#NEXUS [!This data set was downloaded from TreeBASE, a relational database of phylogenetic knowledge. TreeBASE has been supported by the NSF, Harvard University, Yale University, SDSC and UC Davis. Please do not remove this acknowledgment from the Nexus file. Generated on August 05, 2021; 17:49 GMT TreeBASE (cc) 1994-2008 Study reference: Nechwatal J., & Lebecka R. 2013. Genetic and phenotypic analyses of Pythium isolates from reed suggest the occurrence of a new species, P. phragmiticola, and its involvement in the generation of a natural hybrid. Mycoscience, . TreeBASE Study URI: http://purl.org/phylo/treebase/phylows/study/TB2:S14469] BEGIN TAXA; TITLE Taxa1; DIMENSIONS NTAX=46; TAXLABELS Pythium_arrhenomanes_P54 Pythium_catenulatum_AY598675 Pythium_phragmiticola_2007_19a Pythium_phragmiticola_P113 Pythium_phragmiticola_P114 Pythium_phragmiticola_P119 Pythium_phragmiticola_P120 Pythium_phragmiticola_P124 Pythium_phragmiticola_P125 Pythium_phragmiticola_P126 Pythium_phragmiticola_P56 Pythium_phragmiticola_P67 Pythium_phragmiticola_P68 Pythium_phragmiticola_P72 Pythium_phragmiticola_P76 Pythium_phragmiticola_P80 Pythium_phragmiticola_P82 Pythium_phragmiticola_P84 Pythium_phragmiticola_P90 Pythium_phragmiticola_P91 Pythium_phragmiticola_P92 Pythium_phragmitis_2007_17a Pythium_phragmitis_2007_17b Pythium_phragmitis_P13 Pythium_phragmitis_P40 Pythium_phragmitis_P42 Pythium_phragmitis_P52 Pythium_phragmitis_P55 Pythium_phragmitis_P58 Pythium_phragmitis_P59 Pythium_phragmitis_P61 Pythium_phragmitis_P62 Pythium_phragmitis_P63 Pythium_phragmitis_P65 Pythium_phragmitis_P66 Pythium_phragmitis_P69 Pythium_phragmitis_P71 Pythium_phragmitis_P73 Pythium_phragmitis_P85 Pythium_phragmitis_P87 Pythium_phragmitis_P94 Pythium_sp._Hybrid_P11_Clone_Type_A Pythium_sp._Hybrid_P11_Clone_Type_B Pythium_sp._Hybrid_P11_Clone_Type_C Pythium_sp._Hybrid_P11_Clone_Type_D Pythium_sp._Hybrid_P11_Clone_Type_E ; END; BEGIN TAXA; TITLE Taxa2; DIMENSIONS NTAX=26; TAXLABELS Pythium_arrhenomanes_P54 Pythium_graminicola_AF196593 Pythium_phragmiticola_P113 Pythium_phragmiticola_P114 Pythium_phragmiticola_P119 Pythium_phragmiticola_P120 Pythium_phragmiticola_P125 Pythium_phragmiticola_P126 Pythium_phragmiticola_P56 Pythium_phragmiticola_P90 Pythium_phragmitis_P13 Pythium_phragmitis_P40 Pythium_phragmitis_P42 Pythium_phragmitis_P52 Pythium_phragmitis_P55 Pythium_phragmitis_P58 Pythium_phragmitis_P59 Pythium_phragmitis_P61 Pythium_phragmitis_P62 Pythium_phragmitis_P63 Pythium_phragmitis_P65 Pythium_phragmitis_P69 Pythium_phragmitis_P71 Pythium_phragmitis_P73 Pythium_sp._Hybrid_1_Isolate Pythium_sp._Hybrid_7_Isolates ; END; BEGIN TAXA; TITLE Taxa3; DIMENSIONS NTAX=29; TAXLABELS Pythium_arrhenomanes_P54_EU152856 Pythium_graminicola_AY729825 Pythium_phragmiticola_P113 Pythium_phragmiticola_P114 Pythium_phragmiticola_P119 Pythium_phragmiticola_P120 Pythium_phragmiticola_P124 Pythium_phragmiticola_P125 Pythium_phragmiticola_P126 Pythium_phragmiticola_P56 Pythium_phragmiticola_P67 Pythium_phragmiticola_P68 Pythium_phragmiticola_P72 Pythium_phragmiticola_P76 Pythium_phragmiticola_P80 Pythium_phragmiticola_P82 Pythium_phragmiticola_P84 Pythium_phragmiticola_P90 Pythium_phragmiticola_P91 Pythium_phragmiticola_P92 Pythium_phragmitis_P13_EU152854 Pythium_phragmitis_P40 Pythium_phragmitis_P42 Pythium_phragmitis_P52 Pythium_phragmitis_P55 Pythium_phragmitis_P58 Pythium_phragmitis_P94 Pythium_sp._Hybrid_P11_Clone_Type_A Pythium_sp._Hybrid_P11_Clone_Type_B ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17864] TITLE Pythium_phragmiticola_ITS_sequences; LINK TAXA = Taxa1; DIMENSIONS NCHAR=804; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Pythium_arrhenomanes_P54 