#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on July 25, 2021; 19:49 GMT TreeBASE (cc) 1994-2008 Study reference: Riser J.P., Cardinal-mcteague W.M., Hall J.C., Hahn W., Sytsma K.J., & Roalson E.H. 2013. Phylogenetic relationships among the North American cleomoids (Cleomaceae): a test of Iltis' reduction series. American Journal of Botany, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14446] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=77; TAXLABELS Carsonia_sparsifolia_449 Carsonia_sparsifolia_T6561 Carsonia_sparsifolia_T6709 Cleome_angustifolia_C325 Cleomella_angustifolia_462 Cleomella_angustifolia_507 Cleomella_angustifolia_511 Cleomella_angustifolia_B13360 Cleomella_angustifolia_H122279 Cleomella_brevipes_463 Cleomella_brevipes_499 Cleomella_brevipes_T9176 Cleomella_hillmanii_513 Cleomella_hillmanii_goodrichii_G27517 Cleomella_hillmanii_hillmanii_H14700 Cleomella_hillmanii_hillmanii_T13484 Cleomella_hillmannii_500 Cleomella_hillmannii_var._goodrichii_R7428 Cleomella_jaliscensis_514 Cleomella_longipes_501 Cleomella_longipes_504 Cleomella_longipes_508 Cleomella_longipes_W13845 Cleomella_mexicana_R32931 Cleomella_obtusifolia_466 Cleomella_obtusifolia_467 Cleomella_obtusifolia_502 Cleomella_obtusifolia_E5000 Cleomella_obtusifolia_T15037 Cleomella_palmeriana_468 Cleomella_palmeriana_505 Cleomella_palmeriana_509 Cleomella_palmeriana_H16030 Cleomella_palmeriana_H4258 Cleomella_parviflora_T15414 Cleomella_parviflora_T15694 Cleomella_perennis_510 Cleomella_perennis_H14204 Cleomella_perennis_R74105 Cleomella_plocasperma_470 Cleomella_plocasperma_517 Cleomella_plocasperma_T15581 Cleomella_plocasperma_T15647 Oxystylis_lutea_188 Oxystylis_lutea_518 Oxystylis_lutea_T11683 Peritoma_arborea_454 Peritoma_arborea_F5715 Peritoma_arborea_W12490 Peritoma_jonesii_143 Peritoma_jonesii_460 Peritoma_jonesii_C329 Peritoma_jonesii_W98270 Peritoma_lutea_461 Peritoma_lutea_H14618 Peritoma_lutea_W2510 Peritoma_multicaulis_451 Peritoma_multicaulis_O2482 Peritoma_platycarpa_404 Peritoma_platycarpa_452 Peritoma_platycarpa_M3282 Peritoma_serrulata_448 Peritoma_serrulata_521 Peritoma_serrulata_522 Peritoma_serrulata_L8811 Polanisia_dodecandra_194 Polanisia_dodecandra_310 Polanisia_dodecandra_F22 Wislizenia_californica_475 Wislizenia_californica_A15231 Wislizenia_palmeri_476 Wislizenia_palmeri_E1158 Wislizenia_palmeri_S8618 Wislizenia_palmeri_WR258 Wislizenia_refracta_473 Wislizenia_refracta_477 Wislizenia_refracta_478 ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17808] TITLE North_American_cleomoids_ITS_cpDNA; LINK TAXA = Taxa1; DIMENSIONS NCHAR=4019; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800 1810 1820 1830 1840 1850 1860 1870 1880 1890 1900 1910 1920 1930 1940 1950 1960 1970 1980 1990 2000 2010 2020 2030 2040 2050 2060 2070 2080 2090 2100 2110 2120 2130 2140 2150 2160 2170 2180 2190 2200 2210 2220 2230 2240 2250 2260 2270 2280 2290 2300 2310 2320 2330 2340 2350 2360 2370 2380 2390 2400 2410 2420 2430 2440 2450 2460 2470 2480 2490 2500 2510 2520 2530 2540 2550 2560 2570 2580 2590 2600 2610 2620 2630 2640 2650 2660 2670 2680 2690 2700 2710 2720 2730 2740 2750 2760 2770 2780 2790 2800 2810 2820 2830 2840 2850 2860 2870 2880 2890 2900 2910 2920 2930 2940 2950 2960 2970 2980 2990 3000 3010 3020 3030 3040 3050 3060 3070 3080 3090 3100 3110 3120 3130 3140 3150 3160 3170 3180 3190 3200 3210 3220 3230 3240 3250 3260 3270 3280 3290 3300 3310 3320 3330 3340 3350 3360 3370 3380 3390 3400 3410 3420 3430 3440 3450 3460 3470 3480 3490 3500 3510 3520 3530 3540 3550 3560 3570 3580 3590 3600 3610 3620 3630 3640 3650 3660 3670 3680 3690 3700 3710 3720 3730 3740 3750 3760 3770 3780 3790 3800 3810 3820 3830 3840 3850 3860 3870 3880 3890 3900 3910 3920 3930 3940 3950 3960 3970 3980 3990 4000 4010 4020 4030 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Carsonia_sparsifolia_449 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGACGTGGGTGGTTCGCCGCCCGCGACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTATTCCAAAAA-GGAATGACCTGTGAACGAGTGTTTCCACATGTGGT-GCGATAGGAC-CTTAACGGTCCTCTTGCACACCGAATCCACGGGAGCAATT-CGCGTTGCGTCGAGT-CTACTCGTCGGATCGTTGTTTCTTCCGTTGGACC-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATT-TAAACGAAACAG--CTCGTTCCTGCATGACCCTCACAA-GGTGTT-CGTCGGGGTGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTCGTCCCCC-ACTCACCC-GGTGCTT-CATGCCCGGGTGACCACGGAGATGGAGATTGGTCTCCCGTGTGTTGTTACCGCACTTGGTTGGCCCAAAATTGAGCCATGGGCGTTGAGCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGGTTA-CGTCGGTCGCTCATGTCCCAGTTGACTCTATGACCCTT-CTT-GAGCCGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGCTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------AATTTTCCT-ATATA----TAATATATAATTGACGGTATATGAAAACAAATGTATACACGCATCAGATGCATTGTTGGATTTTTAAAATTCCATTTTTATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCATATCCAGAAAAAAATTAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTT---GTTTTCTAAAAAAA---TAGCATACGTTTTGGATACCTATTCGAATCCAATTCGGAATTGGGTTAATTCTTTTTTTATTTGATAAAATTCAGAATTAAGACGTTGGTAATTAAATTAAGATCCTTGTACAAAAAAA----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCCGATTTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGATCCATAGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTAC-- Carsonia_sparsifolia_T6561 CGTAATGCTCATAATTTCCCTCTAGACCTAGCTGCTGT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCCAG-TTTAGTA-AAAAAAGGAGCAATATCAACCTA------------CTTTTTTATCTTAAAA-----AAAATATAAGATAAAA-----GAAATAAAGTTGATATTGCTCCTTCATTTATA------AAAAAAAAGATCTCAGATAGATATAGTAGTGGAGG-CCCGTGGGACAAATAATCAAATAATCAAATTTTCGTTTAGTATCATATTTTTTTTCTCTATTAACCTAATTTACTACTATTCTGTTTTT---------GCGAAATAAGT----------TTTGACCTTATTGTATTTCTATTCTCTTTTTTTCTTTTTGA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-TGTTTGGTCTTGTATTTAAGTCTTTTCCTTT-----------------------------------TTTTATTTTAGAATATATTTCTAAAAGACAATTAGATAAGACA-----AAAAAATACTAGAGTAGGGGCGGATGTAGCCAAGTGGATTAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGGAGGTTCGAATCC-TTCCGTCC--AGAG-TATAGTAATTACAGAATTAATCTTTTATT---------GCTTTTTTAAAGCATCTTT--CTCTTTCTGTTTAAGAATAAAATATTTTTTTTTTTAAGAAAATATTGAAGTGAAAAGAATTAGATTCTTCTTTCTTTTTTTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTATATAGAATTTAATACGGAATTCATTT-------GAATTCT-----GATTGAAACTTTTTT-CTCGTAAATTCTCTATTCCATTCATAGAAAACGAAAAAATAT-AGTATATTATATAT-TGACTGAACTATGACTATTCATGATTCCATAATTGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAACCTATTCCAAAAA-GGAATGACCTGTGAACGAGTGTTTCCACATGTGGT-GCGATAGGAC-CTTAACGGTCCTCTTGCACACCGAATCCACGGGAGCAATT-CGCGTTGCGTCGAGT-CTACTCGTCGGATCGTTGTTTCTTCCGTTGGACC-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATT-TAAACGAAACAG--CTCGTTCCTGCATGACCCTCACAA-GGTGTT-CGTCGGGGTGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTCGT-CCCCCACTCACCC-GGTGCTT-CATGCCCGGGTGACCACGGAGATGGAGATTGGTCTCCCGTGTGTTGTTACCGCACTTGGTTGGCCCAAAATTGAGCCATGGGCGTTGAGCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGGTTA-CGTCGGTCGCTCATGTCCCAGTTGACTCTATGACCCTT-CTT-GAGCCGCTAAGGCAGGTCTCTGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATTGTCGAGATTACAATTTTAATAAAGAGTCAATT----------CAATGCAAT-----TTAGAATTGATTTCATGAATAAAAAAAAACCATAGGG-------------------------------------------------------------ATGTCTGTAATGCAATTAAAAGATTTTTTTT---AATCTGAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GTGCTTTCATTCTTTT-CCTAGAATACAATGAAAAAT-TTAACT-AAATCAACTAGTTTTGGTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTGAATTTATCAGTTCAATTAATAAAAAAAAAAAAAAA--------GA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATATAT------TAT-AT-CCCCAAATTGTGGATAGATGCTTTTATGCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAAGAATCCTCCCGAAAGGTACCAAATTAAAAAATTGGAAC-----------TAAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------TCTACTAAAGATTTTCGATTTCCTCTAAAGAAAAAAAAGAAGAGGAAATCGAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAGGAATCCTCATTTTGGAAATAAAAAAA---TGGGAAACTTTTTTTTTTATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGTAGACAAAAGGCAAAACATTAAAAAAGGAGATCATCTTTTTTCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTTATGTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTTTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATATCCCTTCTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carsonia_sparsifolia_T6709 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTGT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCCAG-TTTAGTA-AAAAAAGGAGCAATATCAACCTA------------CTTTTTTATCTTAAAA-----AAAATATAAGATAAAA-----GAAATAAAGTTGATATTGCTCCTTCATTTATAA-----AAAAAAAAGATCTCAGATAGATATAGTAGTGGAGG-CCCGTGGGACAAATAATCAAATAATCAAATTTTCGTTTAGTATCATATTTTTTTTATCTATTAACCTAATTTACTACTATTCTGTTTTT---------GCGAAATAAGTTTTGACC---TTTGACCTTATTGTATTTCTATTCTCTTTTTTTCTTTTTGA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-TGTTTGGTCTTGTATTTAAGTCTTTTCCTTT-----------------------------------TTTTATTTTAGAATATATTTCTAAAAGACAATTAGATAAGAC------AAAAAATACTAGAGTAGGGGCGGATGTAGCCAAGTGGATTAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGGAGGTTCGAATCC-TTCCGTTCC-AGAG-TATAGTAATTACAAAATTAATCTTTTATT---------GCTTTTTTAAAGCATCTTT--CTCTTTCTGTTTAAGAATAAAATATTTTTTTTT-AAAGAAAATATTGAAGTGAAAAGAATTAGATTCTTCTTTCTTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGTATATAGAATTTAATACGGAATTCATTT-------GAATTCT-----GATTGAAACTTTTTT-CTCGTAAATTCTCTATTCCATTCATAGAAAACGAAAAAATAT-AGTATATTATATAT-TGACTGAACTATGACTATTCATGATTCCATAATTGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTAGGG-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAACCTATTCCAAAAA-GGAATGACCTGTGAACGAGTGTTTCCACATGTGGT-GCGATAGGAC-CTTAACGGTCCTCTTGCACACCGAATCCACGGGAGCAATT-CGCGTTGCGTCGAGT-CTACTCGTCGGATCGTTGTTTCTTCCGTTGGACC-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATT-TAAACGAAACAG--CTCGTTCCTGCATGACCCTCACAA-GGTGTT-CGTCGGGGTGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTCGT-CCCCCACTCACCC-GGTGCTT-CATGCCCGGGTGACCACGGAGATGGAGATTGGTCTCCCGTGTGTTGTTACCGCACTTGGTTGGCCCAAAATTGAGCCATGGGCGTTGAGCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGGTTA-CGTCGGTCGCTCATGTCCCAGTTGACTCTATGACCCTT-CTT-GAGCCGCTAAGGCAGGTCTCTGAACGCGACCCCA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleome_angustifolia_C325 -------------------------TCCGCCCTACTC--------------TATT-TCGCTAGTATT-TTTTAGTCTTAG-----------------------------------TTAAC-----------------------TTTTTTTAATA-----------------------------------------TTTTCTA------AAAAAAATAGTAGTACAT---TAGGTTAATAGATA-------AGAAAAAT---------------------------ATGATA----------CTAAAACAAAATTTGATTATTATTCAATTTTT--TTATAAAAATTTATAAAAAAAAGGAGC----------AATAT-------------CA---------------ATCTTTTTTATCTTAATATAAGATAAAGAAG---------------------GTTTATATTGCTCCTT------------------------------------------------TTTTTTTTTACTAAAC----------GAGATCTAGACTAACATTAAAGCATTATCCATTTGTGGATGG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAACCTTATCCAAAAA-GGAATGACCTGTGAACGAGTGATTACACATGCGGT-GTGTTGGGACCCTCATCGGTCGCAGCTGCTGCCTAGTCCGCGCGGCTACGT-TCGGTCCGTTGATA--CTTATCCACGGATCGCTCGTGACTGCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC--TAACGAAACAGCACTCGTTCCGGGCATCCCCTTACAA-GGAGTG-TGTTCGGGAGAGCTGCTGCGATCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCGT-CCCCCTCCCACCT-CGTGCTT-CAAGCCCGGGTGAGCATGGTGACGGATACTGGTCTCCCGTG---TGATACCGCACGCGGTTGGCCAAAAACTTAGCCACGGACGCAGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCATGCAAA-CGTCGGTCTTTCTTGTCCGAGAGAGCTCCATGACCCTCAGT--GAGCCGTCGAGACGACTCTTCGAACGCGACCCCA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_angustifolia_462 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CCTCGCGGTTCTGCTGCCCGCCGAATCCACGG-AGCGTCG-TGTGTTCCGTCGACT-ACACTCTTCGGAACGCTGTCGCCTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCGCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCTCTCACCC-GTGCTTAACACGCCCGGGTGTGCAGGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGTCCGAAAATCGAGCCATGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCTTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTTTGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAA-------TTAATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTAACTTAATGAATGACATAGATATCAATGAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA--------------------------------------------------------------------------------------------------------------------------ACTAACATTATTATTACTGATCGATAAAATTCAGAAAAAAACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATTAA-------AAAACGGGGGGGGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACT- Cleomella_angustifolia_507 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CCTCGCGGTTCTGCTGCCCGCCGAATCCACGG-AGCGTCG-TGTGTTCCGTCGACT-ACACTCTTCGGAACGCTGTCGCCTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCGCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTA{CT}AACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCTCTCACCC-GTGCTTAACACGCCCGGGTGTGCAGGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGTCCGAAAATCGAGCCATGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCTTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTTTGACCCTT-CT-GGAGCCG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAA-------TTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTAACTTAATGAATGACATAGATATCAATGAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA--------------------------------------------------------------------------------------------------------------------------ACTAACATTATTATTACTGATCGATAAAATTCAGAAAAAAACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATTAA-------AAAACGGGGGGGGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Cleomella_angustifolia_511 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CCTCGCGGTTCTGCTGCCCGCCGAATCCACGG-AGCGTCG-TGTGTTCCGTCGACT-ACACTCTTCGGAACGCTGTCGCCTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCGCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCTCTCACCC-GTGCTTAACACGCCCGGGTGTGCAGGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGTCCGAAAATCGAGCCATGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCTTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTTTGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAA-------TTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTAACTTAATGAATGACATAGATATCAATGAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA--------------------------------------------------------------------------------------------------------------------------ACTAACATTATTATTACTGATCGATAAAATTCAGAAAAAAACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATTAA-------AAAACGGGGGGGGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Cleomella_angustifolia_B13360 ------------------------------GCTGCTCT-TGAGGCT-CATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAGTTTTAGT--AAAAAGGGAGCAATATCACCCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGGTGATATTGCTCCCTCATTTCTAAA----AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAAT---------------------------AACATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCTGTTTTT---------GCGAAATCTGT----------TTTGAGCTTATT------CTA---TTTTTTTTTGTTTTTTC-AAAACAAAAAAGTAAGATGCAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGGTTTTT--------------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGG--------------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATTTTTTTCTCTTTCTGGTTAAGAATCAAATATTTTATATTT-AATAAAATATGGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATATACAATTTTATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACAAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CCTCGCGGTTCTGCTGCCCGCCGAATCCACGG-AGCGTCG-TGTGTTCCGTCGACT-ACACTCTTCGGAACGCTGTCGCCTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCGCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCTCTCACCC-GTGCTTAACACGCCCGGGTGTGCAGGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGTCCGAAAATCGAGCCATGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCTTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTTTGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTGAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAATTGGAACTTAAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAAA-TGGGAAACCTTATTTTTGATGTATATCTTGGTTTTTTTT--CATTCTAAAAAA--GGAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTCATTACTTTTTATATGT-----------------ATTCTAAAGAATTGATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTTAACGCTGTCCAATACCCCTTCTTTTTCCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_angustifolia_H122279 ------------------------------------------GGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCACCCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGGTGATATTGCTCCCTCATTTCTAAA----AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCTGTTTTT---------GCGAAATCTGT----------TTTGAGCTTATT------CTA---TTTTTTTTTGTTTTTTC-AAAACAAAAAAGTAAGATGCAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGGTTTTT--------------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTA-----------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATTTTTTTCTCTTTCTGGTTAAGAATCAAATATTTTATATTT-AATAAAATATGGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATATATACAATTTTATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACAAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CCTCGCGGTTCTGCTGCCCGCCGAATCCACGG-AGCGTCG-TGTGTTCCGTCGACT-ACACTCTTCGGAACGCTGTCGCCTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCGCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCTCTCACCC-GTGCTTAACACGCCCGGGTGTGCAGGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGTCCGAAAATCGAGCCATGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCTTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTTTGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCC----------------AAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTGAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAATTGGAACTTAAAT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTAAAGA---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAAA-TGGGAAACCTTATTTTTGATGTATATCTTGGTTTTTTTT--CATTCTAAAAAA--GGAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTCATTACTTTTTATATGT-----------------ATTCTAAAGAATTGATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTTAACGCTGTCCAATACCCCTTCTTTTTCCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_brevipes_463 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-ACGGCAGGAC-CTCCACGGTTCTGTTGCCCGCCGAATCCACGG-AGCTTCT-CGTGTTCTGTCGAGTAACACTCTTCGGAACACTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGACCCT{CG}ACAAGGGTGCT-TGTCTCGATGCGCGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCCTAACACGCCCGGGTGAACACGGAGACGGATATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTTGTGTT-A-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCGAGGCGACTCTCCGAACGCGACC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATTCTTTTTCATTTTCCT-ATATA----TAATATCTAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTAAAATTCCATTTTT--TTTTTTTA------TAGTAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT-------TTCTAAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTTTTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAA------------------------------------------- Cleomella_brevipes_499 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-ACGGCAGGAC-CTCCACGGTTCTGTTGCCCGCCGAATCCACGG-AGCTTCT-CGTGTTCTGTCGAGTAACACTCTTCGGAACACTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGACCCTGACAAGGGTGCT-TGTCTCGATGCGCGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCCTAACACGCCCGGGTGAACACGGAGACGGATATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTTGTGTT-A-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATTTCAAATTCATTGATAATAGATTCTTTTTCATTTTCCT-ATATA----TAATATCTAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTAAAATTCCATTTTT--TTTTTTTA------TAGTAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT-----TTCTAAAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTTTTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAA------------------------------------------------------------ Cleomella_brevipes_T9176 ----------------------------------------GAGGCTCCATCCATAAAT-GGATAAT-GCGTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATGAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGTTCATATTGCTCCTTCATTTAA-------AAAAAAATGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTATTACTATTCAGTTTTT---------GCGAAATCAGT----------TTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTTT---------------------------TTTTATTTTAGAATATATATTT----GACAATTAGATAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-CGAG-TATAGTAAATACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTT---AATAAAATATTGAAGTGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAAGGTTAGGGAAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-AC-GCTGGAC-CTCCACGGTTCTGTTGCCCGCCGAATCCACGG-AGCTTCT-CGTGTTCTGTCGAGTAACACTCTTCGGAACACTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGACCCTCACAAGGGTGCT-TGTCTCGATGCGCGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACTC-GTGCCTAACACGCCCGGGTGAACACGGAGACGGATATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTTGTGTT-A-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCAGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_hillmanii_513 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGACGTGGTTGGTTCGCCGCCTGCGACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCG-------AACGACCTGTGAATGAGTGTTTCCACATGCGGT-GCAGCAGAACTCTTCACGGTTCAGTTGCCCGCCGAATCCATGG-AGCCTTTTTGGGTTGTGTTGAGT-GTACTCATTGCAACTCTATTGCTTCCGTTGGAAATTCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATAA--AGATCGAAACAG--CTTGCTCTAG-ATGACCCTCACAA-GGTGTT-TGTCTGGATGCGAGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGTCTCCC-ACTCACCC-TGTGCTA-CATGCTTGGGTGAACACGGAGGCGGAGATTGGTCTCCCGTG---TGTTACCGCATGCGGTTGGCCTAAAATCGAGCCATGGACGTTGATCGTCCTGACGAGCGGTGGTGTATAAATGCCTCGTGTTTA-CGTCGTTCGATCACATCCCTCATGACTCTACGACCCTT-CT-AGAGCTGCCAAGGCATCTCTCTGAACGCGACCCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTAATACTAATAATGGAAATAATTTCAGTATGCTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCTTCATATA----TAATAGATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTTTTTTAAATTCCATTTTGA-------TA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATTAAAGGAATCTTCTTATTTTA------GATCTAAAATTACATTTTTTTT---GTTTTCTAAAAAAAAAATAGCATGCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGAGTTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAAATCCTTGTACACAAAAA----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCTATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Cleomella_hillmanii_goodrichii_G27517 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCTCTGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACTTTAT----------TTCTTTTATTTTAAAA------AAATATAAGATAAAA-----GAAATAAAGTTGATATTGCTCCTTCATTAAA-------AAAAAAATGATATCAGACAGATATAGTAGTGGAGG-CCCATGGGACAAATAATCCTATTTTTTTTAGTAGCATAT--ATCATATTTTTCTTATCTATTAAGGTCATTGACTACTATTCCGTTTTT---------GGGAAATAAGT----------TTTTAGCTTATT------CGA------------------------------------------------------------------------------------------------------------------------TTTTTTTTAGA-------------------------------------------------GTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAAAGTATATTTTTCTCTTTCTGTTTAAGAATCAATTATTT-ATTTTT-AATAAAATATTGAAGTGAGAAGAATTAGATTCTTCTTTCTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATACAGAATTCTTTT-------GAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-ATATTACTATATAC-TGACTGAATTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGCTATGGTAAAA-CT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAATGAGTGTTTCCACATGCGGT-GCAGCAGGAC-CTTCACGGTTCAGTTGCCCGCCGAATCCATGG-AGCTTTC-TGGGTTGTGTTGAGT-GTACTCATTGCAACCCTATTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATAT--AAATCGAAACAG--CTTGCTCTAG-ATGGCCCTCACAA-GGTGTT-TGTCTGGATGCGAGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CTCCCAGTCACCC-TGTGCTA-CATGCCCGGGTGAACACGGAGGCGGAGATTGGTCTCCCGTG---TGTTACTGCATGCGGTTGGCCTAAAATCGAGCCATGGACGTTGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACATCCCTCATGACTCTATGACCCTT-CT-AGAGCTGCCAAGGCATCTCTCCGAACGCGACCCCA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TGAGAATTGATTTGATGAATAAAAAAA-GTAATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTTTTCAATCTGAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GGGCTTTTATTTTTTT-CCTAGAATACGATGAAAAAT-GTAACT-AAATAAACAA------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAAAA-------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTC-AAAA-CCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATGTTTTTGTATTATACAAACAGTACAAACATAAAATTTTTTCGATCACTTAAAACAAAAAATATATGG---ATTAT-CCATAAATTGTGGATAGATGCTTTTATCCATTCAATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCCTCTTCTTTATCTTCTTTAGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAA--TCCCCATTTTGGAAATAAAAAAAA--TGTGAAACCTTATTTTTGATGGATATCTTGCCTTTTTT---CATTCTAAAAAA--GG----------GAGTTTAGGAGATAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATACGT-----------------ATTCTATAAAATTTATTTTT------AAGATAGGCTAATTCCAATTATTCTAATATTTTGTTA--------------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTTCCTAACGAAAAAGCTTTCAACGCTGTCCAATATCCCT-CTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_hillmanii_hillmanii_H14700 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACTTTAT----------TTCTTTTATCTTAAAA------AAATATAAGATAAAA-----GAAATAAAGTTGATATTGCTCCTTCATTAA--------AAAAAAATGATATCAGACAGATATAGTAGTGGAGG-CCCATGGGACAAATAATCCTATTTTTTTTAGTATCATAT--ATCATATTTTTCTTATCTATTAAGGTCATTGACTACTATTCCGTTTTT---------GGGAAATAAGT----------TTTGAGCTTATT------CGA------------------------------------------------------------------------------------------------------------------------TTTTTTTTAGA-------------------------------------------------GTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGGCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCCCAGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAAAGGATATTTTTCTCTTTCTGTTTAAGAATCAATTATTT-ATTTTT-AATAAAATATTGAAGGGAGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATACAGAATTCTTTT-------GAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-ATATTACTATATAC-TGACTGAATTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGGGGAATGCTAGGGATAAAACT?CGTTTAAAACGAGGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAATGAGTGTTTCCACATGCGGT-GCAGCAGGAC-CTTCACGGTTCAGTTGCCCGCCGAATCCATGG-AGCTTTC-TGGGTTGTGTTGAGT-GTACTCATTGCAACCCTATTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATAT--AAATCGAAACAG--CTTGCTCTAG-ATGGCCCTCACAA-GGTGTT-TGTCTGGATGCGAGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CTCCCACTCACCC-TGTGCTA-CATGCCCGGGTGAACACGGAGGCGGAGATTGGTCTCCCGTG---TGTTACTGCATGCGGTTGGCCTAAAATCGAGCCATGGACGTTGATCGTCCTGACGTGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACATCCCTCATGACTCTATGACCCTT-CT-AGAGCTGCCAAGGCATCTCTCCGAACGCGACCCCA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TGAGAATTGATTTGATGAATAAAAAAAA-TCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTTTTCAATCTGAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GGGCTTTTATTTTTTT-CCTAGAATACGATGAAAAAT-GTAACT-AAATAAACAA------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGAGAAATTTAATTTATCAGTTCAATTAATAAAAAAAAA--------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTC-AAAA-CCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACATAAAATTTTTTCGATCACTTAAAACAAAAAATATATGG---ATTAT-CCATAAATTGTGGATAGATGCTTTTATCCATTCAATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCCTCTTCTTTATCTTCTTTAGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAA--TCCCCATTTTGGAAATAAAAAAAA--TGTGAAACCTTTTTTTTGATGGATATCTTGCCTTTTTT---CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGGAGATAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATACGT-----------------ATTCTATAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTA--------------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTTCCTAACGAAAAAGCTTTCAACGCTGTCCAATATCCCTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_hillmanii_hillmanii_T13484 -------------------------------CTGCTC--TGAGGCT-CATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACTTAATTTCTTTTAATTTCTTTTATCTTATATTTTTTT------AAGATAAAAAAAAAGAAATTAAGTTGATATTGCTCCTTCATTAA--------AAAAAAATGATATCAGACAGATATAGTAGTGGAGT-CCCATGGGACAAATAATCCGATTTTTTTTAGTATCATAT--ATAATATTTTTCTTATCTATTAAGGTCATTGACTACTATTCTGTTTTT---------GGGAAATAAGT----------TTTGAGCTTATT------CGA-----TTTTTT------------------------------------------------------------------------------------------------------------TTTTTTTTTAGAATATATATTT----GTCAATTAGACAAGACAAAAAAAAAAAAGAGTAGAGTAGGGGCGGAG--------------------------------GGTAAGGCAACGGGTTTTGGGCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TAATG-------------------------------------------------------------------------AATTATTTTATTTTT-AATAAAATATTGAAGTGAGAAGAAATAGATTCTTCTTTTTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATACAGAATTCTTTT-------GAATTCTGTTCTGACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAATTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTCCCAAAC--TAGGGGG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCC-------GAACGACCTGTGAATGAGTGTTTCCACATGCGGT-GCAGCAGAACTCTTCACGGTTCAGTTGCCCGCCGAATCCATGG-AGCCTTTTTGGGTTGTGTTGAGT-GTACTCATTGCAACTCTATTGCTTCCGTTGGAAATTCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATAA--AGATCGAAACAG--CTTGCTCTAG-ATGACCCTCACAA-GGTGTT-TGTCTGGATGCGAGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGT-CTCCCACTCACCC-TGTGCTA-CATGCTTGGGTGAACACGGAGGCGGAGATTGGTCTCCCGTG---TGTTACCGCATGCGGTTGGCCTAAAATCGAGCCATGGACGTTGATCGTCCTGACGAGCGGTGGTGTATAAATGCCTCGTGTTTA-CGTCGTTCGATCACATCCCTCATGACTCTACGACCCTT-CT-AGAGCTGCCAAGGCATCTCTCTGAACGCGACCCCA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TGAGAATAGATTTGATGAATAAAAAAAA-TCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTCAAAGATTTTTTTTTTCAATCTGAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GGGCTTTTATTTTTTTTCCTAGAATACGATGAAAAAT-GTAACT-AAATAAACAA------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAAATAAAAAAAAAA------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTC-AAAA-CCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATAT---------------------------ACAGTACAAACATAAAATTTTTTCGATCACTTAAAACAAAAAATATATAT---ATTAT-CCATAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGATTCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCCTCTTCTTTATCTTCTTTAGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAA--TCCCCATTTTGGAAATAAAAAAAAAATGTGAAACCTTATTTTTGATGGATATCTTGCCTTTTT----CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGGAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATACGT-----------------ATTCTATAAAATTGATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATATCCCT-CTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_hillmannii_500 