAC-ACAAACCCCAACTGTATGTCC-AT---GAATGTTATTTT-CTTG----GGCCATG-TGCCTAT-AAAACCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAATCT--GTAGAGCTTT-----------ATTTGTGA-TATAGATTTGGATTGTTGGGGGCTGCTGGCT---TTTACTG-AGTAGGCTCCTCTTAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGCCGACATGCAATGAC-------------------------------------TTTACAAGTC----- Pleurotus_ostreatus_EU424300 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACACA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTTGGTTTTTTCCAAT-TGTGAT-----GTTTGGATTGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCCAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_ostreatus_EU424309 --------------------------GAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACACA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTTGGTTTTTTCCAAT-TGTGAT-----GTTTGGATTGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCACTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCCAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_ostreatus_EU424310 --------------------------GAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACACA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTTGGTTTTTTCCAAT-TGTGAT-----GTTTGGATTGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCACTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCCAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_ostreatus_GU722281 ----------------------------GTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACACA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTTGGTTTTTTCCAAT-TGTGAT-----GTTTGGATTGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCCAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_populinus_AY368666 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAT---TTAAACGTCTCGGTGTGACTACGCG-GTCTA---TTTACTTAC-ACA--CCCTAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTCGGTTTT--CCAAT-TGTGAT-----GTTTGGAATGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_populinus_AY368667 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAT---TTAAACGTCTCGGTGTGACTACGCG-GTCTA---TTTACTTAC-ACA--CCCTAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTCGGTTTT--CCAAT-TGTGAT-----GTTTGGAATGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_populinus_AY450346 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCGTC----AGACTTGGT-TGCTGGGAT---TTAAACGTCTCGGTGTGACTACGCG-GTCTA---TTTACTTAC-ACA--CCCTAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACTTCGGTTTT--CCAAT-TGTGAT-----GTTTGGAATGTTGGGGGCTGCTGGCC---TTGAC--AGGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGTAAGGACAAT----TTGACAATTTGACCT Pleurotus_populinus_U04095 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCTCTCAAGTCG?C----AGACTTGGT-TGCTGGGAT---TTAAACGTCTCGGTGTGACTACGCG-GTCTA---TTTACTTAC-ACA--CCCTAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTG------------------------------------------------------------------------------------------------------------------------------------------------CTC-------------------------------T-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pleurotus_pulmonarius_AM269807 -------------------------------------GCTGGCCTCTAGGGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCCTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACGCA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGTTAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACATTTGGTTTTTCCA-TCTGTGAT-----GTTTGGATTGTTGGGGGTTGCTGGCT---GTAAC--AAGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_pulmonarius_GU722282 ------------------------TGG?GTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCCTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACGCA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACATTTGGTTTTTCCATC-TGTGAT-----GTTTGGATTGTTGGGGGTTGCTGGCT---GTAAC--AAGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCAATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_pulmonarius_KF280340 ----------------------------------------------------------------------TAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GTAG-TCG------TCCTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---CTAAACGTCTCGGTGTGACAACGCA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACATTTGGTTTTTCCA-TCTGTGAT-----GTTTGGATTGTTGGGGGTTGCTGGCT---GTAAC--AAGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATC-------------------------------------------------------------------- Pleurotus_pulmonarius_U04093 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCCTTCAAGTCGTC----AGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACGCA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTCT------------------------------------------------------------------------------------------------------------------------------------- Pleurotus_pulmonarius_U60648 CATTAATGAATTCAC-------TATGGAGTTG---TTGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCACTAGT------CTTTCAACCACCTGTGAACTTTTGATAGATCT--GT-------GAAG-TCG------TCCTTCAAGTCGTC----GGACTTGGTTTGCTGGGAT---TTAAACGTCTCGGTGTGACAACGCA-GTCTA---TTTACTTAACACA--CCCCAAATGTATGTCT-AC---GAATGTCATTTAA--TG----GGCCTTG-TGCCTAT-AAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTC-------ACATTT---------ATT-TGTGAT-----GTTTGGATTGTTGGGGGTTGCTGGCT---GTAAC--AAGTCGGCTCCTCTTAAATGCATTAGCAGGAC-TTCTCATTGCCTCTGC--GCA-TGATGTGATAA-TTATCACTCATCCATAGCACGCATGAATGAGTCCAGCTCTCTAATCGTCCGCAAGGACAAT----TTGACAATTTGACCT Pleurotus_rickii_KF280341 CATTAATGAATTCAC------TCTTGGAGCTGATAATGCTGGCCTCTA-GGGGCA-TGTGCACGCTTCATCAGT-ACCTCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GTCGGAAGGACGG-TCG-------C-TCCCGAG--------CGACTTGAACTCTAGCGA------------------------------GTCTA------TATTTACACA---CACACATGTATGTTT-AT---GAATGTCATTTACCTTG----GGCCATG-TGCCCATAAAACCTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTCATGAAT-TGTGGT-----GTTTGGATTGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCAGGACTTTGTTGTTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGA-TGTAAGCAATGATAAGTCCAGCTTTCCAATCGTCTTC--GGACAGCTTTATTGACCA-------- Pleurotus_rickii_KF280342 -----------------------------------------GCCTCTA-GGGGCA-TGTGCACGCTTCATCAGT-ACCTCCTTTCACACCCCTGTGCACCTTTGATAGATTC--GTCGGAAGGACGG-TCG-------C-TCCCGAG--------CGACTTGAACTCTAGCGA------------------------------GTCTA------TATTTACACA---CACACATGTATGTTT-AT---GAATGTCATTTACCTTG----GGCCATG-TGCCCATAAAACCTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACCT-------ACCTTTTGCTTCATGAAT-TGTAGT-----GTTTGGATTGTTGGGGGTTGCTGGCTTG-TCACC-G-AGTCGGCTCCTCTTAAATGCATTAGCAGGACTTTGTTGTTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGGA-TGTAAGCAATG------------------------------------------------------ Pleurotus_smithii_AY315779 CATTAATGAATTCAC------TCTTGAAGCTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAGGT-----ACATTCAACCACCTGTGCACTTTTGATAGATTC--GC-------AGA?-TCGCCTACGCCCGTCAGGTCAGTCGATTGACTTGAT-----------------AGGTCCTGGCTTGACTTTGTGGGTCTA---TTATCTTAC-ACA--CCCTGATTGCATGTCT-AT---GAATGTTAT-TA--TTG----GGCCGCG-TGCCTAT-AAAATCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATCCTCAAATCT--ATATAGCTTTT----------AT-TGTGA-TATAAATTTGGATTGTTGGGGGTTGCCGGCTTTATCAC-TG-AGTCAGCTCCTCTGAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGACTGTCATGCAATGACAAGTCCAGCTCTCTAATCGCCTTTCGAGACAATGAC-TTGACAATTTGGCCT Pleurotus_smithii_AY315780 CATTAATGAATTCAC------TCTTGAAGCTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAGGT-----ACATTCAACCACCTGTGCACTTTTGATAGATTC--GC-------AGA?????????????????????????????????TTGAT-----------------AGGTCCTGGCTTGACTTTGTGGGTCTA---TTATCTTAC-ACA--CCCTGATTGCATGTCT-AT---GAATGTTAT-TA--TTG----GGCCGCG-TGCCTAT-AAAATCTAATACAACTTTCAACAACGG??????????????????????????????????????????????????????????GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATCCTCAAATCT--ATATAGCTTTT----------AT-TGTGA-TATAGATTTGGATTGTTGGGGGTTGCCGGCTTTATCAC-TG-AGTCAGCTCCTCTGAAATGCATTA?CGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGACTGTCATGCAATGACAAGTCCAGCTCTCTAATCGCCTTTCGAGACAATGAC-TTGACAATTTGGCCT Pleurotus_smithii_AY315784 