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTCGAATGCGGTGATCTGTTTGGATCGCTTTGCGCGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTGGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGAGCAAATGGTTATTGTGTGAGAGTGGTT-ATTGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATGAATGAATTTTTATTTCGCGGGCGC-TTTTCAAT Pythium_catenulatum_AY598675 CCACACCATAAAAACTTTCCACGTGAACCGTTACAATTATGTTCTGTGCTCTCTCTCGGGAGGGCTGAACGAAGGTAGAGCTGCA--TGTA---AAA---GTGCG-GTT-TCTGCCGATGTACTTTTAAACCCATTACACTAATACTGAACTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCAATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAAATGGCAGAATGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTAAGATGAAGTGTGACTTTCGAACGCAGTGATCTGTTTGGATCGCTTTGCGCGAGTGGGCGACTTCGGTTAGAACATTAAAGGAAGCAACCTCTATTGGCGGTATGTTAGGCTTCGGCCCGACTTTGCAGCTGACAGTGTGTTGTTTTCTGTTCTTTCCTTGAGGTGTACCTGTCTTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTAGTAGAATTTTGCTGCTCTTGGGCGCCCTACTCGTAGGGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGT------------------TTCGGCAGGCGCATTTTCAAT Pythium_phragmiticola_2007_19a CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGGTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P113 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P114 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P119 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P120 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P124 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P125 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P126 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P56 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P67 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P68 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P72 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAAT{GT}AATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P76 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAAT{GT}AATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P80 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAAT{GT}AATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P82 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P84 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P90 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAAT{GT}AATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P91 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGGTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmiticola_P92 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGGTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_2007_17a CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_2007_17b CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P13 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P40 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P42 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P52 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P55 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P58 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P59 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P61 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P62 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P63 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P65 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P66 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P69 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P71 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P73 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P85 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P87 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_phragmitis_P94 CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_sp._Hybrid_P11_Clone_Type_A CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_sp._Hybrid_P11_Clone_Type_B CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTTTGAATGCAGTGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATGAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_sp._Hybrid_P11_Clone_Type_C CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATGAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_sp._Hybrid_P11_Clone_Type_D CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATTACTCTTGGACGCTCTATTCGTAGAGTAAAGGAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT Pythium_sp._Hybrid_P11_Clone_Type_E CCACACCA-AAAAACTTTCCACGTGAACCGTTGTAATTTTGTTTTGTGCCTTCTTTCGGGAGGGCTAAACGAAGGTTGTCC-GCAAGTGTAGTTAATTCTGTACGCGTGGTCTTCCGATGTCTTTTTAAACCCATTACT-TAATACTGATCTATACTCCGAGAACGAAAGTTTTTGGTTTTAATCCATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCACATTGCACTTTCGGGATATTCCTGGAAGTATGCTTGTATCAGTGTCCGTACATCAAACTTGCCTTTCTTTTTTTGTGTAGTCAAGGAGAGAGATGGCAGA-TGTGAGGTGTCTCGCTGACTCCCTCTTCGGAGGAGAAGACGCGAGTCCCTTTAAATGTACGTTCGCTCTTTCTTGTGTCTGAGA-GAAGTGTGACCTCTGAATGCAATGATCTGTTTGGATCGCTTTGCGTGAGTGGGCGACTTCGGTTAGGACGTTAAAGGAAGCAACCATTTTTGGCGGTATGTTAGGCTTCGGCCCGACGTTGCAGCTGAGAGTGTGTCGTTTTCTGTTCTTTCCTTGAGGTGTACCTGT-TTGTGTGAGGCAATGGTCTGGGCAAATGGTTATTGTGTGATAGTGGTT-ATCGCTCTTGGACGCTCTATTCGTAGAGTAAAGAAGGCAACACCAATTTGGGACTAGTCTGTGGAATTAATTAATTTTATTTTCGCGGGCGC-TTTTCAAT ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17865] TITLE Pythium_phragmiticola_cox_II_sequences; LINK TAXA = Taxa2; DIMENSIONS NCHAR=563; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Pythium_arrhenomanes_P54 ATGGAAGGTATTATTAACTTTCATCATGATTTAATGTTTTTCCTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATTCCTGCTTTAATTTTATTAACTGTAGCAGTACCATCATTTGCTTTATTATATTCTATGGATGAAATCATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCCGATAATTTGGAATTTGCTGACGAACCTTTAATTTTTGATAGTTATATGGTACAAGAAAATGATTTAGAAATAGGACAATTGAGACTTTTAGAAGTAGATAATCGTGTTGTTGTACCTACAAATAGTCATATAAGAGTGTTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_graminicola_AF196593 ATGGAAGGTATTATTAACTTTCACCATGATTTAGTGTTTTTCTTAATTATTGTAACAGTTTTTGTTTGTTGGATGTTATTTAGAGTAATAACATTATTTGATGAAAAAAAAAACCCTATTCCTGCTACATTTGTACATGGTGCTACTATAGAAATTATTTGGACAACTATTCCTGCTTTAATTTTATTAACAGTAGCTGTACCTTCTTTTGCTTTATTATATTCTATGGATGAAATTATTGATCCTATTATTACTGTTAAAGTAATTGGTAGTCAATGGTATTGGAGCTATGAATATTCTGATAATTTAGAATTTGCAGATGAACCTTTAATCTTTGATAGTTATATGGTACAAGAAAATGACTTAGAAATCGGACAATTTAGACTTTTAGAAGTTGACAACCGCGTTGTTGTGCCTACAAACAGTCATATTAGAGTATTAATAACAGCTTCTGATGTTTTACACTCTTGGGCTATTCCTTCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTATTCTATGG Pythium_phragmiticola_P113 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P114 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P119 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P120 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P125 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P126 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P56 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmiticola_P90 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P13 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P40 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P42 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P52 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P55 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P58 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P59 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P61 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P62 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P63 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P65 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P69 