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGACGTGGTTGGTTCGCCGCCTGCGACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCG-------AACGACCTGTGAATGAGTGTTTCCACATGCGGT-GCAGCAGAACTCTTCACGGTTCAGTTGCCCGCCGAATCCATGG-AGCCTTTTTGGGTTGTGTTGAGT-GTACTCATTGCAACTCTATTGCTTCCGTTGGAAATTCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATAA--AGATCGAAACAG--CTTGCTCTAG-ATGACCCTCACAA-GGTGTT-TGTCTGGATGCGAGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGTCTCCC-ACTCACCC-TGTGCTA-CATGCTTGGGTGAACACGGAGGCGGAGATTGGTCTCCCGTG---TGTTACCGCATGCGGTTGGCCTAAAATCGAGCCATGGACGTTGATCGTCCTGACGAGCGGTGGTGTATAAATGCCTCGTGTTTA-CGTCGTTCGATCACATCCCTCATGACTCTACGACCCTT-CT-AGAGCTGCCAAGGCATCTCTCTGAACGCGACCCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTAATACTAATAATGGAAATAATTTCAGTATGCTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCTT-CATATA---TAATAGATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTTTTTTAAATTCCATTTTG-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATTAAAGGAATCTTCTTATTTTA------GATCTAAAATTACATTTTTTTT---GTTTTCTAAAAAAAAAATAGCATGCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGAGTTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAAATCCTTGTACACAAAAA----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCTATTGAATTTCAAGTATTCAGTTTCACTAATAAGATAC------------ Cleomella_hillmannii_var._goodrichii_R7428 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACTTTAT----------TTCTTTTATTTTAAAA------AAATATAAGATAAAA-----GAAATAAAGTTGATATTGCTCCTTCATTAAA-------AAAAAAATGATATCAGACAGATATAGTAGTGGAGG-CCCATGGGACAAATAATCCTATTTTTTTTAGTAGCATAT--ATCATATTTTTCTTATCTATTAAGGTCATTGACTACTATTCCGTTTTT---------GGGAAATAAGT----------TTTTAGCTTATT------CGA------------------------------------------------------------------------------------------------------------------------TTTTTTTTAGA-------------------------------------------------GTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAAAGTATATTTTTCTCTTTCTGTTTAAGAATCAATTATTT-ATTTTT-AATAAAATATTGAAGTGAGAAGAATTAGATTCTTCTTTCTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATACAGAATTCTTTT-------GAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-ATATTACTATATAC-TGACTGAATTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGCTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAATGAGTGTTTCCACATGCGGT-GCAGCAGGAC-CTTCACGGTTCAGTTGCCCGCCGAATCCATGG-AGCTTTC-TGGGTTGTGTTGAGT-GTACTCATTGCAACCCTATTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATAT--AAATCGAAACAG--CTTGCTCTAG-ATGGCCCTCACAA-GGTGTT-TGTCTGGATGCGAGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CTCCCAGTCACCC-TGTGCTA-CATGCCCGGGTGAACACGGAGGCGGAGATTGGTCTCCCGTG---TGTTACTGCATGCGGTTGGCCTAAAATCGAGCCATGGACGTTGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACATCCCTCATGACTCTATGACCCTT-CT-AGAGCTGCCAAGGCATCTCTCCGAACGCGACCCCA-GG-AAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TGAGAATTGATTTGATGAATAAAAAAA-GTAATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTTTTCAATCTGAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GGGCTTTTATTTTTTT-CCTAGAATACGATGAAAAAT-GTAACT-AAATAAACAA------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAAAA-------------GAATCATTTTATTTTT--AGAAAAA-TTCATTCTTCTC-AAAA-CCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACATAAAATTTTTTCGATCACTTAAAACAAAAAATATATGG---ATTAT-CCATAAATTGTGGATAGATGCTTTTATCCATTCAATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCCTCTTCTTTATCTTCTTTAGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAA--TCCCCATTTTGGAAATAAAAAAAA--TGTGAAACCTTATTTTTGATGGATATCTTGCCTTTTTT---CATTCTAAAAAA--GG----------GAGTTTAGGAGATAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATACGT-----------------ATTCTATAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTA--------------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTTCCTAACGAAAAAGCTTTCAACGCTGTCCAATATCCCTTC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_jaliscensis_514 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTCACGGTTCCGTTGCCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ATGCTCCTCGGAACGCTGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-CGTCGTTCGATCACGTCCGCATTGACTCCATGACCCTT-CC-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTACTTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTAATTTTAGATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAAGAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGGCTTACTT Cleomella_longipes_501 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTCAAGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ATGCTCCTCGGAACGCTGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-CGTCGTTCGATCACGTCCGCATTGACTCCATGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTACTTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTAATTTTAGATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAAGAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGGCTTACTT Cleomella_longipes_504 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTCAAGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ATGCTCCTCGGAACGCTGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-CGTCGTTCGATCACGTCCGCATTGACTCCATGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTACTTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTAATTTTAGATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAAGAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGGCTTACT- Cleomella_longipes_508 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTCAAGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ATGCTCCTCGGAACGCTGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-CGTCGTTCGATCACGTCCGCATTGACTCCATGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTACTTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTAATTTTAGATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAAGAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGGCTTACTT Cleomella_longipes_W13845 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACTTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCAAA------AAATTGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCGGAA----AAAAAAACGATTTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCTGTTTTT---------GCGAAATCAGT----------TTTGAGCTTATT------CTA---TTTTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTTT---------------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAACAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATTGCTTTTTTTGCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTGATTTTT-AATAAAATATTGAAGTGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATCTACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAACTATAGAGGAAGGTTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTCACGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ATGCTCCTCGGAACGCTGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-CGTCGTTCGATCACGTCCGCATTGACTCCATGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTACTTTCATTTTTTT-CCTGGAATACAATGAAAAAT-GGAACT-AAATAAACTA------GTTTTGACTTCAATCCAAAGACAGAACTGAAAATGATAAATTTAATTTATCAGTTCAATAAAAAAAAAAA----------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTCGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATATTTTAGATCACTTAAAACAATATAT---------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAAAAATTCACAGAAGGAATCATTCCGAAAGGTACAAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--GCCCCTTTTTGGAAATCAAAAAAAA--GGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTGTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTACAACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_mexicana_R32931 ------------------------------GCTGCTC--TGAGGCT-CATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTGGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCAAA------AAATTGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCGGAAA---AAAAAAACGATTTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCTGTTTTT---------GCGAAATCAGT----------TTTGAGCTTATT------CTA--TTTTTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTTT-------------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAACAC------AAAAAATTGTAGAGTAGGG--------------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAGGTATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTATCTTTCTGTTTAAGAATCAAATATTTGATTTTT-AATAAAATATTGAAGGGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATCTACAATTTAATACGGAATTCTTTT-------GAATTCT-----CACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATTC-TGTCTGATCTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGGGGAAGGTTAGGGAAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGGC-CTTCACGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-CGTGTTCCGTCGAGC-ACGCTCCTCGGAACGCCGTCGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTAG-ACAGCCCTCACAA-GGTGCT-TGTCTGGAGGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCGTGCTAA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTACTTTCATTTTTTT-CCTGGAATACAATGAAAAAT-GGAACT-AAATAAACTA------GTTTTGACTTCAATCCAAAGACAGAACTGAAAATGATAAATTAAATTTATCAGTTCAAAAAAAAAAAAAA----------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTCGAAAAAGAAATT-CAATT-AATAATTATCTAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATAT---------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAAAAATTCACAGAAGGAATCATTCCGAAAGGTACAAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTAAAGA---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAAA--GGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTGTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTACAACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTT--CCAAGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_obtusifolia_466 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACGGGAC-CTTCGCGGTTCCGTTGCCCGCCGAATCCACGG-AGCTTCG-TGCGTTCCGTCGAGT-ACACTCTTCGGGACACCGTCGCTTCCGT{CG}GGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATG-AAACCGAAACAG--CTCGCTCCAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACCCACCC-GTGCTCAACACGCACGGGTGTACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTATGACCCTT-CC-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATCGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCAATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATTAAAAAATT-AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGGAGACTTACTT Cleomella_obtusifolia_467 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACGGGAC-CTTCGCGGTTCCGTTGCCCGCCGAATCCACGG-AGCTTCG-TGCGTTCCGTCGAGT-ACACTCTTCGGGACACCGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATG-AAACCGAAACAG--CTCGCTCCAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACCCACCC-GTGCTCAACACGCACGGGTGTACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTG-CGTCGTTCGATCACGTCCGCAGTGACTCTATGACCCTT-CC-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATCGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCAATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATTAAAAAATT-AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Cleomella_obtusifolia_502 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACGGGAC-CTT{CT}GCGGTTCCGTTGCCCGCCGAATCCACGG-AGCTTCG-TGCGTTCCGTCGAGT-ACACTCTTCGGGACACCGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATG-AAACCGAAACAG--CTCGCTCCAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACCCACCC-GTGCTCAACACGCACGGGTGTACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTATGACCCTT-CC-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATCGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCAATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATTAAAAAATT-AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Cleomella_obtusifolia_E5000 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCCGTTTTT---------GCGAAATCAGTTTCGAGCTTATTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTTTT------------------------TTTTATTTTAGAATATAT---------ACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGTATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTGCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGGGGAAGGTTAGGGTAAAA-CTCCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACGGGAC-CTTCGCGGTTCCGTTGCCCGCCGAATCCACGG-AGCTTCG-TGCGTTCCGTCGAGT-ACACTCTTCGGGACACCGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATG-AAACCGAAACAG--CTCGCTCCAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACCCACCC-GTGCTCAACACGCACGGGTGTACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTG-CGTCGTTCGATCACGTCCGCAGTGACTCTATGACCCTT-CC-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA-GG-AAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAACT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GTGCTTTTATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATTAAAAAAAAAA-----------------AATCATTTGATTTTT--CGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATTAT-CCACAAATTGTGAATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTAAAGA---AAAAGAAGATGAAATCTAAGATCTTTA-----GCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTT-GGAAATCAAAAAAA-TGGGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTGATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_obtusifolia_T15037 