CATTAATGAATTCAC------TCTTGAAGCTG---TTGCTGGTCTCTC-GGGACA-TGTGCACGCTTCATAAGT-----ACATTCAACCACCTGTGCACTTTTGATAGATTC--GC-------AGAA-TCGCCTACGCCCGTCAGGTCAGTCGATTGACTTGAT-----------------AGGTCCTGGCTTGACTTTGTGGGTCTA---TTATCTTAC-ACA--CCCTGATTGCATGTCT-AT---GAATGTTAT-TA--TTG----GGCCGCG-TGCCTAT-AAAATCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATCCTCAAATCT--ATATAGCTTTT----------AT-TGTGA-TATAGATTTGGATTGTTGGGGGTTGCCGGCTTTATCAC-TG-AGTCAGCTCCTCTGAAATGCATTAGCGGGAC---TTTATTGCCTCTGC--GCA-CAGTGTGATAA-TTATCTACGCTGACTGTCATGCAATGACAAGTCCAGCTCTCTAATCGCCTTTCGAGACAATGAC-TTGACAATTTGGCCT ; END; BEGIN TREES; TITLE Pleurotus_sp.; LINK TAXA = Taxa1; TRANSLATE 1 Hohenbuehelia_auriscalpium_EF409725, 2 Hohenbuehelia_mastrucata_EF409736, 3 Pleurotus_abalonus_AY315806, 4 Pleurotus_abalonus_AY315808, 5 Pleurotus_abalonus_AY315810, 6 Pleurotus_albidus_AF345658, 7 Pleurotus_albidus_AF345659, 8 Pleurotus_albidus_AF345660, 9 Pleurotus_albidus_AF345661, 10 Pleurotus_albidus_KF280332, 11 Pleurotus_albidus_KF280333, 12 Pleurotus_albidus_KF280334, 13 Pleurotus_albidus_KF280335, 14 Pleurotus_albidus_KF280336, 15 Pleurotus_albidus_KF280337, 16 Pleurotus_albidus_KF280338, 17 Pleurotus_albidus_KF280339, 18 Pleurotus_australis_AY315758, 19 Pleurotus_citrinopileatus_HM561987, 20 Pleurotus_citrinopileatus_JN234853, 21 Pleurotus_cornucopiae_AY265817, 22 Pleurotus_cornucopiae_AY450341, 23 Pleurotus_cornucopiae_DQ342325, 24 Pleurotus_cystidiosus_AY315767, 25 Pleurotus_cystidiosus_AY315774, 26 Pleurotus_cystidiosus_AY315777, 27 Pleurotus_djamor_EU424288, 28 Pleurotus_djamor_FJ040176, 29 Pleurotus_djamor_GU722266, 30 Pleurotus_djamor_GU722274, 31 Pleurotus_djamor_KF280324, 32 Pleurotus_djamor_KF280325, 33 Pleurotus_djamor_KF280326, 34 Pleurotus_djamor_KF280327, 35 Pleurotus_djamor_KF280328, 36 Pleurotus_djamor_KF280329, 37 Pleurotus_dryinus_EU424293, 38 Pleurotus_dryinus_EU424294, 39 Pleurotus_dryinus_GU722278, 40 Pleurotus_eryngii_AY368657, 41 Pleurotus_eryngii_AY450347, 42 Pleurotus_eryngii_EU424295, 43 Pleurotus_eryngii_U04089, 44 Pleurotus_euosmus_AY265826, 45 Pleurotus_euosmus_AY368659, 46 Pleurotus_euosmus_EU424298, 47 Pleurotus_fuscosquamulosus_AY315788, 48 Pleurotus_fuscosquamulosus_AY315789, 49 Pleurotus_fuscosquamulosus_KF280330, 50 Pleurotus_fuscosquamulosus_KF280331, 51 Pleurotus_ostreatus_EU424300, 52 Pleurotus_ostreatus_EU424309, 53 Pleurotus_ostreatus_EU424310, 54 Pleurotus_ostreatus_GU722281, 55 Pleurotus_populinus_AY368666, 56 Pleurotus_populinus_AY368667, 57 Pleurotus_populinus_AY450346, 58 Pleurotus_populinus_U04095, 59 Pleurotus_pulmonarius_AM269807, 60 Pleurotus_pulmonarius_GU722282, 61 Pleurotus_pulmonarius_KF280340, 62 Pleurotus_pulmonarius_U04093, 63 Pleurotus_pulmonarius_U60648, 64 Pleurotus_rickii_KF280341, 65 Pleurotus_rickii_KF280342, 66 Pleurotus_smithii_AY315779, 67 Pleurotus_smithii_AY315780, 68 Pleurotus_smithii_AY315784; TREE PAUP_1 = [&R] ((1:0.13528682,2:0.07308147):0.14815152,((((51:1.0E-8,(54:1.0E-8,(52:1.0E-8,53:1.0E-8):0.00200475):1.0E-8):0.00402041,((61:0.00504677,63:0.00408748):0.0,(59:0.00203697,(60:8.9025E-4,62:1.0E-8):0.00111605):1.0E-8):0.02042862):0.0,(((40:1.0E-8,(42:1.0E-8,(41:0.0059478,43:1.0E-8):0.0):1.0E-8):0.02178137,(57:1.0E-8,(56:1.0E-8,(55:1.0E-8,58:1.0E-8):1.0E-8):1.0E-8):0.0059094):0.0,(17:1.0E-8,(6:0.0019809,((15:1.0E-8,(12:1.0E-8,16:1.0E-8):0.0):0.00222273,((14:1.0E-8,13:1.0E-8):1.0E-8,(11:1.0E-8,(10:1.0E-8,(8:0.00205837,(7:0.00412786,9:0.00412998):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.0):0.02032424):0.01111052):0.08751517,(((38:1.0E-8,(37:1.0E-8,39:1.0E-8):1.0E-8):0.14539063,(18:0.09799552,((68:1.0E-8,(66:0.00198965,67:1.0E-8):0.00198887):0.06320996,((24:0.00766482,(25:0.00197162,26:0.00174609):1.0E-8):0.03672345,((5:1.0E-8,(3:1.0E-8,4:1.0E-8):0.00376217):0.01517304,(50:0.00889412,(47:0.00185326,(49:1.0E-8,48:1.0E-8):1.0E-8):1.0E-8):0.01455713):0.03068259):0.00205632):0.04372844):0.04838992):0.0181795,((27:0.01680165,(36:0.00509422,(35:1.0E-8,(34:1.0E-8,((28:1.0E-8,30:1.0E-8):0.00968629,(33:1.0E-8,(29:0.00383159,(32:1.0E-8,31:1.0E-8):1.0E-8):1.0E-8):1.0E-8):0.00189663):1.0E-8):1.0E-8):0.00109909):0.23893631,((65:1.0E-8,64:0.0025075):0.0776093,((19:1.0E-8,20:1.0E-8):0.02265435,((23:1.0E-8,(21:1.0E-8,22:1.0E-8):1.0E-8):0.00209105,(46:1.0E-8,(44:1.0E-8,45:1.0E-8):1.0E-8):0.00207364):0.00980656):0.02239687):0.0780119):0.04336778):0.068757):0.14815152); END;