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P71 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_phragmitis_P73 ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_sp._Hybrid_1_Isolate ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCAATTCCTGCGACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGAGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG Pythium_sp._Hybrid_7_Isolates ATGGAAGGTATTATAAACTTTCACCATGATTTAATGTTTTTCTTAATTATTGTAACTGTTTTTGTTTGTTGGATGTTATTTAGAGTTATTACATTATTTGATGAAAAAAAAAATCCTATTCCTGCTACATTTGTACATGGAGCTACTATAGAAATTATTTGGACAACAATACCTGCTTTAATTTTATTAACCGTAGCTGTACCATCATTTGCTTTATTATATTCTATGGATGAAATTATAGATCCTATTATTACTTTAAAAGTAATTGGTAGTCAATGGTATTGGAGTTATGAATATTCTGATAATTTAGAATTTGCTGATGAACCTTTAATTTTTGATAGTTATATGGTGCAAGAAAATGATTTAGAAATAGGACAATTCAGACTTTTAGAAGTTGATAACCGTGTTGTTGTACCTACAAATAGTCATATTAGGGTATTAATAACAGCTTCAGATGTATTACATTCTTGGGCTATACCATCTTTAGGTGTTAAATTAGATGCTTGTCCAGGTCGTTTAAATCAAACTTCTATGTATATTAAAAGAGAAGGTGTTTTTTATGG ; END; BEGIN CHARACTERS; [! TreeBASE Matrix URI: http://purl.org/phylo/treebase/phylows/matrix/TB2:M17863] TITLE 'Pythium phragmiticola ß-tubulin sequences'; LINK TAXA = Taxa3; DIMENSIONS NCHAR=809; FORMAT DATATYPE=DNA SYMBOLS= "A C G T" MISSING=? GAP= -; MATRIX [ 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750 760 770 780 790 800 810 ] [ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ] Pythium_arrhenomanes_P54_EU152856 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTTCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCCGACCGTATCATGTGCACTTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCCGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTACGGAGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATCACGACGTGCTTGCGTTTCCCGGGTCAGCTCAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCTTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACGTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACTGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGTTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAGGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTTGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTTATCGGCAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_graminicola_AY729825 AAGGAGGCTGAGAGTTGTGACTGCCTTCAGGGTTTCCAAATCACCCACTCGCTTGGTGGTGGTACGGGCTCGGGTATGGGTACCCTTTTGATTTCCAAGATTCGTGAAGAGTACCCGGATCGTATTATGTGCACATACTCGGTCTGCCCATCACCAAAGGTGTCGGATACCGTCGTTGAGCCGTACAATGCTACGCTCTCGGTGCACCAGCTTGTCGAAAACGCCGATGAAGTCATGTGTCTCGATAACGAAGCCCTTTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCAACCTACGGTGATCTTAACCACCTTGTGTGCGCTGCCATGTCGGGTATCACGACATGCTTGCGTTTCCCAGGTCAGCTCAACTCGGATCTCCGAAAGTTGGCTGTCAACTTGATTCCGTTCCCGCGTCTCCACTTCTTCATGATTGGTTTTGCGCCG{CT}TGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTTACGGTCCCAGAGCTGACCCAGCAGCAGTTCGATGCGAAGAACATGATGTGTGCCGCTGATCCTCGCCACGGTCGTTACCTCACCGCTGCTTGTATGTTCCGTGGTCGTATGAGCACCAAGGAAGTCGATGAGCAGATGCTCAATGTGCAGAACAAGAACTCATCGTACTTTGTTGAGTGGATCCCGAACAACATCAAGGCCAGCGTTTGTGATATCCCGCCGAAGGGTCTTAAGATGTCGACAACCTTCATCGGTAACTCAACTGCTATCCAGGAGATGTTCAAGCGTGTCAGTGAGCAGTTCACGGCAATGTTCCGTCG Pythium_phragmiticola_P113 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P114 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P119 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P120 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P124 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P125 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P126 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P56 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P67 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P68 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P72 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P76 