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCTATTTTTTT------AAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCCGTTTTT---------GCGAAATCAGTTTCGAGCTTATTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTTTT------------------------TTTTATTTTAGAATATAT---------ACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTGCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACGGGAC-CTTCGCGGTTCCGTTGCCCGCCGAATCCACGG-AGCTTCG-TGCGTTCCGTCGAGT-ACACTCTTCGGGACACCGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATG-AAACCGAAACAG--CTCGCTCCAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACCCACCC-GTGCTCAACACGCACGGGTGTACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTATGACCCTT-CC-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAACT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GGGCTTTTATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATTAAAAAAAAAA-----------------AATCATTTGATTTTT--CGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATTAT-CCACAAATTGTGAATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GAATTTCTCCT------------------AAAGATCTTAGATTTCATCTAAAGA---AAAAGAAGATGAAATCTAAGATCTTTA-----GCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTT-GGAAATCAAAAAAA-TGGGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACTTTAAAAAAGGAGATGGTCTTTTTCCTATAGATTACTTTTTATATGT-----------------ATTCTAAAGAATTGATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTT--CCAAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_palmeriana_468 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCCGTGAACGAGTGTTTCCACACGC{AC}GT-GCGGCAGGAC-CCTCGCGGCCCTGTCGCCTGCCGAATCCACGG-AGCTTCG-CGTGTTCCGTCGAGT-ATACTCTTTGGAACGCCGATGCTTCCGCTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATCAAAAACGAAACAG--CTCGCTCTAG-GCCGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCCTAACACGCTCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCC---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTAAAATTCCATTTTT-------ATATAGGAATAGGAGATTTATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATCCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTTATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATAC------------ Cleomella_palmeriana_505 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCCGTGAACGAGTGTTTCCACACGCAGT-GCGGCAGGAC-CCTCGCGGCCCTGTCGCCTGCCGAATCCACGG-AGCTTCG-CGTGTTCCGTCGAGT-ATACTCTTTGGAACGCCGATGCTTCCGCTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATCAAAAACGAAACAG--CTCGCTCTAG-GCCGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCCTAACACGCTCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCCTAGTGACTCTATGACCCTT-CT-GGAGCCG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATATAGGAATAGGAGATTTATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATCCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGAGCATTATTATTACTGATCGATAAA{AG}TTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTTATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATAC------------ Cleomella_palmeriana_509 --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTCTTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCCGTGAA{CT}GAGTGTTTCCACA{CT}GCAGT-GCGGCAGGAC-CCTCGCGGCCCTGTCGCCTGCCGAATCCACGG-AGCTTCG-CGTGTTCCGTCGAGT-ATACTCTTTGGAACGCCGATGCTTCCGCTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATCAAAAACGAAACAG--CTCGCTCTAG-GCCGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCCTAACACGCTCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCCTAGTGACT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATATAGGAATAGGAGATTTATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATCCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTTATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATAC------------ Cleomella_palmeriana_H16030 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCTATTTTTTT------AAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTAAAATCTAAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATAATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCCGTTTTT---------GCGAAATCCGT----------TTTGAGTTTATT------CTA-----TTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTTTTTGTGTGTGTGTGTGTGTGTT----------------------TTTTATTTTAGAATATCTATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTCTTGTATTT----CTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGAT-CCTAATCCGAAAA-GGAACGACCCGTGAACGAGTGTTTCCACACGCAGT-GCGGCAGGAC-CCTCGCGGCCCTGTCGCCTGCCGAATCCACGG-AGCTTCG-CGTGTTCCGTCGAGT-ATACTCTTTGGAACGCCGATGCTTCCGCTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATCAAAAACGAAACAG--CTCGCTCTAG-GCCGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCCTAACACGCTCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCCTAGTGACTCTATGACCCTT-CT-GGAGCCGCCAAGG-GACTCTCCGAACGCGACCCCA---AAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTGAATTTATCAGTTCAATTCAAAAAAAAAAAAA------------GAATCATTTTATTTTT--CGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTATC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATT----------TTGTGGATAGATGCTTTTATCCATTCGATTCCAAGC-AAAAGGTATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTTGATTTCATCTTCTTT---------AGATGAAATCAAAGATCTTTATTATTGCATCAAGTTACTAATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAA--TGGGAAAC--------TGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG----------------------------------------------------------TTATGGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTAGTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAGTACCCCT-CTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_palmeriana_H4258 ----------------------------------------GAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGCT--GGTTGATATTGCTCCTTCATTTCTAAAATCTAAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATAATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCCGTTTTT---------GCGAAATCCGT----------TTTGAGCTTATT------CTA-----TTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTTTTTGTGTGTGTGTGTGTGTGTT----------------------TTTTATTTTAGAATATCTATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGCGGAGAGCC-----------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------TCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CCTCGCGGCCCTGTAGCCCGCCGAATCCACGG-AGCTTCG-CGTGTTCCGTCGAGT-ATACTCTTTGGAACGCCGATGCTTCCGCTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATCAAAAACGAAACAG--CTCGCTCTAG-GCTGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCCTAACACGCTCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACTGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCCTAGTGACTCTATGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTGAATTTATCAGTTCAATTCAAAAAAAAA----------------GAATCATTTTATTTTT--CGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTATC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATT----------TTGTGGATAGATGCTTTTATCCATTCGATTCCAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTTGATTTCATCTTCTTT---------AGATGAAATCAAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAA--TGGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG----------------------------------------------------------TTATGGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTAGTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_parviflora_T15414 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCTATTTTTTT------AAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTAA-------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGAC-------------------------------ATCATATTTTTCTTATCTATTAAAGTAATTTATTACTATTCAGTTTTT---------GTGAAATCAGT----------TTTGAGCTTATT------CTA----TTTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGCGTGTGTGTGTGTTT-----------------------TTTTATTTTAAAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGGCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TATAGTAAATACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCAGCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTTTTT---AATAAAATATTGAAGGGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTTGAATTTTGAATTCT-----GACTGAAATTTTTTT-CTCGGAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCAAAAC--TAGAGGAAGGTTAGGGAAAAA-CTCCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCCAAAA-GGAACGACCTGTGAACGAGTGTTTCCATACGCGGT-GCGGCAGGAC-CTCCGCGGTTCTGTTGCCCGCCGAATCCACGG-AGCTCCG-TGTGTTCCGTGGAGT-ATACTCTTCGGAACACTGTTGCTTCTGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-ATAACGAAACAG--CTCGCTCTAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCCTAACACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGAATAGATTCCTCGTGTTTA-CGTCGTTCGATCGCGTCCATAGTGACTCTATGACCCTT-CT-GGAGCCGCCTAGGCGTCTCTCCGAACGCGACCCCA-GG-------------------------------------------------------------------------ATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCACAGGGATGTATGTAATGCAATTAAAAACAATTTAGAATGGATTTGATGAATAAAAAAACCACAGGGATGTATGTAATGCAATTAAAAGATTTTTTT---GAATTGTAGTTACTTCAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAACGATAAATTCAATTTATCAGTTCAATAAAAAAAAAAAA---------------GAATCATTTTATTTTT---GAAAAAATTCATACTTATCGAAAA-TCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGCAAATTTTTTAGATCACTTAAAACAATATATAT-------ATTAT-CCCCAAATTGTGGATAGATGCTTTTATCCCTTCGATTACAAGC-AAAAGATATAATAATTCACAGAAAGAATCCTTCCGAAAGGTACCAAATTCAAAACTTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTTCTTT---------CGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATAAAAAAAAAA--GGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTCTTTTTAAGTTTAAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTACAACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCTTCTTGT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_parviflora_T15694 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCTATTTTTTT------AAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTTA-------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGAC-------------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTATTACTATTCAGTTTTT---------GTGAAATCAGT----------TTTGAGCTTATT------CTA---TTTTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGCGTGTGTGTGTGTTT-----------------------TTTTATTTTAAAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAAATACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCAGCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTTTTT---AATAAAATATTGAAGTGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTTT-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGGAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCAAAAC--TAGAGAAATGTTAGGGTAAAA-CT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCCAAAA-GGAACGACCTGTGAACGAGTGTTTCCATACGCGGT-GCGGCAGGAC-CTCTGCGGTTCTGTTGCCCGCCGAATCCACGG-AGCTCCG-TGTGTTCCGTGGAGT-ATACTCTTCGGAACACTGTTGCCTCTGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-ATAACGAAACAG--CTCGCTCTAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCCTAACACGCCTGGGTGAACACGGTGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGAATAGATTCCTCGTGTTTA-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCACAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATTGTAGTTACTTCAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAACGATAAATTCAATTTATCAGTTCAATAAAAAAAAAAAA---------------GAATCATTTTATTTTT---GAAAAAATTCATACTTATCGAAAA-TCCTTTTGCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGCAAATTTTTTAGATCCCTTAAAACAATATATAT-------ATTAT-CCCCAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCCCAGAAAGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCGAAAGA---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAAA-TCCCCTTTTTGGAAATAAAAAAAAAA--GGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAC--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTCTTTTTAAGTTTAAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTACAACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCTTCTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_perennis_510 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTC{AC}CGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ACGCTCCTCGGAACGCTGTTGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATG-AAAACG{AG}AACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAAAAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCACGGGCGTTGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTACTTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTAATTTTAGATCTAAAATTCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAAGAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAA--------- Cleomella_perennis_H14204 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCAAA------AAATTGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCGGAA----AAAAAAATGATTTCAGATAGATATAGTAGTGGAGG-CCCATGGGCCAAATA--------------------------ATCATATTTTTCTTATCTATTAAGCTAATTTACTACTATTCTGTTTTT---------GCGAAATCAGT----------TTTGAGCTTATT------CTA---TTTTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTTT-------------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAACAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCCCTTCCGTTCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTGATTTTT-AATAAAATATTGAAGTGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATCTACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGAC-CTTCAAGGTTCCGTTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ATGCTCCTCGGAACGCTGTCGCTTCCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTGG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAAACGTCGTTCGATCACGTCCGCATTGACTCCATGACCCTT-CT-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-GGAACCAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTACTTTCATTTTTTT-CCTGGAATACAATGAAAAAT-GGAACT-AAATAAACTA------GTTTTGACTTCAATCCAAAGACAGAACTGAAAATGATAAATTAAATTTATCAGTTCAATAAAAAAAAAAA----------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTCGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATAT---------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAAAAATTCACAGAAGGAATCATTCCGAAAGGTACAAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTAAAGA---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAAA--GGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTGTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTACAACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTTT-CCAAGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_perennis_R74105 ---------------------------------GCTC--TGAGGCT-CATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTGGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCAAA------AAATTGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCGGAAA---AAAAAAACGATTTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTCTCTATTAAGGTAATTTACTACTATTCTGTTTTT---------GCGAAATCAGT----------TTTGAGCTTATT------CTA--TTTTTTTTTTGTTTTGAA-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTTT-------------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAACAC------AAAAAATTGTAGAGTAGGG-CGGA---------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTATCTTTCTGTTTAAGAATCAAATATTTGATTTTT-AATAAAATATTGAAGTGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATCTACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTCCCAAAC--TAGAGGAAGGTTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCGGCGGGGC-CTTCACGGTTCCGCTGTCCGCCGAATCCACGG-GGCTTCT-TGTGTTCCGTCGAGC-ACGCTCCTCGGAACGCTGTCGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTAG-ACAGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCGCTCACCC-GTGCTTAACAAACCCGGGTGTGCACGGAGACGGAGACTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAACCGAGCCACGGGCGTTGATCGTCCTGACGAGCGGTGGTGTACAGATGCCTCGTGCTAA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTTTCT-GGAGCCGCTAAGGCGACTCTCCGAACGCGACCCCA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Cleomella_plocasperma_470 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CTCCGCGGTTCTGTTGCCCGCCGAATCCACGG-AGCTCC--CGTGTTCCGTCGAGT-ATACTCTTCGGAACGCTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCGTCCCCCCAATCACCC-GCGCCTAACACGCACGGGTGAACATTGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCTGACGAGCGGTGGTGCATAGATTCCTCGTGTTTA-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCTAGGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------TATTTTCCT-ATATA----TAATATCTAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT------TTTCTAAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCAATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTTACTAATAAGATACGAAGACTTACTT Cleomella_plocasperma_517 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CTCCGCGGTTCTGTTGCCCGCCGAATCCACGG-AGCTCC--CGTGTTCCGTCGAGT-ATACTCTTCGGAACGCTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCGTCCCCCCAATCACCC-GCGCCTAACACGCACGGGTGAACATTGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCTGACGAGCGGTGGTGCATAGATTCCTCGTGTTTA-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------TATTTTCCT-ATATA----TAATATCTAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTT------TTTCTAAAAAAAA-----------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCAATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTTACTAATAAGATACGGAGACTTACTT Cleomella_plocasperma_T15581 ------------------------------GCTGCTC--TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCTATTTTTTT------AAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTAA-------AAAAAAATGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTATTACTATTCCGTTTTT---------GCGAAATAAGT----------TTTGAGCTTATT------CTA------CTTTTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCGTTGTGTGTGTGTGTGTTTT------------------------TTTTATTTTAGAATATATACTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTA-----------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTTTTT---AATAAAATATTGAAGTGCGAAGAATTCGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAACGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAAGGTTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CTCCGCGGTTCTGTTGCCCGCCGAATCCACGG-AGCTCC--CGTGTTCCGTCGAGT-ATACTCTTCGGAACGCTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCGTCCCCCCAATCACCC-GCGCCTAACACGCACGGGTGAACATTGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCTGACGAGCGGTGGTGCATAGATTCCTCGTGTTTA-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-GG-AAC-ATACTAACAAATTTTGATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTCGAATGGATTTGATGAATAAAAAAA--CCACAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTA------GTTTTGACTTCAATCAAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATAAAAAAAAAAAAAA-------------GATCCATTTTATTTTT---GAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCCCTTAAAACAATATATAT-------ATTAT-CCCCAAATTGTGGATAGATGTTTTTATCCATTCGATTACCAGCCAAAAGATATAATAATTCCCAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAAGTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTGCTCCT------------------AAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCCTGTTGGAAATAAAAAAAAAAAGGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACTTTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGTGATTCCTTTTTATATGTATTCTAAAGAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-GTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Cleomella_plocasperma_T15647 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTC-ATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTAAA-------AAAAAAATGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTATTACTATTCCGTTTTT---------GCGAAATAAGTTTT----------GAGCTTATT------CTA--------CTTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCGTTGTGTGTGTGTGTGTTTTTTTT------------------------ATTTTAGAATATATACTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGA--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGAT-CCTAATCCG-AAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGGCAGGAC-CTCCGCGGTTCTGTTGCCCGCCGAATCCACGG-AGCTCC--CGTGTTCCGTCGAGT-ATACTCTTCGGAACGCTGTTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCGAG-ACGGCCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGTG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTCGT-CCCCCAATCACCC-GCGCCTAACACGCACGGGTGAACATTGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCTGACGAGCGGTGGTGCATAGATTCCTCGTGTTTA-CGTCGTTCGATCGCGTCCATCGTGACTCTATGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Oxystylis_lutea_188 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCTC-CGGCTCTGTCGCCCGCCGAATCCACGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACACCGTCGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAATCGAAACAG--CCCGCTCCGG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGTGAACGCGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATTGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCGCCGTGACTCTACGACCCTT-GT-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTGATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCTAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAAGTTAATGAATGCCATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTTT-GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAAAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCA------------------------------ Oxystylis_lutea_518 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACGGGAC-CCTC-CGGCTCTGTCGCCCGCCGA{AC}TCCACGG-A{GT}CTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCCGTCGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAATCGAAACAG--CCCGCTCCGG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGTGAACGCGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATTGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCGCCGTGACTCTACGACCCTT-GT-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAATACATATGTATCCCTGATTTTTAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAAGTTAATGAATGCCATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTTT-GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAAAAAAAAAA------------------------------------------------------------------- Oxystylis_lutea_T11683 CGTAATGCTCATAACTTTCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GTTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCAGTTTTT---------GCGAAATCAGTTTTGAGCTTGTTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTTTTTTTTTTTATTTTAGAATATATATTTGTTTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGGCCCGCTATTCGTAGGTTCGAATCCCTTCCGTCCC-AGAG-TATAGTACTTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTTTCTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGGGGAATGTTAGGGAAAAA-CTCCGTTTAAAACGAGGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGTTGCGACAGGAC-CCTCCGGCTCT-GTCGCCCGCCGAGTCCACGG-ATCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCCGTCGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAATCGAAACAG--CCCGCTCCGG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGTGAACGCGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATTGATGCCTCGTGTTTA-CGTCGTCCGATCACGTCCGCCGTGACTCTACGACCCTT-GT-GGAGCCGCCGAGGCGACTCTCCGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGGAAAAT-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATTATAAATTCAATTTATCAGTTCAATTAAAAAAAAAAAAA-------------GAATCTTTTTTTTTTTTTCGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAA--TGGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTTTTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTT--CCAAGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Peritoma_arborea_454 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCTGCAACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCGCTGTTGTGCTGCCCGCC-----CACGG-AGCTCCG-AGTGTTGCGTCGAGT-GTACTCTTCGCGACGCCGGTGCTTCCGTTGGAGA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACGG--CTCGCTCTAG-ACGGCCCTCACAA-GGTGTTCTGTCTGGATGCGTGTCTGCG-TCACAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGAACGCGGTTGGCCCAAAATCGAGCCAAGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGCTCA-CGTCGTTCGATCACGTCCCTCACGACTCAGCGACCCTT-CT-AGAGCTGCTAAGGCGACTCTCCGAACGCGACCCTA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTGATTTAAAATTCATTGATAATCGATT------CATTTTCCC-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTGTTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATTAAAGGAATCTTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCTAAAAAAAAA-TAGCATGCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGGTTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAAAA---------------------------------------ACGACCATTATTATTACT----GTTAA------GATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTC------------------------- Peritoma_arborea_F5715 CGAAAAGCTCATAACTTTCCCCTAGACCCAGCTGCTCT-TGGGGCTC-ATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTCTATTTTTTT------AAGATAAAA-----AGGTT--GGTTGATATTGCT--------------AAAAAAAAAAATGATATCAGATAGATATAGTAGGGGAGG-CCTATGGGACAAATAATCCGAT--------TTTTTTTTAGTATCATATTTTTCTTATCTATTAAGGTAATTGACTACTATTTTGTTTTT---------GCGAAATAAGTTTTGA-----TTTGAGCTTATT------CTA--------TTTTTTTTTTTC-AAAACAAAAAAGTAAAATGGAATTTTGTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTTTTTTTTTT---------------------------------AGAATCTATATTT----GTCAATTAGACAAGAC------AAAAAATAGTAGAGTAGGGGCGGAGGTAACCAAGGGGATAAAGGCGGGGGATTGGGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGAGAAGAATTAGATTCTTCTTTCTTTTTTTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTGCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCGCTGTTGTGCTGCCCGCC-----CACGG-AGCTCCG-AGTGTTGCGTCGAGT-GTACTCTTCGCGACGCCGGTGCTTCCGTTGGAGA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACGG--CTCGCTCTAG-ACGGCCCTCACAA-GGTGTTCTGTCTGGATGCGTGTCTGCG-TCACAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGAACGCGGTTGGCCCAAAATCGAGCCAAGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGCTCA-CGTCGTTCGATCACGTCCCTCACGACTCAGCGACCCTT-CT-AGAGCTGCTAAGGCGACTCTCCGAACGCGACCCTA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Peritoma_arborea_W12490 CGTAATGCTCATAACTTTCCCCTAGACCCAGCTGCTCT--GAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTCTATTTTTTT------AAGATAAAA-----AGGTT--GGTTGATATTGCT--------------AAAAAAAAAAATGATATCAGATAGATATAGTAGTGGAGG-CCTATGGGACAAATAATCCGAT-------TTTTTTTTTAGTATCATATTTTTCTTATCTATTAAGGTAATTGACTACTATTTTGTTTTT---------GCGAAATAAGTTTTGA-----TTTGAGCTTATT------CTA--------TTTTTTTTTTTC-AAAACAAAAAAGTAAAATGGAATTTTGTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTTTTTTTTTT---------------------------------AGAATCTATATTT----GTCAATTAGACAAGAC------AAAAAATAGTAGAGTAGGGCCGGATGTAACCAAGGGGATAAAGGCGGGGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGAGAAGAATTAGATTCTTCTTTCTTTTTTTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTGCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGCGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCGCTGTTGTGCTGCCCGCC-----CACGG-AGCTCCG-AGTGTTGCGTCGAGT-GTACTCTTCGCGACGCCGGTGCTTCCGTTGGAGA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACGG--CTCGCTCTAG-ACGGCCCTCACAA-GGTGTTCTGTCTGGATGCGTGTCTGCG-TCACAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGAACGCGGTTGGCCCAAAATCGAGCCAAGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGCTCA-CGTCGTTCGATCACGTCCCTCACGACTCAGCGACCCTT-CT-AGAGCTGCTAAGGCGACTCTCCGAACGCGACCCTA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTAAAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATTGATTTGATGAATAAAAAAAA-TCATAGGGATGTAGGG-----------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTTT---ATCTGAGTTACTTCAAATCTTTCCAAATTCACTTTTT------GTGCTTTCACTTTTTT-CCTAGAATACAATGAAAAAT-GTAACT-AAATAAACTA------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATTAATAAAAAAAAA--------------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCTC-AAAA-TCCTTTTTCTC------------AAATTTATAAAGATAAATT-CAATT-AATAATTATCAAAATTGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACATAAAATTTTTTAGATCACTTAAAACAAAATATAT---ATATATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTGGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTTCT------------------AAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAAA-GCCACATTTTGGAAATAAAAAAAA--TGTGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAGA--GGGG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTACTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTACAATATCCCTTCTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Peritoma_jonesii_143 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCCGCAACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAGGTTCCGCTGCCCG{CT}CGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCT{AG}G-ACGGCCCTCACAA-GGTGTT{CT}CGTCTGGATGCGTGTCTGC{CG}-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCAAAAATCGAG{CT}CAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTGATAGTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTCATTTCAAATTCATTGATAATAGATT------TATTTTCCC-ATATATAATATATATATAATTTATGGTATATGAAAACAACTGTATACACACATCAGATGGATTGTTTTAAATTCCATTTTT-ATTTTTATA------TAGGAGATTAATTTAATAAATGACATAGATATCAATCAGATACAGAAATAAATTAAAGAAATATTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCGAAAAAAAAAATAGCATCCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGATTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAA-----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATGTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGGAGACTTACTT Peritoma_jonesii_460 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCCGCAACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAGGTTCCGCTGCCCG{CT}CGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCT{AC}G-ACGGCCCTCACAA-GGTGTT{CT}CGTCTGGATGCGTGTCTGC{CG}-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCAAAAATCGAG{CT}CAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATAGTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTCATTTCAAATTCATTGATAATAGATT------TATTTTCCC-ATATATAATATATATATAATTTATGGTATATGAAAACAACTGTATACACACATCAGATGGATTGTTTTAAATTCCATTTTT-ATTTTTATA------TAGGAGATTAATTTAATAAATGACATAGATATCAATCAGATACAGAAATAAATTAAAGAAATATTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCGAAAAAAAAAATAGCATCCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGATTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAA-----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATGTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACT- Peritoma_jonesii_C329 