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P80 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P82 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P84 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P90 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P91 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmiticola_P92 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P13_EU152854 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P40 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P42 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P52 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P55 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P58 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_phragmitis_P94 AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_sp._Hybrid_P11_Clone_Type_A AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCGCTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTTGACAACGAAGCCCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAATCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGCCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAAATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG Pythium_sp._Hybrid_P11_Clone_Type_B AAGGAGGCTGAGAGCTGCGACTGCCTTCAGGGCTTCCAGATTACCCACTCACTGGGTGGTGGTACTGGCTCGGGTATGGGCACCCTCTTGATCTCCAAGATCCGTGAAGAGTACCCGGACCGTATCATGTGCACGTACTCGGTTTGCCCGTCGCCGAAGGTGTCGGACACTGTCGTTGAGCCGTACAACGCCACCCTCTCTGTGCACCAGCTTGTCGAGAACGCCGATGAAGTCATGTGCCTCGACAACGAAGCTCTCTACGATATCTGCTTCCGTACGCTCAAGCTCACGACCCCGACCTATGGCGACCTCAACCATCTTGTGTGTGCTGCCATGTCCGGCATTACGACGTGCTTGCGTTTCCCGGGTCAACTGAACTCGGATCTTCGTAAGTTGGCCGTCAACTTGATCCCGTTCCCGCGTCTCCACTTCTTCATGATCGGTTTCGCTCCGTTGACCTCGCGTGGCTCGCAGCAGTACCGTGCCCTCACCGTGCCGGAGTTGACCCAGCAGCAGTTTGATGCGAAGAACATGATGTGTGCTGCGGATCCTCGCCACGGTCGCTACCTCACTGCCGCGTGTATGTTCCGTGGTCGCATGAGCACCAAGGAAGTCGACGAGCAGATGCTCAACGTGCAGAACAAGAACTCCTCGTACTTCGTGGAGTGGATCCCGAACAACATCAAGGCCAGCGTCTGTGATATCCCGCCGAAGGGCCTGAAGATGTCCACGACCTTCATCGGTAACTCGACGGCCATTCAGGAGATGTTCAAGCGTGTCAGCGAGCAGTTCACGGCCATGTTCCGTCG ; END; BEGIN TREES; TITLE Pythium_phragmiticola_ITS_MLT; LINK TAXA = Taxa1; TRANSLATE 1 Pythium_arrhenomanes_P54, 2 Pythium_phragmiticola_P56, 3 Pythium_phragmiticola_P67, 4 Pythium_phragmiticola_P68, 5 Pythium_phragmiticola_P72, 6 Pythium_phragmiticola_P76, 7 Pythium_phragmiticola_P80, 8 Pythium_phragmiticola_P82, 9 Pythium_phragmiticola_P84, 10 Pythium_phragmiticola_P90, 11 Pythium_phragmiticola_P91, 12 Pythium_phragmiticola_2007_19a, 13 Pythium_phragmiticola_P92, 14 Pythium_phragmiticola_P113, 15 Pythium_phragmiticola_P114, 16 Pythium_phragmiticola_P119, 17 Pythium_phragmiticola_P120, 18 Pythium_phragmiticola_P124, 19 Pythium_phragmiticola_P125, 20 Pythium_phragmiticola_P126, 21 Pythium_sp._Hybrid_P11_Clone_Type_A, 22 Pythium_sp._Hybrid_P11_Clone_Type_B, 23 Pythium_sp._Hybrid_P11_Clone_Type_C, 24 Pythium_sp._Hybrid_P11_Clone_Type_D, 25 Pythium_sp._Hybrid_P11_Clone_Type_E, 26 Pythium_phragmitis_P13, 27 Pythium_phragmitis_P52, 28 Pythium_phragmitis_P40, 29 Pythium_phragmitis_P42, 30 Pythium_phragmitis_P55, 31 Pythium_phragmitis_P58, 32 Pythium_phragmitis_P59, 33 Pythium_phragmitis_P61, 34 Pythium_phragmitis_P62, 35 Pythium_phragmitis_P63, 36 Pythium_phragmitis_P65, 37 Pythium_phragmitis_P66, 38 Pythium_phragmitis_P69, 39 Pythium_phragmitis_P71, 40 Pythium_phragmitis_P73, 41 Pythium_phragmitis_P85, 42 Pythium_phragmitis_P87, 43 Pythium_phragmitis_P94, 44 Pythium_phragmitis_2007_17a, 45 Pythium_phragmitis_2007_17b, 46 Pythium_catenulatum_AY598675; TREE Fig._S1 = [&R] (46:0.045384,(1:0.010025,((22:0.0,(10:0.0,(7:0.0,(5:0.0,(6:0.0,(3:0.0,(4:0.0,(2:0.0,(8:0.0,(9:0.0,(17:0.0,(18:0.0,(19:0.0,((16:0.0,15:0.0)inode15:0.0,(20:0.0,((14:0.0,21:0.0)inode18:0.0,(13:0.0,(12:0.0,11:0.0)inode19:0.0)inode636:0.001295)inode17:0.0)inode16:0.0)inode14:0.0)inode13:0.0)inode12:0.0)inode11:0.0)inode10:0.0)inode9:0.0)inode8:0.0)inode7:0.0)inode586:9.37E-4)inode74:3.52E-4)inode6:0.0)inode5:0.0)inode4:0.0)inode3:0.0,(23:0.0,(24:0.0,(44:0.0,((45:0.0,((36:0.0,37:0.0)inode23:0.0,((33:0.0,34:0.0)inode25:0.0,(35:0.0,(32:0.0,31:0.0)inode27:0.0)inode26:0.0)inode24:0.0)inode22:0.0)inode21:0.0,((30:0.0,29:0.0)inode29:0.0,((28:0.0,(27:0.0,(26:0.0,25:0.0)inode33:0.0)inode32:0.0)inode31:0.0,((39:0.0,38:0.0)inode35:0.0,((43:0.0,42:0.0)inode37:0.0,(41:0.0,40:0.0)inode38:0.0)inode36:0.0)inode34:0.0)inode30:0.0)inode28:0.0)inode20:0.0)inode951:0.003885)inode305:0.001292)inode529:0.002586)inode910:0.00482)inode2:0.032801)root; END; BEGIN TREES; TITLE 'Pythium phragmiticola ß-tubulin MLT'; LINK TAXA = Taxa3; TRANSLATE 1 Pythium_arrhenomanes_P54_EU152856, 2 Pythium_phragmiticola_P56, 3 Pythium_phragmiticola_P67, 4 Pythium_phragmiticola_P68, 5 Pythium_phragmiticola_P72, 6 Pythium_phragmiticola_P76, 7 Pythium_phragmiticola_P80, 8 Pythium_phragmiticola_P82, 9 Pythium_phragmiticola_P84, 10 Pythium_phragmiticola_P90, 11 Pythium_phragmiticola_P91, 12 Pythium_phragmiticola_P92, 13 Pythium_phragmiticola_P113, 14 Pythium_phragmiticola_P114, 15 Pythium_phragmiticola_P119, 16 Pythium_phragmiticola_P120, 17 Pythium_phragmiticola_P124, 18 Pythium_phragmiticola_P125, 19 Pythium_phragmiticola_P126, 20 Pythium_sp._Hybrid_P11_Clone_Type_A, 21 Pythium_sp._Hybrid_P11_Clone_Type_B, 22 Pythium_phragmitis_P13_EU152854, 23 Pythium_phragmitis_P40, 24 Pythium_phragmitis_P42, 25 Pythium_phragmitis_P52, 26 Pythium_phragmitis_P55, 27 Pythium_phragmitis_P58, 28 Pythium_phragmitis_P94, 29 Pythium_graminicola_AY729825; TREE Fig._1A = [&R] (29:0.064449,(1:0.013968,((26:0.0,(25:0.0,(24:0.0,(23:0.0,(22:0.0,(21:0.0,(28:0.0,27:0.0)inode8:0.0)inode7:0.0)inode6:0.0)inode5:0.0)inode4:0.0)inode3:0.0)inode962:0.003657,(20:0.0,((3:0.0,2:0.0)inode10:0.0,(4:0.0,(5:0.0,(19:0.0,(6:0.0,(16:0.0,((17:0.0,18:0.0)inode17:0.0,(15:0.0,(14:0.0,((8:0.0,7:0.0)inode21:0.0,(13:0.0,(12:0.0,(9:0.0,(10:0.0,11:0.0)inode25:0.0)inode24:0.0)inode23:0.0)inode22:0.0)inode20:0.0)inode19:0.0)inode18:0.0)inode16:0.0)inode15:0.0)inode14:0.0)inode13:0.0)inode12:0.0)inode11:0.0)inode9:0.0)inode973:0.003903)inode761:0.008701)inode2:0.050481)root; END; BEGIN TREES; TITLE Pythium_phragmiticola_cox_II_MLT; LINK TAXA = Taxa2; TRANSLATE 1 Pythium_arrhenomanes_P54, 2 Pythium_sp._Hybrid_1_Isolate, 3 Pythium_sp._Hybrid_7_Isolates, 4 Pythium_phragmiticola_P56, 5 Pythium_phragmiticola_P90, 6 Pythium_phragmiticola_P113, 7 Pythium_phragmiticola_P114, 8 Pythium_phragmiticola_P119, 9 Pythium_phragmiticola_P120, 10 Pythium_phragmiticola_P125, 11 Pythium_phragmiticola_P126, 12 Pythium_phragmitis_P13, 13 Pythium_phragmitis_P40, 14 Pythium_phragmitis_P42, 15 Pythium_phragmitis_P52, 16 Pythium_phragmitis_P55, 17 Pythium_phragmitis_P58, 18 Pythium_phragmitis_P59, 19 Pythium_phragmitis_P61, 20 Pythium_phragmitis_P62, 21 Pythium_phragmitis_P63, 22 Pythium_phragmitis_P65, 23 Pythium_phragmitis_P69, 24 Pythium_phragmitis_P71, 25 Pythium_phragmitis_P73, 26 Pythium_graminicola_AF196593; TREE Fig._1B = [&R] (26:0.040381,(1:0.023491,((5:0.0,(4:0.0,(6:0.0,(3:0.0,(7:0.0,(8:0.0,(9:0.0,(11:0.0,10:0.0)inode9:0.0)inode8:0.0)inode7:0.0)inode6:0.0)inode5:0.0)inode4:0.0)inode3:0.0)inode867:0.00338,((25:0.0,24:0.0)inode10:0.0,(23:0.0,(2:0.0,(22:0.0,(18:0.0,(((15:0.0,14:0.0)inode17:0.0,(13:0.0,12:0.0)inode18:0.0)inode16:0.0,(16:0.0,(17:0.0,(19:0.0,(21:0.0,20:0.0)inode22:0.0)inode21:0.0)inode20:0.0)inode19:0.0)inode15:0.0)inode14:0.0)inode13:0.0)inode12:0.0)inode11:0.0)inode857:0.001962)inode676:0.005944)inode2:0.01689)root; END;