CGTAATGCTCATAACTTCCCCCTAGGCCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTAAAA------AAATAGAAGATAAAA-----AGGTT--GGTTGATATTGCTCCCTCATTTATA----AAAAAAAAATGATATCAG------ATAGTAGTGGAGG-CCCATGGGACAAATAATCCGAT--------TTTCTTTTAGTATCATATTTTTCTTATCTATTAGGATAATTGACTATTATTCTGTTTTT---------GTGAAATAAGTTTT----------GAGCTTATT------CTA---------TTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACCCAGTTTGGTCTTGTATTTAAATCTTTGTGTGTGTTTTTTTTTT---------------------------------AGAATATATATTT----GTCAATTAGACAAGAC------AAAAAATAGTAGAGTAGGGGCGGATGTACCCAAGTGGATAAAGGCAGGGGATTG-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAGGTTCCGCTGCCCGCCGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTGG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCTGGGTGAAGACGGAGACGGAGATTGGTCTCCCGTG---TGTTATCGCACGCGGTTGGCCAAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-GG-AAC-ATATTAACAA-TTTTTATTC-ATCGTCGAGATTCCCATTTTAATAAAGCGTCAATT----------CAATATAAT-----TTAGAATTGGTTTGATGAATAAAAAAAA-TCATAGGGATGTAGGT-----------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTT--GAATCTGAGTTACTTTAAATCTTTCCAAATTTACTTTTACTTTTTGTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GTAACT-AAATAAACTA------GTTTTGACTTCAAAACAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAACAAAAAAAA------GAATCATTTGATTTTT--AGAAAAA-TTCATACTTCT-AAAAA-TCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATTGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACAGAAAATTTTTTAGATCACTTAAAACAAAATATAT-------ATTAT-CCACAAATTGTAGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCTGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCTTCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAAA-TCCACATTTTGGAAATAAAAAAAC--TGTGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTACAATATCCCT-CTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Peritoma_jonesii_W98270 ---------------------------------------TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTAAAA------AAATAGAAGATAAAA-----AGGTT--GGTTGATATTGCTCCCTCATTTATA----AAAAAAAAATGATATCAG------ATAGTAGTGGAGG-CCCATGGGACAAATAATCCGAT--------TTTCTTTTAGTATCATATTTTTCTTATCTATTAGGATAATTGACTATTATTCTGTTTTT---------GTGAAATAAGTTTT----------GAGCTTATT------CTA---------TTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAATCTTTGTGTGTGT---------------------------------TTTTTTTTTAGAATATATATTT----GTCAATTAGACAAGAC------AAAAAATAGAGAG--AGGG-CGGA---------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAACGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTTTTAAA-AATAAAATATTGAAGTGAGAAGAATTCGATTCTTCTTTCTTTTTTTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAAGACGGAATTCTTTATTCTTTTGAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATACCTGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAGGTTCCGCTGCCCGCCGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTGG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCCGGGTGAAGACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCAAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-GG-AAC-ATATTAACAA-TTTTTATTCAATCGTCGAGATTCCCATTTTAATAAAGCGTCAATT----------CAATATAAT-----TTAGAATTGGTTTGATGAATAAAAAAAA-TCATAGGGATGTAGGT-----------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTT--GAATCTGAGTTACTTTAAATCTTTCCAAATTTACTTTTACTTTTTGTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GTAACT-AAATAAACTA------GTTTTGACTTCAAAACAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAACAAAAAAAA------GAATCATTTGATTTTT--AGAAAAA-TTCATACTTCT-AAAAA-TCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATTGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACAGAAAATTTTTTAGATCACTTAAAACAAAATATAT-------ATTAT-CCACAAATTGTAGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCTGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCTTCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAAA-TCCACATTTTGGAAATAAAAAAAC--TGTGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTACAATATCCCTTCTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Peritoma_lutea_461 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCCGCAACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAAGTTCCGCTGCCCGCCGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTGG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATTAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACTCACCC-GGTGCTA-{CT}ACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCAAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATAGTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTCATTTCAAATTCATTGATAATAGATT------TATTTTCCC-ATATATAATATATATATAATTTATGGTATATGAAAACAACTGTATACACACATCAGATGGATTGTTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATAAATGACATAGATATCAATCAGATACAGAAATAAATTAAAGAAATATTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCGAAAAAAAAAATAGCATCCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGATTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAA-----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATGTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTA--- Peritoma_lutea_H14618 ---------------------------------------TGAGGCT-CATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTAAAA------AAATAGAAGATAAAA-----AGGTT--GGTTGATATTGCTCCTTCATTTATAAA----AAAAAAATGATATCAG------ATAGTAGTGGAGG-CCCATGGGACAAATAATCCGAT--------TTTCTTTTAGTATCATATTTTTCTTATCTATTAGGATAATTGACTATTATTCTGTTTTT---------GTGAAATAAGT----------TTTGAGCTTATT------CTA---------TTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAATCTTTGTGTGTGT---------------------------------TTTTTTTTTAGAATATATATTT----GTCAATTAGACAAGAC------AAAAAATAGTAGAGTAGGGGCGGA---------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAACGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTAAA-AATAAAATATTGAAGTGAGAAGAATTCGATTCTTCTTTCTTTTTTTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAAGACGGAATTCTTTATTCTTTTGAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACAGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAAGTTCCGCTGCCCGCCGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTAG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCAAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-GGAAACAATATTAACAAATTTTTATTCAATCGTCGAGATTCCCATTTTAATAAAGCGTCAATT----------CAATATAAT-----TTAGAATTGGTTTGATGAATAAAAAAAA-TCATAGGGATGTAGGT-----------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTT--GAATCTGAGTTACTTTAAATCTTTCCAAATTTACTTTTACTTTTTGTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GTAACT-AAATAAACTA------GTTTTGACTTCAAAACAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAACAAAAAAAA------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCT-AAAAA-TCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATTGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACAGAAAATTTTTTAGATCACTTAAAACAAAATATAT-------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCTGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCTTCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAAA-TCCACATTTTGGAAATAAAAAAAC--TGTGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTACAATATCCCT-CTTT--CCAAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Peritoma_lutea_W2510 ------------------------------GCCGCTC--TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTAAAA------AAATAGAAGATAAAA-----AGGTT--GGTTGATATTGCTCCTTCATTTATAAA----AAAAAAATGATATCAG------ATAGTAGTGGAGG-CCCATGGGACAAATAATCCGAT--------TTTCTTTTAGTATCATATTTTTCTTATCTATTAGGATAATTGACTATTATTCTGTTTTT---------GTGAAATAAGT----------TTTGAGCTTATT------CTA---------TTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAATCTTTGTGTGTGT---------------------------------TTTTTTTTTAGAATATATATTT----GTCAATTAGACAAGAC------AAAAAATAGTAGAGTAGGGGCGGA---------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAACGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTAAA-AATAAAATATTGAAGTGAGAAGAATTCGATTCTTCTTTCTTTTTTTTTT----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAAGACGGAATTCTTTATTCTTTTGAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CT-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGGGAC-CTCCAAGGTTCCGCTGCCCGCCGAATCCACGG-GGCTCCG-AGTGTTGCATCGAGC-TTGCTCCTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGTTCTAG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCAAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-CGTCGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-GGAA-C-ATATTAACAAATTTTTATTCAATCGTCGAGATTCCCATTTTAATAAAGCGTCAATT----------CAATATAAT-----TTAGAATTGGTTTGATGAATAAAAAAAA-TCATAGGGATGTAGGT-----------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTT--GAATCTGAGTTACTTTAAATCTTTCCAAATTTACTTTTACTTTTTGTGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GTAACT-AAATAAACTA------GTTTTGACTTCAAAACAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAACAAAAAAAA------GAATCATTTTATTTTT--AGAAAAA-TTCATACTTCT-AAAAA-TCCTTTTTCTC------------AAATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATTGATATTTTGATTGATCTTTTTGTATTATACAAACAGTACAAACAGAAAATTTTTTAGATCACTTAAAACAAAATATAT-------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCTGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCTTCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAAA-TCCACATTTTGGAAATAAAAAAAC--TGTGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GGGG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTACAATATCCCT-CTTT--CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Peritoma_multicaulis_451 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGC-GCGACGGGAC-CTTCGCGGTTCCGTCGCCCGCCGAATCCGCGG-AGCTTCG-TGCGGTCCGTCGAGT-ACACTCTTCGGGGCGCTGTTGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCCGG-ACGACCCTCACAA-GGTGAT-CGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCTCCC-GTGCCTAACACGCTCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGCATAGATTCCTCGTGTTTA-CGTCGTCCGATCACGTCCCCGGTGACTCCACGACCCTT-CC-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACGTATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTGAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATCAAAGGAATCTTCTTATTTTA------GATCGAAAATTCCATTTTTTT----GTTTTCTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACT- Peritoma_multicaulis_O2482 ----------------------------------------GAGGCT-CATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA-----AAAATAGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGACG-CCCATGGGACAAATA--------------------------ATCATATTTTTGTTATCTATTAAGGTAATTTACTACTATTCAATTTTT---------GCGAAATCCGTTTTGAGCTTATTTGAGCTTATT------CTA------------------------------------------------------------------------------------------------------------------TTTTTTTTTTTTTTAGAATAAAGATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGCAGGG--------------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTGATTTTT-AATAAAATATTGAAGTGCGAACAATTAGATTCTTTTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTTTCTCGTAAATTTTCTATTCCATTCATAGAAAACAAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCAAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGC-GCGACGGGAC-CTTCGCGGTTCCGTCGCCCGCCGAATCCGCGG-AGCTTCG-TGCGGTCCGTCGAGT-ACACTCTTCGGGGCGCTGTTGCTTTCGTCGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCCGG-ACGACCCTCACAA-GGTGAT-CGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCTCCC-GTGCCTAACACGCTCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTTGATCGTCCCGACGAGCGGTGGTGCATAGATTCCTCGTGTTTA-CGTCGTCCGATCACGTCCCCGGTGACTCCACGACCCTT-CC-GGAGCCGCCAAGGCGACTCTCCGAACGCGACCCCA-GGAAAC-ATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTGAATAAAACGTCAATT----------CAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCCAAATTCACTTTTT------GGGCTTTCATTTTTTT-CCTAGAATACAATGAAAAAT-GGAACT-AAATAAACTC------GTTTTAACTTCAATCCAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATTAAAAAAAAAAAAAAA-----------GGATCCTTTTTCTTTT--CCAAAAA-TTCCTACTTCTCGAAAAATCTTTTTTCTC-------------AATTTAGAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGCTCACTTAAAACAATATATAT-------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-CGATTTCTCCT------------------AAAGATCTTAGATTTCATCTAAAGA---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTTGAAATCAAAAAAA--TGGGAAACCTTTTTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTCATTACTTTTTATATGT-----------------ATTCTAAAGAATTGATTTTG------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCTCTTT---CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Peritoma_platycarpa_404 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCTGCAACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGG----CTCCACGGTTCTGCTGCCCGCCGAATCCACGG-AGCTCCG-AGTGTTGCGTGGAGT-GTACTCTTCGCAACGCCGGTGCTTCCGTAGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTCG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTGTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGTTGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-GGTCGTTCGATCACGTCCCTCACGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCATTTTAGTATCCTACGAATACACATGTATCCCTGATTTAAAATTCATTGATAATAGATT------AATTTTCCT-ATATA----TAATATATAATTTATAGTATATGAAAACAAATGCATACACACATCAGATGGATTGTTTTAAATTCCATTTTT-----TTTTA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATTAAAGGAATCTTCTTATTTTA------GATCTAAAATTACATTTTTTTT---GTTTTCTAAAAAAAAA-TAGCATACGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGGTTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAAAA---------------------------------------ACTAGCATTATTATTACTGATCCATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATAC------------ Peritoma_platycarpa_452 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCTGCAACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGG----CTCCACGGTTCTGCTGCCCGCCGAATCCACGG-AGCTCCG-AGTGTTGCGTGGAGT-GTACTCTTCGCAACGCCGGTGCTTCCGTAGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTCG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTGTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGTTGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-GGTCGTTCGATCACGTCCCTCACGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCCTACGAATACACATGTATCCCTGATTTAAAATTCATTGATAATAGATT------AATTTTCCT-ATATA----TAATATATAATTTATAGTATATGAAAACAAATGCATACACACATCAGATGGATTGTTTTAAATTCCATTTTT---TTTTTTA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCAAGAAATAAATTAAAGGAATCTTCTTATTTTA------GATCTAAAATTAAATTTTTTTT---GTTTTCTAAAAAAAAA-TAGCATACGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGGTTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAAAA---------------------------------------ACTAGCATTATTATTACTGATCCATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATT---------------------------------------------- Peritoma_platycarpa_M3282 -----------------------------------------------------TAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAGCTTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTAAAA------AAATAGAAGATAAAA-----AGGTT--GGTTGATATTGCTCCTTCATTAAAAA-----AAAAAAATGATATCAGATAGATAGAGTAGGGGAGGTCCCATGGGACAAATAATCCGAT--------TTTCTTTTAGTATCATATTTACCTTATTTATTAAGGTAATTGACTACTATTGGGTTTTT---------GCGAAATAAGT----------TTTGAGCTTATT------CTA------TTTTTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTG----------------------------------TTTTTTTTTAGAATATATATTT----GTCAATTAGACAAGAC------AAAAAATAGTATAGTAGGG--------------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTAAA-AATAAAATATTGAAGTGAGAAGAATTAGATTCTTCTTTCTTTTTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAATATGGAATTCTTTT-------GAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTACAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGTGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCAGCGG----CTCCACGGTTCTGCTGCCCGCCGAATCCACGG-AGCTCCG-AGTGTTGCGTGGAGT-GTACTCTTCGCAACGCCGGTGCTTCCGTAGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATC-AAAACGAAACAG--CTCGCTCTCG-ACGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTGTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACTCACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGTTGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTCA-GGTCGTTCGATCACGTCCCTCACGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-GGAA-C-ATACTAACAAATTTATATTCAATCGTCGAGATTCCAATTTTAATAAAGCGTCAATT----------CAATACAAT-----TTAGAATTGATTTGATGAATAAAAAAAAA--ATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTTTT---ATCTGAGTTACTTAAAATGTTTCCAAATTCACTTTTT------GGGCTTTCTTTTTTTT-CCGAGAATACAATGAAAAAT-GTAACT-AAATAAACTA------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGAGAAATTCAATTTATCAGTTCAATTAATAAAAAAAAAA-------------GAA-----------------------------------------TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATAAAAATTGATATTTTGATTGATCTTTTTGTATTGTACAAACAGTACAAACAGAAAATTTTTTAGATCACTTAAAATAAAATATAT-ATATATATTAT-GCCCAAATTGTGGATAGATGCTTTTATCCATTCGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATCAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGACCTTAGATTTCATCTAAAGA---------AGATGAAATCTAAGATCTTTATTATTGCAACAAGTTACTGATGGGAAAAAAAAA-TCCACATTTTGGAAATAAAAAAAA--TGTGAAACCTTATTTTTTATGTATATCTTGGCTTTTTTT--CATTCGAAAAAAGGGAAGGGGTTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATTGATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTACAATATCCCTTCTTTT-CCAAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Peritoma_serrulata_448 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCTGCAACGTCGCGAGAAGTTCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAATGACCTGTGAACGAGTGTTTCCACACGCGTT-GCAGTGGG-C-CTCCACGGTTCTGCTGCTCGCCTAATCCACGG-GGCTCCG-AGTATTGCATCGAGC-TTGCTCTTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTC{CT}AG-ATGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGC{CT}GTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACACACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-TGTTGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATAGTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTCATTTCAAATTCATTGATAATAGATT------TATTTTCCC-ATATATAATATATATATAATTTATGGTATATGAAAACAACTGTATACACACATAAGATGGATTGTTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATAAATGACATAGATATCAATCAGATACAGAAATAAATTAAAGAAATATTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCGAAAAAAAAAATAGCATCCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGATTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAA-----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATGTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Peritoma_serrulata_521 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGGCGATGTGGTTGGTTCGCCGCCTGCAACGTCGCGAGAAGTTCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAATGACCTGTGAACGAGTGTTTCCACACGCGTT-GCAGTGGG-C-CTCCACGGTTCTGCTGCTCGCCTAATCCACGG-GGCTCCG-AGTATTGCATCGAGC-TTGCTCTTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTAG-ATGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACACACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-TGTTGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCC-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATAGTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTCATTTCAAATTCATTGATAATAGATT------TATTTTCCC-ATATATAATATATATATAATTTATGGTATATGAAAACAACTGTATACACACATAAGATGGATTGTTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATAAATGACATAGATATCAATCAGATACAGAAATAAATTAAAGAAATATTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCGAAAAAAAAAATAGCATCCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGATTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAA-----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATGTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGGAGACTTACTT Peritoma_serrulata_522 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGATGTGGTTGGTTCGCCGCCTGCAACGTCGCGAGAAGTTCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAA--GGAATGACCTGTGAACGAGTGTTTCCACACGCGTT-GCAGTGGG-C-CTCCACGGTTCTGCTGCTCGCCTAATCCACGG-GGCTCCG-AGTATTGCATCGAGC-TTGCTCTTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTAG-ATGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCC-ACACACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-TGTTGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATAGTAATAATGGAAATCATTTTAGTATGCTACGAATACATATGTATCCCTCATTTCAAATTCATTGATAATAGATT------TATTTTCCC-ATATATAATATATATATAATTTATGGTATATGAAAACAACTGTATACACACATAAGATGGATTGTTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATAAATGACATAGATATCAATCAGATACAGAAATAAATTAAAGAAATATTCTTATTTTA------GATCTAAAATTACATTTTTTT----GTTTTCGAAAAAAAAAATAGCATCCGTTTTGGATACCTATTCGAATCTAATTCGGAATTGGATTAATTCTTTTTTTATTTGATAAAATTCCGAATTAAGGAGTTGGTAATTAAATTAAGATCCTTGTACAAAAAA-----------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATGTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAACAAAAAAAAGAAGAAAACAGAGGATCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATA------------- Peritoma_serrulata_L8811 CGTAATGCTCATAACTTCCCTCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCTTTTTATCTTAAAA------AAATAGAAGATAAAA-----AGGTT--GGTTGATATTGCTCCTTCATTTATAAA----AAAAAAATGATATCAG------ATAGTAGTGGAGG-CCCATGGGACAAATAATCCGAT--------TTTCTTTTAGTATCATATTTTTCTTATCTATTAGGGTAATTGACTACTATTCTGTTTTT---------GCGAAATAAGTTTT----------GAGCTTATT------CTA---------TTTTTTTTTTC-AAAACAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAATCTTTGTGTGTGTTTTTTTTTT---------------------------------AGAATATATATTT----GTCAATTAGACAAGAC------AAAAAATAGTAGAGTAGGGGCGGATGTACCCAAGTGGATAAAGGCAGGGGATTGGGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTTTT---------GCTTTTTTAACGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTAAA-AATAAAATATTGAAGTGAGAAGAATTCGATTCTTCTTTCTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATCTATACAATTTAAGACGGAATTCTTTATTCTTTTGAATTCT-----GACTGAAACTTTTTT-CTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-C------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCG-AAA-GGAATGACCTGTGAACGAGTGTTTCCACACGCGTT-GCAGTGGG-C-CTCCACGGTTCTGCTGCTCGCCTAATCCACGG-GGCTCCG-AGTATTGCATCGAGC-TTGCTCTTCGCAACTCCGGTGCTTCCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAATATA-TAAACGAAACAG--CTCGCTCTAG-ATGGCCCTCACAA-GGTGTTCCGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGT-CCCCCACACACCC-GGTGCTA-CACGCCCGGGTGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCAAGGGCGT-GATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTAA-TGTTGTTCGATCACGTCCCTCATGACTCTGCGACCCTT-CT-AGAGCTGCTAAGGCGGCTCTCCGAACGCGACCCCA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Polanisia_dodecandra_194 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGACGTGGGTGGTTCGCCGCCCGCGACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTAATCCGAAAA-GGAATGACCTGTGAACGAGTGATTACACATGCGGT-GCTCGGGAACCCTCAACGGTCCCCTCGCCCGCCGAGTCCGTGA-TGGCACG-TGAGGTCCCTCGAGT-CTTCTTGATGGGTCTTTCGTGTCACCG-CGGAAA-TCACCAAACCCCGGCGCGGTAAGCGCCAAGGAATAT--ACAACGAAACAG--CTCGCTCCGG-CCGCCCCTTACAA-GGTGTG-CGTTCGGATGTGTTGCTGCGATCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCAC-CACTC-GGTGCAA-CTCGCCCGGGTGAGCGTGGAGACGGAGAATGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAAACGAGCCACGGACGCGGAGCGTTCCGACTAGCGGTGGTGTATAT---CCTCGTGGTAA-CGTCGGTCGCTCCCGTCACTACGAACTCTACGACCCTT-CA--GAGACGCTACGGCGACTCTCCGAACGCGACCCCA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGATAAGAATACATATGTATCCGCGATTTCAAATTCATTGATAATAGATC------AATTTTCCT-ATATATA--TAATGTATAATTTACAGTATATGAAAACAAATGTATGCACACATCAGATGGATTGTCTTAAATTCCATCTTG-------ATA------CATGAGATAAATTTAATGAATGACATAGATATCAATCAGATCCATAAATAAATTAAGGGAATCTTTTAATTTTA------GATCTAAAATTACATTTTTTT-----TTTTAGAAAAAAA---TAGCATGCGTTTTGGATACCTATCCGAATCAAATTCGGAATTAGGTTAATTCATTTTTTATTTGATAAAATTCAGAATTAAGAAGTTGATAATTAAATTAAGATCCTTGTACAAAAAAA----------------------------------------ACTAGCATTATTATTACTGATCGGTAAAATTCATATCTTTAAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGGGGATCCGTTGAATTTCAAGTATTCAGTTTCACTAATAAGATAC------------ Polanisia_dodecandra_310 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGGCGACGTGGGTGGTTCGCCGCCCGCGACGTCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGATTACACATGCGGT-GCTCGGGAACCCTCAACGGTCCCCTCGCCCGCCGAGTCCGTGA-TGGCACG-TGAGGTCCCTCGAGT-CTTCTCGATGGGTCTTTCGTGTCACCG-CGGAAA-TCACCAAACCCCGGCGCGGTAAGCGCCAAGGAATAT--ACAACGAAACAG--CTCGCTCCGG-CCGCCCCTTACAA-GGTGTG-CGTTCGGATGTGTTGCTGCGATCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCAC-CACTC-GGTGCAA-CTCGCCCGGGTGAGCGTGGAGACGGAGAATGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAAACGAGCCACGGACGCGGAGCGTTCCGACTAGCGGTGGTGTATAT---CCTCGTGGTAA-CGTCGGTCGCTCCCGTCACTACGAACTCTACGACCCTT-CA--GAGACGCTACGGCGACTCTCCGAACGCGACCCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGATAAGAATACATATGTATCCGCGATTTCAAATTCATTGATAATAGATC------AATTTTCCT-ATATATA--TAATGTATAATTTACAGTATATGAAAACAAATGTATGCACACATCAGATGGATTGTCTTAAATTCCATCTTG-------ATA------CATGAGATAAATTTAATGAATGACATAGATATCAATCAGATCCATAAATAAATTAAGGGAATCTTTTAATTTTA------GATCTAAAATTACATTTTTTT-----TTTTAGAAAAAAA---TAGCATGCGTTTTGGATACCTATCCGAATCAAATTCGGAATTAGGTTAATTCATTTTTTATTTGATAAAATTCAGAATTAAGAAGTTGATAATTAAATTAAGATCCTTGTACAAAAAAA----------------------------------------ACTAGCATTATTATTACTGATCGGTAAAATTCATATCTTTAAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGGGGATCCGTTGAATTTCAAGTATTCAGTTTCACTAATAAGATA------------- Polanisia_dodecandra_F22 ---TACTCTACTATTTTTTTGTCTTGTCTAATTTGATTTTAGAATATATTTCTAAAATCAAAACTCAAAGACTTGAATACAAGACCAAACAGAT---------ACAA-------AATTCCACC--TTG---------CTTTTTTTTTTTCAAA--AAAAATTTAATAAGGTAAAAA----------------CTTATTTCTC------AAAAAAAGAATAGTAGTACATTACATTAATAGATA------------AGCAAAAT----------------------ATGATA----------CTAAAAGAAAATTTTATTATTATTTCATTTTTTTTTATAAAAATTTATAAAAAAAAGGAGC-----AA---TATTAACCTTCTTTCTTTTATCTTA---TATTTTTTT-----AAGATAAAAAGG----------------------------------TTGATATTGCTCCTT---------------------------------------------------TTTTTTACTAAACT---------------AGGTCTAGACTAACACTAAAGCATTATCCATTTGT--GGAGGG--------------------------------------------------------------------CTCC-AGAG-TATAGTCATTACAGAATCAATCTTGTATT---------GCCTTTTTAAACCATC--TTTCCCTTTCTGTTTAAGAATCAAATATTGAATTAAG-AATCAAATATTGAAGTGAAAAGAATTTGATTCTTCTTTCTTATTTTTTCTTCTTCAGAAAAGAAAGAAGAAGAGTTTCTTTTTCATCATTTCAACCGAATTCAAATAACATCTATTTGCTTGTTTGTGTGTGATCCGGGTAAGTAAGGTGGAACCCTAGATTCTAGGAGTTTGAATTAAAAAACAAATAAAAAAAATCTGTTATTTATTTAAAATTAAAAAATATATATAGAAATATAGATTTCTATTAAAATTTCGATTTTTCATATATACAATCTAATACGGGATTCATTT-------GAATTCT-----GACTGAAACTTTTT-CCTCGTAAATTCACTATTCCATTCATAGAGAAAGAAAAAGTAT-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTCCATAATTGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGTGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGAAACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGATTACACATGCGGT-GCTCGGGAACCCTCAACGGTCCCCTCGCCCGCCGAGTCCGTGA-TGGCACG-TGAGGTCCCTCGAGT-CTTCTCGATGGGTCTTTCGTGTCACCG-CGGAAA-TCACCAAACCCCGGCGCGGTAAGCGCCAAGGAATAT--ACAACGAAACAG--CTCGCTCCGG-CCGCCCCTTACAA-GGTGTG-CGTTCGGATGTGTTGCTGCGATCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCAC-CACTC-GGTGCAA-CTCGCCCGGGTGAGCGTGGAGACGGAGAATGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAAACGAGCCACGGACGCGGAGCGTTCCGACTAGCGGTGGTGTATAT---CCTCGTGGTAA-CGTCGGTCGCTCCCGTCACTACGAACTCTACGACCCTT-CA--GAGACGCTACGGCGACTCTCCGAACGCGACCCCA-GG--AC-GTACTAACAAATTTTTATTCAATCGTCGAGATTCAAATTTTAATAAAGAGTCAATT----------CAATGCAAT-----TTGCAATCGATTGAATGAATAAAAACTTGTTTAAATAGGGATTTCTGGTTTTT-----------------------------------------------------AATTCAATTAAAAGATTTTTTTT--TAATCTGAGTTACTTAAAATTTTTTAAAATTCACTTTAT------GTGCTTTCGATTTTTT-CCTAGAATACAATGAAAAAT-ATAACT-AAATAAACTA------GTTGGGACTTCAATCCAAAGACAGAACTCAAGATGCTC-------TTTATCAGTTCAATTAATAAAAAAAAATCGAAAAAAAAAAATAATCATTTTATTTTT--ATAAAAA-TTCACACTTCTCCAAAA-TCCTTTTTTCCTAATTTTTTTTCTAATTTATAAAGAGAAATT-CAAA-TAATAATTATCAAAATAGATATTTTGATTAATCTTTTTCTATTGTACAAACAGTACAAACATAAAATTTTTTTGATCACTTAAAAATCATATATTATTATATAATATCCCACTAATTGTGAATAGATGCTTTTATCAATTCGATTGCAAAC-AAAGGATATAATAATTCAGAGAAAGAATCATTCAGAAAGGTATCAAGTTCAAAAATTTTAACTTAATTAAATATTAAATTAATTTATTTCAAGAACCTAT-GGATTTCTCCT------------TCTCCTAAAGATCTTAGATTTCCTCTTCTTT---------CGACGAAATCTAAGATCTTTATTATTGCAACAAGTTAGTGATGGGAAAAAAAGAATCCCCATTTGGGAAATGAAAAAAAAATGTGAAACCTTATTTTTTATGTATATCTTGTCTTTTTTTTTCATTCTAAAAAAAAGGG----TTTTAGAATTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATCGTCTTTTTTCTATTGATTACTTTTTATATGT-----------------ATTCTAAAAAATGTATTTTT------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTA----------------------------TTTTGTTGTACAAAAAAACTTTTTGAATTACCTG-AG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wislizenia_californica_475 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCGCCCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCCGTCGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCCAG-GCGACCCTCACAA-GGTGCT-TGTCTGGATGCGCGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGCGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTTTTGTTTTGTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Wislizenia_californica_A15231 CGTAATGCTCATAACTTCCCCCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTCTATTTTTTT------AAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTGTCTTATCTATTAAGGTAATTTACTACTATTCAGTTTTT---------GCGAAATCTGTTTTGAGCTTGTTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTCAAAAAAAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTGTTTTTTT--------------------TTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGGGGATTGGGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTTTTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTTTCTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTCCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCGCCCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCCGTCGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCCAG-GCGACCCTCACAA-GGTGCT-TGTCTGGATGCGCGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGCGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-GG-AAC-ATACTAACAA-TTTTTATTC-ATCGTCGAGATTCCAATTTTAATAAAGCGTCAATTCAATTCAATACAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAA-T-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATTAAAAAAAAAAAAA-------------GAATCATTTTTTTTTTT-CGAAAAA-TTCATACTTCTCAAAAA-TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTTGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCT------------------AAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAA---TCCCCTTTTTGGAAATCAAAAAAA--TGGGAAACCTTTTTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTTTTTTTAAGTTTAAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTTTTTTGTTGTTCTAATATTTTGTTATTTATTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCT-CTTTT-CCAAGTTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Wislizenia_palmeri_476 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCGCCCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGGACGCCGTCGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTAGTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTT--GTTTTGTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGGAGACTTACTT Wislizenia_palmeri_E1158 CGTAATGCTCATAACTTCCCCCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGAGAAAA-----GGGCTT-GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCAGTTTTT---------GCGAAATCTGTTTTGAGCTTGTGTGAGCTTATT------CTA-----TTTTTTTGTTTTT-C-AAAAAAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTTGTGTGTTTTTT------------------TTTTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGGGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCCC-TCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTTTCTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTATGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCGTCCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCTGTTGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCAAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTA-CACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGGCGCCTAGGCGACTCTCCGAACGCGACCCCA--G------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wislizenia_palmeri_S8618 CGTAATGCTCATAACTTCCCCCTAGACCTAGCTGCTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAG-TTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCAGTTTTT---------GCGAAATCTGTTTTGAGCTTGTTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTC--AAAAAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTGTTTTTTT-------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGGGCGGATGTAGCCAAGTGGATAAAGGCAGTGGATTGTGAGGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-AGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGAAATTTTTTTTCTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAAGGTTATGGTAAAA-CTTCGTTTAAAACGATGTGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCGTCCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCTGTTGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCAAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTA-CACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-GG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wislizenia_palmeri_WR258 ----------------------------------CTCT-TGAGGCTCCATCCATAAAT-GGATAAT-GCTTTAGTGTTAGTCTAGACCTAGCTTTAGT--AAAAAGGGAGCAATATCAACCAA------------CCCTTTTATCTTAAAA------AAATAGAAGATAAAA-----GGGTT--GGTTGATATTGCTCCTTCATTTCTA------AAAAAAACGATCTCAGATAGATATAGTAGTGGAGG-CCCATGGGACAAATA--------------------------ATCATATTTTTCTTATCTATTAAGGTAATTTACTACTATTCAGTTTTT---------GCGAAATCTGTTTTGAGCTTGTTTGAGCTTATT------CTA-----TTTTTTTGTTTTTTC-AAAAAAAAAAAGTAAGATGGAATTTTCTACC-AGTTTGGTCTTGTATTTAAGTCTTTGTGTGTGTGTGTGTTTTTTT---------------------TTTTATTTTAGAATATATATTT----GACAATTAGACAAGAC------AAAAAATTGTAGAGTAGGG--------------------------------------GGTAAGGCAACGGGTTTTGGTCCCGCTATTCGTAGGTTCGAATCC-TTCCGTCCC-CGAG-TATAGTAATTACAGAATGAATCTTGTATT---------GCTTTTTTAAAGCATCTTTTTCTCTTTCTGTTTAAGAATCAAATATTTTATTTTT-AATAAAATATTGAAGTGCGAAGAATTAGATTCTTCTTTCTTTTTTTTTTTT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CATATATACAATTTAATACGGAATTCTTTT-------GAATTCT-----GACTGACATTTTTTTTCTCGTAAATTTTCTATTCCATTCATAGAAAACGAAAAAGTAC-AGATTACTATATAC-TGACTGAACTATGACTATTCATGATTTCATAATCGAATCAATTACATACTGGTTCCAAAC--TAGAGGAATGTTAGGGTAAAA-CTTCGTTTAAAACGATGGGG-----------------------------------------------------------------------------------------------------------------------------------------------------------------CGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCGTCCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGCCGTCGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCCAG-ACGACCCTCACAA-GGTGCT-TGTCTGGATGCGTGTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGCGAACGCGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCACGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA-GGAAACAATACTAACAAATTTTTATTCAATCGTCGAGATTCCAATTTTAATACAGCGTCAATTCAATTCAATACAATACAAT-----TTAGAATGGATTTGATGAATAAAAAAA--CCATAGGG-------------------------------------------------------------ATGTATGTAATGCAATTAAAAGATTTTTTT---GAATCGTAGTTACTTAAAATCTTTCAAAATTCACTTTTT------GTGCTTTCATTTTTTT-CCTAGAATACAATGAAAA-T-GGAACT-AAATAAACTC------GTTTTGACTTCAATCCAAAGACAGAACTCAAAATGATAAATTCAATTTATCAGTTCAATTAAAAAAAAAAAAA-------------GAACCATTTTTTTTTTT-CGAAAAA-TTCATACTTCTCGAAAA-TCCTTTTTCTC------------AAATTTATAAAGAGAAATT-CAATT-AATAATTATCAAAATCGATATTTTGATTGATCTTTTTGTATTATACAAACTGTACAAACAGAAAATTTTTTAGATCACTTAAAACAATATATAT-------ATTAT-CCACAAATTGTGGATAGATGCTTTTATCCATTTGATTACAAGC-AAAAGATATAATAATTCACAGAAGGAATCATTCCGAAAGGTACCAAATTCAAAAATTGGAAC-----------TTAAATTCATTTATTTCAAGAACCTAT-GGATTTCTCCTAACCTATGGATTTCTCCTAAAGATCTTAGATTTCATCTTCTTT---------AGATGAAATCTAAGATCTTTATTATTGCATCAAGTTACTGATGGGAAAAAAAA--TCCCCTTTTTGGAAATCAAAAAAA--TGGGAAACCTTATTTTTGATGTATATCTTGGCTTTTTTT--CATTCTAAAAAA--GAAG---TTTTAGAGTTTAGTAGACAAAAGTCAAAACATTAAAAAAGGAGATGGTCTTTTTCCTATTGATTACTTTTTATATGT-----------------ATTCTAAAGAATTTTTTTTA------AAGTTAGGCTAATTCCAATTATTCTAATATTTTGTTATTTATTTTGTTGTTCTAATATTTTGTTATTTATTTTGTTGTACAAAATAACTTTTTGAATTACCTGTAGAAAGGGATTTCCCTAACGAAAAAGCTTTCAACGCTGTCCAATACCCCTTCTTTTTCCAAGT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Wislizenia_refracta_473 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCG{CT}CCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGC{CT}GT{CT}GCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTC{AC}AG-{AG}CGACCCTCACAA-GGTGCT-TGTCTGGATGCG{CT}GTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCCA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTTT-GTTTTGTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCC------------------------------------------------- Wislizenia_refracta_477 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCGCTCCTACCGATTGAATGATCCGGTGAAGTGTTCGGATCGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCG{CT}CCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGC{CT}GTCGCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTCCAG-{AG}CGACCCTCACAA-GGTGCT-TGTCTGGATGCG{CT}GTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTA-CACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATTGGTTTAATACTAATAATGGAAATCGTTTCAGTATGTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTTT-GTTTTGTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAAGATACGAAGACTTACTT Wislizenia_refracta_478 ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGCGTCGACGTGGTTGGTTCGCCGCCTGCGACGCCGCGAGAAGTCCACTAAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTAATCCGAAAA-GGAACGACCTGTGAACGAGTGTTTCCACACGCGGT-GCGACAGGAC-CCCCGCGGCTCTGTCG{CT}CCGCCGAATCCGCGG-AGCTTCG-TGTGTTCCGTCGAGT-ACACTCTTCGGAACGC{CT}GT{CT}GCTTTCGTTGGAAA-TCACCAAACCCCGGCGTGAAAAGCGCCAAGGAACATC-AAATCGAAACAG--CCCGCTC{AC}AG-{AG}CGACCCTCACAA-GGTGCT-TGTCTGGATGCG{CT}GTCTGCG-TCATAAGTCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGTCCCCCCACTCACCC-GTGCTTAACACGCCCGGGCGAACACGGAGACGGAGATTGGTCTCCCGTG---TGTTACCGCACGCGGTTGGCCCAAAATCGAGCCATGGGCGTCGATCGTCCTGACGAGCGGTGGTGTATAGATGCCTCGTGTTTA-CGTCGTTCGATCACGTCCGCAGTGACTCTACGACCCTT-CT-GGAGCCGCCTAGGCGACTCTCCGAACGCGACCCC--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTACGAATACATATGTATCCCTGATTTCAAATTCATTGATAATAGATT------CATTTTCCT-ATATA----TAATATATAATTTATGGTATATGAAAACAAATGTATACACACATCAGATGGATTATTTTAAATTCCATTTTT-------ATA------TAGGAGATTAATTTAATGAATGACATAGATATCAATCAGATCCAGAAATAAATGAAAGGAATCTTCTTATTTTA------GATCTAAAATTCCATTTTTTTTT--GTTTTGTAAAAAAA------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTAGCATTATTATTACTGATCGATAAAATTCAGATCTTTCAATTCATATT---------AAAAAACGGGGAGGATTTCTTTTTATGATAAAAAATTCATTCATTTCATTTCAAGAAAAAAAAGAAGAAAACAGAGGAGCCATTGAATTTCAAGTATTCAGTTTCACTAATAA----------------- ; END; BEGIN SETS; CHARSET psbA (CHARACTERS = North_American_cleomoids_ITS_cpDNA) = 1-615; CHARSET trnL (CHARACTERS = North_American_cleomoids_ITS_cpDNA) = 2099-3347; CHARSET ycf1 (CHARACTERS = North_American_cleomoids_ITS_cpDNA) = 3348-4019; CHARSET trnQ (CHARACTERS = North_American_cleomoids_ITS_cpDNA) = 616-1260; CHARSET ITS (CHARACTERS = North_American_cleomoids_ITS_cpDNA) = 1261-2098; END; BEGIN TREES; TITLE ML_phylogeny; LINK TAXA = Taxa1; TRANSLATE 1 Cleome_angustifolia_C325, 2 Carsonia_sparsifolia_T6561, 3 Carsonia_sparsifolia_T6709, 4 Carsonia_sparsifolia_449, 5 Cleomella_angustifolia_462, 6 Cleomella_angustifolia_507, 7 Cleomella_angustifolia_511, 8 Cleomella_angustifolia_B13360, 9 Cleomella_angustifolia_H122279, 10 Cleomella_brevipes_463, 11 Cleomella_brevipes_499, 12 Cleomella_brevipes_T9176, 13 Cleomella_hillmannii_500, 14 Cleomella_hillmanii_513, 15 Cleomella_hillmanii_goodrichii_G27517, 16 Cleomella_hillmannii_var._goodrichii_R7428, 17 Cleomella_hillmanii_hillmanii_H14700, 18 Cleomella_hillmanii_hillmanii_T13484, 19 Cleomella_jaliscensis_514, 20 Cleomella_longipes_W13845, 21 Cleomella_longipes_501, 22 Cleomella_longipes_504, 23 Cleomella_longipes_508, 24 Cleomella_mexicana_R32931, 25 Cleomella_obtusifolia_466, 26 Cleomella_obtusifolia_467, 27 Cleomella_obtusifolia_502, 28 Cleomella_obtusifolia_E5000, 29 Cleomella_obtusifolia_T15037, 30 Cleomella_palmeriana_468, 31 Cleomella_palmeriana_505, 32 Cleomella_palmeriana_509, 33 Cleomella_palmeriana_H16030, 34 Cleomella_palmeriana_H4258, 35 Cleomella_parviflora_T15414, 36 Cleomella_parviflora_T15694, 37 Cleomella_perennis_510, 38 Cleomella_perennis_H14204, 39 Cleomella_perennis_R74105, 40 Cleomella_plocasperma_470, 41 Cleomella_plocasperma_517, 42 Cleomella_plocasperma_T15581, 43 Cleomella_plocasperma_T15647, 44 Oxystylis_lutea_T11683, 45 Oxystylis_lutea_188, 46 Oxystylis_lutea_518, 47 Peritoma_arborea_F5715, 48 Peritoma_arborea_W12490, 49 Peritoma_jonesii_C329, 50 Peritoma_jonesii_W98270, 51 Peritoma_lutea_H14618, 52 Peritoma_lutea_W2510, 53 Peritoma_multicaulis_O2482, 54 Peritoma_platycarpa_M3282, 55 Peritoma_serrulata_L8811, 56 Peritoma_arborea_454, 57 Peritoma_jonesii_143, 58 Peritoma_jonesii_460, 59 Peritoma_lutea_461, 60 Peritoma_multicaulis_451, 61 Peritoma_platycarpa_404, 62 Peritoma_platycarpa_452, 63 Peritoma_serrulata_448, 64 Peritoma_serrulata_521, 65 Peritoma_serrulata_522, 66 Polanisia_dodecandra_F22, 67 Polanisia_dodecandra_194, 68 Polanisia_dodecandra_310, 69 Wislizenia_californica_A15231, 70 Wislizenia_palmeri_E1158, 71 Wislizenia_palmeri_S8618, 72 Wislizenia_palmeri_WR258, 73 Wislizenia_californica_475, 74 Wislizenia_palmeri_476, 75 Wislizenia_refracta_473, 76 Wislizenia_refracta_477, 77 Wislizenia_refracta_478; TREE Imported_tree_0 = [&R] ((((68:6.6149552362724E-7,66:6.6149552362724E-7)96:6.6149552362724E-7,67:0.0017197919198281906)100:0.06778646736203361,(((((43:0.0014512246232590519,((42:6.70533181785056E-4,41:6.6149552362724E-7)45:0.0022774982112256765,40:6.6149552362724E-7)43:6.6149552362724E-7)100:0.010880436608889087,((35:0.004820661513590775,36:0.0071665284430165125)100:0.014384055368122583,(12:0.0019271922908416215,(10:6.6149552362724E-7,11:0.00393508266929658)84:6.6149552362724E-7)100:0.011710483618832406)40:0.0019433248966002382)92:0.00521618937065461,(((((((((70:0.006084087165332723,71:0.0016468238263380845)86:0.0023705975568170303,(73:6.6149552362724E-7,69:6.6149552362724E-7)89:0.004619420151834812)25:6.6149552362724E-7,75:6.6149552362724E-7)6:6.6149552362724E-7,76:6.6149552362724E-7)9:6.6149552362724E-7,77:6.6149552362724E-7)43:6.769965881401633E-4,(72:0.0020948933803559785,74:0.0020548421359339007)58:0.0012351800531047123)98:0.003357542654147693,(44:0.005202765092404014,(46:0.001945700431336426,45:0.0010504265923018384)82:6.6149552362724E-7)100:0.006992311780191883)97:0.004636182395008919,(((((((21:6.6149552362724E-7,(22:6.6149552362724E-7,38:4.984272975587494E-4)22:6.6149552362724E-7)22:6.6149552362724E-7,23:6.6149552362724E-7)68:0.0022439793165157013,19:0.0018030777319795535)33:6.6149552362724E-7,20:0.0041382563534717465)62:0.0012864972609146128,(37:0.0031861286729260732,(24:0.005174694410431973,39:0.0027769412551024893)97:0.002607819094961264)84:0.0015201925625252188)100:0.018240556108683307,((53:6.6149552362724E-7,60:6.6149552362724E-7)100:0.023959160174610323,(9:6.6149552362724E-7,(6:6.6149552362724E-7,((5:6.6149552362724E-7,8:8.117032314730322E-4)35:0.0021175478429236666,7:6.6149552362724E-7)19:6.6149552362724E-7)51:6.6149552362724E-7)100:0.015685261234311854)26:0.0025190055970792493)19:0.0014034181866253962,(((25:6.6149552362724E-7,29:9.366350724265137E-4)58:0.0022358155940410567,27:6.6149552362724E-7)40:6.6149552362724E-7,(26:6.6149552362724E-7,28:6.6149552362724E-7)67:0.002007412990216166)100:0.007511301748629314)51:0.003763094604906591)72:0.003190928371690929,(34:0.004923728016496357,((33:6.6149552362724E-7,30:9.740224310927405E-4)27:6.6149552362724E-7,(32:9.592606897343546E-4,31:6.6149552362724E-7)24:6.6149552362724E-7)97:0.0046029722569732485)100:0.012745823320624652)88:0.002533801240843522)100:0.014717956570224944,(((18:6.6149552362724E-7,(13:0.004380435578613478,14:6.6149552362724E-7)85:0.0021364993350787946)100:0.013904526881751509,(17:0.0034435362712546195,(16:4.2178748682288644E-4,15:0.0012693038312688993)100:0.0029543040799665165)95:0.004818835799902435)100:0.033841869856520976,((47:0.0035040076180212587,(48:6.093844206950292E-4,56:6.6149552362724E-7)47:6.6149552362724E-7)100:0.01603582897339538,((61:6.6149552362724E-7,(54:6.6149552362724E-7,62:6.6149552362724E-7)98:0.002290854046482994)100:0.016791219229438506,((58:6.6149552362724E-7,((((50:0.0018170509147556466,49:9.941015816847475E-4)72:0.0015469408576126394,57:5.177470117048157E-4)47:0.0011651345482543037,52:8.166112658950262E-4)15:6.6149552362724E-7,(59:0.0016934105860827579,51:6.6149552362724E-7)54:6.761300025428095E-4)29:6.6149552362724E-7)100:0.003814081908673671,((63:6.6149552362724E-7,(65:6.6149552362724E-7,64:8.593383850085554E-4)53:6.6149552362724E-7)86:6.6149552362724E-7,55:6.6149552362724E-7)100:0.00629349797757108)100:0.014622302515295614)73:0.0014308993062744223)99:0.007910198867890055)95:0.007374158585621049)98:0.01732026916810372,(3:0.0014854002133749562,(4:6.6149552362724E-7,2:0.0014105665626254656)41:6.6149552362724E-7)100:0.053619628016238305)100:0.16259544364949122):0.45,1:0.45); END;